Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
ACYL-TRANSFERASE
Document Type and Number:
WIPO Patent Application WO/2008/079705
Kind Code:
A2
Abstract:
The present invention is directed to a polypeptide (hGOAT), a novel acyl- transferase. The present invention is also directed to nucleic acids encoding hGOAT and methods of assaying this acyl-transferase.

Inventors:
GUTIERREZ, Jesus, Antonio (2841 East Fairway Village Drive, Greenfield, IN, 46228, US)
PERKINS, Douglas, Raymond (6570 West Cross Trail, New Palestine, IN, 46163, US)
SOLENBERG, Patricia, Jean (10116 Seabreeze Way, Indianapolis, IN, 46256, US)
Application Number:
US2007/087334
Publication Date:
July 03, 2008
Filing Date:
December 13, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
ELI LILLY AND COMPANY (Lilly Corporate Center, Indianapolis, IN, 46285, US)
GUTIERREZ, Jesus, Antonio (2841 East Fairway Village Drive, Greenfield, IN, 46228, US)
PERKINS, Douglas, Raymond (6570 West Cross Trail, New Palestine, IN, 46163, US)
SOLENBERG, Patricia, Jean (10116 Seabreeze Way, Indianapolis, IN, 46256, US)
International Classes:
C07K14/435; C12N9/10; C12Q1/48
Attorney, Agent or Firm:
COHEN, Charles, E. et al. (Eli Lilly And Company, Patent DivisionP.O. Box 628, Indianapolis IN, 46206-6288, US)
Download PDF:
Claims:
We Claim:

1. An isolated polynucleotide that comprises a sequence that encodes a polypeptide comprising the amino acid sequence of hGOAT (SEQ ID NO: 2).

2. The isolated polynucleotide of Claim 1 that encodes a polypeptide that comprises the amino acid sequence of hGOAT (SEQ ID NO: 2).

3. The isolated polynucleotide of either claim 1 or Claim 2 that comprises the nucleotide sequence SEQ ID NO: 3.

4. A vector comprising the polynucleotide of any one of Claims 1 -3.

5. An engineered cell comprising the vector of claim 4.

6. An isolated polypeptide that comprises the amino acid sequence of hGOAT (SEQ ID NO: 2).

7. The polypeptide of Claim 6 that consists of the amino acid sequence of hGOAT (SEQ ID NO:2).

8. An isolated antibody which binds to hGOAT (SEQ ID NO: 2).

9. An assay for identifying compounds which modulate hGOAT activity comprising a) contacting hGOAT with a compound and b) measuring hGOAT activity.

10. An assay for identifying a compound which modulates hGOAT activity comprising

a) contacting an expression system comprising a polynucleotide sequence encoding hGOAT with a compound and b) measuring hGOAT activity.

11. An assay for identifying a compound which modulates hGOAT activity comprising a. providing i. a host cell having a vector comprising a polynucleotide sequence encoding hGOAT, and ii. a compound b. contacting said host cell and said compound and c. measuring hGOAT activity.

12. An assay for identifying a compound which modulates ghrelin activation comprising a) contacting hGOAT with a compound and b) measuring ghrelin activation.

13. An assay for identifying a compound which modulates ghrelin activation comprising a) contacting an expression system comprising a polynucleotide sequence encoding hGOAT with a compound and b) measuring ghrelin activation.

14. An assay for identifying a compound which modulates ghrelin activity comprising a. providing i. a host cell having a vector comprising a polynucleotide sequence encoding hGOAT, and ii. a compound

b. contacting said host cell and said compound and c. measuring ghrelin activity.

15. The assay of any one of claims 9-14, wherein hGOAT comprises SEQ ID NO: 2.

16. The assay of any one of claims 10, 11, 13, or 14 wherein the polynucleotide sequence encoding hGOAT comprises SEQ ID NO: 3.

Description:

ACYL-TRANSFERASE

FIELD OF THE INVENTION

The present invention relates to a novel human acyltransferase. The present invention further relates to a novel human ghrelin acyltransferase. The invention also relates to nucleic acids encoding a novel human ghrelin acyltransferase.

