Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
ADP-RIBOSYLTRANSFERASE BASED METHODS AND COMPOSITIONS
Document Type and Number:
WIPO Patent Application WO/2008/021048
Kind Code:
A2
Abstract:
Provided herein are methods for identifying agents that modulate the activity of sirtuin ADP ribosyltransferases, e.g., Sirt4 and Sirt6. Also provided are methods for treating a hyperproliferating disease, comprising, e.g., administering to a subject in need thereof an agent that reduces the activity or protein level of an ADP ribosyltransferase, e.g., Sirt6.

Inventors:
SINCLAIR, David, A. (8 Preston Road, West Roxbury, MA, 02132, US)
FIRESTEIN, Ron (131 Sewall Avenue, Brookline, MA, 02446, US)
HUBBARD, Basil (8 Preston Road, Cambridge, MA, MA, US)
Application Number:
US2007/017461
Publication Date:
February 21, 2008
Filing Date:
August 06, 2007
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
PRESIDENT AND FELLOWS OF HARVARD COLLEGE (17 Quincy Street, Cambridge, MA, 02138, US)
SINCLAIR, David, A. (8 Preston Road, West Roxbury, MA, 02132, US)
FIRESTEIN, Ron (131 Sewall Avenue, Brookline, MA, 02446, US)
HUBBARD, Basil (8 Preston Road, Cambridge, MA, MA, US)
International Classes:
G01N33/53; G01N33/53
Attorney, Agent or Firm:
VAN AMSTERDAM, John, R. (Wolf, Greenfield & Sacks P.C.,600 Atlantic Avenu, Boston MA, 02210, US)
Download PDF:
Claims:

Claims:

1. A method for identifying an agent that modulates the activity of a sirtuin ribosyltransferase, comprising

(i) contacting a sirtuin ribosyltransferase or a functional homo log thereof with NAD+, a test agent and a target peptide comprising a lysine or arginine residue located N- terminally and immediately adjacent to a fluorescent group that is located at the C-terminus of the peptide, for a time sufficient for the ribosyl group of NAD+ to be transferred to the target in the absence of the test agent, thereby forming a reaction mixture; (ii) adding trypsin to the reaction mixture; and (iii) detecting the fluorescence, wherein a difference in the fluorescence obtained in the presence of the test agent relative to the absent of the test agent indicates that the test agent is an agent that modulates the activity of a sirtuin ribosyltransferase.

2. The method of claim 1, wherein the target peptide is about 2 to about 50 amino acids long. 3. The method of claim 1, wherein the fluorescent group is dimethyl coumarin.

4. A method for identifying an agent that modulates the activity of a sirtuin ribosyltransferase, comprising

(i) combining a sirtuin ribosyltransferase or a functional homolog thereof with a sirtuin ribosyltransferase target, labeled NAD+ and a test agent; and (ii) detecting labeled target, wherein a difference in the amount of labeled target in a reaction mixture comprising the test agent relative to the amount of labeled target in a reaction mixture that does not comprise the test agent indicates that the test agent modulates the activity of a sirtuin ribosyltransferase. 5. The method of claim 4, wherein the target is linked to a solid surface, and the method comprises detecting labeled target that is attached to the solid surface.

6. The method of claim 4, wherein the target is Alternate Reading Frame (ARF), p53, nucleophosmin (NPMl) or GDH or a functional homolog thereof.

7. The method of claim 4, wherein the sirtuin ribosyltransferase is a human sirtuin ribosyltransferase.

8. The method of claim 7, wherein the sirtuin ribosyltransferase is SIRT4, SIRT6 or SIRT7.

9. The method of claim 4, wherein the labeled NAD+ is NAD+ linked to biotin or horse radish peroxidase (HRP).

10. A method for identifying an agent that modulates the activity of a sirtuin ribosyltransferase, comprising (i) contacting a cell or a cell lysate comprising a sirtuin ribosyltransferase with labeled NAD+ and a test agent; and

(ii) comparing the level of labeled proteins in the cell or cell lysate that was contacted with a test agent relative to a cell or cell lysate that was not contacted with a test agent, wherein a different level of labeled proteins in the cell or cell lysate that was contacted with a test agent relative to a cell or cell lysate that was not contacted with a test agent indicates that the test agent is an agent that modulates the activity of a sirtuin ribosyltransferase. 11. The method of claim 10, wherein the cell comprises a heterologous nucleic acid encoding a sirtuin ribosyltransferase or a functional homolog thereof.

12. The method of claim 11, wherein the sirtuin ribosyltransferase or functional homolog thereof is over-expressed.

13. The method of claim 10, further comprising comparing the level of labeled proteins in a cell or cell lysate that does not comprise the sirtuin ribosyltransferase, wherein a difference in labeled proteins obtained in a cell or cell lysate comprising the sirtuin ribosyltransferase and contacted with the test agent and that in a cell or cell lysate that does not comprise the sirtuin ribosyltransferase and was contacted with the test agent, indicates that the test agent is an agent that modulates the activity of a sirtuin ribosyltransferase.

14. A method for identifying an agent that modulates the activity of a sirtuin ribosyltransferase, comprising

(i) contacting a cell or cell lysate comprising a sirtuin ribosyltransferase or a functional homolog thereof with labeled NAD+ and a test agent for an amount of time and under conditions appropriate for transfer of the ribosyl group of NAD+ onto a target protein in the absence of the test agent; and

(ii) determining whether there is a difference between the number and/or amount of labeled proteins in a cell or cell lysate that was contacted with a test agent relative to a cell or cell lysate that was not contacted with the test agent, wherein a difference indicates that the test agent is an agent that modulates a sirtuin ribosyltransferase.

15. A method for identifying a target peptide of a sirtuin ribosyltransferase, comprising

(i) contacting a sirtuin ribosyltransferase or a functional homolog thereof with a test peptide and labeled NAD+; and

(ii) determining whether the test peptide is labeled, wherein the presence of label on the test peptide indicates that the test peptide is a target peptide of the sirtuin deacetylase protein. 16. A method for identifying a target protein of a sirtuin ribosyltransferase, comprising (i) contacting a cell expressing a sirtuin ribosyltransferase with labeled NAD+ for an amount of time and under conditions appropriate for transfer of the ribosyl group of NAD+ onto a target protein; and

(ii) determining the identity of a protein that is labeled, wherein a protein that is labeled is a target protein of a sirtuin ribosyltransferase.

17. The method of claim 16, further comprising

(iii) combining a sirtuin ribosyltransferase with labeled NAD+ and the target protein or a functional homolog thereof; and

(iv) determining whether the target protein or the functional homolog thereof is labeled, wherein the presence of label on the target protein further confirms that the target protein is a target protein of a sirtuin ribosyltransferase.

18. The method of claim 16 wherein the cell comprises a heterologous nucleic acid encoding a sirtuin ribosyltransferase or a functional homolog thereof.

19. The method of claim 18, wherein the sirtuin ribosyltransferase or functional homolog thereof are over-expressed in the cell.

20. The method of claim 16, wherein determining the identity of a protein that is labeled comprises isolating one or more proteins that are labeled using a reagent that interacts with the label and subjecting the one or more proteins or portion thereof to mass spectroscopy.

21. A method for treating or preventing a hyper-proliferating disease in a subject, comprising administering to a subject in need thereof, a therapeutically effective amount of an agent that decreases the level of protein or activity of a Sirtό protein.

22. The method of claim 21 , wherein the hyperproliferating disease is cancer.

23. The method of claim 22, wherein cancer is prostate cancer.

24. The method of claim 21, wherein the agent is a small molecule.

25. The method of claim 24, wherein the agent is a compound of formula I:

I wherein, independently for each occurrence, X is -O-, -N(R 8 )-, -C(R a ) 2 -, -C(MD)-, -C(=NR b )-, -C(MS)-, -S-, -S(MD)- or -S(MD) 2 -;

Y is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(MD)-, -C(=S)-, -S-, -S(MD)- or -S(MD) 2 -;

Z is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(MD)-, -C(=NR b )-, -C(MS)-, -S-, -S(MD)- or -S(MD) 2 -;

R a is hydrogen, alkyl, aryl, or araikyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or araikyl; R 1 is aryl;

R 2 is hydrogen, alkyl, aryl, or araikyl;

R 3 is hydrogen, halogen, alkyl, alkβnyl, alkynyl, aryl, heteroaryl, araikyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl, or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, araikyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl, or sulfoxido; provided that when X is -C(=O)-; Y is -N(H)-; Z is -CH(CH 3 )-; R 2 is hydrogen; R 3

is hydrogen; and R 4 is hydrogen; Ri is not and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or

a compound of formula II:

II wherein, independently for each occurrence, X is -O-, -N(RO-, -C(R a ) 2 -, -Q=O)-, -CC=NR*)-, -CC=S)-, -S-, -S(=O)- or -SC=O) 2 -;

Y is -O-, -N(R 3 )-, -C(Ra) 2 -, -CC=O)-, -CC=NRb)-, -CC=S)-, -S-, -S(=O)- or -SC=O) 2 -;

Z is -O-, -NCRa)-, -CCRa) 2 -, -CC=O)-, -C(=NR b )-, -Q=S)-, -S-, -S(=O)- or -SC=O) 2 -;

R a is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl; R 1 is aryl;

R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or

a compound of formula III:

III wherein, independently for each occurrence,

X is -O-, -N(R a )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -; Y is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -; Z is -O-, -N(R a )-, -C(R a ) 2 -, -C(=O)- 5 -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -; R a is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl; Ri is aryl;

R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

26. The method of claim 25, wherein X is -C(=O)-, -N(H)-, -S- or -S(=O) 2 -. 27. The method of claim 25, wherein Y is -C(=O)-, -N(H)- or -CH 2 -. 28. The method of claim 25, wherein Z is -CH(CH 3 )-. 29. The method of claim 25, wherein R 2 is hydrogen. 30. The method of claim 25, wherein R 3 is hydrogen.

31. The method of claim 25, wherein R 4 is hydrogen.

32. The method of claim 25, wherein R 2 is hydrogen; R 3 is hydrogen; and R 4 is hydrogen.

33. The method of claim 24, wherein the agent is a compound of formula IV:

rv wherein, independently for each occurrence,

X is -O-, -N(R a )-, -C(R a ) 2 -, -CC=O)-, -CC=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Y is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-,

Z is -O-, -NCRa)-, -C(R a ) 2 -, -C(=O)-, -CC=S)-, -S-, -SC=O)- or -SC=O) 2 -;

R 3 is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl;

Ri is aryl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxide;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 5 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 6 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl,, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; provided that when X is -C(=O)-; Y is -N(H)-; Z is -CH(CH 3 )-; R 3 is hydrogen; R 4 is hydrogen; and R 6 is hydrogen; R 5 is not hydroxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or a compound of formula V:

V wherein, independently for each occurrence,

X is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(=O)-, -C(=NRb)-, -C(=S)-, -S-, -S(=O)- or -SC=O) 2 -;

Y is -O-, -N(R 3 )-, -C(Ra) 2 -, -CC=O)-, or -S(=O) 2 -;

Z is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-,

R a is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl;

Ri is aryl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl,

carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 5 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

Re is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or a compound of formula VI:

VI wherein, independently for each occurrence,

X is -O-, -N(R 3 )-, -C(R a ) 2 -, -S-, -SC=O)- or -SC=O) 2 -; Y is -O-, -N(R 3 )-, -C(R a ) 2 -, -CC=O)-, or -SC=O) 2 -; Z is -O-, -NCRa)-, -C(Ra) 2 -, -CC=O)-, -CC=NRbK -CC=S)-, -S-, -SC=O)- or -SC=O) 2 -; R 3 is hydrogen, alkyl, aryl, or aralkyl;

Rb is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl; R] is aryl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 5 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

Re is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers .

34. The method of claim 33, wherein X is -C(=O)-, -N(R 3 )-, -S- or -S(=O) 2 -.

35. The method of claim 33, wherein X is -C(=O)-, -N(H)-, -S- or -S(=O) 2 -. 36. The method of claim 33, wherein Y is -C(=O)-, -N(R 3 )- or -C(R a ) 2 --

37. The method of claim 33, wherein Y is -C(=O)-, -N(H)- or -CH 2 -.

38. The method of claim 33, wherein Z is -C(Ra) 2 --

39. The method of claim 33, wherein Z is -CH(R 3 )-; and R a is alkyl.

40. The method of claim 33, wherein Z is -CH(CH 3 )-. 41. The method of claim 33, wherein R 3 is hydrogen, R 4 is hydrogen, R5 is hydroxyl and/or Rg is hydrogen. 42. The method of claim 33, wherein R 5 is hydroxyl; and Re is hydrogen.

43. The method of claim 33, wherein R 5 is hydroxyl; R 6 is hydrogen; and R 4 is hydrogen.

44. The method of claim 33, wherein R 5 is hydroxyl; R 6 is hydrogen; R 4 is hydrogen; and R 3 is hydrogen. 45. The method of claim 33, wherein R 5 is hydroxyl; R 6 is hydrogen; R 4 is hydrogen; R 3 is hydrogen; Z is -CH(R a )-; and R a is alkyl.

46. The method of claim 33, wherein R 5 is hydroxyl; R 6 is hydrogen; R 4 is hydrogen; R 3 is hydrogen; and Z is -CH(CHs)-.

47. The method of claim 24, wherein the agent is a compound of formulaVII:

VII wherein, independently for each occurrence, X is -N(H)-, -C(=O)-, -S- or -S(=O) 2 -; Y is -N(H)-, -CH 2 - or -C(=O)-; R 5 is hydrogen, hydroxyl or alkoxyl; provided that when X is -C(=O)-; and Y is -N(H)-; R 5 is not hydroxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or a compound of formula VIII:

VIII wherein, independently for each occurrence, X is -N(H)-, -C(=O)-, -S- or -S(=O) 2 -; Y is -N(H)-, -CH 2 - or -C(=O)-;

R. 5 is hydrogen, hydroxyl or alkoxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or a compound of formula IX:

IX wherein, independently for each occurrence, X is -N(H)-, -C(=O)-, -S- or -SC=O) 2 -; Y is -N(H)-, -CH 2 - or -C(=O)-;

R. 5 is hydrogen, hydroxyl or alkoxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

48. The method of claim 47, wherein R 5 is hydroxyl. 49. The method of claim 47, wherein R 5 is hydroxyl; X is -C(=O)-; and Y is -N(H)-.

50. The method of claim 47, wherein R 5 is hydroxyl; X is -N(H)-; and Y is -C(=O)-.

51. The method of claim 47, wherein R 5 is hydroxyl; X is -S-; and Y is -CH 2 -.

52. The method of claim 47, wherein R 5 is hydroxyl; X is -S(=O) 2 -; and Y is -N(H)-.

53. The method of claim 47, wherein the compound is a single enantiomer or steroisomer.

54. The method of claim 24, wherein the agent is a compound of formula X:

X wherein, independently for each occurrence,

Ri is aryl;

R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; provided that when R 2 is hydrogen; R 3 is hydrogen; and R4 is

-C(=O)NHCH(CH 3 )Ph; Ri is not and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers; or a compound of formula XI:

XI wherein, independently for each occurrence, R 4 is -C(=O)OR a , -C(=O)N(R a ) 2 or -CN; R a is hydrogen, alkyl, aryl, or aralkyl; provided that R 4 is not -C(=O)NHCH(CH 3 )Ph; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

55. The method of claim 54, wherein R 4 is -C(=O)OEt, -C(=O)OH, -C(=O)NH 2 or -CN.

56. The method of claim 24, wherein the agent is a compound of formula XII:

XII wherein, independently for each occurrence, A is O 5 S or N(R 1 );

X is C(R) 2 ; Y is N or C(R);

W is -(CH 2 ) P N(R')C(=O)R", -(CH 2 ) P C(=O)OR" or -(CH 2 ) P C(=O)N(R') 2 ; R is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R' is hydrogen, alkyl, aralkyl, or -C(=O)R"; R" is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; p is 0, 1, 2 or 3; and the stereochemical configuration at any stereocenter is R, S, or a mixture of these configurations. 57. The method of claim 24, wherein the agent is a compound of formula XIlI:

XIII wherein, independently for each occurrence,

X Is C(R) 2 ;

W is -(CH 2 ) P C(=O)R", -(CH 2 ) P C(=O)OR" or -(CH 2 ) P C(=O)N(R') 2 ;

R is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 1 is hydrogen, alkyl, aralkyl, or -C(=O)R";

R" is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclo alkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; p is 0, 1, 2 or 3; and the stereochemical configuration at any stereocenter is R, S, or a mixture of these configurations.

58. The method of claim 24, wherein the agent is a compound of formula XIV:

XIV wherein, independently for each occurrence, Z is -OR" or -N(RO 2 ;

R is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R' is hydrogen, alkyl, aralkyl, or -C(=O)R";

R" is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; and the stereochemical configuration at any stereocenter is R, S, or a mixture of these configurations.

59. The method of any one of claims 1-58, further comprising administering a second agent to the subject.

60. The method of claim 59, wherein the second agent is a compound of any one of claims 1-58 that is different from the first agent.

61. The method of claim 59, wherein the second agent is a chemo therapeutic agent.

Description:

ADP-RIBOSYLTRANSFERASE BASED METHODS AND COMPOSITIONS

Cross-reference to related applications This application claims the benefit of U.S. Provisional Application No. 60/836,008, filed August 7, 2006, and U.S. Provisional Application No. 60/836,035, filed August 7, 2006, the content of each of which is specifically incorporated by reference herein in its entirety.

Governmental Support

This invention was made with government support under Grant numbers ROl AG19719, ROl AG19972 and 2T3HL007627-21 awarded by the National Institutes of Health. The government has certain rights in this invention.

Background

Normal tissue homeostasis is achieved by an intricate balance between the rate of cell proliferation and cell death. Disruption of this balance either by increasing the rate of cell proliferation or decreasing the rate of cell death can result in the abnormal growth of cells and is thought to be a major event in the development of cancer, as well as other cell proliferative disorders such as restenosis.

The effects of cancer are catastrophic, causing over half a million deaths per year in the United States alone. Conventional strategies for the treatment of cancer include chemotherapy, radiotherapy, surgery or combinations thereof, however further advances in these strategies are limited by lack of specificity and excessive toxicity to normal tissues. In addition, certain cancers are refractory to treatments such as chemotherapy, and some of these strategies such as surgery are not always viable alternatives.

Prostate cancer is the most common non-skin cancer in America. Predictions estimated that in 2006, over 232,000 men would be diagnosed with prostate cancer, and over 30,000 men would die from it. One new case occurs every 2.5 minutes and a man dies from prostate cancer every 17 minutes.

There is also a need for identifying compounds which are effective at low doses in inhibiting excessive cell proliferation.

Summary

Provided herein are methods for identifying agents that modulate, e.g., stimulate or inhibit sirtuin proteins that are ADP-ribosyltransferases, referred to herein as "sirtuin ADP- ribosyltransferases" or "sirtuin ribosyltransferases." Other methods described herein may be used for identifying targets of the sirtuin ribosyltransferases. Agents that modulate the activity of sirtuin ribosyltransferases may be used as therapeutics for treating or preventing cancer, ischemia-reperfusion injury, and other disorders, as well as delaying the aging process.

