Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
6HNA-PRODUCING MICRO-ORGANISM, METHOD OF OBTAINING SAID MICRO-ORGANISM, ELEMENTS USED TO PRODUCE SAME AND APPLICATIONS THEREOF
Document Type and Number:
WIPO Patent Application WO/2006/123007
Kind Code:
A1
Abstract:
The invention relates to a genetically-modified micro-organism which can be used to produce 6HNA (6-hydroxynicotinic acid) from NA (nicotinic acid), based on the genetic modification of one or more genes of the nic route, which may be of endogenous or exogenous origin, belonging to the nic group containing nicA, nicB and nicC. The invention also relates to a method of obtaining the aforementioned micro-organism through the manipulation of genes of the nic route. The invention further relates to the use of said micro-organism in a method of obtaining 6HNA under suitable culture conditions. 6HNA is an important precursor in the synthesis of modern insecticides.

Inventors:
Jimenez Zarco, José Ignacio (Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas C/ Ramiro De Maezt, 9 Madrid, E-28040, ES)
García, Lopez José Luis (Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas C/ Ramiro De Maezt, 9 Madrid, E-28040, ES)
Diaz Fernandez, Eduardo (Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas C/ Ramiro De Maezt, 9 Madrid, E-28040, ES)
Application Number:
PCT/ES2006/070063
Publication Date:
November 23, 2006
Filing Date:
May 17, 2006
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
Consejo, Superior Investigaciones Científicas DE. (C/ Serrano, 117, Madrid, E-28006, ES)
Jimenez Zarco, José Ignacio (Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas C/ Ramiro De Maezt, 9 Madrid, E-28040, ES)
García, Lopez José Luis (Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas C/ Ramiro De Maezt, 9 Madrid, E-28040, ES)
Diaz Fernandez, Eduardo (Centro de Investigaciones Biológicas, Consejo Superior de Investigaciones Científicas C/ Ramiro De Maezt, 9 Madrid, E-28040, ES)
International Classes:
C12P17/12; C12N9/00
Foreign References:
US20020137163A12002-09-26
Other References:
NELSON K.E. ET AL.: "Complete genome sequence and comparative analysis of the metadolically versatile Pseudomonas putida KT2440", ENVIRONMENTAL MICROBIOLOGY, vol. 4, no. 12, December 2002 (2002-12-01), pages 799 - 808, XP002968819
JIMENEZ J.I. ET AL.: "Genomic analysis of the aromatic catabolic pathways from Pseudomonas putida KT2440", ENVIRONMENTAL MICROBIOLOGY, vol. 4, no. 12, December 2002 (2002-12-01), pages 824 - 841, XP003003933
NAKANO H. ET AL.: "Purification, characterization and gene cloning of 6-hydroxynicotinate 3-monooxygenase from Pseudomonas fluorescens TN5", EUROPEAN JOURNAL OF BIOCHEMISTRY/FEBS, vol. 260, February 1999 (1999-02-01), pages 120 - 126, XP003003934
THACKER R. ET AL.: "NIC, a conjugative nicotine-nicotinate degradative plasmid in Pseudomonas convexa", JOURNAL OF BACTERIOLOGY, vol. 135, no. 1, July 1978 (1978-07-01), pages 289 - 290, XP003003935
Download PDF:
Claims:
REIVINDICACIONES
1. Microorganismo genéticamente transformado útil para la producción de 6HNA a partir de NA caracterizado porque presenta una modificación genética de uno o varios de los genes de la ruta nic, ya sean de origen endógeno ó exógeno, pertenecientes al siguiente grupo nic: nicA, nicB y nicC. 2. Microorganismo según la reivindicación 1 caracterizado porque el microorganismo pertenece al género Pseudomonas . 3. Microorganismo según la reivindicación 1 caracterizado porque el microorganismo tiene inactivado su gen nicC de tal forma que dicho gen nicC no es capaz de expresar la enzima NicC.
2. 4 Microorganismo según la reivindicación 3 caracterizado porque el microorganismo es la cepa P. putida KT2440d.nicC depositado en la Colección Española de Cultivos Tipo (CECT) con el número CECT 7048.
3. 5 Microorganismo según la reivindicación 1 caracterizado porque el microorganismo tiene transferido los genes nicA y nicB de otro microorganismo. 6. Microorganismo según la reivindicación 5 caracterizado porque el microorganismo es la cepa Pseudomonas fluorescens R2f (pNicAB) y depositado en la CECT con el número CECT 7049 o el denominado Pseudomonas sp . DSM 6412 (pNicAB) . 7. Procedimiento de obtención del microorganismo según las reivindicaciones 1 a la 6 caracterizado porque se lleva a cabo mediante la manipulación endógena o exógena de los genes de la ruta nic.
4. 8 Procedimiento según la reivindicación 7 caracterizado porque la manipulación consiste en la inactivación del gen nicC endógeno de un microorganismo que posee la ruta nic.
5. 9 Procedimiento según la reivindicación 8 caracterizado porque la inactivación del gen nicC se realiza por una técnica o método de mutagénesis perteneciente al siguiente grupo: la mutagénesis quimica, la mutagénesis por irradiación, la mutagénesis por transposones, la mutagénesis por minitransposones, otras técnicas de mutagénesis al azar o mutagénesis por recombinación homologa, empleo de sistemas de RNA antisentido o mediante el empleo de proteinas reguladoras que impidiesen su transcripción.
6. 10 Procedimiento según la reivindicación 9 caracterizado porque es un proceso de mutagénesis por recombinación homologa del gen nicC unida o no a una secuencia limitrofe. 11.
7. Procedimiento según la reivindicación 10 caracterizado porque es un procedimiento de recombinación homologa que comprende los siguientes pasos: a) construcción de un vector de clonación que contenga un fragmento de la secuencia de nucleótidos del gen nicC unida o no a una secuencia limitrofe, y que sea capaz de replicarse en un microorganismo que actúa de huésped para su replicación, pero que no sea capaz de replicarse en el microorganismo original que se quiere mutagenizar por transformación genética, y b) transformación genética del microorganismo original mediante recombinación homologa con el vector de a) en condiciones adecuadas .
8. Procedimiento según la reivindicación 11 caracterizado porque el vector de clonación de a) es un plásmido.
9. Procedimiento según la reivindicación 11 caracterizado porque la recombinación homologa se realiza mediante conjugación triparental y porque el fragmento del gen nicC está constituido por la secuencia de nucleótidos SEQ ID N07, el vector es el plásmido pKnicC y el microorganismo original es la cepa P. putida.
10. Secuencia de nucleótidos del gen nicC caracterizada porque es una secuencia de nucleótidos perteneciente al siguiente grupo: a) la secuencia de nucleótidos del gen nicC de P. putida KT2440 constituida por la SEQ ID N05, b) una secuencia de nucleótidos análoga a la secuencia de a) , c) un fragmento de una cualquiera de las secuencias de a) y b) , y d) una secuencia de nucleótidos que comprende una secuencia cualquiera perteneciente de a) , b) y e). 15.
11. Secuencia de nucleótidos según la reivindicación 14 caracterizada porque es la secuencia SEQ ID N05.
12. Secuencia de nucleótidos según la reivindicación 14 caracterizada porque es un fragmento del gen nicC c) de secuencia SEQ ID N07.
13. Vector de clonación caracterizado porque comprende una secuencia de nucleótidos según las reivindicaciones 14 a la 16 y que permite llevar a cabo una recombinación homologa de un gen nicC endógeno.
14. Vector de clonación según la reivindicación 17 caracterizado porque es un vector movilizable capaz de replicarse en E. coli.
15. Vector de clonación según la reivindicación 18 caracterizado porque el vector es el plásmido pKnicC. 20.
16. Procedimiento según la reivindicación 7 caracterizado porque es un procedimiento de transformación génica de un microorganismo, que inicialmente es incapaz de degradar NA, con las secuencias de nucleótidos codificantes de las proteinas NicA y NicB.
17. Procedimiento según la reivindicación 20 caracterizado porque comprende los siguientes pasos: a) construcción de un vector de expresión que comprenda las secuencias de nucleótidos de los genes nicA y nicB, y b) transformación genética del microorganismo original mediante el vector de expresión de a) en condiciones adecuadas .
18. Procedimiento según la reivindicación 21 caracterizado porque el vector de clonación de a) es un plásmido.
19. Procedimiento según la reivindicación 21 caracterizado porque la secuencia de nucleótidos del gen nicA es la SEQ ID NOl y la del gen nicB es la SEQ ID N03, el vector de clonación utilizado es el plásmido pNicAB, la transformación se realiza mediante conjugación triparenteral y el microorganismo original es una cepa perteneciente al siguiente grupo: Pseudomonas fluorescens R2f y Pseudomonas sp . DSM 6412.
20. Secuencia de nucleótidos del gen nicA caracterizada porque es una secuencia de nucleótidos perteneciente al siguiente grupo: a) la secuencia de nucleótidos del gen nicA de P. putida KT2440 constituida por la SEQ ID NOl, b) una secuencia de nucleótidos análoga a la secuencia de a) , c) un fragmento de una cualquiera de las secuencias de a) y b) , y d) una secuencia de nucleótidos que comprende una secuencia cualquiera perteneciente de a) , b) y e). 25. Secuencia de nucleótidos según la reivindicación 24 caracterizada porque es la secuencia SEQ ID NOl. 26. Secuencia de nucleótidos del gen nicB caracterizada porque es una secuencia de nucleótidos perteneciente al siguiente grupo: a) la secuencia de nucleótidos del gen nicB de P. putida KT2440 constituida por la SEQ ID N03, b) una secuencia de nucleótidos análoga a la secuencia de a) , c) un fragmento de una cualquiera de las secuencias de a) y b) , y d) una secuencia de nucleótidos que comprende una secuencia cualquiera perteneciente de a) , b) y e). 27. Secuencia de nucleótidos según la reivindicación 26 caracterizada porque es la secuencia SEQ ID N03. 28. Vector de clonación caracterizado porque comprende una secuencia de nucleótidos nicA o nicB, ambas, o una construcción genética que contenga las anteriores y que permite la expresión de las proteinas NicA y NicB en una célula huésped en condiciones adecuadas .
21. 29 Vector de clonación según la reivindicación 28 caracterizado porque el vector es el plásmido pNicAB. 30.
22. Uso del microorganismo según las reivindicaciones 1 a la 6 para la elaboración de un procedimiento de obtención de 6HNA en condiciones adecuadas de cultivo.
23. Uso del microorganismo según la reivindicación 30 caracterizado porque el microorganismo es una cepa que presenta el gen nicC inactivado. 32. Uso del microorganismo según la reivindicación 31 caracterizado porque el microorganismo es la cepa mutante P. putida KT2440dr¡icC (CECT 7048) que se cultiva preferentemente en un medio adecuado suplementado con una fuente de carbono, elementos traza, antibióticos y NA. 33. Uso del microorganismo según la reivindicación 32 caracterizado porque se lleva a cabo tanto con células en crecimiento como en células en suspensión.
24. 34 Uso del microorganismo según la reivindicación 30 caracterizado porque el microorganismo es un microorganismo transformado con los genes nicA y nicB.
25. 35 Uso del microorganismo según la reivindicación 34 caracterizado porque el microorganismo es la cepa P. fluorescens R2f (pNicAB) (CECT 7049) o la cepa Pseudomonas sp. DSM 6412 (pNicAB) que se cultivan en medio adecuado suplementado con una fuente de carbono, elementos traza, antibióticos y NA.
26. 36 Secuencia de aminoácidos caracterizada por la SEQ ID N02 o SEQ ID N04 codificada por la secuencia de nucleótidos SEQ ID NOl y SEQ ID N03 correspondiente a la proteina NicA y NicB, respectivamente.
27. 37 Uso de la secuencia de aminoácidos según la reivindicación 36 en un procedimiento de sintesis enzimática de 6HNA.
Description:
MICROORGANISMO PRODUCTOR DE 6HNA, PROCEDIMIENTO DE OBTENCIÓN, ELEMENTOS PARA SU REALIZACIÓN Y SUS APLICACIONES