BACKGROUND OF THE INVENTION

Human ghrelin is a 28 amino acid appetite regulating peptide hormone which is produced mainly in the stomach. Ghrelin is involved in energy balance, gastric motility, anxiety and when administered to mice, leads to fat deposition. Ghrelin plays a key role in motivating feeding as serum levels increase during food deprivation in animals, peak prior to eating, and decrease upon refeeding. In humans, studies have correlated elevated ghrelin levels to obesity. For example, one study demonstrated that people who underwent gastric bypass surgery and lost up to 36% of their body weight had greatly reduced circulating ghrelin levels. Additionally, people with Prader-Willi syndrome, a genetic disorder that causes severe obesity with uncontrollable appetite, have extremely high levels of ghrelin. These observations indicate a key role for ghrelin in motivating feeding. Ghrelin is the first peptide hormone to be identified which is modified by a fatty acid. In humans, ghrelin is modified at the serine found at position 3 (Ser-3) of the amino acid sequence. When ghrelin is isolated from stomach tissue, various acylated forms of ghrelin can be detected. These forms include unacylated, octanoylated (C-8), decanoylated (C-IO), and possibly decenoylated (C-IO: 1 and C- 10:2) ghrelin. The predominant form found in stomach tissue is unacylated ("des-acyl,") ghrelin, however, studies have demonstrated the n-octanoylated form ("activated ghrelin") is responsible for most of ghrelin' s endocrine activities. It is administration of this activated ghrelin which leads to fat deposition in mice. Given the role of activated ghrelin as an appetite regulating hormone and potential role in obesity, there is a need to understand the mechanism by which ghrelin is acylated ("activated"). As such, there is a need to

identify the enzyme responsible for the acylation of ghrelin, particularly, the n- octanoylation of ghrelin.

To date, the gene(s) encoding the protein(s) responsible for the acylation of ghrelin have not been described. A number of members of a serine acyltransferase family that transfer acyl groups to serine residues of target molecules have been identified, including two serine palmitoyltransferases functioning in the biosynthesis of sphingolipids in mammals, and a plant Ser O-acetyltransferase gene family in Arabidopsis thaliana. In addition, numerous sequences exist in sequence databases described as putative O-acyltransferases based on homology to other proteins, including a predicted human gene sequence (Genbank accession number XM 940502) and predicted human protein sequence (XP 945595) and a chimpanzee putative protein (XP 519692). There is, however, no evidence indicating that any of these proteins have O- acyltransferase activity and are able to acylate ghrelin.

Applicants have discovered a gene encoding a human ghrelin O-acyltransferase ("hGOAT") which is capable of acylating ghrelin. In particular, the gene encodes a protein which is able to acylate ghrelin with n- fatty acids, including octanoic acid and as such is capable of activating ghrelin. This discovery satisfies a need in the art by providing a new composition useful in generating acylated ghrelin and identifying modulators of hGOAT activity and ghrelin activation.

SUMMARY OF THE INVENTION

The present invention provides an isolated polynucleotide that comprises a sequence that encodes a polypeptide comprising the amino acid sequence of hGOAT (SEQ ID NO: 2). In another embodiment, the present invention provides an isolated nucleic acid comprising SEQ ID NO: 3.

The present invention also provides an isolated polypeptide that comprises the amino acid sequence of hGOAT (SEQ ID NO: 2).

In an embodiment of the present invention, the present invention provides an isolated antibody that binds to a human ghrelin O-acyltransferase. In another embodiment, the antibody binds to a polypeptide of SEQ ID NO: 2.

The present invention provides assays for identifying a modulator of hGOAT activity. In a preferred embodiment, the assays identify antagonists of hGOAT activity. In another embodiment, the assays identify agonists of hGOAT activity. In an embodiment of the present invention, the modulators of hGOAT activity increase or decrease levels of nucleic acid encoding hGOAT. In a preferred embodiment, hGOAT comprises SEQ ID NO: 2. In another preferred embodiment, the nucleic acid encoding hGOAT comprises SEQ ID NO: 3.

The present invention also provides modulators which modulate hGOAT transcript levels ghrelin acyltransferase comprises SEQ ID NO: 2.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides an isolated polynucleotide sequence encoding a polypeptide comprising SEQ ID NO: 2. The present invention also provides an isolated polynucleotide sequence comprising SEQ ID NO:3. In another embodiment, the present invention provides an isolated polypeptide of SEQ ID NO: 2.