Also provided herein are methods for treating or preventing a hyper-proliferating disease in a subject. A method may comprise administering to a subject in need thereof a therapeutically effective amount of an agent that decreases the level of protein or activity of a sirtuin ribosyltransferase, e.g., Sirtβ, protein or inhibits a sirtuin ribosyltransferase, e.g., Sirtό, dependent ribosylation pathways. A hyper-proliferating disease may be cancer, such as prostate cancer or a skin cancer, or benign cancer, or a non-cancerous cellular growth. An agent for use in the therapeutic or prophylactic methods may be a small molecule, e.g., a compound of any of formulas I-XI. An agent may also be an siRNA, antisense molecule, triplex DNA, antibody, aptamer, dominant negative mutant of Sirt6 or a substrate of Sirtό or functional homolog thereof.

Methods may further comprise administering to a subject a second agent, e.g., a second compound of any of formulas I-XI, or other chemotherapeutic agent.

Brief description of the drawings

Figure l is a diagram of an exemplary method for identifying agents that modulate sirtuin ribosyltransferase activity or for identifying targets of these enzymes. Figure 2, panels A, B and C, shows a strategy for isolation of ribosylation targets.

Figure 3 is an exemplary biotin-labeled NAD+ molecule. Figure 4, panels A and B, shows SIRT6 knockdown in TRAMPC2 cells. Figure 5, panels A-D, shows that inhibition of SIRT6 dramatically reduces focus or anchorage dependent colony formation of prostate cancer cells, as assessed by growing a fixed number of cells in culture and subsequently staining with Crystal Violet dye.

Figure 6, panels A-C, shows that inhibition of SIRT6 reduces colony growth of prostate cancer cells in soft agar.

Figure 7 is a histogram showing the focus formation assay results of Figure 5.

Figure 8 shows the size of tumors resulting from injection into a xenograft model of prostate cancer cells transfected with vector alone or cells in which Sirtό expression is downregulated.

Figure 9 is a histogram showing the percent invasion of RS485 prostate cancer cells in which SIRTl, SIRT6 or SIRT7 is either down-regulated or overexpressed.

Figure 10 shows the level of SIRT6 protein via Western Blot (panel A) or mRNA via RT-PCR (panel B) in TRAMP prostate cells in which SIRT6 was stably knocked down with an hsRNA based on the SIRT6 nucleotide sequence shown in panel C.

Figure 11 panels A, B and C show that knockdown of SIRT6 suppresses cell migration and invasion (two markers for metastasis).

Figure 12 show the results of microarray analysis, which indicate that several genes involved in cellular migration are modified in SIRT6 knockdown cells. The genes are listed in the order in which they were in the cluster analysis. A few fold changes from the original data are provided for reference. Figure 13 show the results of microarray analysis, which indicate that several genes involved in cell motility are modified in SIRT6 knockdown cells. The genes are listed in the order in which they were in the cluster analysis. A few fold changes from the original data are provided for reference.

Figure 14 show the results of microarray analysis, which indicate that several genes involved in chemotaxis are modified in SIRT6 knockdown cells. The genes are listed in the order in which they were in the cluster analysis. A few fold changes from the original data are provided for reference.

Figure 15 is a histogram showing that several signaling pathways are reduced in SIRT6 knockdown TRAMP cells. Figure 16 is a diagram of an exemplary method for identifying agents that modulate sirtuin ribosyltransferase activity or for identifying targets of these enzymes.

Figure 17, panels A and B, is a diagram of an exemplary method for identifying agents that modulate sirtuin ribosyltransferase activity.

Figure 18 shows the structure of sirtinol analogues described herein. Detailed description

Described herein are methods for identifying agents that modulate ADP- ribosyltransferases, as well as uses of agents that modulate these enzymes.

Both poly- and mono- AD ribosyltransferases comprise an important subclass of enzymes which have been linked to cancer, ischemia-reperfusion injury and the aging process. Members of the sirtuin class of enzymes (Sirt 4 and Sirt 6) have recently been identified as ADP-ribosyltransferases.

Exemplary methods for identifying modulators of sirtuin ADP-ribosyltransferases

Sirtuins are class III histone/protein deacetylases (Brachmann et al. (1995) Genes Dev. 9:2888 and Frye et al. (1999) BBRC 260:273). Some of the sirtuins, in particular, Sirt4 and Sirtβ are ribosyl transferases, in particular, mono-ADP-ribosyltransferases (see Liszt et al. (2005) J. Biol. Chem. 280:21313 regarding Sirtό). Sirt7 is an activator of Poll (Ford et al. (2006) Genes & Dev. 20:1075), however, it is also likely to be a ribosyltransferase. The mono-ADP-ribosyltransferase reaction is set forth in Corda and Girolamo (2003) EMBO J. 22:1953. Briefly, a mono-ADP-ribosyltransferase catalyzes the reaction in which the ribosyl group from βNAD + is transferred onto an amino acid, e.g., arginine or lysine, residue of a target or acceptor protein, thereby releasing nicotinamide.

A ribosyl may be transferred to a protein or peptide, generally referred to herein as a "target," "substrate" or "acceptor," which may be either a peptide, a polypeptide or a protein, or a modified form thereof. Targets of the ribosyltransferase activity of Sirt4 include glutamate dehydrogenase (GDH), the human version of which has the nucleotide and amino acid sequences set forth under GenBank Accession numbers NM 005271 and NP_005262, respectively.

Targets of the ribosyltransferase activity of Sirt6 proteins include histones, e.g., core histones (see Liszt et al., infra). Another target protein is nucleoplasmin, also referred to as nucleophosmin, nucleolar phosphoprotein B23, numatrin, and as chromatin decondensation protein. Nucleophosmin 1 isoform 1 is the predominant variant and represents the longest transcript and encodes the longest isoform (1). The nucleotide and amino acid sequences of the human isoform 1 are set forth in GenBank Accession numbers NM_002520 and NP_002511, respectively. Isoform 2 lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2) that lacks an internal segment, compared to isoform 1. The nucleotide and amino acid sequences of the human isoform 2 are set forth in GenBank Accession numbers NM_199185 and NP_954654, respectively. Isoform 3 utilizes an alternate 3'-terminal exon, compared to variant 1, resulting in a shorter protein (isoform 3) with a distinct C-terminus. The nucleotide and amino acid sequences of the

human isoform 3 are set forth in GenBank Accession numbers NM__001037738 and NP_001032827, respectively. All three isoforms comprise a conserved domain located between amino acids 113-116 (pfam03066). Another target protein of Sirtό is Alternative Reading Frame (ARF) protein, which is a tumor suppressor, as well as p53. The ink4a/arf locus encodes two cell cycle regulatory proteins - the cyclin-dependent kinase inhibitor (pl6(ink4a)), and the p53 activator (ARF), The nucleotide and amino acid sequences of human pl6(ink4a) are set forth in GenBank Accession Nos. AF115544 and AAD11437, respectively, and those of human p53 are set forth in GenBank Accession Nos. NM_000546 and NP_000537, respectively. Yet another target is a sirtuin itself, e.g., Sirtό, since it has been shown that Sirtό may auto-ribosylate (Liszt et al. > infra).

Table 1 provides GenBank Accession numbers for Sirt4, Sirtό and Sirt 7 proteins and nucleic acids of various species. Human Sirt nucleic acids and proteins are referred to as "SIRT."

Table 1: Sirt4, 6 and 7 nucleotide and amino acid sequences from various species Sirtuin Species Nucleotide sequence Amino acid sequence GenBank SEO ID NO GenBank SEO ID

NO

Sirt4 human NM 012240 NP 036372

Sirtό human NM_016539; NP_057623

AF233396 mouse NM_181586; NP_853617

BC052763 rat NMJ)Ol 031649; NP_001026819

BC098923 Xenopus NM_204022; NP_989353

BC064193

Drosophila NMJ.41733 NP_649990 S. cerevisiae NM_001039320; NP_001034409

AJ719316

Sirt7 human NM 016538 NP 057622

Exemplary methods for identifying modulators of sirtuin ribosyltransferases

A method for identifying an agent that modulates the activity of a sirtuin ribosyltransferase may be a cell based or a cell-free assay. A cell free assay may comprise (i) combining a sirtuin ribosyltransferase or a functional homolog thereof with a sirtuin ribosyltransferase target, labeled NAD+ and a test agent; and (ii) detecting labeled target. A difference in the amount of labeled target in a reaction mixture comprising the test agent relative to the amount of labeled target in a reaction mixture that does not comprise the test agent indicates that the test agent modulates the activity of a sirtuin ribosyltransferase. A difference in amount may be a factor of at least about 50%, 2 fold, 3 fold, 5 fold, 10 fold, 30 fold, 50 fold or more. If the amount of label in the presence of the test agent is higher relative to the absence of the test agent, the test agent is an agent that stimulates the activity of a sirtuin ribosyltransferase. If the amount of label in the presence of the test agent is lower relative to the absence of the test agent, the test agent is an agent that inhibits the activity of a sirtuin ribosyltransferase. The reagents used in an assay for identifying modulators of sirtuin ribosyltransferases may be added simultaneously or sequentially in a reaction mixture. For example, the enzyme and NAD+ may be combined first, followed by the addition of the test agent and then the target peptide.

One technique may utilize a substrate-linked immunosorbent assay (SLISA). In brief, a SIRT6 substrate, or SIRT6 itself (to assess auto-ADP-ribosylation activity), may be covalently linked to a solid support matrix present in each well of a multiwell, e.g., 96-well, plate. Various techniques may be applied to cross-link the SIRT6 substrate to the plate to render it immobile, including simple absorption of the protein to the plastic surface.

In the case where activity is being assayed on an external substrate (not auto- ADP- ribsosylation), recombinant SER.T6 may be added to each well (in the presence or absence of potential chemical activators/inhibitors) in ribosylation buffer (Liszt et al. J. Biol. Chem., June 3, 2005; 280(22): 21313 - 21320), supplemented with a 1:10 dilution of FITC- NAD (6- Fluorescein- 17-nicotinamide-adenine-dinucleotide) (available from Trevigen: 4673-500-01). SIRT6 will catalytically transfer an ADP-ribose-FITC fluorometric moiety onto the target molecule. In the case where auto- ADP ribosylation of SIRT6 itself is being assayed, SIRT6 may be covalently bound on the sorbent matrix, and ribosylation buffer + NAD-FITC may be added in solution (in addition to any chemical agents being tested).

Following an incubation time sufficient for allowing the reaction to take place, e.g., 1 hour, at 37 0 C, the liquid contents of each well may be aspirated off to remove any un- reacted NAD-FITC. The 96-well plate may be washed 3x in ribosylation buffer. Subsequently, the amount of covalently labeled substrate, may be assessed using a fluorometric spectrophotometer (see, e.g., Trevigen product information for appropriate excitation/emission wavelengths). The intensity of the signal will be proportional to the activity of SIRT6 under the defined conditions (activators/inhibitors). A standard curve using different amounts of STRT6 protein can also be constructed.

The aforementioned assay may be used to screen for chemical activators and inhibitors of SER.T6 ADP-ribosylation activity. It can be used to examine both intrinsic auto- ADP ribosylation of SIRT6 itself, and external protein targets, depending on which variation of the assay is used.

Exemplary assays are set forth in Figures 1, 15 and 16.

A sirtuin ribosyltransferase may be any sirtuin having ribosyltransferase activity, e.g., Sirt4, 6 and 7. A homolog of a sirtuin ribosyltransferase includes proteins (e.g., peptides and polypeptides) comprising, consisting essentially of, or consisting of an amino acid sequence that has at least about 70%, 80%, 90%, 95%, 98% or 99% identity with the amino acid sequence of a sirtuin ribosyltransferase. A homolog may also be a protein that is encoded by a nucleic acid comprising, consisting essentially of, or consisting of a nucleotide sequence that has at least about 70%, 80%, 90%, 95%, 98% or 99% identity with a nucleotide sequence encoding a sirtuin ribosyltransferase or the coding sequence thereof. A homolog may also be a protein that is encoded by a nucleic acid that hybridizes, e.g., under stringent hybridization conditions, to a nucleic acid encoding a sirtuin ribosyltransferase, or the coding sequence thereof. The term "percent identical" refers to sequence identity between two amino acid sequences or between two nucleotide sequences. Identity can each be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar amino acid residue (e.g., similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology, similarity, or identity refers to a function of the number of identical or similar amino acids at positions shared by the

compared sequences. Expression as a percentage of homology, similarity, or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. Various alignment algorithms and/or programs may be used, including FASTA, BLAST, or ENTREZ. FASTA and BLAST are available as a part of the GCG sequence analysis package (University of Wisconsin, Madison, Wis.), and can be used with, e.g., default settings. ENTREZ is available through the National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Md. In one embodiment, the percent identity of two sequences can be determined by the GCG program with a gap weight of 1, e.g., each amino acid gap is weighted as if it were a single amino acid or nucleotide mismatch between the two sequences.

Other techniques for alignment are described in Methods in Enzymology, vol. 266: Computer Methods for Macromolecular Sequence Analysis (1996), ed. Doolittle, Academic Press, Inc., a division of Harcourt Brace & Co., San Diego, California, USA. Preferably, an alignment program that permits gaps in the sequence is utilized to align the sequences. The Smith- Waterman is one type of algorithm that permits gaps in sequence alignments. See Meth. MoI. Biol. 70: 173-187 (1997). Also, the GAP program using the Needleman and Wunsch alignment method can be utilized to align sequences. An alternative search strategy uses MPSRCH software, which runs on a MASPAR computer. MPSRCH uses a Smith-Waterman algorithm to score sequences on a massively parallel computer. This approach improves ability to pick up distantly related matches, and is especially tolerant of small gaps and nucleotide sequence errors. Nucleic acid-encoded amino acid sequences can be used to search both protein and DNA databases.

For example, homologs may be encoded by nucleic acids that hybridize under high stringency conditions of 0.2 to 1 x SSC at 65 0 C followed by a wash at 0.2 x SSC at 65 0 C to a nucleic acid encoding a sirtuin ribosyltransferase. Nucleic acids that hybridize under low stringency conditions of 6 x SSC at room temperature followed by a wash at 2 x SSC at room temperature to nucleic acid encoding a sirtuin ribosyltransferase or a portion thereof can be used. Other hybridization conditions include 3 x SSC at 40 or 50 0 C, followed by a wash in 1 or 2 x SSC at 20, 30, 40, 50, 60, or 65 0 C. Hybridizations can be conducted in the presence of formaldehyde, e.g., 10%, 20%, 30% 40% or 50%, which further increases the stringency of hybridization. Theory and practice of nucleic acid hybridization is described, e.g., in S. Agrawal (ed.) Methods in Molecular Biology, volume 20; and Tijssen (1993)

Laboratory Techniques in biochemistry and molecular biology-hybridization with nucleic acid probes, e.g., part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, New York provide a basic guide to nucleic acid hybridization. Homologs of sirtuin ribosyltransferases may also be analogs, e.g., that differ from the naturally occurring protein by conservative amino acid sequence differences or by modifications that do not affect sequence, or by both. Any number of procedures may be used for the generation of mutant, derivative or variant forms of a protein of interest using recombinant DNA methodology well known in the art such as, for example, that described in Sarnbrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York) and Ausubel et al. (1997, Current Protocols in Molecular Biology, Green & Wiley, New York).

For example, conservative amino acid changes may be made, which do not normally or significantly alter its function. Conservative amino acid substitutions typically include substitutions within the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine (in positions other than proteolytic enzyme recognition sites); phenylalanine, tyrosine.

Homologs of a sirtuin ribosyltransferase also include portions or fragments of a naturally occurring sirtuin ribosyltransferase or homolog thereof, such as portions comprising one or more conserved domains, e.g., the catalytic domain that sirtuin ribosyltransferases share with the other sirtuins (Frye et al. (1999) Biochem. Biophys. Res. Comm. 260:273 and Liszt et al, infra). The catalytic domain of human Sirt4 (SIRT4) corresponds to about amino acids 55-314 of SEQ ID NO: 2 (Frye et al. (1999) BBRC 260:273. The catalytic domain of human Sirt6 (SIRT6) corresponds to about amino acids 45 to 271 of SEQ ID NO: 4 (see Liszt et al., infra).

A "functional homolog" of a sirtuin ribosyltransferase refers to a homolog of sirtuin ribosyltransferase having at least one biological activity of the protein, e.g., ribosyltransferase activity or deacetylase activity. Whether a homolog is a functional homolog can be determined according to methods known in the art. For example, a ribosyl transferase activity can be determined as further described herein.

An exemplary functional homolog of SIR.T6 comprises, consists essentially of, or consists of an amino acid sequence that is at least about 80%, 95%, 90%, 95%, 96%, 97%, 98%, or 99% identical to the amino acid sequence set forth as SEQ ID NO: 4 or of a portion

thereof, wherein the functional homolog has ribosyltransferase activity. In certain embodiments, a functional homolog of Sirt6 is not the full length Sirtβ protein and may lack from about 1-5, 1-10, 1-15, 1-20, 1-25, 1-50 or more amino acids at the N- and/or C- terminus of the protein. In one embodiment, a functional homolog of SIRT6 comprises, consists essentially of, or consists of about amino acids 45 to 271 of SEQ ID NO: 4, which functional homolog may in certain embodiments, not comprise about amino acids 1-10, 1- 20, 1-30, 1-40 or 1-44 and/or about amino acids 272-355, 275-355, 280-355, 300-355, 320- 355 or 330-355 of SEQ ID NO: 4.

A sirtuin ribosyltransferase target for using in an assay may be a full length target protein, e.g., a sirtuin, a nucleoplasmin, ARF, p53 or GDH. It may also be a functional homolog thereof, e.g., a homolog of a naturally occurring target or a fragment thereof that is sufficient for receiving a ribosyl group. A "homolog" of a sirtuin ribosyltransferase target may be any protein that differs from a sirtuin ribosyltransferase target protein in the same manner as described above in the context of a sirtuin ribosyltransferase, e.g., a protein that is a fragment of a target protein and/or that has a certain percentage identity to it. For example, a target may comprise or consist of 1-5 amino acids, about 5-10, about 10-15, about 15-20, about 20-25, about 25-30, about 11-40 amino acids, more than 30 amino acids, about 1-50, about 1-100, about 1-150 or 1-200 amino acids, wherein the target comprises a lysine and/or an arginine. A target may lack about 1-5, 1-10, 1-15, 1-20, 1-30, 1-50 or more amino acids from the N- and/or C-terminus of the naturally occurring target.

"Labeled NAD + " or "tagged NAD + " refers to an NAD + molecule that is labeled on one or more atoms of its ribosyl group, such that if the ribosyl portion of the NAD + molecule is transferred onto a target protein, the target protein becomes labeled. An NAD + molecule may be labeled with any type of label, e.g., one that is directly detectable or one that is indirectly detectable, such as further described herein. Exemplary labeled NAD + molecules include ό-biotin-^-nicotinamideadenine-dinucleotide, 6-biotin-10- nicotinamideadenine-dinucleotide and S-biotin-δ-nicotinamideadenine-dinucleotide. Labeled NAD + molecules may be prepared and at least some are also commercially available. For example, biotinylated NAD + is available from Trevigen and R&D systems. A label may be a detectable label, e.g., a molecule capable of detection, including, but not limited to, fluorophores, chemiluminescent moieties, enzymes, enzyme substrates, enzyme cofactors, enzyme inhibitors, dyes, metal ions, ligands (e.g., biotin or haptens) and the like.