SECTOR DE LA TÉCNICA

La invención se encuadra en el área de la biotecnologia, y más concretamente en un proceso de biotransformación mediante microorganismos. Se trata de la producción de ácido 6-hidroxinicotinico (en lo sucesivo denominado como 6HNA) , un importante precursor en la sintesis de insecticidas modernos.

ESTADO DE LA TÉCNICA

El ácido nicotinico (en lo sucesivo denominado como NA) es un compuesto muy abundante en la naturaleza y puede ser utilizado por algunas bacterias como única fuente de carbono, nitrógeno y energia. La capacidad para emplear NA como sustrato de crecimiento se encuentra ampliamente distribuida en microorganismos del género Pseudomonas, y las distintas etapas enzimáticas del catabolismo de este compuesto son conocidas (Behrman y Stanier J. Biol. Chem. 1957, 228, 923-45). La primera reacción enzimática consiste en la hidroxilación del NA para producir 6HNA (Hughes . Biochem. J. 1955, 60, 303) . Aunque la bioquimica de la hidroxilación era conocida, hasta la fecha no se conocian los determinantes genéticos responsables de dicho proceso.

La bacteria Pseudomonas putida KT2440 es uno de los organismos modelo en el estudio de la degradación de compuestos aromáticos . Se trata de una bacteria de suelo con una gran versatilidad metabólica y cuyo genoma ha sido secuenciado completamente (Nelson et al. Environ.. Microbiol. 2002, 4, 799-808) . El análisis genómico de P. putida KT2440 ha permitido determinar en su mapa catabólico global la localización de distintos "agrupamientos génicos"

("clusters") ya conocidos en otras bacterias para la degradación de compuestos aromáticos (Jiménez et al. Environ. Microbiol, 2002, 4, 824-841) . Además, dentro de este mapa se han identificado nuevos clusters, como los denominados pcm y nic, localizados en las posiciones 2.8 Mb y 4.4 Mb del genoma, respectivamente, cuya función se desconoce .