In an embodiment, the invention provides a vector comprising an isolated polynucleotide sequence encoding hGOAT. The invention provides a vector, preferably, (but not limited to) a plasmid, a recombinant expression vector, a yeast expression vector, or a retroviral expression vector comprising an isolated polynucleotide sequence encoding hGOAT. In another embodiment, the present invention provides a vector comprising a polynucleotide sequence comprising SEQ ID NO: 3. In another embodiment, the invention provides a host cell comprising a vector of the present invention. In a preferred embodiment, the host cell comprises a vector comprising a polynucleotide sequence encoding hGOAT. Preferably, a host cell of the invention comprises one or more vectors or constructs comprising a polynucleotide sequence of the present invention. In a preferred embodiment, the host cell comprises a vector comprising SEQ ID NO: 3. The host cell of the invention is a cell into which a vector of the invention has been introduced (e.g., via transformation, transduction, infection), said vector comprising a nucleic acid encoding hGOAT. The host cell types include mammalian, bacterial, plant, and yeast cells. Preferably, the host cell is a CHO cell, a

COS cell, an SP2/0 cell, an NSO cell, a TT cell, a yeast cell, or a derivative or progeny of any preferred cell type.

In another embodiment, the invention provides a method of preparing hGOAT of the invention, comprising maintaining a host cell of the invention (i.e., a host cell that has been transformed, transduced, or infected with a vector (or vectors) of the invention) under conditions appropriate for expression of the hGOAT of the invention, whereby such protein is expressed. The method can further comprise the step of isolating the protein of the invention from the cell or preferably, from the culture medium in which such cell is grown. Generally, the definitions of nomenclature and descriptions of general laboratory procedures used in this application can be found in J. Sambrook et al., Molecular Cloning, A Laboratory Manual, (1989) Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. In addition, Ausubel et al., eds., Current Protocols in Molecular Biology, (1987 and periodic updates) Greene Publishing Associates, Wiley-Interscience, New York, discloses methods useful in the present application.

A protein of the present invention may be obtained using a variety of methods known to one of skill in the art. For example, the nucleic acid (e.g., cDNA or genomic DNA) encoding hGOAT may be isolated by nucleic acid techniques such as polymerase chain reaction (PCR). Once isolated, the gene is inserted into a replicable vector for cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector may, for example, be plasmid, cosmid, viral particle, or phage. The appropriate nucleic acid sequence may be inserted into the vector by a variety of procedures. In general, DNA is inserted into an appropriate restriction endonuclease site(s) using techniques known in the art. Vector components generally include, but are not limited to, one or more of a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence. Construction of suitable vectors containing one or more of these components employs standard techniques which are known to the skilled artisan.

It is expected that those of skill in the art are knowledgeable in the expression systems chosen for expression of hGOAT. Briefly, the polynucleotides are expressed in

hosts after the sequences have been operably linked to (i.e., positioned to ensure the functioning of) an expression control sequence. These expression vectors are typically replicable in the host organisms either as episomes or as an integral part of the host chromosomal DNA. Commonly, expression vectors contain selection markers, e.g., tetracycline, neomycin, and dihydro folate reductase, to permit detection of those cells transformed with the desired DNA sequences. The vectors containing the polynucleotide sequences of interest (e.g., hGOAT encoding sequences and expression control sequences) are transferred into the host cell by well-known methods, which vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts.

E. coli is a prokaryotic host useful particularly for cloning the polynucleotides of the present invention. Other microbial hosts suitable for use include bacilli, such as Bacillus subtilus, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species. In these prokaryotic hosts, one can also make expression vectors, which will typically contain expression control sequences compatible with the host cell (e.g., an origin of replication). In addition, any of a number of well-known promoters may be present, such as the lactose promoter system, a tryptophan (trp) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda. The promoters will typically control expression, optionally with an operator sequence, and have ribosome binding site sequences and the like, for initiating and completing transcription and translation.

Eukaryotic cells may also be used to express and produce hGOAT. For example, yeast, may be used for expression. Pichia pastoris is a preferred host, with suitable vectors having expression control sequences, such as promoters, including 3- phosphoglycerate kinase or other glycolytic enzymes, and an origin of replication, termination sequences and the like as desired. Additionally, mammalian tissue cell culture may also be used to express and produce the polypeptides of the present invention. Mammalian tissue culture is actually preferred, because a number of suitable host cell lines capable of secreting intact recombinant proteins have been developed in

the art, and include the CHO cell lines, various COS cell lines, HeLa cells, myeloma cell lines, transformed B-cells, human embryonic kidney cell lines, or hybridomas. Preferred cell lines are CHO and myeloma cell lines such as SP2/0 and NSO. Expression vectors for these cells can include expression control sequences, such as an origin of replication, a promoter, an enhancer, and necessary processing information sites, such as ribosome binding sites, RNA splice sites, polyadenylation sites, and transcriptional terminator sequences. Preferred expression control sequences are promoters such as SV40, adenovirus, bovine papilloma virus, cytomegalovirus and the like.

