7: 663-698). Programmed cell death occurs both in vertebrate and invertebrate species and is characterized by unique morphological alterations, such as cytoplasmic contraction and chromatin condensation, as well as by specific DNA cleavage into oligonucleosomal fragments. Unlike necrosis, programmed cell death or apoptosis is an irreversible process which in most systems appears to depend on the expression of a specific set of novel"death genes". Deregulation of this process contributes to the pathogenesis of several diseases including neurodegenerative disorders, cancer, immunodeficiency, and autoimmune diseases (Thompson C. B. et al. (1995) Science 267: 1456).

Calcium is believed to play an important regulatory function in programmed cell death or apoptosis (Trump B. F. et al. (1992) Curr. Opin. Cell Biol. 4: 227-232). Early evidence came from studies which demonstrated that sustained elevation of cytosolic calcium was capable of inducing apoptosis in thymocytes (Durant S. et al. (1980) Biochem. Biophys. Res. Commun. 93: 385-391). A sustained increase in calcium concentration is capable of activating a number of potentially harmful processes in the cell. Some of these processes include the activation of hydrolytic enzymes, such as phospholipase A2, calcium-activated proteases, and calcium-activated endonucleases; the destabilization of the cytoskeleton; the disruption of cell junctions leading to decreased or absent cell-cell communication; and the activation of expression of immediate-early genes, such as c-fos, cjun, and c-myc (Zhong L. T. et al. (1993) Proc.

Natl. Acad. Sci. USA 90: 4533-4573).

Several mechanisms may interact to deregulate intracellular calcium concentration. Initially, such interaction may be organelle specific, e. g., anoxia inhibiting mitochondrial respiration, thapsigargin inhibiting the ER Ca2+-ATPase

(Thastrup, O. et al (1990) Proc. Natl. Acad. Sci. USA 87 2466-2470), or activated complement permeabilizing the plasma membrane.

Increased cytosolic ionized sodium concentration can also effect cytosolic calcium concentration because of the importance of Na+/Ca2+ exchange in many cells (Snowdowne, K. W. et al. (1985) J. Biol. Chem. 260,14998-15007). Increased cytosolic sodium concentration can also result in the increase of pHi through activation of the Na+/H+ exchange. Decreased pHi significantly retards the rate of progression of cell death following injury in a variety of cells, probably by antagonizing Ca2+ mediated effects on phospholipases, proteases, and endonucleases, whereas increased pHi often accelerates the progress toward cell death.

Moreover, activation of membrane receptors by ligand binding and interaction with G proteins often results in activation of PLC-P and PLC-y. This in turn mediates, among other things, the formation of inositol 1,4,5,-triphosphate (IP3) and 1,2- diacylglycerol. IP3 in turn, mediates release of Ca2+ from the ER which, through the formation of a calcium influx factor, can result in increased Ca2+ entry into the cell.

Summary of the Invention This invention provides, at least in part, novel nucleic acid molecules encoding proteins which modulate programmed cell death, e. g., programmed cell death in cells that express these proteins. Examples of nucleic acid molecules encoding such proteins include human ALG-2LP, monkey ALG-2LP, and mouse ALG-2LP, which are also referred to herein as apoptosis linked gene-2 like proteins (ALG-2LP). In a preferred embodiment, the hALG-2LP, sALG-2LP, and mALG-2LP proteins interact with (e. g., bind to) a protein, or a portion or subunit thereof, which is a member of a programmed cell death transduction pathway.

ALG-2 was first identified in a screen for genes involved in apoptosis and has subsequently been shown, in antisense experiments, to be required for cell death induced by fas ligand (Vito P. et al. (1996) Science 271: 521-525). ALG-2 comprises 191 amino acids, containing two canonical calcium binding EF-hand structures.

The presently disclosed proteins have sequence homology with ALG-2 and are therefore likely to participate in similar biological processes, e. g., modulate programmed cell death.

Thus, apoptosis linked gene-2-like protein molecules, e. g., hALG-2LP, sALG- 2LP, and mALG-2LP, can be used to modulate the activity of programmed cell death pathway related molecules and provide novel therapeutic approaches for treatment of disorders characterized by deregulated programmed cell death. Examples of disorders characterized by deregulated programmed cell death include neurodegenerative disorders, e. g., Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, Jakob- Creutzfieldt disease, or AIDS related dementia; or proliferative disorders, e. g., cancer such as chronic lymphocytic leukemia or colorectal cancer.