The label may be isotopic or nonisotopic. By way of example, the label can be a part of a catalytic reaction system such as enzymes, enzyme fragments, enzyme substrates, enzyme inhibitors, coenzymes, or catalysts; part of a chromogen system such as fiuorophores, dyes, chemiluminescers, luminescers, or sensitizers; a dispersible particle that can be non-magnetic or magnetic, a solid support, a liposome, a ligand, a receptor, a hapten radioactive isotope, and so forth. "Fluorophore" refers to a substance or a portion thereof that is capable of exhibiting fluorescence in the detectable range. Particular examples of labels that may be used include fluorescein, rhodamine, dansyl, umbelliferone, Texas red, luminol, NADPH, α-galactosidase, β-galactosidase and horseradish peroxidase, europium cryptate and a 105 kDa phycobiliprotein.

The enzyme or coenzyme employed provides the desired amplification by producing a product, which absorbs light, e.g., a dye, or emits light upon irradiation, e.g., a fluorescer. Alternatively, the catalytic reaction can lead to direct light emission, e.g., chemiluminescence. A large number of enzymes and coenzymes for providing such products are indicated in U.S. Pat. No. 4,275,149, columns 19 to 23, and U.S. Pat. No.

4,318,980, columns 10 to 14. A number of enzyme combinations are set forth in U.S. Pat. No. 4,275,149, columns 23 to 28, which combinations can find use in the subject invention. When enzymes are employed, molecular weights of the marker typically range from about 10,000 to 600,000 Da, more usually from about 10,000 to 300,000 Da, and the involved reactions will be, for the most part, hydrolysis or redox reactions. Of particular interest are enzymes that involve the production of hydrogen peroxide and the use of the hydrogen peroxide to oxidize a dye precursor to a dye. Particular combinations include saccharide oxidases, e.g., glucose and galactose oxidase, or heterocyclic oxidases, such as uricase and xanthine oxidase, coupled with an enzyme which employs the hydrogen peroxide to oxidize a dye precursor, that is, a peroxidase such as horse radish peroxidase, lactoperoxidase, or microperoxidase.

When a single enzyme is used as a marker, such enzymes that may find use are hydrolases, transferases, lyases, isomerases, ligases or synthetases and oxidoreductases, preferably, hydrolases. Alternatively, luciferases may be used such as firefly luciferase and bacterial luciferase. Exemplary enzymes, based on the I.U.B. classification are: Class 1. oxidoreductases and Class 3. Hydrolases; particularly in Class 1, the enzymes of interest are dehydrogenases of Class 1.1, more particularly 1.1.1, 1.1.3, and 1.1.99 and peroxidases, in

Class 1.11. Of the hydrolases, particularly Class 3.1, more particularly 3.1.3 and Class 3.2, more particularly 3.2.1.

Illustrative dehydrogenases include malate dehydrogenase, glucose-6-phosphate dehydrogenase, and lactate dehydrogenase. Of the oxidases, glucose oxidase is exemplary. Of the peroxidases, horse radish peroxidase is illustrative. Of the hydrolases, alkaline phosphatase, beta-glucosidase and lysozyme are illustrative.

The label can also be fluorescent either directly or by virtue of fluorescent compounds or fluorescers bound to a particle or other molecule in conventional ways. The fluorescent labels will be bound to, or functionalized to render them capable of binding (being conjugated) to, optionally through a linking group, NAD+.

The fluorescers of interest will generally emit light at a wavelength above about 350 nm, usually above about 400 run and preferably above about 450 ran. Desirably, the fluorescers have a high quantum efficiency, a large Stokes shift, and are chemically stable under the conditions of their conjugation and use. The term luminescent marker or label is intended to include substances that emit light upon activation by electromagnetic radiation, electro chemical excitation, or chemical activation and includes fluorescent and phosphorescent substances, scintillators, and chemiluminescent substances.

Fluorescers of interest fall into a variety of categories having certain primary functionalities. These primary functionalities include 1- and 2-aminonaphthalene, p,p- diaminostilbenes, pyrenes, quaternary phenanthridine salts, 9-aminoacridines, p,p'- diaminostilbenes imines, anthracenes, oxacarboxyanine, merocyanine, 3-aminoequilenin, perylene, bis-benzoxazole, bis-p-oxazolyl benzene, 1,2-benzophenazine, retinol, bis-3- aminopyridinium salts, hellebrigenin, tetracycline, sterophenol, benzimidazolylphenylamine, 2-oxo-3-chromen, indole, xanthene, 7-hydroxycoumarin, 4,5- benzimidazoles, phenoxazine, salicylate, strophanthidin, porphyrins, triarylmethanes, flavin and rare earth chelates, oxides, and salts. Exemplary fluorescers are enumerated in U.S.

Pat. No. 4,318,707, columns 7 and 8.

A label or marker may be a chemiluminescent compound. The chemiluminescent source involves a compound, which becomes electronically excited by a chemical reaction and may then emit light which serves as the detectable signal or donates energy to a fluorescent acceptor. A diverse number of families of compounds have been found to provide chemiluminescence under a variety of conditions. One family of compounds is 2,3- dihydro-l,4-phthalazinedione. The most popular compound is luminol, which is the 5-

amino analog of the above compound. Other members of the family include the 5-amino- 6,7,8-trimethoxy- and the dimethylamine-[ca]benzo analog. These compounds can be made to luminesce with alkaline hydrogen peroxide or calcium hypochlorite and base. Another family of compounds is the 2,4,5-triphenylimidazoles, with lophine as the common name for the parent product. Chemi luminescent analogs include para-dimethylamino- and para- methoxy-substituents. Chemiluminescence may also be obtained with geridinium esters, dioxetanes, and oxalates, usually oxalyl active esters, e.g., p-nitrophenyl and a peroxide, e.g., hydrogen peroxide, under basic conditions. Alternatively, luciferins may be used in conjunction with luciferase or lucigenins. An assay may comprise using a reagent or an agent that is linked to a solid support or surface. In one embodiment, the target protein is linked covalently or not to a solid support. The method may then comprise determining the presence and/or amount of label that is linked to the solid support. The method may further comprise washing off any unbound labeled NAD+ prior to determining the presence or amount of label. An exemplary method is set forth in Fig. 1.

A solid support may be the inner surface of a reaction container (e.g., a reaction tube or a well of a microtiter plate). A solid phase is a porous or non-porous water insoluble material. The solid phase can be hydrophilic or capable of being rendered hydrophilic and includes inorganic powders such as silica, magnesium sulfate, and alumina; natural polymeric materials, particularly cellulosic materials and materials derived from cellulose, such as fiber containing papers, e.g., filter paper, chromatographic paper, etc.; synthetic or modified naturally occurring polymers, such as nitrocellulose, cellulose acetate, poly (vinyl chloride), polyacrylamide, cross linked dextran, agarose, polyacrylate, polyethylene, polypropylene, poly(4-methylbutene), polystyrene, polymethacrylate, poly(ethylene terephthalate), nylon, poly( vinyl butyrate), etc.; either used by themselves or in conjunction with other materials; glass available as Bioglass, ceramics, metals, and the like. Natural or synthetic assemblies such as liposomes, phospholipid vesicles, and cells can also be employed.

The surface can have any one of a number of shapes, such as strip, rod, particle, including bead, and the like. The surface will usually be polyfunctional or be capable of being polyfunctionalized or be capable of binding a reagent, e.g., a target, through specific or non-specific covalent or non-covalent interactions. A wide variety of functional groups for linking are known in the art. According to some embodiments, a reagent is attached by

using a suitable coupling agent, and in others by using appropriate linker substances, such as biotin and (strept)avidin. In some embodiments, the immobilization of a reagent is carried out after the incubation with one or more reagents, thereby allowing the reaction between the reagents to proceed in the liquid phase. For example, a target may be added to a reaction comprising a sirtuin ribosyltransferase or a functional homolog thereof, a labeled NAD+ and a test agent. Following the reaction, a solid surface can be added that will capture the target. Alternatively, the target may be linked to the surface when it is first added to the reaction.

The assay may further comprise rinsing steps, e.g., a step wherein the excess free labeled NAD+ is removed prior to the detection step. When the target is linked to a solid surface, it is sufficient to isolate the solid surface from the reaction mixture and wash the solid surface to remove any free labeled NAD+. Methods for removing free labeled NAD+ from labeled target when the target is not linked to a solid surface include methods based on size separation, such as chromatographic methods, as well as dialysis. Labeled target protein may be detected and/or measured by any manner that allows detection of the label. For example, detecting labeled target may comprise contacting the labeled target with a binding partner that recognizes the label. Usually, the binding partner carries a marker allowing its detection. In an illustrative embodiment, the binding partner is an antibody, e.g., a mouse antibody (either polyclonal or monoclonal) that binds specifically to the label, e.g., a goat anti-mouse IgG containing an enzyme moiety.

In the detection phase using an enzymatic label, a substrate for the label (e.g., enzyme) is added. To allow quantitative measurement of the target, the label's substrate solution is added for a time that should be sufficiently long to allow a substantial enzymatic conversion of the label's substrate into a measurable reaction product. After termination of the label's substrate-converting reaction, the intensity of the reaction product, which is proportional to the immobilized amount of the target, maybe measured, e.g., by optical means, such as a photometer that measures the absorbance at a proper wavelength.

In an illustrative embodiment, the method is a quantitative method to determine the concentration or amount of the target in the reaction. The method is not restricted to quantitative measurements, however, and may be useful to qualitatively determine the presence of labeled target.

In exemplary embodiments, the label is an enzyme and the detection means comprises a substrate of the enzyme. The method may be an immunoassay, e.g., an ELISA

method. A horseradish peroxidase may be used as the enzyme and 3,3'-diaminobenzidine as the substrate. However, the methods extend to other enzyme-substrate combinations capable of producing a precipitate, such as an alkaline phosphatase as the enzyme and 5- bromo-4-chloro-3-indolylphosphate and nitroblue tetrazolium as substrate. Further, methods include any other combination of label and detection means that is capable of producing a precipitate on a solid phase that carries said label. For example, formation of a precipitate may be the result of nucleation, by nucleated growth of metal, or non-metal particles, or the result of chain or polymerization reactions, of, e.g. unsaturated hydrocarbons which can be polymerized by exposure to ultraviolet radiation, etc. The label may comprise an unsaturated hydrocarbon and the detection means a further amount of the same or a different hydrocarbon together with means to initiate polymerization (such as UV radiation). Alternatively, the label could comprise colloidal particles of a metal, e.g. gold, silver, etc., or a non-metal, e.g. selenium, tellurium, carbon, silica, etc., while the detection means comprises a source of a further amount of the same or a different metal or non-metal, together with means (e.g. a suitable reducing agent, such as a borohydride compound, capable of liberating the metal from a chemical compound containing said metal) to promote growth of the colloidal particles used as the label.

An agent may be may be any type of molecule, such as a small molecule or a macromolecule, e.g., a nucleic acid, oligonucleotide, protein, peptide, peptide nucleic acids, peptidomimetics, carbohydrates, lipids, combination thereof. A "small molecule" may be a composition which has a molecular weight of less than about 2000 amu, or less than about 1000 amu, and even less than about 500 amu. Small molecules may be, for example organic (carbon containing) or inorganic molecules. The term "small organic molecule" refers to a small molecule that is often identified as being an organic or medicinal compound, and does not include molecules that are exclusively nucleic acids, peptides or polypeptides.

An agent may be a chemical compound, a mixture of chemical compounds, a biological macromolecule (such as a nucleic acid, an antibody, a protein or portion thereof, e.g., a peptide), or an extract made from biological materials such as bacteria, plants, fungi, or animal (particularly mammalian) cells or tissues. Agents may be identified as having a particular activity by screening assays described herein below. The activity of such agents may render it suitable as a "therapeutic agent" which is a biologically, physiologically, or

pharmacologically active substance (or substances) that acts locally or systemically in a subject.

Instead of using an agent in the assays described herein, one may also use a composition comprising more than one agent, e.g., 2, 3, 5, 10, 15, 20, 30, 50, 100 or more agents. Many pharmaceutical companies have extensive libraries of chemical and/or biological mixtures, often fungal, bacterial, or algal extracts, which can be screened with any of the assays described herein.

In another embodiment, a method for identifying an agent that modulates the ribosyltransferase activity of a sirtuin is a cell based assay. A method may comprise (i) contacting a cell expressing a sirtuin ribosyltransferase or a functional homolog thereof with labeled NAD+ and a test agent; and (ii) comparing the level of labeled proteins in a cell that was contacted with the test agent relative to a cell that was not contacted with the test agent. A different level of labeled proteins in a cell that was contacted with a test agent relative to a cell that was not contacted with a test agent indicates that the test agent is an agent that modulates the activity of a sirtuin ribosyltransferase. A difference in amount may be a factor of at least about 50%, 2 fold, 3 fold, 5 fold, 10 fold, 30 fold, 50 fold or more. If the amount of label in the presence of the test agent is higher relative to the absence of the test agent, the test agent is an agent that stimulates the activity of a sirtuin ribosyltransferase. If the amount of label in the presence of the test agent is lower relative to the absence of the test agent, the test agent is an agent that inhibits the activity of a sirtuin ribosyltransferase.

A cell may be any cell, e.g., a mammalian cell, such as a human cell, a murine cell, a rat cell, or a non-human simian cell. The cell may be a normal cell, a transformed cell, a cell in culture (e.g., of a cell line), a cell from a primary cell culture, or a stem cell. In one embodiment, the cell comprises a heterologous nucleic acid (one that is not naturally part of the cell) encoding the sirtuin ribosyltransferase or functional homolog thereof. The nucleic acid may be present in an integrated form in a chromosome of the cell or it may be present as an extrachromosomal nucleic acid, e.g., as an episome. The nucleic acid may be introduced into the cell by stable or transient transfection. The nucleic acid may be part of a plasmid or a vector, e.g., an expression vector. The portion encoding the sirtuin ribosyltransferase or functional homolog thereof may be under the control of an endogenous or exogenous promoter and/or enhancer and/or other regulatory element. An "endogenous" regulatory element refers to a regulatory element that is part of the cell,

whereas an "exogenous" or "heterologous" regulatory element refers to a regulatory element that is not part of the cell, but that is part of a nucleic acid that was introduced into the cell. A regulatory element, e.g., a promoter or enhancer, may be constitutive or inducible. Inducible promoters include those that are inducible by heavy metals, hormones, e.g., steroid hormones, and TetR.

A sirtuin ribosyltransferase or functional homolog thereof may be linked to a detectable tag, allowing its detection and/or isolation. Exemplary tags include any peptide for which an antibody is available; polyhistidine tags; and myc tags. Labels further described herein may also be used. A sirtuin ribosyltransferase or functional homolog thereof may be expressed at a level that is essentially normal for a cell, i.e., the level at which a cell normally expresses a sirtuin ribosyltransferase. Alternatively, the sirtuin ribosyltransferase or functional homolog thereof may be over-expressed, e.g., expressed at least 50%, 2 fold, 3 fold, 5 fold, 10 fold or more relative to the normal level of expression of the sirtuin ribosyltransferase in a cell.

A cell based screening method may comprise contacting a cell expressing a sirtuin ribosyltransferase with a test agent and labeled NAD+ simultaneously or consecutively (sequentially). For example, a cell may be contacted with a test agent and then with labeled NAD+. A screening method may also be conducted with a cell lysate or cell extract, instead of a cell. A cell lysate may be prepared from whole cells, or may be fractions of such lysates. A cell lysate or extract may comprise a sirtuin ribosyltransferase or functional homolog thereof. For example, a lysate may be prepared from a cell that comprises a heterologous nucleic acid encoding a sirtuin ribosyltransferase or a functional homolog thereof. Alternatively, a cell lysate or extract does not comprise a sirtuin ribosyltransferase or functional homolog thereof, and it is added to the lysate or extract.

In another embodiment, a screening assay is a fiuorimetric assay. In one embodiment, an assay comprises using a target peptide comprising a lysine or arginine residue located adjacent to a fluorescent group, e.g., dimethylcoumarin, and a trypsin cleavage site (see, e.g., Figure 17). Lysine and arginine are target amino acids for ribosylation by sirtuin ribosyltransferases. Trypsin cleaves peptides on the C-terminal side of lysine and arginine amino acid residues. The rate of hydrolysis is slower if an acidic residue is on either side of the cleavage site and no cleavage occurs if a proline residue is on

the carboxyl side of the cleavage site. Ribosylation of either amino acid prevents cleavage by trypsin. Target peptides may comprise stretches of amino acids around the site of ribosylation. The arginine or lysine that is modified may be immediately on the N-terminal side of the fluorescent group that is attached to the C-terminus of the peptide. Cleavage will liberate the labeled group. Since trypsin cleavage is necessary for obtaining a fluorescent signal, a reaction in which a target peptide is ribosylated will result in the lack of a fluorescent signal. On the other hand, if the reaction includes an inhibitor of the ribosylation, then a fluorescent signal is expected.

A fluorimetric assay may also be described as follows. A method for screening for potential activators/inhibitors of SIRT6 involves a target peptide which contains a fluorescent group (i.e. Dimethylcoumarin) adjacent to a target ribosylation lysine or arginine residue which may function as a trypsin cleavage site (K, R). This assay is based upon the principal that ribosylation of this target lysine or arginine residue by SIRT6 will block trypsin's ability to cleave the peptide. Cleavage of the peptide is required in order to observe a fluorescent signal. Structurally, the fluorescent moiety will be placed on the C- terminus of the peptide (which may be derived from a SHRT6 substrate - i.e. Histones). The output of the assay will be a fluorometric measurement - activity of SIRT6 will be inversely proportional to the amount of fluorescence (i.e. If SIRT6 is fully active, no cleavage will occur, and there will be no fluorescence). In brief, SIRT6 will be incubated with the aforementioned peptide construct in the presence of ribosylation buffer (Liszt et al., 2006) for a time sufficient for ribosylation, e.g., about one hour. Next, the reaction may be be stopped by heating at 90°C for about 10 minutes. The reaction will then be subject to a tryptic (or similar endroproteolytic) digest in accordance with the manufacturer's protocol, and quantified using one of the methods detailed herein. Exemplary target peptides for use in a fluorimetric assay may comprise about 1, 2,

3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, or from about 1, 2 or 3 to about 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 or more amino acids. A target peptide may also be from about 5 or from about 10 to about 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more amino acids. A lysine or arginine may be located at the last or second to last amino acid of the sequence. The fluorescent group may be attached to the last amino acid of the peptide, immediately adjacent to the lysine or arginine. In one embodiment, the amino acid sequence of the target peptide is that of a naturally occurring target peptide, e.g., a histone or Sirt6 for a Sirt6 target peptide; the second to last amino acid is a lysine or an arginine and the

fluorescent group is attached to the last amino acid. In another embodiment, the last amino acid of the peptide is an arginine or a lysine and the fluorescent group is linked to an amino acid that is linked immediately C-terminal to the arginine or lysine.