The present invention also encompasses an isolated antibody which binds to hGOAT. In one aspect of the present invention, the isolated antibody which binds to hGOAT is a monoclonal antibody. In another aspect of the present invention the isolated monoclonal antibody binds to SEQ ID NO: 2. The antibodies of the present invention are useful in diagnostic assays to detect hGOAT. In addition, the antibodies of the present invention are useful as antagonists of hGOAT to inhibit or decrease hGOAT activity and also inhibit or decrease levels of activated ghrelin.

For the present invention, "an antibody" refers to an intact antibody (comprising a complete or full length Fc region), a substantially intact antibody, or a portion or fragment of an antibody comprising an antigen-binding region, e.g., a Fab fragment, Fab' fragment or F(ab') 2 fragment of a humanized or human antibody. The term "monoclonal antibody" as used herein refers to an antibody from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical and/or bind the same epitope(s), except for possible variants that may arise during production of the monoclonal antibody, such variants generally being present in minor amounts. Such monoclonal antibody typically includes an antibody comprising a polypeptide sequence that binds a target, wherein the target-binding polypeptide sequence was obtained by a process that includes the selection of a single target binding polypeptide sequence from a plurality of polypeptide sequences. For example, the selection process can be the selection of a unique clone from a plurality of clones, such as a pool of hybridoma clones, phage clones or recombinant DNA clones. It should be understood that the selected target binding sequence can be further altered, for example,

to improve affinity for the target, to humanize the target binding sequence, to improve its production in cell culture, to reduce its immunogenicity in vivo, to create a multispecific antibody, etc., and that an antibody comprising the altered target binding sequence is also a monoclonal antibody of this invention. In contrast to polyclonal antibody preparations which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. In addition to their specificity, the monoclonal antibody preparations are advantageous in that they are typically uncontaminated by other immunoglobulins. The modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by a variety of techniques, including the hybridoma method (e.g., Kohler et al., Nature, 256:495 (1975); Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et al., in: Monoclonal Antibodies and T-CeIl Hybridomas 563-681, (Elsevier, N.Y., 1981), recombinant DNA methods (see, e.g., U.S. Patent No. 4,816,567), phage display technologies (see, e.g., Clackson et al., Nature, 352:624-628 (1991); Marks et al., J. MoI. Biol, 222:581-597 (1991); Sidhu et al., J. MoI. Biol. 338(2):299-310 (2004); Lee et al., J.Mol.Biol.340(5): 1073-1093 (2004); and Fellouse, Proc. Nat. Acad. Sci. USA 101(34): 12467-12472 (2004).

The monoclonal antibodies herein specifically include "chimeric" antibodies (immunoglobulins) in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while portions of the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired biological activity (U.S. Patent No. 4,816,567; Morrison et al., Proc. Nati. Acad. Sci. USA, 81 :6851-6855 (1984)). Methods of making chimeric antibodies are known in the art.

"Humanized" forms of non-human (e.g., murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. In some embodiments, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a complementarity-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications are generally made to further refine and maximize antibody performance. Typically, the humanized antibody will comprise substantially all of at least one variable domain, in which all or substantially all of the hypervariable loops derived from a non-human immunoglobulin and all or substantially all of the FR regions are derived from a human immunoglobulin sequence although the FR regions may include one or more amino acid substitutions to, e.g., improve binding affinity. In some embodiments, the number of these amino acid substitutions in the FR are typically no more than six in the heavy chain (H chain), and in the light chain (L chain), no more than three. In one preferred embodiment, the humanized antibody will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin or a human consensus constant sequence. For further details, see Jones et al, Nature, 321 :522-525 (1986) and Reichmann et al, Nature, 332:323-329 (1988).

DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.