Existen varios procesos registrados para la producción de 6HNA, un importante precursor en la sintesis de insecticidas modernos tales como el imidachloprid (Hurh et al. J. Ferm. and Bioeng., 1994, 77, 382-385; Schmid et al. Nature, 2001, 409, 258-268), a partir de NA mediante fermentaciones con microorganismos (Kiener US5266469, Hoeks et al. US5151351, Kulla et al. US4738924, Lehky et al. US508277 y Hurh et al. J. Ferm. and Bioeng., 1994, 77, 382- 385) . Todos ellos se basan en el uso de bacterias de diferentes géneros (Agrobacterium, Bacillus, Pseudomonas, Achromobacter, Serratia) capaces de degradar NA que sufren el bloqueo de la ruta catabólica por inhibición de las enzimas implicadas en las reacciones posteriores a la bioconversión de NA en 6HNA.

En el procedimiento que se detalla a continuación se realiza un abordaje diferente y consistente en: i) la manipulación genética de los genes nic de Pseudomonas putida KT2440 para la disrupción de aquellos que participan en el catabolismo del 6HNA, y ii) la transferencia de los genes nicAB, involucrados en la sintesis de la monooxigenasa que convierte NA en 6HNA, a otros microorganismos que no poseen la capacidad de catabolizar NA.

DESCRIPCIÓN DE LA INVENCIÓN Breve Descripción

Un objeto de la presente invención lo constituye un microorganismo genéticamente transformado mediante técnicas de ingenieria genética útil para la producción de 6HNA a partir de NA basado en que presenta una modificación genética de uno o varios de los genes de la ruta nic, ya sean de origen endógeno (procedentes del propio microorganismo modificado genéticamente) , ó exógeno (procedentes de otro microorganismo distinto al modificado genéticamente), pertenecientes al siguiente grupo nic: nicA, nicB y nicC.

Una realización particular de este microorganismo es el desarrollado en la presente invención denominado P. putida KT2440dr¡icC depositado en la Colección Española de Cultivos Tipo (CECT) con el número CECT 7048 o el microorganismo P. fluorescens R2f (pNicAB) depositado en la CECT con el número CECT 7049 o el denominado Pseudomonas sp. DSM 6412 (pNicAB) . Otro objeto de la presente invención lo constituye un procedimiento de obtención de un tipo de microorganismo de la invención basado en la alteración genética mediante la manipulación endógena o exógena de los genes de la ruta nic. Una posibilidad particular de alteración genética del gen nicC lo constituye un procedimiento de mutagénesis por recombinación homologa que provoca la disrupción de la secuencia de nucleótidos de dicho gen y por tanto la incapacidad de degradar el 6HNA.

Otro objeto particular de la presente invención lo constituye la secuencia de nucleótidos completa del gen nicC SEQ ID N05 y el fragmento del gen nicC con la secuencia SEQ ID N07.

Otro objeto particular de la presente invención lo constituye un vector de clonación que comprende una

secuencia de nucleótidos de las descritas en la presente invención que permite llevar a cabo una disrupción del gen nicC por recombinación homologa.

Otro objeto particular de la invención lo constituye el procedimiento de la invención que consiste en un procedimiento de transformación de un microorganismo que inicialmente es incapaz de degradar NA con las secuencias de nucleótidos codificantes de las proteinas NicA y NicB procedentes de otro microorganismo. Otro objeto particular de la presente invención lo constituye el gen nicA con la secuencia de nucleótidos SEQ ID NOl o el gen nicB con la secuencia de nucleótidos SEQ ID N03.

De forma similar a lo anteriormente descrito, otro objeto particular de la presente invención lo constituye un vector de expresión génica o de clonación que porta las secuencias de nucleótidos de nicA y nicB o una construcción genética que contenga las anteriores y que permite la expresión de las proteinas NicA y NicB. Otro objeto de la presente invención lo constituye el uso de un microorganismo de la invención en un procedimiento de obtención de 6HNA en condiciones adecuadas de cultivo.

Finalmente, otro objeto particular de la invención lo representan las proteinas de secuencia de aminoácidos SEQ ID N02 y SEQ ID N04 codificadas por las secuencias de nucleótidos SEQ ID NOl y SEQ ID N03; asi como cualquier otra forma homologa aislada o construida mediante la información de la presente invención.

Descripción detallada de la invención

La invención se enfrenta a la necesidad de crear nuevas herramientas y procedimientos de sintesis enzimática de compuestos quimicos de valor industrial.

La presente invención se basa en que los inventores han identificado y aislado mediante, en primer lugar, el análisis del genoma de P. putida KT2440 (número de acceso en GenBank AE015451) en busca de ORFs implicadas en procesos de degradación de compuestos aromáticos (ver Ejemplo 1) , y, en segundo lugar, mediante ensayos experimentales de la actividad de las enzimas expresadas o anuladas (ver Ejemplos 2 y 3) , la presencia de un agrupamiento de genes, en lo sucesivo denominado cluster nic, responsable del catabolismo de heterociclos aromáticos, y que en concreto contiene los genes implicados directamente en la ruta de biotransformación del ácido nicotinico (NA) tanto en el primer paso enzimático de transformación del NA en 6HNA - genes nicA y nicB (ver SEQ ID NOl y N03) -, como en la posterior hidroxilación del 6HNA - gen nicC (ver SEQ ID N05)-.

En primer lugar, mediante técnicas de biologia molecular se ha diseñado un mutante de P. putida KT2440, que presenta una inserción por recombinación homologa del plásmido pKnicC en el gen nicC. La cepa recombinante P. putida KT2440d nicC, portadora de la disrupción en el gen nicC, pierde la capacidad de crecer cuando se cultiva en medio minimo M63 (Miller, JH 1972 En "Experiments in molecular genetics". CoId Spring Harbor, New York) suplementado con NA (5 mM) como única fuente de carbono. Cuando el crecimiento se repite en presencia de una fuente de carbono adicional, citrato al 0.2% (p/v) , se ha comprobado que el NA es transformado en 6HNA según se detecta en el análisis por cromatografia liquida de alta definición (HPLC) del sobrenadante del cultivo (Ejemplo 2.1) . La biotransformación de NA en 6HNA también se observa con células en suspensión del mutante P. putida KT2440dr¡icC crecido en presencia de citrato y NA (Ejemplo 2.2) .