Furthermore, as they are involved in programmed cell death, hALG-2LP, sALG- 2LP, or mALG-2LP genes containing genetic lesions can be detected in order to diagnose a disorder characterized by aberrant or abnormal hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP, or mALG-2LP protein activity, e. g., a neurodegenerative disorder.

Moreover, another aspect of the invention pertains to isolated nucleic acid molecules (e. g., cDNAs) comprising a nucleotide sequence encoding a hALG-2LP, sALG-2LP, or mALG-2LP protein or a biologically active portion thereof, as well as nucleic acid fragments suitable for use as primers or hybridization probes for the detection of hALG-2LP, sALG-2LP, or mALG-2LP-encoding nucleic acid (e. g., mRNA). In particularly preferred embodiments, the isolated nucleic acid molecules comprise the nucleotide sequences of SEQ ID NOs: 1,4 or 7, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number or the coding region (shown in SEQ ID NOs: 3,6, or 9), or a complement of these nucleotide sequences. In other particularly preferred embodiments, the isolated nucleic acid molecules of the invention comprise a nucleotide sequence which hybridizes to, or is at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the entire length of the nucleotide sequences shown

in SEQ ID NOs: 1,4, or 7, the entire length of nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number, or a portion of these nucleotide sequences. In other preferred embodiments, the isolated nucleic acid molecules encode the amino acid sequences of SEQ ID NOs: 2,5, or 8, or an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. The preferred hALG-2LP, sALG-2LP, or mALG-2LP proteins of the present invention also preferably possess at least one of the activities described herein.

In another embodiment, the isolated nucleic acid molecules encode proteins or portions thereof wherein the proteins or portions thereof include an amino acid sequence which is sufficiently homologous to an amino acid sequence of SEQ ID NOs: 2,5, or 8, e. g., sufficiently homologous to an amino acid sequence of SEQ ID NOs: 2,5, or 8 such that the proteins or portions thereof maintain at least on the of the activities described herein. Preferably, the proteins or portions thereof encoded by the nucleic acid molecules maintain the ability to modulate a programmed cell death pathway activity.

In one embodiment, the proteins encoded by the nucleic acid molecules are at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the amino acid sequences of SEQ ID NOs: 2,5, or 8 (e. g., the entire amino acid sequences of SEQ ID NOs: 2,5, or 8) or the amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. In another preferred embodiment, the proteins are full length human proteins which are substantially homologous to the entire amino acid sequences of SEQ ID NOs: 2,5, or 8 (encoded by the open reading frames shown in SEQ ID NOs: 3,6, or 9, respectively).

In another preferred embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid molecule is derived from a mammal, e. g., a human, a monkey, or a mouse, and encodes a protein (e. g., a hALG-2LP, sALG-2LP, or mALG-2LP fusion protein) which includes a calcium binding domain which is at least 42% or more homologous to SEQ ID NO: 10,11,12,13,14, or 15 and has one or more of the following activities: 1) it can interact with a programmed cell death pathway associated molecule, e. g., an ALG-

2 interacting protein; and 2) it can modulate cell death, e. g., programmed cell death, in a cell, e. g., a brain cell and other cells that express ALG2-LP.

In another embodiment, the isolated nucleic acid molecule is at least 15 nucleotides in length and hybridizes under stringent conditions to a nucleic acid molecule comprising the nucleotide sequence of SEQ ID NOs: 1,4, or 7, or to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC) as Accession Number Preferably, the isolated nucleic acid molecule corresponds to a naturally-occurring nucleic acid molecule. More preferably, the isolated nucleic acid encodes a naturally-occurring human hALG-2LP, sALG-2LP, or mALG-2LP, or a biologically active portion thereof. Moreover, given the disclosure herein of a hALG- 2LP, sALG-2LP, or mALG-2LP-encoding cDNA sequence (e. g., SEQ ID NOs: 1,4, or 7), antisense nucleic acid molecules (i. e., molecules which are complementary to the coding strand of the hALG-2LP, sALG-2LP, or mALG-2LP cDNA sequence) are also provided by the invention.