For example, the following peptides may be used for an assay using Sirt6 (the amino acid in parenthesis is an optional last amino acid of the peptide for linkage of the fluorescent group, which amino acid may be replaced by another): PEIFDPPEELER(K), corresponding to amino acids 21 to 33 of SEQ ID NO: 4; HGVWTMEER(G), corresponding to amino acids 68 to 77 of SEQ ID NO: 4; LQPTKHDR(H), corresponding to amino acids 241-249 of SEQ ID NO: 4. Based on the description herein, a person of skill in the art can design numerous target peptides that can be used in the assays described herein.

This arrangement is not necessary for the fluorescent polarization (FP) and mass spectrometry (MS) assays described herein.

Rather than directly measuring fluorescence of the aforementioned group, this technique could be modified to use fluorescent polarization (FP) or mass spectrometry. In these cases, the position of the attached group can be varied and does not need to be on the very end of the peptide. For FP, an FP group may be incorporated on the C-terminus. Shortening of the peptide by cleavage would result in a change in polarization. The Arg or lysine does not need to be adjacent, as long as the peptide becomes shorter when cleaved so it spins faster and alters polarization. The lysine or arginine may be placed about mid-way (although it may not be exactly centered, so as to generate different lengths peptides) within a peptide, e.g., of about 30-40 amino acids. The absence of ribosylation allows the peptide to be cleaved by trypsin, which results in faster spinning of the molecules because they are smaller, resulting in light depolarization or low fluorescence polarization. On the other hand, ribosylation of the target peptide results in the absence of cleavage by the enzyme, resulting in slower spinning of the molecules because they are larger, and emission of high fluorescence polarization. Again, activity of SIRT6 would be inversely proportional to the change in polarization (i.e. SER.T6 were completely active, there would be no change in polarization). With regards to Mass Spectrometry, quantifying these changes could be performed using standard mass spectrometric techniques.

An exemplary method may comprise contacting a sirtuin ribosyltransferase or a functional homolog thereof with a target peptide comprising an arginine or lysine residue located N-terminallyto and adjacent to a fluorescent group; NAD+ and a test agent. These

reagents are incubated for a time sufficient for the ribosyl group of NAD+ to be transferred onto a target peptide in the absence of the agent, e.g., about 1, 5, 10, 20, 30, 45, 60, 75, 90, or 120 minutes, with 60 minutes being preferred. The method further comprises adding to the reaction mixture trypsin that cleaves at the C-terminus of the arginine or lysine residue in the absence of ribosylation at the arginine or lysine residue. Trypsin is preferably added after incubation of the other reagents together, such that the peptide is not cleaved before it is ribosylated, if at all. The enzyme is incubated for a time sufficient for the enzyme to cleave essentially all of the target peptides that are not ribosylated, e.g., about 1, 5, 10, 20, 30, 45 or 60 minutes, with 10 minutes being preferred. The method then comprises determining the presence and/or amount of fluorescence. This can be done according to methods known in the art. The presence of a fluorescent signal that is above that obtained in a control reaction that does not include the test agent indicates that the test agent is an agent that inhibits the sirtuin ribosyltransferase. A lower amount of fluorescence in a reaction that was incubated with a test agent relative to a reaction that was not incubated with a test agent indicates that the test agent is an agent that stimulates the sirtuin ribosyltransferase.

The fluorescent group on the target peptide may be dimethylcoumarin, fluorescein, tetramethylrhodamine, Texas Red, as well as longer- wavelength dyes and others described herein. The fluorescent group could also be one that works in a fluorescent polarization (FP) assay, such as BOD EPY fluorescent dyes (InVitrogen).

In ceratin embodiments, an enzyme other than trypsin is used, in which case, the peptide must include an additional enzymatic cleavage site to be cleaved by the enzyme. An enzyme cleavage site may be a site that is recognized and cleaved by an enzyme, e.g., a restriction enzyme, e.g. a peptidase or protease that cleaves a peptide or protein at specific recognition sites. Exemplary peptidases and proteases include: aminopeptidase Y (also known as aminopeptidase Co; cobalt-activated aminopeptidase and lysyl aminopeptidase), clostripain (also known as clostridiopeptidase B), chymotrypsin, enterokinase, LysC lysyl endopeptidase (also known as Achromobacter proteinase I) and trypsin.

Another screening method comprises (i) contacting a cell expressing a sirtuin ribosyltransferase or a functional homolog thereof with labeled NAD+ and a test agent for an amount of time and under conditions appropriate for transfer of the ribosyl group of NAD+ onto a target protein in the absence of the test agent; and (ii) determining whether there is a difference between the number and/or amount of labeled proteins in a cell that

was contacted with a test agent relative to a cell that was not contacted with a test agent. The presence of a difference indicates that the test agent is an agent that modulates a rib osyl transferase. The assay may comprise examining all or most of the proteins in the cell, or a portion thereof, such as the proteins within a particular range of sizes. The assay may also comprise analyzing specific proteins, e.g., those that are known targets of sirtuin ribosyltransferases. Labeled proteins may be detected via Western blot and/or spectrometry or as further described herein. The cell may be any cell as further described herein, e.g., a cell comprising a heterologous nucleic acid encoding the sirtuin ribosyltransferase or functional homolog thereof. The assays described herein may be accompanied by control reactions. For example, when using a cell or a lysate from a cell that expresses a heterologous sirtuin ribosyltransferase, a control reaction may be a reaction using a cell or lysate of a cell that does not express a heterologous sirtuin ribosyltransferase. Such a control may indicate whether any difference in labeled target is specific to a sirtuin ribosyltransferase, as opposed to any other ribosyltransferase that may be present in a cell or lysate.

When any of the screening assays described herein are used on a test composition comprising a mixture of different molecules and the results indicate that the composition is a modulator of a sirtuin ribosyltransferase, the method may be followed by the fractioning or subfractioning of the composition. The same or a different screening assay may then be conducted on the one or more fractions of the composition. These steps may be repeated (or reiterated) until a sole agent has been identified. For example, the steps of screening and fractioning maybe repeated 2, 3, 5, 10, 25, 50, 100 times or more.

Screening assays may be conducted in any type of container or vial. For example, screening assays may be conducted in microtiter plates, e.g., 96 well plates.

Exemplary methods for identifying targets of sirtuin ribosyltransferases

Methods for identifying targets of sirtuin ribosyltransferases may be cell-based or cell-free methods.

A method for identifying a target protein of a sirtuin ribosyltransferase may comprise:

(i) contacting a sirtuin ribosyltransferase or a functional homolog thereof with a test peptide and labeled NAD+; and (ii) determining whether the test peptide is labeled, wherein the presence of label on the test peptide indicates that the test peptide is a target peptide of the

sirtuin deacetylase protein. A test peptide may be any peptide or protein comprising an arginine or a lysine. A test peptide may be about 10, 15, 20, 25, 30, 35, 40, 50 or more amino acids long. The arginine or lysine is preferably located at least about 1, 2, 3, 4, 5, 6,

7, 8, 9 or 10 amino acids from one or both ends of the peptide. Test peptides may be portions of proteins, e.g., naturally occurring proteins, or they may be artificial peptides, e.g., from a library. Test peptides may also be full length proteins.

Instead of using one peptide per reaction, one can also use a composition comprising 2, 3, 5, 10, 25, 50, 100 or more different peptides. A method may then further comprise identifying which peptide is labeled, e.g., by isolating the peptide that is labeled, and determining its amino acid sequence. Alternatively, each peptide may be tagged with a unique identifier, in which case, one would identify the identifier to determine the identity of a test peptide that was labeled.

Other methods for identifying targets of sirtuin ribosyltransferases are cell-based methods. In one example, a method comprises (i) contacting a cell expressing a sirtuin ribosyltransferase or a functional homolog thereof with labeled NAD+ for an amount of time and under conditions appropriate for transfer of the ribosyl group of NAD+ onto a target protein; and

(ii) determining the identity of a protein that is labeled, wherein a protein that is labeled is a target protein of a sirtuin ribosyltransferase. The cell may be any cell as further described herein, e.g., a cell comprising a heterologous nucleic acid encoding the sirtuin ribosyltransferase or functional homolog thereof.

The method may be used for detecting changes in the ribosylation of either a specific target or the entire proteome. ELISA type detection strategies may be used with either streptavidin-conjugated enzyme, e.g., horse radish peroxidase or anti-biotin antibodies. In order to physically characterize the targets, the ribosylated targets may be irnmunoprecipitated by pull down using streptavidin conjugated beads followed by mass spectrometric analysis. Targets may be completely or partially sequenced.

Determining the identity of a protein that is labeled may comprise isolating one or more proteins that are labeled, e.g., using a reagent that interacts with the label, and subjecting the one or more proteins or portions thereof to a method of detection, e.g., mass spectroscopy.

In one embodiment, a method for identifying a target protein of a sirtuin ribosyltransferase comprises contacting a cell comprising, e.g., over-expressing, a sirtuin

ribosyltransferase or a functional homolog thereof with biotin-NAD+, for a time sufficient for target proteins to become biotinylated. The method then comprises lysing the cells and adding to the cell lysate avidin coated surfaces, e.g., beads, under conditions in which avidin binds to biotin. The avidin-coated surfaces are then separated from the reaction mixture to thereby isolate the proteins that are biotinylated. The proteins that are linked to the avidin-coated surfaces can then be stripped from the surfaces and subjected to an analytical method, e.g., a Western blot in which the biotinylated proteins are detected with avidin, or a silver stained gel. Proteins from the silver stained gel may be extracted from the gel and subjected to a method of identification, e.g., mass spectroscopy (see Example 1).

A method of identifying a sirtuin ribosylation target protein may further be followed by an experiment that confirms that the identified protein is indeed a sirtuin ribosylation target. For example, a method may further comprise combining a sirtuin ribosyltransferase with labeled NAD+ and the suspected target protein or a functional homolog thereof; and determining whether the suspected target protein or the functional homolog thereof is labeled, wherein the presence of label on the suspected target protein confirms that the suspected target protein is a target protein of a sirtuin ribosyltransferase.

Target proteins of sirtuin ribosyltransferases, e.g., identified as described herein, may be used in screening assays for identifying modulators of sirtuin ribosyltransferases, e.g., as further described herein. Such modulators may then be used to treat or prevent diseases or conditions that are associated with particular target proteins. In addition, a target protein or functional homolog thereof may be administered to a subject to interfere with or augment the function of the naturally-occurring protein in a cell, e.g., to treat or prevent a disease or condition associated with a sirtuin ribosyltransferase. The assay could also be used as a biomarker of a phenotype/symptorn/pathway.

Although the above-described assays can be conducted using a single sirtuin ribosyltransferase or functional homolog thereof, a single target, or a single compound in one assay, the assays may also be conducted in a high throughput screening mode, with, e.g., a plurality (e.g., about 1-5, 1-10, 1-20 or 1-50) of sirtuin ribosyltransferases or functional homologs thereof, targets, and/or compounds (See generally, High Throughput Screening: The Discovery of Bioactive Substances (Devlin, Ed.) Marcel Dekker, 1997; Sittampalam et al, Curr. Opin. Chem. Biol., 1(3):384-91 (1997); and Silverman et al., Curr.

Opin. Chem. Biol., 2(3):397-403 (1998)). For example, the assay can be conducted in a multi-well (e.g., 24-, 48-, 96-, or 384-well), chip or array format.

Also provided herein are kits, e.g., kits for screening assays. A kit may comprise one or more components described herein and any other reagent that may be necessary or helpful in conducting an assay.

Exemplary sirtuin ribosyltransferase based methods and compositions

Provided herein are methods for treating or preventing a disease associated with hyperproliferating cells in a subject. A method may comprise administering to a subject in need thereof a therapeutically effective amount of an agent that inhibits a sirtuin ribosyltransferase, e.g., Sirtδ or a sirtuin ribosyltransferase, e.g., Sirtβ, dependent ribosylation pathway. For example, a method may decrease the level of protein or activity of a Sirtβ protein. A decrease of the level of protein or activity may be by a factor of at least about 50%, 2 fold, 5 fold, 10 fold, 30 fold, 100 fold or more. "Treating" a condition or disease refers to curing as well as ameliorating at least one symptom of the condition or disease or preventing the condition or disease from worsening. A subject in need of treatment may be a subject who has been diagnosed as having or likely to develop a hyper-proliferating disease. A subject may be a vertebrate, such as a mammal, e.g., a human, a bovine, an ovine, a sheep, porcine, a canine, a feline, a mouse or a rat. An agent that inhibits a sirtuin dependent ribosylation or ribosylation pathway may be any type of molecule, such as a small molecule or a macromolecule, e.g., a nucleic acid, oligonucleotide, sϊRNA, antisense RNA, triplex RNA or other. 1. Exemplary small molecule inhibitors of sirtuin dependent ribosylation pathways The following molecules may be inhibitors of Sirtό and/or Sirt4. In one embodiment, the agent is sirtinol (2-[(2-hydroxy-naphthalen-l-ylmethylene)-amino]- N-(l-phenyl-ethy- l)-benzamide; Grozinger et al. (2001) J. Biol. Chem. 276:38837), splitomycin (Bedalov et al. (2001) PNAS 98:15113), M15 ((l-[(4-methoxy-2-nitro- phenylimino)-methyl]-naphthalene-2-ol); Grozinger et al., supra), A3 ((8,9-dihydroxy-6H- (l)benzofuro[3,2-c]chromen-6-one; Grozinger et al., supra) or an analog or derivative thereof. Other inhibitors include nicotinamide (NAM), suranim; NF023 (a G-protein antagonist); NF279 (a purinergic receptor antagonist); Trolox (6-hydroxy- 2,5,7,8,tetramethylchroman-2-carboxylic acid); (-)-epigallocatechin (hydroxy on sites 3,5,7,3',4', 5'); (-)-epigallocatechin (hydroxy on sites 3,5,7,3',4',5'); (-)-epigallocatechin

gallate (Hydroxy sites 5,7,3',4',5' and gallate ester on 3); cyanidin choloride (3,5,7,3',4 * - pentahydroxyflavylium chloride); delphinidin chloride (3,5,7,3^4\5'-hexahydroxyflavylium chloride); myricetin (cannabiscetin; 3,5,7,3',4',5'-hexahydroxyfiavone); 3,7,3',4',5'- pentahydroxyflavone; and gossypetin (3,5,7,8,3',4'-hexahydro- xyflavone), all of which are further described in Howitz et al. (2003) Nature 425: 191 and in U.S. Patent Applications Publication Numbers 20050096256, 20050136429, 20050209300, 20050287597, 20060074124 and 20060084085. At least certain of these compounds are available from ChemBridge. Compounds may also be synthesized, e.g., as described in the references cited herein. Inhibitory compounds are also described in WO 2007/084162. In one embodiment, an inhibitor of Sirt6 is set forth in formulas I-XI.

A Sirtδ inhibitory compound may have the formula I:

I wherein, independently for each occurrence, X is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(=O)-, -C(=NR b )-, -CC=S)-, -S-, -S(=O)- or -SC=O) 2 -;

Y is -O-, -N(R a )-, -C(R a ) 2 -, -C(=O>, -C(=NRb)-, -CC=S)-, -S-, -SC=O)- or -SC=O) 2 -; Z is -O-, -N(R 3 )-, -C(R a ) 2 -, -CC=O)-, -CC=NRb)-, -CC=S)-, -S-, -SC=O)- or -SC=O) 2 -; R 3 is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl; Ri is aryl;

R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl, or sulfoxido;

R4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl, or sulfoxido;

provided that when X is -C(O)-; Y is -N(H)-; Z is -CH(CH 3 )-; R 2 is hydrogen; R 3

is hydrogen; and R 4 is hydrogen; Ri is not and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In another aspect, a Sirt6 inhibitory compound may be a compound of formula II:

II wherein, independently for each occurrence,

X is -O-, -N(R 9 )-, -C(Ra) 2 -, -C(O)-, -C(=NR b )-, -C(=S)-, -S-, -S(O)- or -S(O) 2 -; Y is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(O)- or -S(O) 2 -;

Z is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(O)-, -C(=NR b )-, -C(=S)-, -S-, -S(O)- or -S(O) 2 -; R 3 is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl; Ri is aryl; R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In another aspect, a Sirtβ inhibitory compound may be a compound of formula III:

III wherein, independently for each occurrence, X is -O-, -N(R a )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Y is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(K))-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(^O) 2 -; Z is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(O) 2 -; R a is hydrogen, alkyl, aryl, or aralkyl;

Rb is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl; R 1 is aryl;

R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In certain embodiments, Sirt6 inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein X is -C(=O)-, -N(H)-, -S- or -S(=O) 2 --

In certain embodiments, Sirtό inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein Y is -C(=O)-, -N(H)- or -CH2-.

In certain embodiments, Sirtό inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein Z is -CH(CH3)-.

In certain embodiments, Sirtό inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein R 2 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein R3 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein R 4 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by I, II, or III and the attendant definitions, wherein R 2 is hydrogen; R 3 is hydrogen; and R 4 is hydrogen.

In another aspect, a Sirtό inhibitory compound may be a compound of formula TV:

rv wherein, independently for each occurrence,

X is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Y is -O-, -N(R a )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Z is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

R a is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl;

Ri is aryl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

Rs is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro,

sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 6 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; provided that when X is -C(=O)-; Y is -N(H)-; Z is -CH(CH 3 )-; R 3 is hydrogen; R 4 is hydrogen; and R 6 is hydrogen; R 5 is not hydroxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In another aspect, a Sirt6 inhibitory compound may be a compound of formula V:

V wherein, independently for each occurrence,

X is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O> or -S(=O) 2 -;

Y is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(=O>, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Z is -O-, -N(R 3 )-, -C(R a ) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(O) 2 -;

R 3 is hydrogen, alkyl, aryl, or aralkyl;

R b is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl;

Ri is aryl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

Rs is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamide, sulfamoyl, sulfonyl or sulfoxido;

R O is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In another aspect, a Sirtό inhibitory compound may be a compound of formula VI:

VI wherein, independently for each occurrence,

X is -O-, -N(R 3 )-, -C(Ra) 2 -, -C(=O)-, -C(=NRb)-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Y is -O-, -N(R 3 )-, -C(Ra) 2 -, -CO=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Z is -O-, -N(Ra)-, -C(Ra) 2 -, -C(=O)-, -C(=NR b )-, -C(=S)-, -S-, -S(=O)- or -S(=O) 2 -;

Ra is hydrogen, alkyl, aryl, or aralkyl;

Rb is hydrogen, hydroxyl, alkoxyl, amine, alkyl, aryl, or aralkyl;

Ri is aryl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro,

sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 5 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

Re is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In certain embodiments, Sirt6 inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein X is -C(=O)-, -N(R 3 )-, -S- or -S(=O) 2 -. In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein X is -C(=O)-, -N(H)-, -S- or -S(=O) 2 -.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein Y is -C(=O)-, -N(R a )- or -C(R a ) 2 --

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein Y is -C(=O)-, -N(H)- or -CH 2 -.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein Z is -C(Ra) 2 --

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein Z is -CH(R a )-; and R a is alkyl. In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein Z is -CH(CHs)-.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 3 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 4 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 5 is hydroxyl.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 6 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V 3 or VI and the attendant definitions, wherein R 5 is hydroxyl; and Rg is hydrogen. In certain embodiments, Sirtβ inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 5 is hydroxyl; R 6 is hydrogen; and R 4 is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 5 is hydroxyl; R^ is hydrogen; R 4 is hydrogen; and R 3 is hydrogen. In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R5 is hydroxyl; Re is hydrogen; R4 is hydrogen; R3 is hydrogen; Z is -CH(R a )-; and R a is alkyl.