Por otro lado, a partir de una librería genómica de P. putida KT2440 se clonaron los genes nicA y nicB en un plásmido de amplio espectro de huésped, pBBRlMCS-5 (Kovach et al. Gene, 1995, 166, 175-176), bajo el control del promotor heterólogo Plac . El plásmido resultante, pNicAB, se transfirió mediante conjugación triparental a distintas bacterias incapaces de degradar NA tales como Pseudomonas fluorescens R2f (van Elsas et al., 1988, FEMS Microbiol. Ecol., 53, 299-306) y Pseudomonas sp . DSM 6412 (Blaschke et al. Arch. Microbiol. 1991, 155, 164-169). Cuando las dos cepas recombinantes se cultivan en citrato en presencia de NA se comprueba que son capaces de producir 6HNA a unos niveles comparables a los del mutante recombinante P. putida KT2440d nicC, lo que indica que los genes nicAB se expresan y generan una monooxigenasa de NA que es activa en diferentes bacterias.

Las células recombinantes generadas acumulan 6HNA en el sobrenadante del caldo de cultivo, y éste, al contrario de lo que sucede en los procedimientos mencionados anteriormente en la literatura, no sufre degradación posterior. Las ventajas que supone este procedimiento respecto a los anteriores es que el diseño racional de cepas que expresan exclusivamente los genes nicAB acumulan específicamente 6HNA con un rendimiento cercano al 100% independientemente del NA presente de partida, y además son incapaces de continuar la degradación de 6HNA.

Así, un objeto de la presente invención lo constituye un microorganismo genéticamente transformado mediante técnicas de ingeniería genética útil para la producción de 6HNA a partir de NA, en adelante microorganismo de la presente invención, basado en que presenta una modificación genética de uno o varios de los genes del cluster nic, ya sean de origen endógeno o exógeno, pertenecientes al siguiente grupo nic: nicA, nicB y nicC.

Tal como se utiliza en la presente invención el término "microorganismo genéticamente transformado" se refiere a cualquier microorganismo que ha sido genéticamente modificado por técnicas de ingenieria genética para transformar el NA en 6HNA, es decir, cualquier microorganismo que sea capaz de expresar los genes nicA y nicB originando las correspondientes proteinas NicA y NicB activas y que sea incapaz de producir una proteina NicC activa. A titulo ilustrativo y sin que limite el alcance de la presente invención el microorganismo de la invención pertenece al género Pseudomonas .

Un objeto particular de la presente invención lo constituye un microorganismo que posee los genes del cluster nic pero que tiene inactivado su gen nicC de tal forma que dicho gen nicC no es capaz de expresar la enzima NicC o produce una enzima NicC inactiva y, por lo tanto, este microorganismo es incapaz de modificar el 6HNA.

Una realización particular de este microorganismo es el desarrollado en la presente invención denominado P. putida KT2440dr¡icC y depositado en la Colección Española de Cultivos Tipo (CECT) con el número CECT 7048, en el que el gen nicC se ha inactivado mediante recombinación homologa (Ejemplo 2.1) .

Otro objeto particular de la presente invención lo constituye un microorganismo al que se le han transferido los genes nicA y nicB de otro microorganismo de tal forma que este nuevo microorganismo genéticamente transformado es capaz de convertir el NA en 6HNA.

Una realización particular de este microorganismo es el desarrollado en la presente invención denominado Pseudomonas fluorescens R2f (pNicAB) y depositado en la CECT con el número CECT 7049 o el denominado Pseudomonas sp. DSM 6412 (pNicAB) (Ejemplo 3) .

Por lo tanto, otro objeto de la presente invención lo constituye un procedimiento de obtención del microorganismo de la invención, en adelante procedimiento de la invención, basado en la alteración genética mediante la manipulación endógena o exógena de los genes del cluster nic.

Un objeto particular de la invención lo constituye el procedimiento de la invención que consiste en la inactivación del gen nicC endógeno de un microorganismo que posee el cluster nic. Cualquier técnica o método de mutagénesis conocido por un experto puede ser utilizado para inducir una inactivación del gen nicC, como por ejemplo la mutagénesis quimica, la mutagénesis por irradiación, la mutagénesis por transposones, la mutagénesis por minitransposones, y otras técnicas de mutagénesis al azar. Para que esta técnica produzca exclusivamente una inactivación en el gen nicC, la mutagénesis ha de realizarse por recombinación homologa con parte del gen nicC o de sus regiones limitrofes . Otra forma de inactivar la función del gen nicC seria mediante el empleo de sistemas de RNA antisentido. También se podria inactivar la expresión del gen nicC mediante el empleo de proteinas reguladoras que impidiesen su transcripción.

De acuerdo con lo anterior, una posibilidad particular de disrupción del gen nicC lo constituye un procedimiento de mutagénesis por recombinación homologa que provoca la disrupción de la secuencia de nucleótidos de dicho gen y por tanto la incapacidad de degradar el 6HNA. Para llevar a cabo la rotura del gen nicC mediante recombinación homologa se necesita crear un vector de recombinación que contenga un fragmento de la secuencia de nucleótidos del gen nicC unido o no a una secuencia limitrofe del mismo, como por ejemplo de su promotor (Ejemplo 2) . Asi, una realización particular lo constituye un procedimiento de recombinación homologa que comprende los siguientes pasos:

a) construcción de un vector de clonación, preferentemente un plásmido, que contenga un fragmento de la secuencia de nucleótidos del gen nicC unida o no a una región limítrofe, y que sea capaz de replicarse en un microorganismo que actúa de huésped para su construcción, pero que no sea capaz de replicarse en el microorganismo original que se quiere mutagenizar por transformación genética, y b) transformación genética del microorganismo original mediante recombinación homologa con el vector de a) en condiciones adecuadas . Un caso ejemplarizante del procedimiento de la invención mediante disrupción del gen nicC con un plásmido lo constituye el procedimiento de obtención del microorganismo P. putida KT2440d.nicC mediante recombinación homologa a través de un procedimiento de transformación por conjugación triparental en el que el fragmento de la secuencia de nucleótidos del gen nicC está constituido por la secuencia de nucleótidos SEQ ID N07, el vector de clonación es el plásmido pKnicC y el microorganismo original es la cepa P. putida KT2440 (ver Ejemplo 2.1) . En la secuencia SEQ ID N05 se indica la secuencia completa codificante del gen nicC identificado y aislado en la presente invención así como una parte del promotor de dicho gen (ver secuencia comprendida entre el nucleótido 1 y 321) , de tal forma que pueden seleccionarse por cualquier experto en la materia múltiples alternativas de una secuencia eficaz para la disrupción del gen nicC mediante recombinación homologa.

La identificación en la presente invención de la secuencia de nucleótidos de los genes que comprende dicho

cluster nic - nicA, nicB y nicC - permite el uso de dichas secuencias de nucleótidos, fragmentos o formas análogas en procedimientos de ingenieria genética y en la transformación de microorganismos que produzcan 6HNA por un experto en la materia que puede aislar o producir dichas secuencias de nucleótidos .

