| Document |
Document Title |
|
WO/2003/094929 |
A cell-targeted polymeric drug delivery system was designed based on the specific interaction between hyaluronic acid (HA) and its cell surface receptors over-expressed on cancer cell surface. Compounds composed of a carrier molecule, wh...
|
|
WO/2003/092623 |
Methods for preparing monomeric cytotoxic drug/carrier conjugates with a drug loading significantly higher than in previously reported procedures and with decreased aggregation and low conjugate fraction (LCF) are described. Cytotoxic dr...
|
|
WO/2003/092746 |
The present invention relates to a method and/or apparatus suitable for use in reduction of any pathogens in a fluid such as a biological fluid, or a fraction or component thereof, which may contain pathogens. The device may include a ve...
|
|
WO/2003/092691 |
The present invention provides compositions and methods for the treatment, prevention or inhibition of neoplasia by administering an effective amount of a cyclooxygenase-2 selective inhibitor in combination with an effective amount of th...
|
|
WO/2003/092683 |
The present invention relates to a method of treating a warm-blooded animal, especially a human, having a cancer disease selected from hepatoma; primary fallopian tube cancer; primary peritoneal cancer; breast cancer progressing after tr...
|
|
WO/2003/090793 |
The methods of this invention involve preventing the formation of a complex between adenine and riboflavin by reducing the amount of adenine in a solution containing blood or blood components to be pathogen reduced.
|
|
WO/2003/090744 |
The present invention relates to pharmaceutical compositions comprising metal phthalocyanine analogues of formula (I) and metal chelating compounds having a good bioavailability and enhanced photoinactivation properties against Gram nega...
|
|
WO/2003/091694 |
The invention provides an in vitro method for eliciting long term potentiation (LTP) in the neuronal tissue of an animal using an electrical stimulation protocol that ranges from 4 to 12 Hz. The stimulation is applied over a short time c...
|
|
WO/2003/090599 |
A method for modifying a property of a brain of a patient includespresenting an odorant to an air passage of the patient, the odorant havingbeen selected for presentation to the air passage because it is such as toincrease conductance of...
|
|
WO/2003/088883 |
Provided is a new therapeutic method to treat cancer that combines radiofrequency (RF) ablation and local controlled drug delivery. A preferred method utilizes localized drug delivery of 5-fluorouricil (5-FU) from polyanhydride implants.
|
|
WO/2003/089046 |
A method and apparatus are provided for treating biological cellular material with a treating agent using pulsed electrical fields provided by a waveform generator (12). The treatment method includes obtaining an electrode assembly which...
|
|
WO/2003/086503 |
|
|
WO/2003/087307 |
The present invention relates to the anti-cancer activity of IL-19 polypeptide molecules. IL-19 is a cytokine involved in inflammatory processes and human disease. The present invention includes Use of IL-19 for decreasing proliferation ...
|
|
WO/2003/087411 |
Described are methods for treating hyperproliferative disorders, including cancers, by administering to the affected mammal (e.g.,human) an effective amount of a composition comprising pTT or a composition comprising one or more oligonuc...
|
|
WO/2003/087308 |
The present invention relates to the anti-cancer activity of IL-24 polypeptide molecules. IL-24 is a cytokine involved in inflammatory processes and human disease. The present invention includes Use of IL-24 for decreasing proliferation ...
|
|
WO/2003/086460 |
Treatment of neoplastic or non-neoplastic dermatological conditions is achieved by administration and photodynamic activation of photosensitizers and pro-photosensitizers by coherent and/or incoherent light. The treatment does not cause ...
|
|
WO/2003/086298 |
The present invention relates to the anti-cancer activity of IL-19 polypeptide molecules. IL-19 is a cytokine involved in inflammatory processes and human disease. The present invention includes use of IL-19 for decreasing proliferation ...
|
|
WO/2003/086215 |
Disclosed is a method for treating various dermatological conditions using electromagnetic radiation. Particularly preferred are narrowband, multichromatic electromagnetic radiation emitters having a dominant emissive wavelength correspo...
|
|
WO/2003/086312 |
Disclosed are conjugates comprising cancer cell specific ligands, a sugar and cancer chemotherapeutic agents/boron neutron capture therapy agents, and uses thereof, e.g. for treating or ameliorating hyperproliferative diseases.
|
|
WO/2003/082267 |
The present invention provides the use of acryloyl distamycin derivatives, in particular &agr -bromo- or &agr -chloro-acryloyl distamycin derivatives, in combination with radiotherapy, for the treatment of tumors.
|
|
WO/2003/080094 |
Product for regression of tumors which comprises Ruta graveolens 6, Calcarea phosphorica 3X and distilled water.
|
|
WO/2003/080093 |
Chemical composition for the treatment of tumors which comprises Ruta graveolens 6, Calcarea phosphorica 3X and distilled water.
|
|
WO/2003/079966 |
Novel photo-active labeled diagnostic and therapeutic peptides which are conformationally constrained backbone cyclized somatostatin analogs, having improved somatostatin receptor subtype affinity and selectivity are disclosed. The backb...
|
|
WO/2003/077723 |
The present invention relates to devices for detection and therapy of active atheromatous plaque and/or thin-capped fibro-atheroma ("vulnerable plaque"), using selectively targeted fluorescent, radiolabeled, or fluorescent and radiolabel...
|
|
WO/2003/078361 |
This invention relates to novel methods for affecting, controlling and/or directing various reactions and/or reaction pathways or systems by exposing one or more components in a holoreaction system to at least one spectral energy pattern...
|
|
WO/2003/077933 |
The present invention provides a method of increasing oxygen content in tumors by administration of stressed cells, or inducing formation of stressed cells in vivo. Such treatment allows for increased efficacy of drugs, or radiation ther...