The present invention further provides assays for identifying a compound which modulates hGOAT activity. For purposes of the present invention, "modulate" refers to the ability of a molecule ("modulator") to alter hGOAT activity such as, inhibit, in the case of an antagonist, or stimulate, in the case of an agonist, hGOAT activity. Such modulator may directly or indirectly, bind, complex, or interact with hGOAT such that hGOAT activity is inhibited or stimulated. In addition, modulator also encompasses molecules which are able to alter hGOAT mRNA transcript levels or hGOAT expression. Such modulators may decrease or increase hGOAT expression such that hGOAT activity is altered. The present invention provides assays to identify a modulator of hGOAT activity comprising contacting a host cell overexpressing hGOAT with a compound and measuring or detecting hGOAT activity. The present invention also provides an assay for identifying a compound which modulates hGOAT activity comprising providing a host cell having a vector comprising a polynucleotide sequence encoding hGOAT and a compound, contacting said host cell and said compound measuring hGOAT activity. In an embodiment, the host cell is contacted with a compound from a chemical screening library. In another aspect, the assays of the present invention comprise contacting an expression system comprising a polynucleotide sequence encoding hGOAT with a compound from a chemical screening library and measuring hGOAT activity. In another embodiment, the host cell is contacted with a compound which is a small nucleic acid which interferes with hGOAT gene expression. In a preferred embodiment, the polynucleotide sequence encoding hGOAT comprises SEQ ID NO: 3. In another embodiment of the present invention, the small nucleic acid is selected from the group consisting of anti-hGOAT small interfering RNA (siRNA), anti-hGOAT antisense DNA or an anti-hGOAT small hairpin RNA (shRNA). In another preferred embodiment, the host cell is a mammalian cell. In a more preferred embodiment, the host cells are TT cells.

In another embodiment, the assays for identifying a modulator of hGOAT comprise contacting hGOAT with a compound and determining whether there is a change in hGOAT activity. In another aspect, the present invention provides assays for identifying a hGOAT agonist comprising contacting hGOAT with a compound and

determining whether there is an increase in hGOAT activity. In another embodiment, the present invention provides assays for identifying a hGOAT antagonist comprising contacting hGOAT with a compound and determining whether there is a decrease in hGOAT activity. In a preferred embodiment, the assays comprise hGOAT comprising SEQ ID NO: 2.

The present invention further provides assays for identifying a compound which modulates activated ghrelin levels. Such modulators may decrease or increase activated ghrelin levels. The present invention provides assays to identify a modulator of activated ghrelin levels comprising contacting a host cell overexpressing hGOAT with a compound and measuring activated ghrelin levels. The present invention also provides assays to identify a modulator of ghrelin levels comprising contacting a host cell which expresses ghrelin and which host cell also comprises a vector which comprises a polynucleotide sequence encoding hGOAT with a compound and measuring activated ghrelin levels. In another aspect, the assays of the present invention comprise contacting an expression system comprising a polynucleotide sequence encoding hGOAT with a compound from a chemical screening library and measuring activated ghrelin levels. In another embodiment, the host cell is contacted with a compound, a small nucleic acid, which interferes with hGOAT gene expression. In a preferred embodiment, the polynucleotide sequence encoding hGOAT comprises SEQ ID NO: 3. In another embodiment of the present invention, the small nucleic acid is selected from the group consisting of anti- hGOAT small interfering RNA (siRNA), anti-hGOAT antisense DNA or an anti-hGOAT small hairpin RNA (shRNA). In another preferred embodiment, the host cell is a mammalian cell. In a more preferred embodiment, the host cells are TT cells.

The assays of the present invention will include assays amenable to high- throughput screening of chemical libraries, making them particularly suitable for identifying small molecule drug candidates. Screening for compounds that inhibit hGOAT activity or stimulate hGOAT activity may be accomplished, for example, by assays comprising contacting membrane extracts from cells overexpressing hGOAT with small molecule drug candidates and measuring the amount of hGOAT activity or measuring the amount of acylated ghrelin. Screening may also be accomplished by

assays comprising contacting membrane extracts from cells overexpressing hGOAT and overexpressing ghrelin with small molecule drug candidates and measuring the amount of hGOAT activity or measuring the amount of acylated ghrelin.

In another embodiment, the present invention provides a method of modulating hGOAT activity comprising administering a modulator of hGOAT. In one embodiment, the method of modulating hGOAT activity comprises administering an hGOAT antagonist. In one embodiment, the method of modulating hGOAT activity comprises administering an hGOAT agonist. In another embodiment, the present invention provides a method of modulating hGOAT activity comprising administering an anti- hGOAT antibody.

The present invention also provides a method of inhibiting ghrelin acylation comprising administering an effective amount of an hGOAT antagonist. In addition, the present invention provides a method of inhibiting ghrelin activation comprising administering an effective amount of an hGOAT antagonist. In a preferred embodiment, the inhibition of ghrelin acylation or ghrelin activation comprises the administration of an effective amount of an antagonist selected from the group consisting of small molecules, small interfering RNA's and anti-hGOAT antibodies.