Por lo tanto, otro objeto de la presente invención lo constituye la secuencia de nucleótidos del gen nicC, a partir de la cual se pueden elaborar herramientas para un procedimiento de disrupción génica. Tal como se utiliza en la presente invención el término "gen nicC" se refiere a una secuencia de nucleótidos perteneciente al siguiente grupo : a) la secuencia de nucleótidos del gen nicC de P. putida KT2440 constituida por la SEQ ID N05, b) una secuencia de nucleótidos análoga a la secuencia de a) , c) un fragmento de una cualquiera de las secuencias de a) y b) , y d) una secuencia de nucleótidos que comprende una secuencia cualquiera perteneciente a a) , b) y e). Otro objeto particular de la presente invención lo constituye la secuencia de nucleótidos completa del gen nicC SEQ ID N05 y el fragmento del gen nicC con la secuencia de nucleótidos SEQ ID N07.

En el sentido utilizado en esta descripción, el término "análoga" pretende incluir cualquier secuencia de nucleótidos que pueda ser aislada o construida en base a las secuencias mostradas en la presente memoria, por ejemplo, mediante la introducción de sustituciones de nucleótidos conservativas o no conservativas, incluyendo la inserción de uno o más nucleótidos, la adición de uno o más nucleótidos en cualquiera de los extremos de la molécula o la deleción de uno o más nucleótidos en cualquier extremo o

en el interior de la secuencia, y que permita la codificación de un péptido o proteina capaz de mimetizar la acción de la proteina NicA y NicB juntas, y en el caso del gen nicC cualquier secuencia de nucleótidos que permita realizar una inactivación de dicho gen por mutagénesis insercional mediante recombinación homologa.

En general, una secuencia de nucleótidos análoga es sustancialmente homologa a la secuencia de nucleótidos comentada anteriormente. En el sentido utilizado en esta descripción, la expresión "sustancialmente homologa" significa que las secuencias de nucleótidos en cuestión tienen un grado de identidad de, al menos, un 30%, preferentemente de, al menos, un 85%, o más preferentemente de, al menos, un 95%. La secuencia de nucleótidos de la invención también puede comprender (secuencia d) anterior) , en caso necesario y para permitir un mejor aislamiento, detección o expresión de la proteina, a una secuencia de nucleótidos que codifica para un péptido susceptible de ser utilizado con fines de aislamiento, detección o secreción de dicho péptido. Por tanto, otro objeto particular de la presente invención lo constituye una construcción genética que comprende, además de la secuencia de nucleótidos de uno de los genes del cluster nic, cualquier otra secuencia de nucleótidos codificante de un péptido o secuencia peptidica que permita el aislamiento, la detección o la expresión, por ejemplo, a titulo ilustrativo y sin que limite el alcance de la invención, una secuencia de polihistidina (βxHis) , una secuencia peptidica reconocible por un anticuerpo monoclonal (por ejemplo, para su identificación, o cualquier otra que sirva para purificar la proteina de fusión resultante por cromatografia de inmunoafinidad: péptidos etiqueta tales como c-myc, HA, E-tag) (Using antibodies : a laboratory manual. Ed. Harlow and David Lañe

(1999). CoId Spring Harbor Laboratory Press. New York. Capítulo: Tagging proteins . Pp. 347-377).

Las secuencias de nucleótidos del cluster nic descritas y aisladas en la presente invención pueden obtenerse por un experto en el sector de la técnica mediante el empleo de técnicas ampliamente conocidas en el estado de la técnica (Sambrook et al. "Molecular cloning, a Laboratory Manual 2 nd ed., CoId Sping Harbor Laoratory Press, N. Y., 1989 vol 1-3). Dichas secuencias de nucleótidos pueden estar integradas en un vector de expresión génica o de clonación que permite la regulación de la expresión de la misma en una célula huésped en condiciones adecuadas .

Otro objeto particular de la presente invención lo constituye un vector de clonación, en adelante vector de clonación, que comprende una secuencia de nucleótidos o una construcción genética de las descritas en la presente invención que permite llevar a cabo una recombinación homologa de un gen nicC endógeno. Este vector de clonación ha de ser capaz de replicarse en un microorganismo que actúa de huésped para su replicación, pero no ha de ser capaz de replicarse en el microorganismo original que se quiere mutagenizar por transformación genética mediante recombinación homologa. Un caso particular de un vector de clonación de la invención es un plásmido movilizable capaz de replicarse en E. coli pero no en P. putida KT2440 y que confiere resistencia a algún antibiótico, como por ejemplo el plásmido pKnicC obtenido a partir del plásmido pKl8mob (ver Ejemplo 2.1) .

En general, un vector de expresión comprende, además de una secuencia de nucleótidos o de la construcción genética descritos en la invención, un promotor que dirige su transcripción (por ejemplo, pT7, plac, ptrc, ptac, pBAD,

etc) , al que está operativamente enlazado, y otras secuencias necesarias o apropiadas que controlan y regulan dicha transcripción y, en su caso, la traducción del producto de interés, por ejemplo, señales de inicio y terminación de transcripción (tlt2, etc), origen de replicación, secuencias de unión a ribosomas (RBS) , secuencias codificantes de reguladores transcripcionales, potenciadores de la transcripción (enhancers) , silenciadores transcripcionales (silencers) , represores, puntos de corte de enzima de restricción, etc. Ejemplos de vectores de expresión apropiados pueden seleccionarse de acuerdo con las condiciones y necesidades de cada caso concreto entre plásmidos de expresión, vectores virales, cósmidos, etc. que pueden contener, además, marcadores utilizables para seleccionar las células transfectadas o transformadas con el gen o genes de interés. La elección del vector dependerá de la célula huésped y del tipo de uso que se quiera realizar. Por tanto, según un modo de realización particular de la presente invención dicho vector es un plásmido. La obtención de dicho vector puede realizarse por métodos convencionales conocidos por los expertos en la materia al igual que para la transformación de microorganismos se pueden utilizar diferentes métodos ampliamente conocidos - transformación quimica, electroporación, etc - descritos en diversos manuales [Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989). Molecular cloning: a laboratory manual, 2 nd ed. CoId Spring Harbor Laboratory, CoId Spring Harbor, N. Y.].

Otro objeto particular de la invención lo constituye el procedimiento de la invención que consiste en un procedimiento de transformación con las secuencias de nucleótidos codificantes de las proteinas NicA y NicB de un microorganismo que inicialmente es incapaz de degradar NA. Asi, una realización particular lo constituye un

procedimiento de transformación genética de un microorganismo que comprende los siguientes pasos: a) construcción de un vector de clonación, preferentemente un plásmido, que comprenda las secuencias de nucleótidos de los genes nicA y nicB,

Y b) transformación genética del microorganismo original mediante el vector de expresión de a) en condiciones adecuadas . Tal como se utiliza en la presente invención el término "gen nicA" se refiere a una secuencia de nucleótidos perteneciente al siguiente grupo: a) la secuencia de nucleótidos del gen nicA de P. putida KT2440 constituida por la SEQ ID NOl, b) una secuencia de nucleótidos análoga a la secuencia de a) , c) un fragmento de una cualquiera de las secuencias de a) y b) , y d) una secuencia de nucleótidos que comprende una secuencia cualquiera perteneciente de a) , b) y c) .