In certain embodiments, Sirtό inhibitory compounds are represented by IV, V, or VI and the attendant definitions, wherein R 5 is hydroxyl; R 6 is hydrogen; R 4 is hydrogen; R 3 is hydrogen; and Z is -CH(CH 3 )-.

In another aspect, a Sirtό inhibitory compound may be a compound of formula VII:

VII wherein, independently for each occurrence, X is -N(H)-, -C(=O)-, -S- or -S(O) 2 -;

Y is -N(H)-, -CH 2 - or -C(O)-;

Rs is hydrogen, hydroxyl or alkoxyl; provided that when X is -C(=O)-; and Y is -N(H)-; R 5 is not hydroxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In another aspect, a Sirtβ inhibitory compound may be a compound of formula VIII:

VIII wherein, independently for each occurrence, X is -N(H)-, -C(=O)-, -S- or -S(=O) 2 -;

Y is -N(H)-, -CH 2 - or -C(O)-; Rs is hydrogen, hydroxyl or alkoxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers. In another aspect, a Sirtβ inhibitory compound may be a compound of formula IX:

IX wherein, independently for each occurrence,

X is -N(H)-, -C(=OK -S- or -S(=O) 2 -; Y is -N(H)-, -CH 2 - or -C(=O)-;

Rs is hydrogen, hydroxyl or alkoxyl; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In certain embodiments, Sirtβ inhibitory compounds are represented by VII, VIII, or IX and the attendant definitions, wherein R 5 is hydroxyl.

In certain embodiments, Sirtβ inhibitory compounds are represented by VII, VIII, or IX and the attendant definitions, wherein R 5 is hydroxyl; X is -C(=O)-; and Y is -N(H)-.

In certain embodiments, Sirt6 inhibitory compounds are represented by VII, VIlI, or IX and the attendant definitions, wherein R 5 is hydroxyl; X is -N(H)-; and Y is -C(=O)-.

In certain embodiments, Sirtό inhibitory compounds are represented by VII, VIII, or IX and the attendant definitions, wherein R 5 is hydroxyl; X is -S-; and Y is -CH 2 -. In certain embodiments, Sirtό inhibitory compounds are represented by VII, VIII, or

IX and the attendant definitions, wherein R 5 is hydroxyl; X is -S(=O) 2 -; and Y is -N(H)-.

In certain embodiments, Sirtό inhibitory compounds are represented by VII, VIII, or IX and the attendant definitions, wherein the compound is a single enantiomer or steroisomer. In another aspect, a Sirtό inhibitory compound may be a compound of formula X:

X wherein, independently for each occurrence,

Ri is aryl; R 2 is hydrogen, alkyl, aryl, or aralkyl;

R 3 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; R4 is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; provided that when R 2 is hydrogen; R 3 is hydrogen; and R 4 is

-C(=O)NHCH(CH 3 )Ph; Ri is not and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers.

In another aspect, a Sirtό inhibitory compound may be a compound of formula XI:

XI wherein, independently for each occurrence, R 4 is -C(=O)OR a , -C(=O)N(R a ) 2 or -CN;

R 3 is hydrogen, alkyl, aryl, or aralkyl; provided that R 4 is not -C(=O)NHCH(CH 3 )Ph; and the compound is achiral or, when chiral, is a single stereoisomer or a mixture of stereoisomers. In certain embodiments, Sirtό inhibitory compounds are represented by X or XI and the attendant definitions, wherein R 4 is -C(=O)OEt.

In certain embodiments, Sirtό inhibitory compounds are represented by X or XI and the attendant definitions, wherein R 4 is -C(=O)OH.

In certain embodiments, Sirtό inhibitory compounds are represented by X or XI and the attendant definitions, wherein R 4 is -C(=O)NH 2 .

In certain embodiments, Sirtό inhibitory compounds are represented by X or XI and the attendant definitions, wherein R 4 is -CN.

Other Sirtό inhibitors include those described in Solomon et al. (2006) MoI. Cell. Biol. 26:28 and referred to as EX-519, EX-527, EX-586, EX-589, EX-622 and EX-635, derivatives and analogs thereof.

EX-527 has the following structure:

and its isomers have the following structures:

In another aspect, a Sirtό inhibitory compound may be a compound of formula XII:

XII wherein, independently for each occurrence,

A is O, S or N(R 1 ); X is C(R) 2 ; Y is N or C(R);

W is -(CH 2 ) p C(=O)R", -(CH 2 ) p OC(=O)R", -(CH 2 ) P N(R')C(=O)R", -(CH 2 ) P C(=O)OR" or -(CH 2 )pC(=O)N(R')2;

R is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido; R 1 is hydrogen, alkyl, aralkyl, or -C(=O)R";

R" is hydrogen, alkyl, alkenyl. alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; p is 0, 1, 2 or 3; and the stereochemical configuration at any stereocenter is R, S, or a mixture of these configurations.

In certain embodiments, Sirtό inhibitory compounds are represented by XII and the attendant definitions, wherein A is N(R 1 ).

In certain embodiments, Sirt6 inhibitory compounds are represented by XEI and the attendant definitions, wherein Y is C(R).

In certain embodiments, Sirtό inhibitory compounds are represented by XII and the attendant definitions, wherein W is -(CH 2 ) P C(=O)N(R')2- In certain embodiments, Sirtό inhibitory compounds are represented by XII and the attendant definitions, wherein R' is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by XII and the attendant definitions, wherein p is 0.

In another aspect, a Sirtό inhibitory compound may be a compound of formula XIII:

XIII wherein, independently for each occurrence, X is C(R) 2 ; W is -(CH 2 )pC(=O)R", -(CH 2 ) P C(=O)OR" or -(CH 2 )pCeθ)N(R') 2 ; R is hydrogen, halogen, alkyl, alkenyl, alkynyU aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamide, sulfamoyl, sulfonyl or sulfoxido;

R' is hydrogen, alkyl, aralkyl, or -C(=O)R"; R" is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; p is 0, 1 , 2 or 3 ; and the stereochemical configuration at any stereocenter is R, S, or a mixture of these configurations. In certain embodiments, Sirtό inhibitory compounds are represented by XIII and the attendant definitions, wherein W is -(CH 2 ) P C(=O)N(R')2; and p is 0.

In certain embodiments, Sirtό inhibitory compounds are represented by XTII and the attendant definitions, wherein R' is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by XIII and the attendant definitions, wherein p is 0.

In another aspect, a Sirtό inhibitory compound may be a compound of formula XIV:

XIV wherein, independently for each occurrence,

Z is -OR" or -N(R') 2 ; R is hydrogen, halogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, aralkyl, aralkyenyl, aralkynyl, heteroaralkyl, heteroaralkyenyl, heteroaralkynyl, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, acylamino, amido, alkylthio, carboxyl, carbamoyl, alkoxyl, sulfonate, sulfate, sulfonamido, sulfamoyl, sulfonyl or sulfoxido;

R 1 is hydrogen, alkyl, aralkyl, or -C(=O)R"; R" is hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, aralkyl, or heteroaralkyl; and the stereochemical configuration at any stereocenter is R, S, or a mixture of these configurations.

In certain embodiments, Sirtό inhibitory compounds are represented by XIV and the attendant definitions, wherein Z is -N(R) 2 .

In certain embodiments, Sirtό inhibitory compounds are represented by XIV and the attendant definitions, wherein R' is hydrogen.

In certain embodiments, Sirtό inhibitory compounds are represented by XIV and the attendant definitions, wherein Z is -N(H) 2 .

In certain embodiments, Sirt6 inhibitory compounds are represented by XIV and the attendant definitions, wherein R is halogen, cyano, nitro, sulfhydryl, hydroxyl, sulfonyl, amino, alkoxyl, or trifluoromethyl.

In certain embodiments, Sirt6 inhibitory compounds are represented by XIV and the attendant definitions, wherein R is -Cl, -Br, -I or -F.

In certain embodiments, Sirt6 inhibitory compounds are represented by XIV and the attendant definitions, wherein R is -Cl.

Also included are pharmaceutically acceptable addition salts and complexes of the compounds of formula I-X. In cases wherein the compounds may have one or more chiral centers, unless specified, the compounds contemplated herein may be a single stereoisomer or racemic mixtures of stereoisomers.

Synthesis of these compounds is described, e.g., in Mai et al. (2005) J. Med. Chem. 48:7789.

In cases in which the Sirtό inhibitory compounds have unsaturated carbon-carbon double bond ' s, both the cis (Z) and trans (E) isomers are contemplated herein. In cases wherein the compounds may exist in tautomeric forms, such as keto-enol tautomers,

O OR' such as — ^^ and ~-" " ^=i- , each tautomeric form is contemplated as being included within the methods presented herein, whether existing in equilibrium or locked in one form by appropriate substitution with R\ The meaning of any substituent at any one occurrence is independent of its meaning, or any other substituent's meaning, at any other occurrence.

Also included in the methods presented herein are prodrugs of the Sirt6 inhibitory compounds of formulas I-XI. Prodrugs are considered to be any covalently bonded carriers that release the active parent drug in vivo. Metabolites, e.g., degradation products, of these compounds are also included. In certain embodiments, a compound is included within the generic structures of formula I-XI with the proviso that the compound is not a particular compound, such as a naturally occuring compound or that the compound is not present in a particular form, such as a naturally-occurring form.

A compound may have a binding affinity for a Sirt6 of about 10 "9 M, 10 "10 M, 10 " 11 M, 10 "12 M or less. A compound may have an EC 50 for inhibiting an activity of a Sirtβ, such as its NAD-ribosyltransferase activity, of less than about 1 nM, less than about 10 nM, less than about 100 nM, less than about 1 μM, less than about 10 μM, less than about

100 μM, or from about 1-10 nM, from about 10-100 nM, from about 0.1-1 μM, from about 1-10 μM or from about 10-100 μM. A compound may inhibit an activity of a Sirtό by a factor of at least about 50%, 2, 5, 10, 20, 30, 50, or 100, as measured in an acellular assay or in a cell based assay. A compound may cause at least a 10%, 30%, 50%, 80%, 2 fold, 5 fold, 10 fold, 50 fold or 100 fold greater inhibition of an activity of Sirtό relative to the same concentration of sirtinol or other compound described herein.

The qualitative or quantitative effect of a compound on the NAD-ribosyltransferase activity of Sirtό may be determined as described, e.g., in Liszt et al. (2005) J. Biol. Chem. 22:21313. For instance, a Sirtό protein or a functional homolog thereof may be contacted with a compound in vitro, e.g., in a solution, in a cell or in a cell extract, hi one embodiment, a Sirtό protein of functional homolog thereof is contacted with a compound and a ribosyltransferase target peptide in a solution and the amount of ribosyl that was transferred onto the target peptide is determined. A target peptide may be a peptide from a histone or core histones or a functional homolog thereof. A target peptide may also be nucleoplasmin, also referred to as nucleolar phosphoprotein B23, numatrin, and as chromatin decondensation protein or a functional homolog thereof. Targets are further described herein. These substrate or target proteins and functional homolog thereof may also be used in the assays. Similar assays may also be used to identify other inhibitors of Sirtό. A homolog of a protein of interest, such as Sirtό or a protein that is a substrate of

Sirtό, includes proteins comprising, consisting essentially of, or consisting of an amino acid sequence that has at least about 70%, 80%, 90%, 95%, 98% or 99% identity with the amino acid sequence of the protein of interest. A homolog may also be a protein that is encoded by a nucleic acid comprising, consisting essentially of, or consisting of a nucleotide sequence that has at least about 70%, 80%, 90%, 95%, 98% or 99% identity with a nucleotide sequence encoding the protein of interest or the coding sequence thereof. A homolog may also be a protein that is encoded by a nucleic acid that hybridizes, e.g., under stringent hybridization conditions, to a nucleic acid encoding a protein of interest, or the coding sequence thereof. For example, homologs may be encoded by nucleic acids that hybridize under high stringency conditions of 0.2 to 1 x SSC at 65 0 C followed by a wash at 0.2 x SSC at 65 0 C to a nucleic acid encoding a protein of interest. Nucleic acids that hybridize under low stringency conditions of 6 x SSC at room temperature followed by a wash at 2 x SSC at

room temperature to nucleic acid encoding a protein of interest or a portion thereof can be used. Other hybridization conditions include 3 x SSC at 40 or 50 0 C, followed by a wash in 1 or 2 x SSC at 20, 30, 40, 50, 60, or 65 0 C. Hybridizations can be conducted in the presence of formaldehyde, e.g., 10%, 20%, 30% 40% or 50%, which further increases the stringency of hybridization. Theory and practice of nucleic acid hybridization is described, e.g., in S. Agrawal (ed.) Methods in Molecular Biology, volume 20; and Tijssen (1993) Laboratory Techniques in biochemistry and molecular biology-hybridization with nucleic acid probes, e.g., part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays," Elsevier, New York provide a basic guide to nucleic acid hybridization.

Homologs of proteins described herein, such as Sirtβ or a substrate thereof, may also be analogs, e.g., that differ from the naturally occurring protein by conservative amino acid sequence differences or by modifications that do not affect sequence, or by both. Analogs can differ from naturally occurring proteins by conservative amino acid sequence differences or by modifications which do not affect sequence, or by both. Any number of procedures may be used for the generation of mutant, derivative or variant forms of a protein of interest using recombinant DNA methodology well known in the art such as, for example, that described in Sambrook et al. (1989, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York) and Ausubel et al. (1997, Current Protocols in Molecular Biology, Green & Wiley, New York).

Homologs of a protein of interest also includes portions thereof, such as portions comprising one or more conserved domains, e.g., the catalytic domain that Sirt6 shares with the other sirtuins (Frye et al. (1999) Biochem. Biophys. Res. Comm. 260:273 and Liszt et al, infra). The catalytic domain of human Sirt6 (SIRT6) corresponds to about amino acids 45 to 271 of SEQ ID NO: 2 (see Liszt et al., infra).

A "functional homolog" of a protein of interest refers to a homolog of the protein having at least one biological activity of the protein. For example, a functional homolog of Sirt6 may be a protein having an ribosyl transferase or deacetylase activity, or other biological activities. Whether a homolog is a functional homolog can be determined according to methods known in the art. For example, a ribosyl transferase activity can be determined as further described herein.

A compound may inhibit more efficiently Sirt6 relative to one or more other sirtuins. For example, a compound may inhibit more efficiently Sirtό than the other

sirtuins from the same species, e.g., SIRTl, SIRT2ϊ1, SIRT2i2, SIRT3ia, SIRT3ib, SIRT4,

SIRT5il, SIRTi2 and SIRT7 or non human homologs thereof. A compound may inhibit more efficiently a sirtuin from a particular species relative to the homologous sirtuin from another species. For example, a compound may inhibit more efficiently a sirtuin from a microorganism, such as a pathogen, relative to the same sirtuin from humans. A sirtuin inhibiting compound may be more efficient in inhibiting one sirtuin relative to another by a factor of at least about 50%, 2 fold, 5 fold, 10, fold, 20 fold, 50 fold, or 100 fold.

A compound may traverse the cytoplasmic membrane of a cell. For example, a compound may have a cell-permeability of at least about 20%, 50%, 75%, 80%, 90% or 95%. A compound having a cell-permeability of at least about 20% means that at least about 20% of these compounds will enter a cell within a certain time frame when a given amount of these compounds is contacted with the cell.

A compound may have a normal half-life under normal atmospheric conditions of at least about 30 days, 60 days, 120 days, 6 months, or 1 year. One compound maybe more stable in solution than another compound, e.g., sirtinol, by a factor of at least about 50%, 2 fold, 5 fold, 10 fold, 30 fold, 50 fold, or 100 fold.

In one embodiment, a cell is obtained from a subject following administration of an inhibitory compound to the subject, such as by obtaining a biopsy, and the activity of the sirtuin is determined in the biopsy. The cell may be any cell of the subject, but in cases in which an inhibitory compound is administered locally, the cell is preferably a cell that is located in the vicinity of or at the site of administration.

Definitions for chemical formula:

The term "stereoisomers" is art-recognized and refers to compounds which have identical chemical constitution, but differ with regard to the arrangement of the atoms or groups in space. In particular, "enantiomers" refer to two stereoisomers of a compound which are non-superimposable mirror images of one another. "Diastereomers", on the other hand, refers to stereoisomers with two or more centers of dissymmetry and whose molecules are not mirror images of one another.

Furthermore, a "stereoselective process" is one which produces a particular stereoisomer of a reaction product in preference to other possible stereoisomers of that product. An "enantioselective process" is one which favors production of one of the two possible enantiomers of a reaction product.

The term "regioisomers" is art-recognized and refers to compounds which have the same molecular formula but differ in the connectivity of the atoms. Accordingly, a "regioselective process" is one which favors the production of a particular regioisomer over others, e.g., the reaction produces a statistically significant increase in the yield of a certain regioisomer.

The term "epimers" is art-recognized and refers to molecules with identical chemical constitution and containing more than one stereocenter, but which differ in configuration at only one of these stereocenters.

"Treating" a condition or disease refers to curing as well as ameliorating at least one symptom of the condition or disease or preventing the condition or disease from worsening.

The term "structure-activity relationship" or "(SAR)" is art-recognized and refers to the way in which altering the molecular structure of a drug or other compound alters its biological activity, e.g., its interaction with a receptor, enzyme, nucleic acid or other target and the like. The term "aliphatic" is art-recognized and refers to a linear, branched, cyclic alkane, alkene, or alkyne. In certain embodiments, aliphatic groups in the present compounds are linear or branched and have from 1 to about 20 carbon atoms.

The term "heteroatom" is art-recognized and refers to an atom of any element other than carbon or hydrogen. Illustrative heteroatoms include boron, nitrogen, oxygen, phosphorus, sulfur and selenium.

The term "alkyl" is art-recognized, and includes saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In certain embodiments, a straight chain or branched chain alkyl has about 30 or fewer carbon atoms in its backbone (e.g., C1-C 30 for straight chain, C 3 -C 3 0 for branched chain), and alternatively, about 20 or fewer. Likewise, cycloalkyls have from about 3 to about 10 carbon atoms in their ring structure, and alternatively about 5, 6 or 7 carbons in the ring structure.

Unless the number of carbons is otherwise specified, "lower alkyl" refers to an alkyl group, as defined above, but having from one to about ten carbons, alternatively from one to about six carbon atoms in its backbone structure. Likewise, "lower alkenyl" and "lower alkynyl" have similar chain lengths.

The term "aralkyl" is art-recognized and refers to an alkyl group substituted with an aryl group (e.g., an aromatic or heteroaromatic group).

The terms "alkenyl" and "alkynyl" are art-recognized and refer to unsaturated aliphatic groups analogous in length and possible substitution to the alkyls described above, but that contain at least one double or triple bond respectively.