The invention provides a method of modulating hGOAT activity comprising administering an effective amount of a modulator of hGOAT to said mammal. In a preferred embodiment, the invention also provides a method of modulating activated ghrelin levels in a mammal, preferably a human in need thereof comprising administering an effective amount of a hGOAT modulator. In a preferred embodiment, the modulator is an antagonist. In another embodiment, the modulator is an agonist. The invention further provides a method of treating or preventing a disease or disorder ameliorated by modulating signal transduction resulting from inhibition of ghrelin activation, comprising administering to a patient (e.g., a human) in need of such treatment or prevention an effective amount of an antagonist of hGOAT of the invention. The invention also provides a method of treating or preventing a disease or disorder ameliorated by modulating signal transduction resulting from stimulation of ghrelin activation, comprising administering to a patient (e.g., a human) in need of such treatment or

prevention an effective amount of an agonist of hGOAT of the invention. As used herein, "treating or preventing" refers to a disease or disorder associated with activated ghrelin levels, or benefited by increasing or decreasing hGOAT activity or benefited by an increase or decrease in the existing activated ghrelin levels. The invention provides a method for treating disorders associated with prolactin and adrenocorticotropic hormone (ACTH) secretion, effects on the pituitary-gonadal axis, stimulation of appetite, control of energy balance, effects on sleep and behavior, control of gastric motility and acid secretion, effects on exocrine and endocrine pancreatic function and glucose metabolism, and modulation of proliferation of neoplastic cells in a mammal, preferably, a human, in need thereof.

Specifically, diseases or disorders treated or prevented with an modulator of hGOAT include, but are not limited to, obesity and related disorders including, for example, Type II non-insulin dependent diabetes mellitus (NIDDM), Prader-Willi syndrome, eating disorders, hyperphagia, impaired satiety, cachexia, and anorexia. The invention also encompasses a modulator of hGOAT for therapy. In another embodiment, the invention provides the use of an modulator of hGOAT for the manufacture of a medicament for treating a disorder selected from the group consisting of obesity, Type II non-insulin dependent diabetes mellitus (NIDDM), Prader-Willi syndrome, eating disorders, hyperphagia, impaired satiety, cachexia, and anorexia. In a preferred embodiment, hGOAT comprises SEQ ID NO: 2. In a more preferred embodiment, the invention encompasses the use of an antagonist of a polypeptide comprising SEQ ID NO: 2, wherein the antagonist is small molecule, short interfering RNA, or an anti-hGOAT antibody. In an even more preferred embodiment, antagonist is a small molecule. In another preferred embodiment, the antagonist is an anti-hGOAT antibody.

The invention also encompasses an article of manufacture, comprising a packaging material and an antagonist of the present invention contained within said packaging material, and wherein the packaging material comprises a package insert indicating that the antagonist specifically modulates hGOAT activity, or modulates the levels of activated ghrelin.

hGOAT modulators of the present invention can be in the form of a composition comprising an hGOAT modulator of the invention suspended in a pharmacologically acceptable diluent or excipient. These pharmaceutical compositions may be administered by any means known in the art that achieve the generally intended purpose to treat disorders involving hGOAT. The preferred route of administration is oral, but the administration route may also be parenteral, defined herein as referring to modes of administration that include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous, and intraarticular injection and infusion. Preferably, the route of administration is intravenous and/or subcutaneous. The dosage administered will be dependent upon the age, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the effect desired.

Compositions within the scope of the invention include all compositions wherein the hGOAT modulator is present in an amount that is effective to modulate hGOAT activity, modulate acylation of ghrelin, or treat diseases or disorders including, but are not limited to, obesity and related disorders including, for example, Type II non-insulin dependent diabetes mellitus (NIDDM), Prader-Willi syndrome, eating disorders, hyperphagia, impaired satiety, cachexia, and anorexia. While individual needs may vary from one patient to another, the determination of the optimal ranges of effective amounts of all of the components is within the ability of the clinician of ordinary skill. The pharmaceutical compositions for administration are designed to be appropriate for the selected mode of administration, and pharmaceutically acceptable excipients such as, buffers, surfactants, preservatives, solubilizing agents, isotonicity agents, stabilizing agents, carriers, and the like are used as appropriate. Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton PA, latest edition, incorporated herein by reference, provides a compendium of formulation techniques as are generally known to practitioners. For example, the formulation may include a buffer. Preferably, the buffer is a citrate buffer or a phosphate buffer or a combination thereof. Generally, the pH of the formulation is between about 4 and about 8. Preferably, the pH is between about 5 and about 7.5. The pH of the formulation can be selected to balance antagonist stability (chemical and physical) and comfort to the patient when administered. The

formulation may also include a salt such as NaCl. In addition, the formulation may be sterile filtered after making the formulation, or otherwise made microbiologically acceptable. A preservative such as m-cresol or phenol, or a mixture thereof may be added to prevent microbial growth and contamination. The following examples are intended to illustrate but not to limit the invention.