Otro objeto particular de la presente invención lo constituye el gen nicA con la secuencia SEQ ID NOl.

Tal como se utiliza en la presente invención el término "gen nicB" se refiere a una secuencia de nucleótidos perteneciente al siguiente grupo: a) la secuencia de nucleótidos del gen nicB de P. putida KT2440 constituida por la SEQ ID N03, b) una secuencia de nucleótidos análoga a la secuencia de a) , c) un fragmento de una cualquiera de las secuencias de a) y b) , y d) una secuencia de nucleótidos que comprende una secuencia cualquiera perteneciente de a) , b) y e).

Otro objeto particular de la presente invención lo constituye el gen nicB con la secuencia de nucleótidos SEQ ID N03.

Un caso ejemplarizante del procedimiento de la invención mediante transformación genética con un plásmido lo constituye el procedimiento de obtención del microorganismo de la invención en el que la secuencia de nucleótidos del gen nicA es la SEQ ID NOl y la del gen nicB es la SEQ ID N03, el vector es el plásmido pNicAB, la transformación se realiza mediante conjugación triparenteral y el microorganismo original es una cepa perteneciente al siguiente grupo: Pseudomonas fluorescens R2f y Pseudomonas sp . DSM 6412 (ver Ejemplo 3).

De forma similar a lo anteriormente descrito, otro objeto particular de la presente invención lo constituye un vector de expresión génica o de clonación, que porta las secuencias de nucleótidos nicA y nicB y que permite la expresión de las proteinas NicA y NicB. En la presente invención el término vector de clonación se refiere también a un sistema de expresión constituido por dos vectores de clonación cada uno de ellos con una de las secuencias de nucleótidos de los genes nicA o nicB, respectivamente. La expresión de estos dos genes genera una actividad monooxigenasa de NA en el interior de las células huésped que contienen las secuencias de nucleótidos de los genes nicA y nicB, produciéndose 6HNA. Un caso particular de un vector de clonación de la invención es el plásmido pNicAB, que permite la expresión de las proteinas NicA y NicB.

Igualmente, forma parte de la invención el uso de las secuencias de nucleótidos descritas del gen nicA, nicB y nicC (incluyendo en este último caso, fragmentos del gen o de la región descrita de su promotor) para la elaboración de vectores de clonación génica, asi como el uso de dichos

vectores para la transformación de microorganismos productores de 6HNA.

Como se ha comentado inicialmente el 6HNA es un importante precursor en la sintesis de insecticidas modernos. Tal como se describe en la invención, la sintesis de 6HNA mediante organismos vivos es posible y presenta las ventajas de la especificidad del proceso, la sencillez, el bajo coste económico y el ser un proceso respetuoso con el medio ambiente (Ejemplo 2 y 3) . Por lo tanto, otro objeto de la presente invención lo constituye el uso del microorganismo NA/6HNA de la invención en un procedimiento de obtención de 6HNA en condiciones adecuadas de cultivo.

Otro objeto particular de la invención lo constituye el uso del microorganismo NA/6HNA en un procedimiento de obtención de 6HNA en el que el microorganismo es una cepa que presenta el gen nicC inactivado. Una realización concreta del uso de la invención es aquel en el que la cepa que se utiliza es la cepa mutante P. putida KT2440d nicC (CECT 7048) que se crece en un medio de cultivo, por ejemplo, en medio minimo M63 suplementado con una fuente de carbono, elementos traza, antibióticos y NA (ver Ejemplo 2.2) . El procedimiento de producción de 6HNA puede llevarse a cabo tanto con células en crecimiento como en células en suspensión.

Otro objeto particular de la invención lo constituye el uso del microorganismo NA/6HNA en un procedimiento de obtención de 6HNA en el que el microorganismo es un microorganismo transformado con los genes exógenos nicA y nicB. Una realización particular lo constituye el uso del microorganismo de la invención en el que el microorganismo es la cepa P. fluorescens R2f (pNicAB) (CECT 7049) o la cepa Pseudomonas sp. DSM 6412 (pNicAB) que se crece en un medio de cultivo, por ejemplo, medio minimo M63,

suplementado con una fuente de carbono, elementos traza, antibióticos y NA (Ejemplo 3.3) .

Para el cultivo de estos microorganismos se pueden utilizar otros medios minimos diferentes al medio minimo M63 siempre que permitan el crecimiento del microorganismo.

Para el cultivo de estos microorganismos también se pueden utilizar medios ricos.

Finalmente, otro objeto particular de la invención lo representan las proteinas de secuencia de aminoácidos SEQ ID N02 y SEQ ID N04 codificadas por las secuencias de nucleótidos SEQ ID NOl y SEQ ID N03, correspondientes a las proteinas NicA y NicB de la cepa P. putida KT2440, respectivamente; asi como cualquier otra forma homologa aislada o construida mediante la información de la presente invención; asi como su uso en un procedimiento de sintesis enzimática de 6HNA.

EJEMPLOS DE REALIZACIÓN DE LA INVENCIÓN

En los ejemplos que se exponen a continuación se detalla la experimentación necesaria para desarrollar esta patente y no se deben considerar como limitación del alcance de la presente invención.

Ejemplo 1.- Análisis del genoma de P. putida KT2440 y planteamiento de la hipótesis de partida

Como ya se ha comentado el análisis del genoma de P. putida KT2440 permitió identificar un fragmento de ADN de 12723 pb, localizado en la posición 4.4 Mb del genoma, que contiene un agrupamiento de genes denominado cluster nic cuya función se desconocia (Jiménez et al. Environ. Microbiol, 2002, 4, 824-841) . Por otra parte, se habia comprobado que la bacteria P. putida KT2440 podia crecer en un medio que contenia NA como única fuente de carbono y energia, pero se desconocian los genes que eran utilizados

por la bacteria para degradar este compuesto (Jiménez et al. Environ. Microbiol, 2002, 4, 824-841) . Posteriormente, a partir de estas dos observaciones y como inicio de la presente invención se hipotetizó que tal vez genes existentes en el cluster nic (inicialmente denominado asi por la posibilidad de que estuviese involucrado en la degradación de un compuesto nitrogenado, comentario éste no referenciado en la publicación) pudieran estar implicados en la degradación de NA. El análisis de dicho cluster ha permitido la identificación y aislamiento posterior de una serie de secuencias de ácido nucleico que tras los estudios de actividad de sus productos proteicos expresados (ver ejemplos posteriores) corresponden a varios genes implicados en la degradación de NA: una primera etapa de la ruta de degradación de NA, la conversión de éste en 6HNA, que estaria catalizada por los productos proteicos de los genes nicA (SEQ ID NOl) y nicB, (SEQ ID N03) y, una segunda etapa, la hidroxilación del 6HNA, que estaria mediada por el producto proteico del gen nicC (SEQ ID N05) . Las proteinas anteriormente mencionadas NicA, NicB y NicC están identificadas por las secuencias SEQ ID N02, SEQ ID N04 y SEQ ID N06, respectivamente.