The term "aryl" is art-recognized and refers to 5-, 6- and 7-membered single-ring aromatic groups that may include from zero to four heteroatoms, for example, benzene, naphthalene, anthracene, pyrene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine,. and the like. Those aryl groups having heteroatoms in the ring structure may also be referred to as "aryl heterocycles" or "heteroaromatics." The aromatic ring may be substituted at one or more ring positions with such substituents as described above, for example, halogen, azide, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, alkoxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, sulfonamide, ketone, aldehyde, ester, heterocyclyl, aromatic or heteroaromatic moieties, - CF 3 , -CN, or the like. The term "aryl" also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings (the rings are "fused rings") wherein at least one of the rings is aromatic, e.g., the other cyclic rings may be cycloalkyls, cycloalkenyls, cycloalkynyls, aryls and/or heterocyclyls. The terms ortho, meta and para are art-recognized and refer to 1 ,2-, 1 ,3- and 1 ,4- disubstituted benzenes, respectively. For example, the names 1 ,2-dimethylbenzene and ortho-dimethylbenzene are synonymous.

The terms "heterocyclyl", "heteroaryl", or "heterocyclic group" are art-recognized and refer to 3- to about 10-membered ring structures, alternatively 3- to about 7-membered rings, whose ring structures include one to four heteroatoms. Heterocycles may also be polycycles. Heterocyclyl groups include, for example, thiophene, thianthrene, furan, pyran, isobenzofuran, chromene, xanthene, phenoxanthene, pyrrole, imidazole, pyrazole, isothiazole, isoxazole, pyridine, pyrazine, pyrimidine, pyridazine, indolizine, isoindole, indole, indazole, purine, quinolizine, isoquinoline, quinoline, phthalazine, naphthyridine, quinoxaline, quinazoline, cinnoline, pteridine, carbazole, carboiine, phenanthridine, acridine, pyrimidine, phenanthroline, phenazine, phenarsazine, phenothiazine, furazan, phenoxazine, pyrrolidine, oxolane, thiolane, oxazole, piperidine, piperazine, morpholine, lactones, lactams such as azetidinones and pyrrolidinones, sultams, sultones, and the like.

The heterocyclic ring may be substituted at one or more positions with such substituents as described above, as for example, halogen, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, - hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, ketone, aldehyde, ester, a heterocyclyl, an aromatic or heteroaromatic moiety, -CF3, -CN, or the like.

The terms "polycyclyl" or "polycyclic group" are art-recognized and refer to two or more rings (e.g., cycloalkyls, cycloalkenyls, cycloalkynyls, aryls and/or heterocyclyls) in which two or more carbons are common to two adjoining rings, e.g., the rings are "fused rings". Rings that are joined through non-adjacent atoms are termed "bridged" rings. Each of the rings of the polycycle may be substituted with such substituents as described above, as for example, halogen, alkyl, aralkyl, alkenyl, alkynyl, cycloalkyl, hydroxyl, amino, nitro, sulfhydryl, imino, amido, phosphonate, phosphinate, carbonyl, carboxyl, silyl, ether, alkylthio, sulfonyl, ketone, aldehyde, ester, a heterocyclyl, an aromatic or heteroaromatic moiety, -CF 3 , -CN, or the like. The term "carbocycle" is art-recognized and refers to an aromatic or non-aromatic ring in which each atom of the ring is carbon.

The term "nitro" is art-recognized and refers to -NO 2 ; the term "halogen" is art- recognized and refers to -F, -Cl, -Br or -I; the term "sulfhydryl" is art-recognized and refers to -SH; the term "hydroxyl" means -OH; and the term "sulfonyl" is art-recognized and refers to -SO2 " . "Halide" designates the corresponding anion of the halogens, and

"pseudohalide" has the definition set forth on 560 of "Advanced Inorganic Chemistry" by Cotton and Wilkinson.

The terms "amine" and "amino" are art-recognized and refer to both unsubstituted and substituted amines, e.g., a moiety that may be represented by the general formulas:

wherein R50, R51 and R52 each independently represent a hydrogen, an alkyl, an alkenyl, - (CH 2 )m-R61 , or R50 and R51 , taken together with the N atom to which they are attached complete a heterocycle having from 4 to 8 atoms in the ring structure; R61 represents an aryl, a cycloalkyl, a cycloalkenyl, a heterocycle or a polycycle; and m is zero or an integer in the range of 1 to S. Tn other embodiments, R50 and R51 (and optionally R52) each independently represent a hydrogen, an alkyl, an alkenyl, or -(CH 2 ) m -R61. Thus, the term

"alkylamine" includes an amine group, as defined above, having a substituted or unsubstituted alkyl attached thereto, i.e., at least one of R50 and R51 is an alkyl group.

The term "acylamino" is art-recognized and refers to a moiety that may be represented by the general formula:

wherein R50 is as defined above, and R54 represents a hydrogen, an alkyl, an alkenyl or - (CH 2 ) m -R61, where m and R61 are as defined above.

The term "amido" is art recognized as an amino-substituted carbonyl and includes a moiety that may be represented by the general formula:

wherein R50 and R51 are as defined above. Certain embodiments of the amide in the present invention will not include imides which may be unstable.

The term "alkylthio" refers to an alkyl group, as defined above, having a sulfur radical attached thereto. In certain embodiments, the "alkylthio" moiety is represented by one of -S-alkyl, -S-alkenyl, -S-alkynyl, and -S-(CH 2 ) m -R61, wherein m and R61 are defined above. Representative alkylthio groups include methylthio, ethyl thio, and the like. The term "carboxyl" is art recognized and includes such moieties as may be represented by the general formulas:

wherein X50 is a bond or represents an oxygen or a sulfur, and R55 and R56 represents a hydrogen, an alkyl, an alkenyl, -(CH 2 ) m -R61or a pharmaceutically acceptable salt, R56 represents a hydrogen, an alkyl, an alkenyl or -(CH 2 ) m -R61, where m and R61 are defined above. Where X50 is an oxygen and R55 or R56 is not hydrogen, the formula represents an "ester". Where X50 is an oxygen, and R55 is as defined above, the moiety is referred to herein as a carboxyl group, and particularly when R55 is a hydrogen, the formula represents

a "carboxylic acid". Where X50 is an oxygen, and R56 is hydrogen, the formula represents a "formate". In general, where the oxygen atom of the above formula is replaced by sulfur, the formula represents a "thiolcarbonyl" group. Where X50 is a sulfur and R55 or R56 is not hydrogen, the formula represents a "thiolester." Where X50 is a sulfur and R55 is hydrogen, the formula represents a "thiolcarboxylic acid." Where X50 is a sulfur and R56 is hydrogen, the formula represents a "thiolformate." On the other hand, where X50 is a bond, and R55 is not hydrogen, the above formula represents a "ketone" group. Where X50 is a bond, and R55 is hydrogen, the above formula represents an "aldehyde" group.

The term "carbamoyl" refers to -0(C=O)NRR', where R and R' are independently H, aliphatic groups, aryl groups or heteroaryl groups.

The term "oxo" refers to a carbonyl oxygen (=O).

The terms "oxime" and "oxime ether" are art-recognized and refer to moieties that may be represented by the general formula:

wherein R75 is hydrogen, alkyl, cycloalkyl, alkenyl, alkynyl, aryl, aralkyl, or -(CH 2 ) m -R61.

The moiety is an "oxime" when R is H; and it is an "oxime ether" when R is alkyl, cycloalkyl, alkenyl, alkynyl, aryl., aralkyl, or -(CH 2 ) m -R61.

The terms "alkoxyl" or "alkoxy" are art-recognized and refer to an alkyl group, as defined above, having an oxygen radical attached thereto. Representative alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like. An "ether" is two hydrocarbons covalently linked by an oxygen. Accordingly, the substituent of an alkyl that renders that alkyl an ether is or resembles an alkoxyl, such as may be represented by one of -O-alkyl, -O-alkenyl, -O-alkynyl, -O~(CH 2 ) m -R61, where m and R61 are described above.

The term "sulfonate" is art recognized and refers to a moiety that may be represented by the general formula:

O

OR57

O in which R57 is an electron pair, hydrogen, alkyl, cycloalkyl, or aryl.

The term "sulfate" is art recognized and includes a moiety that may be represented by the general formula:

in which R57 is as defined above. The term "sulfonamido" is art recognized and includes a moiety that may be represented by the general formula:

in which R50 and R56 are as defined above.

The term "sulfamoyl" is art-recognized and refers to a moiety that may be represented by the general formula:

R50

o M1 in which R50 and R51 are as defined above.

The term "sulfonyl" is art-recognized and refers to a moiety that may be represented by the general formula:

O R58

O in which R58 is one of the following: hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, heterocyclyl, aryl or heteroaryl.

The term "sulfoxido" is art-recognized and refers to a moiety that may be represented by the general formula:

-/ \ R58

in which R58 is defined above.

The term "phosphoryl" is art-recognized and may in general be represented by the formula:

wherein Q50 represents S or O, and R59 represents hydrogen, a lower alkyl or an aryl.

When used to substitute, e.g., an alkyl, the phosphoryl group of the phosphorylalkyl may be represented by the general formulas:

wherein Q50 and R59, each independently, are defined above, and Q51 represents O, S or N. When Q50 is S, the phosphoryl moiety is a "phosphorothioate".

The term "phosphoramidite" is art-recognized and may be represented in the general formulas:

wherein Q51, R50, R51 and R59 are as defined above. The term "phosphonamidite" is art-recognized and may be represented in the general formulas:

wherein Q51, R50, R51 and R59 are as defined above, and R60 represents a lower alkyl or an aryl.

Analogous substitutions may be made to alkenyl and alkynyl groups to produce, for example, aminoalkenyls, aminoalkynyls, amidoalkenyls, amidoalkynyls, iminoalkenyls, iminoalkynyls, thioalkenyls, thioalkynyls, carbonyl-substituted alkenyls or alkynyls.

The definition of each expression, e.g. alkyl, m, n, and the like, when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.

The term "selenoalkyl" is art-recognized and refers to an alkyl group having a substituted seleno group attached thereto. Exemplary "selenoethers" which may be substituted on the alkyl are selected from one of -Se-alkyl, -Se-alkenyl, -Se-alkynyl, and - Se-(CH2)m-R61 , m and R61 being defined above.

The terms triflyl, tosyl, mesyl, and nonaflyl are art-recognized and refer to trifluoromethanesulfonyl, /?-toluenesulfonyl, methanesulfonyl, and nonafluorobutanesulfonyl groups, respectively. The terms triflate, tosylate, mesylate, and nonaflate are art-recognized and refer to trifluoromethanesulfonate ester, /7-toluenesulfonate ester, methanesulfonate ester, and nonafluorobutanesulfonate ester functional groups and molecules that contain said groups, respectively.

The abbreviations Me, Et, Ph, Tf, Nf, Ts, and Ms represent methyl, ethyl, phenyl, trifluoromethanesulfonyl, nonafluorobutanesulfonyl, /7-toluenesulfonyl and methanesulfonyl, respectively. A more comprhensive list of the abbreviations utilized by organic chemists of ordinary skill in the art appears in the first issue of each volume of the Journal of Organic Chemistry; this list is typically presented in a table entitled Standard List of Abbreviations.

Certain compounds contained in compositions of the present invention may exist in particular geometric or stereoisomeric forms. In addition, polymers of the present invention may also be optically active. The present invention contemplates all such compounds, including cis- and trans-isomers, R- and 5-enantiomers, diastereomers, (D)-isomers, (L)- isomers, the racemic mixtures thereof, and other mixtures thereof, as falling within the scope of the invention. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group. All such isomers, as well as mixtures thereof, are intended to be included in this invention.

If, for instance, a particular enantiomer of a compound of the present invention is desired, it may be prepared by asymmetric synthesis, or by derivation with a chiral auxiliary, where the resulting diastereomeric mixture is separated and the auxiliary group

cleaved to provide the pure desired enantiomers. Alternatively, where the molecule contains a basic functional group, such as amino, or an acidic functional group, such as carboxyl, diastereomeric salts are formed with an appropriate optically-active acid or base, followed by resolution of the diastereomers thus formed by fractional crystallization or chromatographic means well known in the art, and subsequent recovery of the pure enantiomers.

It will be understood that "substitution" or "substituted with" includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, or other reaction.

The term "substituted" is also contemplated to include all permissible substituents of organic compounds. In a broad aspect, the permissible substituents include acyclic and cyclic, branched and unbranched, carbocyclic and heterocyclic, aromatic and nonaromatic substituents of organic compounds. Illustrative substituents include, for example, those described herein above. The permissible substituents may be one or more and the same or different for appropriate organic compounds. For purposes of this invention, the heteroatoms such as nitrogen may have hydrogen substituents and/or any permissible substituents of organic compounds described herein which satisfy the valences of the heteroatoms. This invention is not intended to be limited in any manner by the permissible substituents of organic compounds.

The phrase "protecting group" as used herein means temporary substituents which protect a potentially reactive functional group from undesired chemical transformations. Examples of such protecting groups include esters of carboxylic acids, silyl ethers of alcohols, and acetals and ketals of aldehydes and ketones, respectively. The field of protecting group chemistry has been reviewed (Greene, T. W.; Wuts, P.G.M. Protective Groups in Organic Synthesis, 3 rd ed.; Wiley: New York, 1999). Protected forms of the inventive compounds are included within the scope of this invention.

For purposes of this invention, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics. 67th Ed., 1986-87, inside cover.

The term "protecting group" is art-recognized and refers to temporary substituents that protect a potentially reactive functional group from undesired chemical

transformations. Examples of such protecting groups include esters of carboxylic acids, silyl ethers of alcohols, and acetals and ketals of aldehydes and ketones, respectively. The field of protecting group chemistry has been reviewed by Greene and Wuts in Protective Groups in Organic Synthesis (2 nd ed., Wiley: New York, 1991). The term "hydroxyl-protecting group" is art-recognized and refers to those groups intended to protect a hydroxyl group against undesirable reactions during synthetic procedures and includes, for example, benzyl or other suitable esters or ethers groups known in the art.

The term "carboxyl-protecting group" is art-recognized and refers to those groups intended to protect a carboxylic acid group, such as the C-terminus of an amino acid or peptide or an acidic or hydroxyl azepine ring substituent, against undesirable reactions during synthetic procedures and includes. Examples for protecting groups for carboxyl groups involve, for example, benzyl ester, cyclohexyl ester, 4-nitrobenzyl ester, t-butyl ester, 4-pyridylmethyl ester, and the like. The term "amino-b locking group" is art-recognized and refers to a group which will prevent an amino group from participating in a reaction carried out on some other functional group, but which can be removed from the amine when desired. Such groups are discussed by in Ch. 7 of Greene and Wuts, cited above, and by Barton, Protective Groups in Organic Chemistry ch. 2 (McOmie, ed., Plenum Press, New York, 1973). Examples of suitable groups include acyl protecting groups such as, to illustrate, formyl, dansyl, acetyl, benzoyl, trifluoroacetyl, succinyl, methoxysuccinyl, benzyl and substituted benzyl such as 3,4-dimethoxybenzyl, o-nitrobenzyl, and triphenylmethyl; those of the formula -COOR where R includes such groups as methyl, ethyl, propyl, isopropyl, 2,2,2-trichloroethyl, 1- methyl-1-phenylethyl, isobutyl, t-butyl, t-amyl, vinyl, allyl, phenyl, benzyl, p-nitrobenzyl, o-nitrobenzyl, and 2,4-dichlorobenzyl; acyl groups and substituted acyl such as formyl, acetyl, chloroacetyl, dichloroacetyl, trichloro acetyl, trifluoroacetyl, benzoyl, and p- methoxybenzoyl; and other groups such as methanesulfonyl, p-toluenesulfonyl, p- bromobenzenesulfonyl, p-nitrophenylethyl, and p-toluenesulfonyl-aminocarbonyl. Preferred amino-blocking groups are benzyl (-CH 2 CeH 5 ), acyl [C(O)Rl] or SiRl 3 where Rl is C1-C4 alkyl, halomethyl, or 2-halo-substituted-(C2-C 4 alkoxy), aromatic urethane protecting groups as, for example, carbonylbenzyloxy (Cbz); and aliphatic urethane protecting groups such as t-butyloxycarbonyl (Boc) or 9-fluorenylmethoxycarbonyl (FMOC).

The definition of each expression, e.g. lower alkyl, m, n, p and the like, when it occurs more than once in any structure, is intended to be independent of its definition elsewhere in the same structure.

The term "electron-withdrawing group" is art-recognized, and refers to the tendency of a substituent to attract valence electrons from neighboring atoms, i.e., the substituent is electronegative with respect to neighboring atoms. A quantification of the level of electron- withdrawing capability is given by the Hammett sigma (σ) constant. This well known constant is described in many references, for instance, March, Advanced Organic Chemistry 251-59 (McGraw Hill Book Company: New York, 1977). The Hammett constant values are generally negative for electron donating groups (σ(P) = - 0.66 for NH 2 ) and positive for electron withdrawing groups (σ(P) = 0.78 for a nitro group), σ(P) indicating para substitution. Exemplary electron- withdrawing groups include nitro, acyl, formyl, sulfonyl, trifluoromethyl, cyano, chloride, and the like. Exemplary electron- donating groups include amino, methoxy, and the like. The term "small molecule" is art-recognized and refers to a composition which has a molecular weight of less than about 2000 amu, or less than about 1000 amu, and even less than about 500 amu. Small molecules may be, for example, nucleic acids, peptides, polypeptides, peptide nucleic acids, peptidomimetics, carbohydrates, lipids or other organic (carbon containing) or inorganic molecules. The term "small organic molecule" refers to a small molecule that is often identified as being an organic or medicinal compound, and does not include molecules that are exclusively nucleic acids, peptides or polypeptides.

The term "chemical entity," as used herein, refers to chemical compounds, complexes of two or more chemical compounds, and fragments of such compounds or complexes. In certain instances, it is desirable to use chemical entities exhibiting a wide range of structural and functional diversity, such as compounds exhibiting different shapes (e.g., flat aromatic rings(s), puckered aliphatic rings(s), straight and branched chain aliphatics with single, double, or triple bonds) and diverse functional groups (e.g., carboxylic acids, esters, ethers, amines, aldehydes, ketones, and various heterocyclic rings).

2. Other inhibitors of sirtuin dependent ribosylation pathways

A sirtuin ribosyltransferase inhibitor may also be a siRNA, anti-sense RNA, or a ribozyme that can decrease the expression or level of the sirtuin ribosyltransferase.

Although the description below focusses on Sirt6, the description also applies to Sirt4.

In one embodiment, Sirtό expression or protein levels is reduced by gene silencing using double-strand RNA (Sharp (1999) Genes and Development 13: 139-141). RNAi, otherwise known as double-stranded RNA interference (dsRNAi) or small interfering RNA (siRNA), has been extensively documented in a number of organisms, including mammalian cells and the nematode C. elegans (Fire, A., et al, Nature, 391, 806-811, 1998). dsRNA can be delivered to cells or to an organism to antagonize a sirtuin or other protein described herein. For example, a dsRNA that is complementary to a Sirtό nucleic acid can silence protein expression of Sirt6. The dsRNA can include a region that is complementary to a coding region of a Sirtό nucleic acid, e.g., a 5' coding region, a region encoding a sirtuin core domain, a 3' coding region, or a non-coding region, e.g., a 5' or 3' untranslated region. dsRNA can be produced, e.g., by transcribing a cassette (in vitro or in vivo) in both directions, for example, by including a T7 promoter on either side of the cassette. The insert in the cassette is selected so that it includes a sequence complementary to the Sirtό nucleic acid. The sequence need not be full length, for example, an exon, or between 19-50 nucleotides or 50-200 nucleotides. The sequence can be from the 5' half of the transcript, e.g., within 1000, 600, 400, or 300 nucleotides of the ATG. See also, the HISCRIBE™. RNAi Transcription Kit (New England Biolabs, MA) and Fire, A. (1999) Trends Genet. 15, 358-363. dsRNA can be digested into smaller fragments. See, e.g., U.S. patent application 2002-0086356 and 2003-0084471.