Example 1- Inhibition of Ghrelin acylation by Knockdown of hGOAT Gene TT Cells (ATCC Cat. No. CRL-1803) are cultured in Ham's F12K media (ATCC 30-2004) supplemented with 2 mM L-glutamine, 1.5 g/1 sodium bicarbonate, 10% fetal bovine serum, 10 units/ml penicillin, and 10 μg/ml streptomycin (TT cell culture media) in a T25 flask. Appropriate siRNA is added at 2 μg/T25 flask. Transfection of RNA silencing sequences into cells is achieved with an Amaxa Nucleofector II Device (Cologne, Germany) using 5X10 6 cells and 2 μg RNA silencing sequences per transfection following the manufacturer's recommended protocol. hGOAT transcript specific RNA silencing sequences: siRNA-1, 5'-UGU UGC AGA CAU UUG CCU UCU-3'; and siRNA-3, 5'-AAU GCC UAA ACG UGG CAG UGA-3' and S-I, 5'- CAGAUUCUUGGACUAGAAUGCCUAA-3' S-2, 5'- CGGGACUGACUGAUUGCCAGC AAUU-3' and S-3, 5'- AGCUGACUACCUGAUUCACUCCUUU-3 and all are obtained from Invitrogen (Carlsbad, CA). The S-I through S-3 RNA silencing sequences are designed by

Invitrogen using Invitrogen' s Stealth™ RNAi technology. Control cells are treated with the Non Targeting Control (NTC) siRNA, Cat. No. D-OO 1210-02-05 from Dharmacon (Lafayette, CO). Double stranded silencing RNAs Stealth 1-3 are from Invitrogen, and S1RNA7-1, and siRNA7-3, (Cat. No. 1027020) are custom siRNAs from Qiagen (Valencia, CA). After transfection, cells in TT cell media are allowed to adhere overnight to T-25 tissue culture flasks. Cell media are replaced with TT cell culture media supplemented with 125 μg/ml octanoic acid, to stimulate ghrelin octanoylation, 0.4 ng/ml SIL (Stable Isotope Label 13 C and 15 N, +24 mass units, Midwest Biotech, Indianapolis, IN) human octanoylated ghrelin and 10 μg/ml anti-ghrelin antibody (C2- 5Al), to prevent the conversion of octanoylated ghrelin into desacyl ghrelin. Cells are

allowed to incubate for 6 days. After this incubation period, cell media are collected, acidified to 50 mN HCl, and stored at -8O 0 C until ready for hGOAT transcript level determination and immunoprecipitation mass spectrometry analysis.

Determination of hGOAT Transcript Levels To ensure that reduced levels of ghrelin acylation are due to siRNA mediated inhibition of hGOAT transcript levels, the levels of hGOAT mRNA present in treated cells is determined after isolation of total RNA from each treatment group with an RNeasy kit from Qiagen (Valencia, CA). One microgram of total RNA from each treatment is then transcribed to cDNA using a High Capacity cDNA Reverse Transcription kit from Applied Biosystems (Foster City, CA). Relative quantitative reverse transcriptase PCR (qRT-PCR) is performed by employing a standard curve method using a 7900HT instrument and procedures from Applied Biosystems (ABI, Foster City, CA).

Twenty μL PCR reactions are prepared containing IX Universal master mix (ABI, catalog number 4305719), 0.8 μM of custom forward primer (5' GGCTCTCTGTGCTCCTTCCA 3'), 0.8 μM custom reverse primer (5' AGAGTGTCTGGGATGCAAAGC 3'), 0.2 μM probe containing a 5' 6-FAM label with 3' black hole quencher 1 (BHQl) - (5' FAM- CTGGACCCTTGAACACGAGCCTGAAA-BHQ 1-3'), and 4 μL of template cDNA diluted 1 :50 in 1OmM Tris, pH 7.5. Primers and probes are synthesized by Biosource International (Camarillo, CA). A pre-packaged 18s rRNA assay (ABI, catalog 4310893E) is run on all samples as described by the manufacturer. PCR conditions for hGOAT and 18s rRNA are as follows: 50 ° C for 2 minutes, 95 ° C for 10 minutes, followed by 40 cycles of 95 ° C for 15 seconds and 60 ° C for 1 minute. The data from hGOAT is normalized to the 18s rRNA and the data is calibrated relative to non-targeting control (NTC).