Para demostrar si efectivamente el cluster nic estaba involucrado en la degradación del NA se procedió a obtener un mutante de P. putida KT2440 inactivado en uno de los genes postulados, el gen nicC, primer gen de uno de los operones que integran el cluster nic.

Ejemplo 2.- Construcción de un microorganismo mutante del gen nicC y producción de 6HNA con este microorganismo

2.1.- Construcción del plásmido pKnicC, disrupción del gen nicC y caracterización del mutante P. putida KT2440dnicC

Se amplificó por PCR un fragmento interno del gen nicC empleando los oligonucleótidos nih5

(GCAAGCTTCATCGGGTGGCAGGCG) (SEQ ID NO8) y nih3

(CCGAATTCCGCTGGGCGAGTTTGC) (SEQ ID NO9) y DNA cromosómico de P. putida KT2440 como molde de la reacción y cuya secuencia de nucleótidos se corresponde con la SEQ ID N07. Los oligonucleótidos nih5 y nih3 incluyen dianas de restricción HindIII y EcoRI respectivamente (subrayadas debajo de la secuencia) , que se usaron para clonar el producto de la amplificación en pKlδmojb, un plásmido movilizable que replica en E. coli pero no en Pseudomonas y confiere resistencia a kanamicina (Schafer et al. Gene, 1994, 145, 69-73), previamente digerido con las enzimas de restricción HindIII y EcoRI. El plásmido resultante, pKnicC (4.4 kb) , se seleccionó transformando la mezcla de ligación en E. coli DHlOB (Sambrook, J., Fritsch, E. F., y Maniatis, T. 1989. Molecular Cloning, CSHL Press, CoId Spring Harbor, New York) , y la presencia del fragmento nicC se confirmó mediante secuenciación utilizando ddNTPs fluorescentes y un secuenciador automático (Applied Biosystems, Inc) . Todas las técnicas de manipulación de DNA, PCR y transferencia génica por transformación empleadas en este y otros ejemplos de esta patente son de uso generalizado en biologia molecular y están descritas en textos generales

(por ej . , Sambrook, J., Fritsch, E. F., y Maniatis, T.

1989. Molecular Cloning, CSHL Press, CoId Spring Harbor, Nueva Cork) . El plásmido pKnicC se transfirió a P. putida KT2440 por conjugación triparental según se describe en la literatura (Herrero et al. J. Bacteriol 1990, 172, 6557- 6567) . Para ello, se cultivaron en medio LB (Sambrook, J., Fritsch, E. F., y Maniatis, T. 1989, Molecular Cloning. CSHL Press, CoId Spring Harbor, Nueva York) células de E. coli DHlOB (pKnicC) (kanamicina 30 μg/ml) , E. coli HBlOl (pRK600) (cloramfenicol 34 μg/ml) , cepa que aporta las funciones para la transferencia del plásmido pKnicC

(Herrero et al. J. Bacteriol 1990, 172, 6557-6567), y P. putida KT2440. Se toma 1 mi de cada cultivo que, tras tres lavados sucesivos, se resuspende en 100 μl de medio LB. Se mezclan 100 μl de cada cultivo y la mezcla se deposita sobre un filtro de nitrocelulosa (0.22 μm, Millipore) durante 8 horas a 30°C. Finalmente, las células se resuspenden en 1 mi de solución salina y se cultivan en placas de medio M63-agar que contiene citrato al 0.2% (p/v) y el antibiótico kanamicina (30 μg/ml) de forma que sólo se seleccionan aquellas células de P. putida KT2440 que hayan adquirido el plásmido pKnicC. Dado que pKnicC no es capaz de replicar en Pseudomonas, los exconjugantes que crecen en M63-kanamicina son células de P. putida KT2440 que han integrado por recombinación homologa el plásmido pKnicC en la copia cromosómica del gen nicC, o sea, células con una disrupción del gen nicC. Uno de los clones exconjugantes, P. putida KT2440d.nicC, se analizó por PCR para confirmar la disrupción del gen nicC. Un esquema de este proceso puede verse en la Figura 1. A diferencia de la cepa parental, el mutante P. putida KT2440dr¡icC ha perdido la capacidad de utilizar NA como única fuente de carbono y energia, con lo que se demostraba por primera vez que el cluster nic estaba involucrado en la degradación del NA y que la hipótesis de partida expresada en el Ejemplo 1 era correcta.

2.2.- Biotransformación de NA a 6HNA con células de Pseudomonas putida KT2440dnicC

Se inoculó la cepa mutante P. putida KT2440d.nicC a una DOβoonm de 0.1 en medio minimo M63 suplementado con citrato

0.2% (p/v) como fuente de carbono, elementos traza (Bauchop and Elsden. 1960. J. Gen. Microbiol . 23, 457-469), kanamicina (30 μg/ml) , y NA (5 mM) . Se tomaron alicuotas a

diferentes tiempos de incubación con agitación (300 rpm) a 30 0 C, se centrifugaron y el sobrenadante libre de células se sometió a un análisis por HPLC según se describe más adelante. El resultado del análisis reveló que el NA se habia transformado en 6HNA al cabo de 12 horas de incubación con un rendimiento del 85%. La cepa parental P. putida KT2440 incubada en similares condiciones no acumuló 6HNA. Estos resultados indican que la inactivación del gen nicC de P. putida KT2440 provoca la transformación de NA a su derivado hidroxilado 6HNA, el cual se secreta fuera de la célula y se acumula en el medio de cultivo.

Para la detección de 6HNA en las diferentas muestras de este ejemplo 2.2 y en los siguientes 2.3 y 3, se preparan diluciones 1/100 de los sobrenadantes libres de células y se analizan 20 μl de cada una de ellas mediante HPLC empleando un equipo Gilson equipado con una columna phenomenex 5 RP-18 (150x4.60 mm) y un diodo-array. Se utilizan las condiciones descritas previamente (Hurh et al. J. Ferm. and Bioeng., 1994, 77, 382-385). El eluyente utilizado es una solución de fosfato sódico (10 rtiM pH

3.0) /acetonitrilo (98/2, v/v) a un flujo de 1 ml/min. Dos picos con tiempos de retención de 4.9 y 8.1 minutos coincidentes con los de los compuestos patrón NA y 6HNA

(adquiridos de Sigma) respectivamente, fueron detectados espectrofotométricamente a 210 nm. Los espectros de absorción de los dos picos detectados corresponden a los de los patrones NA y 6HNA.