In one embodiment, Sirtό levels are decreased by administration of or expression in a subject, e.g., in cells or a tissue of the subjet, of one or more Sirtό siRNAs.

The term "short interfering RNAs (siRNA)" refers to any nucleic acid molecule capable of mediating RNAi or gene silencing. The term siRNA encompasses various naturally generated or synthetic compounds, with RNAi function. Such compounds include, without limitation, duplex synthetic oligonucleotides, of about 21 to 23 base pairs with terminal overlaps of 2 or 3 base pairs; hairpin structures of one oligonucleotide chain with sense and complementary, hybridizing, segments of 21-23 base pairs joined by a loop of, e.g., 3-5 base pairs; and various genetic constructs leading to the expression of the preceding structures or functional equivalents. siRNAs is equivalent to any term in the art defined as a molecule capable of mediating sequence-specific RNAi. Such equivalents include, for example, double-stranded RNA (dsRNA), micro-RNA (mRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, and post-transcriptional gene silencing

RNA (ptgsRNA).

A composition comprising an siRNA effective to inhibit Sϊrtό expression may include an RNA duplex comprising a sense sequence of Sirtό. An RNA duplex may comprise a first strand comprising a sense sequence of Sirtό and a second strand comprising a complement of the sense sequence of Sirtό. In one embodiment the sense and/or complement sequence of Sirtό comprise of from 10 to 25 nucleotides in length. More preferably, the sense and/or complement sequence of Sirtό comprise of from 19 to 25 nucleotides in length. Most preferably, the sense and/or complement sequence of Sirtό comprise of from 21 to 23 nucleotides in length. The sense sequence of Sirtό may comprise a sequence of Sirtό containing a translational start site, or may comprise a portion of Sirtό sequence within about 1000, 600, 400 or 300 nucleotides of the ATG. The complement sequence need not be perfectly complementary to the sense sequence. They may differ in one or more nucleotide substitutions, deletions or additions. Similarly, the sense and/or complement sequences of Sirtό may differ in one or more nucleotide substitutions, additions and deletions from the Sirtό sequence in a target cell, provided that the siRNA is sufficiently specific for targeting Sirtό expression.

Exemplary human Sirtό target sequences for siRNAs may comprise, consist essentially of or consist of one of the following sequences: AAGCGGCCTCAACAAGGGAAA (starting at nucleotide 12); AACAAGGGAAACTTTATTGTT (starting at nucleotide 22) ; AAGGGAAACTTTATTGTTCCC (starting at nucleotide 25); AAACTTTATTGTTCCCGTGGG (starting at nucleotide 30); AATTACGCGGCGGGGCTGTCG (starting at nucleotide 70); AAGTTCGACACCACCTTTGAG (starting at nucleotide 301); AAACTGGCAGAGCTCCACGGG (starting at nucleotide 442); and

AAGGCAAGGGGGCTGCGAGCC (starting at nucleotide 568). Any other target sequence may be identified according to methods known in the art. For example, software for identifying siRNA target sequences is available at www.ambion.com/techlib/misc/siRNA_finder.html and several other sites for designing siRNAs are set forth in www.maiweb.com.

An siRNA may comprise one or more chemical modifications and/or nucleotide analogues. The modification and/or analogue may be any modification and/or analogue, respectively, that does not negatively affect the ability of the siRNA to inhibit IMP3

expression. The inclusion of one or more chemical modifications and/or nucleotide analogues in an siRNA may be preferred to prevent or slow nuclease digestion, and in turn, create a more stable siRNA for practical use. Chemical modifications and/or nucleotide analogues which stabilize RNA are known in the art. Phosphorothioate derivatives, which include the replacement of non-bridging phosphoroyl oxygen atoms with sulfur atoms, are one example of analogues showing increased resistance to nuclease digestion. Sites of the siRNA which may be targeted for chemical modification include the loop region of a hairpin structure, the 5' and 3' ends of a hairpin structure (e.g. cap structures), the 3' overhang regions of a double-stranded linear siRNA, the 5' or 3' ends of the sense strand and/or antisense strand of a linear siRNA, and one or more nucleotides of the sense and/or anti sense strand. siRNAs may be administered to a cell or tissue or subject. Alternatively, a nucleic acid encoding an siRNA is introduced or administred to a cell or tissue or subject, e.g., using a vector, e.g., a viral vector. A vector may comprise a constitutive or an inducible promoter. Generally, siRNA delivery systems include viral and non-viral systems.

Examples of suitable viral systems include adenoviral vectors, adeno-associated virus, lentivirus, poxvirus, retroviral vectors, vaccinia, herpes simplex virus, HFV, the minute virus of mice, hepatitis B virus and influenza virus. Exemples of non-viral delivery systems include, for example, uncomplexed DNA or RNA, DNA or RNA-liposome complexes, DNA or RNA-protein complexes and DNA or RNA-coated gold particles, bacterial vectors such as salmonella, and other technologies such as those involving VP22 transport protein, Co-X-gene, and replicon vectors.

Publications describing RNAi technology include: U.S. Pat. No. 6,686,463, U.S. Pat. No. 6,673,611, U.S. Pat. No. 6,623,962, U.S. Pat. No. 6,506,559, U.S. Pat. No. 6,573,099, and U.S. Pat. No. 6,531,644; U.S. publication Nos: 20030153519,

20030167490, International Publication Numbers WO04061081; WO04052093; WO04048596; WO04048594; WO04048581; WO04048566; WO04046320; WO04044537; WO04043406; WO04033620; WO04030660; WO04028471; WO 0175164; Brummelkamp Science 296: 550-553 (2002); Caplen Expert Opin. Biol. Ther. 3:575-86 (2003); Brummelkamp, Sciencexpress 21 Mar. 3 1-6 (2003); Yu Proc Natl Acad Sci USA 99:6047-52 (2002); Paul Nature Biotechnology 29:505-8 (2002); Paddison Proc Natl Acad Sci USA 99:1443-8 (2002); Brummelkamp Nature 424: 797-801 (2003); Brummelkamp,

Science 296: -550-3 (2003); Sui Proc Natl Acad Sci USA 99: 5515-20 (2002); and Paddison, Genes and Development 16:948-58 (2002).

In another embodiment, the level of Sirt6 or Sirtό expression is reduced or decreased by administration or the expression of antisense molecules in a subject or tissue or cell thereof. Antisense molecules may be antisense DNA or RNA or those resulting in triple-helix formation An antisense nucleic acid molecule which is complementary to a nucleic acid molecule encoding Sirt6 can be designed based on the known Sirtό nucleotide sequences. An antisense nucleic acid molecule can comprise a nucleotide sequence which is complementary to a coding strand of a nucleic acid, e.g. complementary to an mRNA sequence, constructed according to the rules of Watson and Crick base pairing, and can hydrogen bond to the coding strand of the nucleic acid. The antisense sequence complementary to a sequence of an mRNA can be complementary to a sequence in the coding region of the mRNA or can be complementary to a 5' or 3' untranslated region of the mRNA. Furthermore, an antisense nucleic acid can be complementary in sequence to a regulatory region of the gene encoding the mRNA, for instance a transcription initiation sequence or regulatory element. An antisense nucleic acid may be complementary to a region preceding or spanning the initiation codon or in the 3' untranslated region of an mRNA.

In another embodiment, ribozymes are used to inhibit expression of Sirtδ. Yet other agents that can be used to inhibit Sirtό expression or reduce Sirtδ protein levels or activity include anti-Sirt6 antibodies, e.g., intrabodies, single chain antibodies, and aptamers. Aptamers can be produced using the methodology disclosed in a U.S. Pat. No. 5,270,163 and WO 91/19813. An antibody (or other inhibitors or intrabody) can be administered intracellularly as described in, e.g., Marasco and Haseltine in PCT WO94/02610. An antibody may comprise a nuclear localization sequence, e.g., an SV40 nuclear localization signal. Other Sirtό inhibitors include dominant negative mutants of Sirtό, e.g., a SIRT6 protein or portion thereof, in which the histidine at position 133 or the serine residue at position 56 is changed to another amino acid. For example, a dominant negative mutant of human Sirtό is a human Sirtό or portion thereof having one or both of the following mutations: S56A and H133Y (see Liszt et al., infra). Other Sirtό inhibitors include Sirtό target proteins or peptides thereof. Sirtό target peptides are fragments of Sirtό target proteins that are ribosylated by Sirtό, a high level of which in a cell, would titrate out the activity of Sirtό, preventing ribosylation of the target proteins in the cell. Peptides may be

about 5-10; 10-15, 15-20, 20-25 amino acids long or longer. Target peptides maybe identified according to methods known in the art.

Yet other Sirtό inhibitors may be identified by screening methods. A screening method may involve Sirtό or a portion thereof or a functional homolog thereof. Exemplary assays for determining the ability of a compound to inhibit Sirtό, such as its function as a ribosyltransferase, are further described herein as well as in, e.g., in Liszt et al. (2005) J. Biol. Chem. 280:21313.

In many embodiments, an agent that inhibits Sirtβ is an agent that inhibits Sirt6 activity by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90%, or more, compared to the Sirtό activity in the absence of the agent.

Exemplary methods of treatment and prevention Target proteins of Sirtό ribosylation include histones, nucleoplasmin, and the two tumor suppressors, ARF and p53. Nucleoplasmins are involved in histone binding, chromatin remodeling, embryonic development, fertilization, oocyte differentiation, regulation of meiosis, regulation of translation, and they interact with the reverse transcriptase and Tat of human immunodeficiency virus 1 (HIV-I). Accordingly, modulators of Sirtό ribosylation activity may be used for affecting reproduction, aging, cell growth, and for treating or preventing HIV-I infections. Based on the fact that Sirtό ribosylates tumor suppressors, Sirtό modulators may be used for treating or preventing cancer.

Generally, provided herein are methods for treating or preventing hyper- proliferative diseases by inhibiting or reducing the protein level or activity of a sirtuin

ADP-ribosyltransferase, e.g., Sirtό. In one embodiment, a method comprises administering to a subject in need thereof a therapeutically effective amount of an agent that inhibits Sirtό or a Sirtό dependent ribosylation pathway, such as an agent that decreases Sirtό activity or protein level. "Treating" a subject refers to curing, or improving at least one symptom of the disease or preventing the disease or a symptom thereof to worsen. For example, treating cancer in a subject includes reducing or maintaining tumor load; reducing metastasis; or curing the subject. The method may also be used prophylactically to prevent the occurrence of a disease, e.g., cancer.

An "effective amount" of an agent refers to an amount of an agent which, when applied as part of a desired dosage regimen brings about a decrease in the rate of cell proliferation and/or the state of the disease, so as to produce a result according to clinically acceptable standards for the disorder to be treated. The agents described herein can be administered in a "growth inhibitory amount," i.e., an amount of the compound that is pharmaceutically effective to inhibit or decrease proliferation of target cells.

Generally, the agents described herein can be used to normalize, e.g., inhibit or block the proliferation of cells, in particular, cells that are subject to abnormal growth. "Abnormal growth of cells" means cell growth independent of normal regulatory mechanisms (e.g., loss of contact inhibition), including abnormal growth resulting form expression of an oncogene. The agents described herein may be used for reducing or eliminating excessive cell proliferation. The phrase "excessive cell proliferation," used interchangeably herein with "hyper-proliferation" of cells refers to cells, which divide more often than their normal or wild-type counterpart or which are not sensitive to normal mechanisms of growth control. For example, cells are excessively proliferating when they double in less than 24 hours if their normal counterparts double in 24 hours. Excessive proliferation can be detected by simple counting of the cells, with or without specific dyes, or by detecting DNA replication or transcription, such as by measuring incorporation of a labeled molecule or atom into DNA or RNA. Generally, unwanted cell proliferation can be reduced or eliminated as described herein. The phrase "unwanted cell proliferation" refers to cell proliferation that is undesirable. Unwanted cell proliferation can refer to cells that are proliferating normally and to cells which are proliferating abnormally, such as cancerous cells. For example, a wart is a tissue in which unwanted epithelial cell proliferation is occurring. Methods described herein may be used for inhibiting cell proliferation, i.e., for decreasing the rate of cell division, by arresting or slowing down the cell cycle. The phrase refers to complete blockage of cell proliferation, i.e., cell cycle arrest, as well as to a lengthening of the cell cycle. For example, the period of a cell cycle can be increased by about 10%, about 20%, about 30, 40, 50, or 100%. The duration of the cell cycle can also be augmented by a factor of two, three, 4, 5, 10 or more.

Methods described herein may also be used for normalizing cell proliferation, i.e., reducing the rate of cell proliferation of a cell that proliferates excessively relative to that of its normal or wild-type counterpart.

Methods described herein may also be used for suppressing an oncogenic phenotype of a cell, i.e., reducing the transforming, tumorigenic or metastatic potential of the cell. A "transformed cell" refers to a cell which was converted to a state of unrestrained growth, i.e., they have acquired the ability to grow through an indefinite , number of divisions in culture. Transformed cells may be characterized by such terms as neoplastic, anaplastic and/or hyperplastic, with respect to their loss of growth control. Transformed cells include cancer cells, cells infected by a microorganism, e.g., viruses, such as retroviruses.

Methods described herein may also be used to decrease the rate of proliferation of immortalized cells, e.g., cells which have been altered via chemical and/or recombinant means such that the cells have the ability to grow through an indefinite number of divisions in culture.

Exemplary diseases or disorders that may be treated by the methods described herein include "proliferative disorders" and "hyper-proliferative disorders," i.e., any disease/disorder of a tissue marked by unwanted or aberrant proliferation of at least some cells in the tissue. Whether a proliferative disorder is a hyper-proliferative disorder depends on how excessive the cell growth is. For example cancer is a hyper-proliferative disorder. Other proliferative diseases include benign diseases or disorders, such as warts or other benign tumors. A preferred therapeutic effect provided by the instant composition is the treatment of cancer and specifically the inhibition of cancerous tumor growth and/or the regression of cancerous tumors. Exemplary cancers include carcinomas, e.g., basal cell carcinomas, squamous cell carcinomas, carcinosarcomas, adenocystic carcinomas, epidermoid carcinomas, nasopharyngeal carcinomas, renal cell carcinomas, papillomas, and epidermoidomas. Exemplary cancers are those of the brain including glioblastomas, medulloblastoma, astrocytoma, oligodendroglioma, ependymomas; kidney; colon; lung; liver; pancreas; endometrium; spleen; small intestine; stomach; skin; head and neck; esophagus; hormone-dependent cancers including breast, prostate, testicular, and ovarian cancers; lymphomas (lymph node); and leukemias including cancer of blood cells and bone marrow. Other examples of cancers that can be treated include acral lentiginous melanoma, actinic keratoses, adenocarcinoma, adenoid cycstic carcinoma, adenomas, adenosarcoma, adenosquamous carcinoma, astrocytic tumors, bartholin gland carcinoma, basal cell carcinoma, bronchial gland carcinomas, capillary, carcinoids, carcinoma,

carcinosarcoma, cavernous, cholangiocarcinoma, chondrosarcoma, choriod plexus papilloma/carcinoma, clear cell carcinoma, cystadenoma, endodermal sinus tumor, endometrial hyperplasia, endometrial stromal sarcoma, endometrioid adenocarcinoma, ependymal, epitheloid, Ewing's sarcoma, fibrolamellar, focal nodular hyperplasia, gastrinoma, germ cell tumors, glioblastoma, glucagonoma, hemangiblastomas, hemangioendothelioma, hemangiomas, hepatic adenoma, hepatic adenomatosis, hepatocellular carcinoma, insulinoma, intaepithelial neoplasia, interepithelial squamous cell neoplasia, invasive squamous cell carcinoma, large cell carcinoma, leiomyosarcoma, lentigo maligna melanomas, malignant melanoma, malignant mesothelial tumors, medulloblastoma, medulloepithelioma, melanoma, meningeal, mesothelial, metastatic carcinoma, mucoepidermoid carcinoma, neuroblastoma, neuroepithelial adenocarcinoma nodular melanoma, oat cell carcinoma, oligodendroglial, osteosarcoma, pancreatic polypeptide, papillary serous adenocarcinoma, pineal cell, pituitary tumors, plasmacytoma, pseudosarcoma, pulmonary blastoma, renal cell carcinoma, retinoblastoma, rhabdomyosarcoma, sarcoma, serous carcinoma, small cell carcinoma, soft tissue carcinomas, somatostatin-secreting tumor, squamous carcinoma, squamous cell carcinoma, submesothelial, superficial spreading melanoma, undifferentiatied carcinoma, uveal melanoma, verrucous carcinoma, vipoma, well differentiated carcinoma, and Wilm's tumor. Preferred cancers that can be treated with Sirtδ inhibitors include prostate cancer and epithelial cell derived cancers, such as skin and lung cancers.

In cancers associated with solid tumors, a Sirtό inhibitory agent may be administered directly into the tumor. Cancer of blood cells, e.g., leukemia can be treated by administering a Sirtό inhibitory agent into the blood stream or into the bone marrow. As shown in the Examples, reducing SIRT6 reduces the migration of cancerous cells and suppresses their invasiveness, which are markers of metastasis. Accordingly, the methods described herein may also be used for treating or preventing metastasis of tumors, in addition to treating or preventing primary tumors. Methods may also be used for reducing or preventing migration of cancer cells and/or their invasiveness. Other types of proliferative disorders that can be treated according to the invention include non malignant cell proliferative disorders, e.g., benign cancers, neurofibromatosis; glaucoma; psoriasis; rheumatoid arthritis; restenosis; inflammatory bowel disease; chemotherapy-induced alopecia and mucositis; keratoacanthoma and actinic keratosis;

smooth muscle cell hyper-proliferation, e.g., in atherosclerosis and restenosis; inhibiting vascularization, e.g., in tumors; cell hyper-proliferations stimulated by, e.g., hepatitis C or delta and related viruses, and papilloma viruses (HPV); hyperplastic epidermal conditions, such as keratosis; autoimmune diseases; atopic dermatosis; dermatitis; lens epithelial cell proliferation, e.g., to prevent post-operative complications of extracapsular cataract extraction; corneopathies, e.g., marked by corneal epithelial cell proliferation, as for example in ocular epithelial disorders such as epithelial downgrowth or squamous cell carcinomas of the ocular surface; trichosis, e.g. hypertrichosis; hirsutism; inflammatory diseases; infectious diseases; asthma, allergies, e.g., allergic rhinitis; excema; fibromas; and warts.

The methods described herein may be used for treating or preventing proliferative skin disorders, e.g., any disease/disorder of the skin marked by unwanted or aberrant proliferation of cutaneous tissue, e.g., X-linked ichthyosis, psoriasis, atopic dermatitis, allergic contact dermatitis, epidermolytic hyperkeratosis, epidermodysplasia, epidermolysis, and seborrheic dermatitis.