Immunoprecipitation Reactions

Antibodies with specificity toward the carboxyl-terminus of ghrelin peptide (D4- 7.1) are covalently coupled to Invitrogen/Dynal Magnetic beads following the manufacturer's recommended protocol and used for immunoprecipitation reactions.

Acidified media from cell culture studies are centrifuged at 2Kg for 5 minutes.

Supernatants are extracted on equilibrated tC18 Sep Pak cartridges (Millipore Corp., Cat. No. WAT036805, Billerica, MA). Peptides are eluted from tC18 sep-pack units using 60% acetonitrile in 0.1% trifluoroacetic acid and lyophilized to dryness. Dried pellets are suspended in 275 μL of Tris-Hepes Buffer (140 mM Tris-HCl, 50 mM Hepes, 150 mM NaCl, and 0.1% N-octyl glucopyranoside, pH 7.5) and exposed to approximately 1 μg of anti-ghrelin antibody (D4-7.1) bound to Dynal magnetic beads. Extracts and antibody beads are incubated overnight at 4 0 C or 2 hours at room temperature with gentle rotation. Antibody-antigen complexes are washed at room temperature with 500 μL of the following solutions: twice in 50 mM Tris-HCl, 50 mM Hepes, 150 mM NaCl, pH 7.5 and twice in distilled water. Ghrelin immunocomplexes are separated from the antibody beads by acidification with 10 μL of a solution of 0.1 % trifluoroacetic acid and further processed using Cl 8 Zip Tips (Millipore, Billerica MA, Catalogue No. ZTC 18S) as recommended by the manufacturer. Ghrelin peptides are eluted from C 18 Zip Tip columns using 3.0 μL of 50% acetonitrile-0.1% TFA saturated with α-cyano-4-hydroxy- cinammic acid matrix. 1.0 μL volume from each resulting eluate is spotted on target plates coated with α -cyano-4-hydroxy-cinammic acid matrix as described previously [Gutierrez, Biotechniques manuscript]. An Applied Biosciences 4700 (Applied Biosystems, Foster City, CA) MALDI-TOF mass spectrometer is used for mass spectrometry analysis under optimized conditions for ghrelin peptide detection. The laser is operated at a fixed fluence just above the threshold value. Additional parameters are optimized for detection of octanoylated and des-acyl ghrelin peptides. Spectra are automatically collected for each spot by a random, center-biased pattern. "Normalized (%) Ghrelin Octanoylation" values are determined as a ratio between octanoylated ghrelin (1-28) and SIL octanoylated ghrelin (standard) and normalized to NTC results.

The data indicate that the normalized percent of ghrelin octanoylation after siRNA 7-1, siPvNA 7-3, Stealth- 1, Stealth-2, and Stealth-3 independent treatments (100, 37, 29, 56, 35, and 0) correlated with the normalized percent of hGOAT transcript levels as measured by qRT-PCR (100, 44, 33, 52, 13, 3 ). SiRNA mediated decrease in hGOAT

transcript results in specific ghrelin octanoylation inhibition and indicates that hGOAT is responsible for ghrelin acylation.

Example 2- Acylation of Ghrelin by hGOAT

To determine the ability to hGOAT to acylate ghrelin directly in mammalian cells, the hGOAT gene in pcDNA3.2/V5/GW/D-TOPO (Invitrogen) is transiently expressed in the presence or absence of transiently expressed ghrelin. Mammalian cell transfection studies are performed in 293 T HEK cells using Minis transfection reagents following the manufacturer's protocol. Cells are allowed to adhere overnight to T-25 cell culture flasks in DMEM media containing 10% fetal bovine serum, and 50 μg/ml gentamycin (293T HEK growth media). After overnight incubation, the medium in each flask is replaced with 293 T HEK growth media supplemented with 125 μg/ml octanoic acid, 0.4 ng/ml (Stable Isotope Label l^C-^^N- labeled) human octanoylated ghrelin and 10 μg/ml anti-ghrelin antibody (C2-5A1, see WO2006/091381) antibody. Cells are allowed to incubate for 3 days. Cell media is collected, acidified to 50 mN HCl, and stored at -8O 0 C until ready for immunoprecipitation mass spectrometry analysis as described in Example 1. Values indicated are ng/immunoprecipitation.

The data thus indicate that hGOAT is able to acylate ghrelin with octanoic acid. Table 1 : hGOAT Dependent Octanylation of Ghrelin