2.3.- Biotransformación de NA en 6HNA con células en suspensión de P. putida. KT2440d.ni.cC

Se inocula la cepa mutante P. putida KT2440dr¡icC a una DOβoonm de 0.1 en medio minimo M63 suplementado con citrato 0.2% (p/v) como fuente de carbono, elementos traza,

kanamicina (30 μg/ml) y con NA (1 mM) como inductor de la conversión. Tras incubación a 30°C con agitación (300 rpm) hasta alcanzar DOβoo de 0.8, el cultivo se centrifugó y las células se lavaron con un volumen de solución salina. El sedimento celular se resuspendió en 1/5 de volumen de medio M63 conteniendo NA (5 mM) . La suspensión de bacterias (10 mi) se incubó a 30°C con agitación y se tomaron muestras (0.1 mi) a distintos tiempos. Las muestras se centrifugaron 2 minutos en una microcentrifuga (12000 rpm) y el sobrenadante libre de células se sometió al análisis descrito en el Ejemplo 2.1. Se observó que al cabo de 6 horas de incubación el NA se habia transformado en 6HNA con un rendimiento del 98% (véase Tabla 1) .

Tabla 1. Rendimiento de la conversión del ácido nicotinico (NA) en el ácido 6-hidroxinicotinico (6HNA) en función del tiempo de ensayo utilizando distintas bacterias nativas, mutantes y recombinantes . El rendimiento está expresado en porcentaje sobre el total de moles de ácido nicotinico (NA) incluido en el ensayo.

Ejemplo 3.- Construcción de microorganismos portadores del plásmido pNicAB y producción de 6HNA con estos microorganismos

3.1.- Construcción del plásmido pNicAB .

La construcción del plásmido pNicAB que contiene los genes nicAB bajo el control del promotor Plac se realizó en

dos etapas. Primeramente, el cósmido 3n5 (amablemente cedido por Diana Stjepandic del Krebsforschungszentrum de Heidelberg, Alemania) , que contiene clonado una región del genoma de P. putida KT2440 que abarca desde la posición 4421 kb a la 4464 kb, se digirió con las enzimas de restricción EcoRI y Seal aislándose un fragmento de 4.1 kb que comprende el gen nicB y gran parte del gen nicA. Dicho fragmento se subclonó en el plásmido pUC19 (Yanisch-Perron et al. Gene, 1985, 33, 103-119) digerido con las enzimas EcoRI y Smal , generando el plásmido pFUSAB (6.8 kb) , que se aisló en células de E. coli DHlOB resistentes a ampicilina (100 μg/ml) transformadas con la mezcla de ligación. Para reconstituir el gen nicA completo en pFUSAB, se amplificó del cromosoma de P. putida KT2440 un fragmento de 1.4 kb mediante PCR con los oligonucleótidos nicA5 (GGGGATCCGTAACCGTTGCCGCCACCACCGTATTCG, contiene la diana de restricción BamHI, subrayada, e hibrida con el extremo 5' del gen nicA) (SEQ ID NOlO) y Sgral (CGCTGTCATGGCCGGCATAGGG, hibrida en el gen nicB) (SEQ ID NOIl) . El fragmento amplificado se digirió con las enzimas de restricción BamEI y SgrAI y reemplazó al fragmento BamHI-SgrAI de 1.2 kb del plásmido pFUSAB generándose un plásmido, pUCNAB (7.3 kb) , que contiene los genes nicA y nicB completos bajo el control del promotor Plac. Dado que el plásmido pUCNAB sólo replica en E. coli, los genes nicA y nicB se subclonaron en un plásmido de amplio espectro de huésped y que confiere resistencia a gentamicina, pBBRlMCS-5 (Kovach et al. Gene, 1995, 166, 175-176) . Para ello, los genes nicA y nicB se aislaron del plásmido pUCNAB tras digerir éste con las enzimas de restricción EcoRI y Hindlll, y el fragmento resultante se ligó con el plásmido pBBRlMCS-5 tratado con las mismas enzimas. Se transformó la mezcla de ligación en la cepa E.

coli DHlOB y se seleccionaron los clones resistentes a gentamicina (10 μg/ml) y portadores de un plásmido, pNicAB

(9.4 kb) , capaz de replicar en diversos microorganismos y que expresa los genes nicA y nicB bajo el control del promotor heterólogo Plac . Un esquema de este proceso puede verse en la Figura 2.

3.2.- Construcción de las cepas Pseudomonas flúorescens R2f (pNicAB) y Pseudomonas sp. DSM 6412 (pNicAB) . El plásmido pNicAB se transfirió desde E. coli a

Pseudomonas fluorescens R2f (van Elsas et al., 1988, FEMS

Microbiol. Ecol . , 53, 299-306) y Pseudomonas sp . DSM 6412

(Blaschke et al. Arch. Microbiol. 1991, 155, 164-169), dos cepas incapaces de utilizar NA, mediante conjugación triparental según se describe en el Ejemplo 2, seleccionándose los exconjugantes en placas de medio minimo que contenian gentamicina (10 μg/ml) y citrato (0.2%, p/v) como única fuente de carbono y energia. La presencia del plásmido pNicAB en los exconjugantes se confirmó mediante su extracción y la determinación de su perfil de restricción.

3.3.- Biotransformación de NA a 6HNA con células en suspensión de las cepas P. fluorescens R2f (pNicAB) y Pseudomonas sp. DSM 6412 (pNicAB) .

Se inocularon las cepas P. fluorescens R2f (pNicAB) y Pseudomonas sp. DSM 6412 (pNicAB) en medio minimo M63 suplementado con citrato 0.2% (p/v) como fuente de carbono, elementos traza y gentamicina (10 μg/ml) . Tras incubación a 30°C con agitación (300 rpm) hasta alcanzar DOβoo de 0.8, los cultivos se centrifugaron y las células se lavaron con un volumen de solución salina. Los sedimentos celulares se resuspendieron en 1/5 de volumen de medio M63 conteniendo

NA (5 itiM) . Las suspensiones celulares (10 mi) se incubaron a 30°C con agitación y se tomaron muestras (0.1 mi) a distintos tiempos . Las muestras se centrifugaron 2 minutos en una microcentrifuga (12000 rpm) y los sobrenadantes libres de células se analizaron según se describe en el Ejemplo 2. Se observó que al cabo de 6 horas de incubación el NA se habia transformado en 6HNA con un rendimiento similar al que proporciona la cepa P. putida KT2440d nicC (Ejemplo 2) (véase Tabla 1) . Las cepas P. fluorescens R2f y Pseudomonas sp. DSM 6412 que contienen el plásmido control pBBRlMCS-5 incubadas en condiciones similares a las descritas anteriormente no generan conversión alguna del NA, lo que demuestra que son necesarios los genes nicA y nicB para la biosintesis de 6HNA a partir de NA, y que los productos de dichos genes son funcionales en bacterias distintas a la cepa parental .