Examples of autoimmune diseases that may be treated or prevented as described herein include active chronic hepatitis, addison's disease, anti-phospholipid syndrome, atopic allergy, autoimmune atrophic gastritis, achlorhydra autoimmune, celiac disease, Crohn's disease, cushing's syndrome, dermatomyositis, diabetes (type I), discoid lupus, erythematosis, goodpasture's syndrome, grave's disease, hashimoto's thyroiditis, idiopathic adrenal atrophy, idiopathic thrombocytopenia, insulin-dependent diabetes, lambert-eaton syndrome, lupoid hepatitis, some cases of lymphopenia, mixed connective tissue disease, multiple sclerosis, pemphigoid, pemphigus vulgaris, pernicious anema, phacogenic uveitis, polyarteritis nodosa, polyglandular auto, syndromes, primary biliary cirrhosis, primary sclerosing cholangitis, psoriasis, raynaud's syndrome, reiter's syndrome, relapsing polychondritis, rheumatoid arthritis, Schmidt's syndrome, limited scleroderma (or crest syndrome), severe combined immunodeficiency syndrome (SCID), Sjogren's syndrome, sympathetic ophthalmia, systemic lupus erythematosis, takayasu's arteritis, temporal arteritis, thyrotoxicosis, type b insulin resistance, ulcerative colitis and Wegener's granulomatosis, in which it is desirable to eliminate autoimmune cells.

The compounds of this invention may be administered to mammals, preferably humans, either alone or, preferably, in combination with pharmaceutically acceptable carriers, excipients or diluents, in a pharmaceutical composition, according to standard

pharmaceutical practice. The compounds can be administered orally or parenterally, including intravenously, intramuscularly, intraperitoneally, subcutaneously, rectally and topically. In one embodiment, one or more compounds are injected directly into a tumor of a subject to be treated. A subject in need of therapy may be a subject having been diagnosed with a disease, e.g., cancer. A subject may also be a subject who has been determined as being likely to develop cancer, e.g., a subject having a gene indicating susceptibility of developing the disease, or a subject in whose family the disease is more frequent than normal. A subject in need of Sirtβ inhibitory therapy may also be a subject having cancer that is likely to metastasize.

In another embodiment, cells can be obtained from a subject, e.g., a human or other mammal, treated ex vivo according to the methods of the invention to remove undesirable cells, e.g., cancer cells, and then administered to the same or a different subject. Accordingly, cells or tissues may be obtained from a donor, treated ex vivo as described herein and administered to the same or different subject. In certain embodiments, cells are incubated with an agent described herein in the presence of a drug, e.g., a chemotherapeutic drug, such as to increase the susceptibility of the cells to the effect of the drug. An exemplary situation in which one may use this method is in purging bone marrow (or blood) obtained from a cancer patient from cancer cells. A method may also be used to purge bone marrow or blood from autoimmune cells.

In the context of reducing unwanted cell proliferation, and reducing tumor mass, an effective amount of an agent that inhibits Sirtό may be an amount that reduces the level and/or rate of cell proliferation and/or reduces tumor mass by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 80%, at least about 85%, or at least about 90%, or more, compared to the level and/or rate of cell proliferation and/or tumor mass in the absence of treatment with an agent that inhibits Sirtβ.

Whether in vitro, ex vivo, or in vivo, a cell may also be contacted with more than one agent, e.g., a compound. A cell may be contacted with at least 2, 3, 5, or 10 different agents. A cell may be contacted simulatenously or sequentially with different agents. In one embodiment, a Sirt6 inhibitory agent is administered as part of a combination therapy with another therapeutic agent. In an exemplary embodiment, the second therapeutic

agent is another Sirtό inhibitory agent, such as nicotinamide or sirtinol, and/or an agent that kills cells. Such combination therapies may be administered simultaneoulsy (e.g., more than one therapeutic agent administered at the same time) or sequentially (e.g., different therapeutic agents administered at different times during a treatment regimen). Chemotherapeutic agents that may be coadministered with agents, e.g., compounds, described herein include: aminoglutethimide, amsacrine, anastrozole, asparaginase, beg, bicalutamide, bleomycin, buserelin, busulfan, campothecin, capecitabine, carboplatin, carmustine, chlorambucil, cisplatin, cladribine, clodronate, colchicine, cyclophosphamide, cyproterone, cytarabine, dacarbazine, dactinomycin, daunorubicin, dienestrol, diethylstilbestrol, docetaxel, doxorubicin, epirubicin, estradiol, estramustine, etoposide, exemestane, filgrastim, fludarabine, fludrocortisone, fluorouracil, fluoxymesterone, flutamide, gemcitabine, genistein, goserelin, hydroxyurea, idarubicin, ifosfamide, imatinib, interferon, irinotecan, ironotecan, letrozole, leucovorin, leuprolide, levamisole, lomustine, mechlorethamine, medroxyprogesterone, megestrol, melphalan, mercaptopurine, mesna, methotrexate, mitomycin, mitotane, mitoxantrone, nilutamide, nocodazole, octreotide, oxaliplatin, paclitaxel, pamidronate, pentostatin, plicamycin, porfimer, procarbazine, raltitrexed, rituximab, streptozocin, suramin, tamoxifen, temozolomide, teniposide, testosterone, thioguanine, thiotepa, titanocene dichloride, topotecan, trastuzumab, tretinoin, vinblastine, vincristine, vindesine, and vinorelbine. These chemotherapeutic agents may be categorized by their mechanism of action into, for example, following groups: anti-metabolites/anti-cancer agents, such as pyrimidine analogs (5-fluorouracil, floxuridine, capecitabine, gemcitabine and cytarabine) and purine analogs, folate antagonists and related inhibitors (mercaptopurine, thioguanine, pentostatin and 2-chlorodeoxyadenosine (cladribine)); antiproliferative/antimitotic agents including natural products such as vinca alkaloids (vinblastine, vincristine, and vinorelbine), microtubule disruptors such as taxane (paclitaxel, docetaxel), vincristin, vinblastin, nocodazole, epothilones and navelbine, epidipodophyllotoxins (teniposide), DNA damaging agents (actinomycin, amsacrine, anthracyclines, bleomycin, busulfan, camptothecin, carboplatin, chlorambucil, cisplatin, cyclophosphamide, Cytoxan, dactinomycin, daunorubicin, docetaxel, doxorubicin, epirubicin, hexamethylmelamineoxaliplatin, iphosphamide, melphalan, merchlorethamine, mitomycin, mitoxantrone, nitrosourea, paclitaxel, plicamycin, procarbazine, teniposide, triethylenethiophosphorarnide and etoposide (VP 16)); antibiotics such as dactinomycin (actinomycin D), daunorubicin,

doxorubicin (adriamycin), idarubicin, anthracyclines, mitoxantrone, bleomycins, plicamycin (mithxamycin) and mitomycin; enzymes (L-asparaginase which systemically metabolizes L-asparagine and deprives cells which do not have the capacity to synthesize their own asparagine); antiplatelet agents; antiproliferative/antimitotic alkylating agents such as nitrogen mustards (mechlorethamine, cyclophosphamide and analogs, melphalan, chlorambucil), ethylenimines and methylmelamines (hexamethylmelamine and thiotepa), alkyl sulfonates-busulfan, nitrosoureas (carmustine (BCNU) and analogs, streptozocin), trazenes - dacarbazinine (DTIC); antiproliferative/antimitotic antimetabolites such as folic acid analogs (methotrexate); platinum coordination complexes (cisplatin, carboplatin), procarbazine, hydroxyurea, mitotane, aminoglutethimide; hormones, hormone analogs (estrogen, tamoxifen, goserelin, bicalutamide, nilutamide) and aromatase inhibitors (letrozole, anastrozole); anticoagulants (heparin, synthetic heparin salts and other inhibitors of thrombin); fibrinolytic agents (such as tissue plasminogen activator, streptokinase and urokinase), aspirin, COX-2 inhibitors, dipyridamole, ticlopidine, clopidogrel, abciximab; antimigratory agents; antisecretory agents (breveldin); immunosuppressives (cyclosporine, tacrolimus (FK-506), sirolimus (rapamycin), azathioprine, mycophenolate mofetil); anti- angiogenic compounds (TNP -470, genistein) and growth factor inhibitors (vascular endothelial growth factor (VEGF) inhibitors, fibroblast growth factor (FGF) inhibitors, epidermal growth factor (EGF) inhibitors); angiotensin receptor blocker; nitric oxide donors; anti-sense oligonucleotides; antibodies (trastuzumab); cell cycle inhibitors and differentiation inducers (tretinoin); mTOR inhibitors, topoisomerase inhibitors (doxorubicin (adriamycin), amsacrine, camptothecin, daunorubicin, dactinomycin, eniposide, epirubicin, etoposide, idarubicin, irinotecan (CPT-11) and mitoxantrone, topotecan, irinotecan), corticosteroids (cortisone, dexamethasone, hydrocortisone, methylpednisolone, prednisone, and prenisolone); growth factor signal transduction kinase inhibitors; mitochondrial dysfunction inducers and caspase activators; chromatin disrupters.

Methods for the safe and effective administration of most of these chemotherapeutic agents are known to those skilled in the art. In addition, their administration is described in the standard literature. For example, the administration of many of the chemotherapeutic agents is described in the "Physicians' Desk Reference" (PDR), e.g., 1996 edition (Medical Economics Company, Montvale, NJ. 07645-1742, USA).

Radiation therapy, including x-rays or gamma rays which are delivered from either

an externally applied beam or by implantation of tiny radioactive sources, may also be used in combination with an agent described herein to treat cancer.

Modulators of sirtuin ribosyltransferases may be used for treating or preventing a variety of diseases or disorders. For example, since a target protein of Sirt4 is glutamate dehydrogenase (GDH), agents that modulate ribosylation activity of Sirt4 may be used for treating or preventing disorders that are associated with GDH. GDH has, in particular, been shown to play an important role in insulin secretion, as evidenced in children by gain of function mutations of this enzyme that cause a hyperinsulinism-hyperammonernia syndrome (GDH-HI) and sensitize beta-cells to leucine stimulation (Li et al. J Biol Chem. 2006 Jun 2;281 (22): 15064). Thus, Sirt4 ribosylation modulators may be used to regulate insulin production and treat or prevent, e.g., diabetes such as type I diabetes. Since ribosylation of GDH inhibits or represses it, and that Sirt4 ribosylates GDH, Sirt4 inhibits or represses GDH. Therefore, Sirt4 and agents that stimulate Sirt4 or increase its protein level may be used for treating or preventing diseases that are associated with a hyperactive GDH 5 e.g., GDH-HI, and may be used for reducing insulin levels. On the other hand, inhibitors of Sirt4 may be used for treating or preventing diseases that are associated with a hypoactive GDH and may be used for increasing insulin levels. Other metabolic diseases may also be treated.

Also provided herein are methods for regulating signalling pathways or the expression of certain genes in a cell. A method may comprise contacting a cell with an agent that modulates the protein level or activity of Sirtό in the cell. Signalling pathways and genes that may be modulated inclue IGFBP3, Adenylate cyclase 3, Braf, Rho GTPase activating protein 1 and the vitamin D receptor (see Fig. 14).

Yet other methods provided herein include the use of the genes that are described herein as being up- or down-regulated by Sirtό inhibition (see Examples) as biomarkers for Sirt6 modulation in cells or in vivo. A method may comprise determining the level of expression of 1, 2, 3, 4, 5, or from about 1-5, 1-10, 1-20, 1-50 genes listed in Figures 12-14, and comparing their expression level to that in a control, e.g., corresponding wild-type cells, wherein a difference in expression of these one or more genes relative to that in the control indicates that the expression or activity of Sirtό is either higher or lower relative to the control. For example, cells in which Sirtό expression or activity is down-regulated will have a profile of gene expression that is significantly similar to that described in the Examples. Determining the level of expression of the genes that are biomarkers can be

done, e.g., by measuring their mRNA level, such as with microarray analysis, Western blot or PCT, e.g., RT-PCR.

Exemplary kits All the essential materials and reagents required for administering the agents described herein may be assembled together in a kit. When the components of the kit are provided in one or more liquid solutions, the liquid solution preferably is an aqueous solution, with a sterile aqueous solution being particularly preferred.

For in vivo use, as discussed below, the agents may be provided in combination with one or more other drugs, e.g., chemo- or radiotherapeutic agent. These normally will be a separate formulation, but may be formulated into a single pharmaceutically acceptable composition. The container means may itself be geared for administration, such as an inhalant, syringe, pipette, eye dropper, or other such like apparatus, from which the formulation may be applied to an infected area of the body, such as the lungs, or injected into an animal, or even applied to and mixed with the other components of the kit.

The compositions of these kits also may be provided in dried or lyophilized forms. When reagents or components are provided as a dried form, reconstitution generally is by the addition of a suitable solvent. It is envisioned that the solvent also may be provided in another container means. The kits of the invention may also include an instruction sheet defining administration of the agent and, e.g., explaining how the agent will decrease proliferation of cells.

The kits of the present invention also will typically include a means for containing the vials in close confinement for commercial sale such as, e.g., injection or blow-molded plastic containers into which the desired vials are retained. Irrespective of the number or type of containers, the kits of the invention also may comprise, or be packaged with a separate instrument for assisting with the injection/administration or placement of the ultimate complex composition within the body of an animal. Such an instrument may be an inhalant, syringe, pipette, forceps, measured spoon, eye dropper or any such medically approved delivery vehicle. Other instrumentation includes devices that permit the reading or monitoring of compound levels or reactions in vitro.

All publications, patents, patent applications, and GenBank Accession numbers mentioned herein are hereby incorporated by reference in their entirety as if each individual

publication or patent was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including any definitions herein, will control.

The present invention is further illustrated by the following examples which should not be construed as limiting in any way.

Examples

Example 1 : Isolation of ribosylation targets

Cells over-expressing SIRT6 or SIRT7 or no sirtuin (control) were contacted with biotin-NAD+ for 60 minutes at 37°C. The cells were first lysed in the following hypotonic lysis buffer is : Buffer A: 10 mM Hepes, pH 7.9, 1OmM KCl, 1.5mM MgC12, 0.5mM DTT.

Avidin coated beads were added to the cell lysates, mixed with the cell lysates and the beads were then separated from the cell lysate. The proteins linked to the beads were eluted and these were subjected to a Western blot analysis using avidin or to a gel separation followed by silver staining of the gel. The results are shown in Fig. 2. The results clearly indicate that some proteins are only present in the cells that over-expressed SIRT6 or

SIRT7.

Proteins visualized on the silver stained gel were then separated from the gel and subjected to spectroscopy as follows. Proteins were visualized on silver-stained polyacrylamide gels (5-20%) and individual bands that were greater in intensity than the

"no SIRT overexpression control" lane were excised with a scalpel, eluted from the gel, digested with proteases and subjected to Mass spectormetry for identification according to standard mass spectrometry methods.

Example 2: Inhibition of Sirt6 reduces prostate cancer cell oncogenic properties

Cells from the TRAMP-C2 prostate cancer cell line were stably transformed with a lenti viral shRNA vector targeting the Sirtό gene. This cell line is a mouse transgenic prostate cancer model driven by the large T antigen.

The lentiviral vector is described in Araki et al. (2004) Science 305:1010. This vector was generated from the FUGW backbone by replacing the ubiquitin promoter and GFP cDNA with the human U6 promoter and Pol I termination signal followed by the SV40 promoter-puromycin-N-acetyl transferase gene. The nucleotide sequence from Sirtό and its complement that were inserted into the vector for expression of siRNA

corresponded to nucleotides 1390-1408 of human Sirtβ nucleotide sequence. These were under the control of the U6 promoter (S2). A fixed number of cells were grown in culture and subsequently stained with Crystal Violet dye.

TRAMP-C2 cells were transformed by viral infection (overnight incubation in the presence of polybrene), followed by selection with puromycin 48 hours after infection.

The results, which are shown in Figs. 5-7, show that inhibiting the expression of Sirtό dramatically reduces colony growth (foci formation) in soft agar.

In another example, the effects of SIRTl , 6 and 7 knockdown and over-expression was tested on the invasive potential of RS485 prostate cancer cells, as described above for the TRAMP cells. The results are shown in Fig. 9.

Using shRNA, SIRT6 was stably knocked down to about 30-40% in TRAMP prostate cells (confirmed via Western blot and quantitative RT-PCR) (see Fig. 10), in order to further investigate the observations of Fig. 9.

Example 3: SIRT6 knockdown reduces chemotaxis and invasive potential

Cell migration (chemotaxis) was measured using a commercial assay from Cell Biolabs. As show in Fig. 11 panel A, knockdown of SIRT6 significantly reduced migration through a polycarbonate membrane (about 50%). Invasive potential through a Boyden chamber was measured using a kit from Cell Biolabs. As shown in Fig. 11, panels B and C, knockdown of SIRT6 suppressed invasiveness by approximately 50%. Increased cellular migration/invasion are markers for metastatic cancer.

Example 4: Inhibition of Sirtό in a xenograft reduces its cancerous growth

2.5 x 10 6 TRAMP-C2 prostate cancer cells stably transformed with a lentiviral shRNA vector targeting the Sirtό gene (described above) were injected into subcutaneous tissue on the right flank of mice. One month after injection, the tumors were removed from the mice and their size was determined. As shown in Fig. 8, cells that contained a vector only generated a tumor that was much larger than the tumor that was generated after injection of cells in which Sirt 6 was downregulated. These results show that inhibiting Sirtό in a tumor reduces its growth potential.

Thus, this xenograft experiment suggests that knockdown of SIRT6 may also suppress anchorage-independent growth in vivo. This result suggests that SIRT6 regulates a major oncogenic pathway.

Example 5: Microarrav analysis of genes modified in SIRT6 knockdown cells

Microarray analysis comparing prostate cancer (TRAMP) cells and prostate cancer cells in which SIRT6 is knocked down was performed using an Affymetrix Mouse 430 chip. The results, which are shown in Fig. 12, show that several genes involved in cellular migration are modified in SER.T6 knockdown cells.

Microarray was also used for comparing the expression of genes involved in cell motility and chemotaxis in prostate cancer (TRAMP) cells. The results, which are shown in

Figs. 13 and 14, show that genes involved in cell motility and chemotaxis are also modified when SIRT6 is knocked down. Several of these genes have been reported to play a role in cancer cell metastasis.

Example 6: Identification of signalling pathways that are deregulated when SIRT6 is knocked down The role of the genes identified in the microarray experiments described above was further investigated via qRT-PCR. In these experiments, the experssion of the genes set forth in Fig. 15 was measured via qRT-PCR in control TRAMP cells and SIRT6 knockdown TRAMP cells. The results are shown in Fig. 15 and indicate that several signalling pathways are deregulated when SIRT6 is knocked down. Most notably, the Braf oncogene, which regulates the MAPK cascade, is decreased by about 50% in SIRT6 knockdown TRAMP cells. It is our hypothesis that suppression of MAPK signalling by knockdown of SIRT6 results in a decreased invasive potential and decreased transformative potential of prostate cancer cells.

Example 7: SIRT6 is expressed at the protein level in both normal and cancerous prostate tissue

Histological analysis has revealed that SIRT6 is expressed at the protein level in both normal and cancerous prostate tissue, thus making it a viable target for inactivation with small molecules.

Equivalents

Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the specific embodiments of the invention

described herein. Such equivalents are intended to be encompassed by the following claims.