|
|
WO/2003/077723 |
The present invention relates to devices for detection and therapy of active atheromatous plaque and/or thin-capped fibro-atheroma ("vulnerable plaque"), using selectively targeted fluorescent, radiolabeled, or fluorescent and radiolabel...
|
|
WO/2003/077873 |
Molecular conjugates for the treatment and prevention of infectious diseases due to pathogenic microorganisms are provided. These conjugates comprise at least one photosensitizer coupled to a microorganism receptor (vector) that binds se...
|
|
WO/2003/075959 |
The invention provides a method of treating cancer in a subject in need of such treatment which comprises: radiotherapy, or cytotoxic therapy in combination with heat shock, and further comprises administering to the subject an effective...
|
|
WO/2003/074002 |
This invention pertains to methods of treating Pin 1 associated disorders through the administration of inhibitors of the Pin 1 isomerase activity.
|
|
WO/2003/072591 |
A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1−4 and 18−21 bear 2'−O−methoxyethyl modificat...
|
|
WO/2003/072135 |
Methods for inhibiting pro-inflammatory cytokine release or inflammation in a vertebrate are provided. The methods comprise activating a brain muscarinic receptor of the vertebrate, or directly stimulating a vagus nerve pathway in the br...
|
|
WO/2003/071953 |
Dysplasia- and malignancy-related changes in laser-induced fluorescence after tissue exposure to 5-Aminolevulinic acid (ALA) are used as a non-invasive diagnostic method for oral cancer. An animal model was used to demonstrate the invent...
|
|
WO/2003/070890 |
The transcription factor NF−κB is activated in response to various stimuli including ionizing radiation. Disruption of NF−κB activation by mutant forms of the NF−κB inhibitor IκB−&agr or by proteasome inhibitors enhances both...
|
|
WO/2003/070726 |
The application concerns a compound of formula I: (I) wherein one of P and Q is O, and the other of P and Q is H, where there is a double bond between whichever of Q and P is CH and the carbon atom bearing the R3 group;Y is either O or S...
|
|
WO/2003/070933 |
The invention relates to the use of an electrical field applied to a mixture containing a first type of cell (C1), a second type of cell (C2), a bispecific ligand able to bind to C1 and&sol or to C2 and non−covalent complexes formed be...
|
|
WO/2003/070221 |
The invention relates to the use of oliognucleotide containing cationic liposomal formulations to enhance the efficacy of chemotherapy and/or radiotherapy, particularly as a means to chemosensitize cancer are tumor tissues to the efficie...
|
|
WO/2003/070905 |
The invention provides compositions and methods for introducing bioactive agents into cells. Bioactive agents are provided together with a delivery vehicle and a cell is subjected to electroporation, thereby resulting in the introduction...
|
|
WO/2003/068155 |
A method for increasing radiosensitivity of a tumor in a subject via administration of a VEGF-R2 Inhibitor to a tumor in a subject. Also provided are methods for delaying tumor growth and for inhibiting tumor blood vessel growth via admi...
|
|
WO/2003/068929 |
Methods are disclosed for inhibiting the activity of a viral protein R (Vpr), inhibiting HIV replication, and treating or preventing an HIV infection through the use of an inhibitor of ATR or Rad17. Newly discovered ATR or Rad17 inhibito...
|
|
WO/2003/065971 |
A method of inducing immune tolerance in a first mammal to antigens of a second, non-syngeneic, mammal, is disclosed. The method is utilized to minimize graft rejection and/or reduce graft-versus-host diseases in transplantation procedur...
|
|
WO/2003/066109 |
This invention provides methods and compositions for using nitric oxide in a photoradiation pathogen inactivation process for whole blood and blood components to improve pathogen kill and to improve preservation of the quality of the blo...
|
|
WO/2003/065888 |
Novel tumor specific phototherapeutic and photodiagnostic agents are disclosed. The compounds consist of a carbocyanine dye for visualization, photosensitizer for photodynamic treatment, and tumor receptor−avid peptide for site−speci...
|
|
WO/2003/064427 |
The invention refers to macrocyclic tetrapirrolic compounds of the family of porphyrins (structure I), chlorins (structure II) and bacteriochlorins (structure III) characterized by the presence of hydrogen or halogen atoms and/or phenyl ...
|
|
WO/2003/063900 |
The present invention relates to a process for increasing the efficacy and&sol or bioavailability of a nutrient formulation or composition for the treatment and&sol or prevention of inflammatory processes associated with airway diseases ...
|
|
WO/2003/064424 |
The invention relates to novel, water-soluble porphyrin platinuim compounds of the tetraarylporphyrin platinum derivatives type or of the hematoporphyrin platinum derivatives type with high tumor selectivity and their use for the treatme...
|
|
WO/2003/064426 |
A series of N,N -dimethylated N-confused porphyrin salts were synthesized through methylation of N-confused porphyrins using Mel in the presence of Na2C03. These compounds have an intense absorption around 790 nm. It has also been shown ...
|
|
WO/2003/063901 |
The invention is novel amino-substituted hypocrellins, such as demethoxylated hypocrellin B, that are sonosensitizers, and their therapeutic use.
|
|
WO/2003/063915 |
Methods and apparatuses are provided for inactivation of pathogens in fluids containing blood products. Preferred methods include the steps of adding an effective, non-toxic amount of a photosensitizer such as riboflavin to the blood pro...
|
|
WO/2003/063757 |
A method for the treatment of a tumor, comprising administering to a subject a therapeutically effectiveamount of a complex of a heavy element with a polydentate, pyrrole-containing macrocyclic ligandsubstituted with charged chemical gro...
|