Another aspect of the invention pertains to vectors, e. g., recombinant expression vectors, containing the nucleic acid molecules of the invention and host cells into which such vectors have been introduced. In one embodiment, such a host cell is used to produce a hALG-2LP, sALG-2LP, or mALG-2LP protein by culturing the host cell in a suitable medium. If desired, the hALG-2LP, sALG-2LP, or mALG-2LP protein can be then isolated from the medium or the host cell.

Yet another aspect of the invention pertains to transgenic nonhuman animals in which a hALG-2LP, sALG-2LP, or mALG-2LP gene has been introduced or altered. In one embodiment, the genome of the nonhuman animal has been altered by introduction of a nucleic acid molecule of the invention encoding hALG-2LP, sALG-2LP, or mALG- 2LP as a transgene. In another embodiment, an endogenous ALG-2LP gene within the genome of the nonhuman animal has been altered, e. g., functionally disrupted, by homologous recombination.

Still another aspect of the invention pertains to an isolated hALG-2LP, sALG- 2LP, or mALG-2LP protein or a portion, e. g., a biologically active portion, thereof. In a preferred embodiment, the isolated hALG-2LP, sALG-2LP, or mALG-2LP protein or portion thereof can modulate programmed cell death in a cell, e. g., a brain cell and other

cells that express ALG2-LP. In another preferred embodiment, the isolated hALG-2LP, sALG-2LP, or mALG-2LP protein or portion thereof is sufficiently homologous to an amino acid sequence of SEQ ID NO: 2,5, or 8 such that the protein or portion thereof maintains the ability to modulate programmed cell death in a cell, e. g., a brain cell and other cells that express ALG2-LP.

In one embodiment, the biologically active portion of the hALG-2LP, sALG- 2LP, or mALG-2LP protein includes a domain or motif, preferably a domain or motif which has an activity described herein. The domain can be a calcium binding domain, e. g., an EF hand. If the active portion of the protein which comprises the calcium binding domain is isolated or derived from a mammal, e. g., a human, it is preferred that the calcium binding domain be at least 38%, 42%, 44% 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more homologous to SEQ ID NO: 10,11,12,13, 14, or 15. Preferably, the biologically active portion of the hALG-2LP, sALG-2LP, or mALG-2LP protein which includes a calcium binding domain also has one of the following activities: 1) it can interact with a programmed cell death pathway associated molecule, e. g., an ALG-2 interacting protein; and 2) it can modulate cell death, e. g., programmed cell death, in a cell, e. g., a brain cell and other cells that express ALG2-LP.

The invention also provides an isolated preparation of a hALG-2LP, sALG-2LP, or mALG-2LP protein. In preferred embodiments, the hALG-2LP, sALG-2LP, or mALG-2LP protein comprises the amino acid sequence of SEQ ID NO: 2,5, or 8 or an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number In another preferred embodiment, the invention pertains to an isolated full length hALG-2LP, sALG-2LP, or mALG-2LP protein which is substantially homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8 (encoded by the open reading frame shown in SEQ ID NO: 3,6, or 9, respectively). In yet another embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP protein is at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8, respectively. In other embodiments, the hALG-2LP, sALG-2LP, or mALG-2LP protein comprises an amino acid sequence which is at least 42% or more homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8, respectively, and has an one or more

of the following activities: 1) it can interact with a programmed cell death pathway associated molecule, e. g., an ALG-2 interacting protein; and 2) it can modulate cell death, e. g., programmed cell death, in a cell, e. g., a brain cell and other cells that express ALG2-LP.

Alternatively, the isolated hALG-2LP, sALG-2LP, or mALG-2LP protein can comprise an amino acid sequence which is encoded by a nucleotide sequence which hybridizes, e. g., hybridizes under stringent conditions, or is at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the entire length of the nucleotide sequence of SEQ ID NO: 1,4, or 7, respectively, or the entire length of the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number, respectively.

Moreover, it is preferred that the forms of hALG-2LP, sALG-2LP, or mALG-2LP also have one or more of the activities described herein.

The hALG-2LP, sALG-2LP, or mALG-2LP protein (or polypeptide) or a biologically active portion thereof can be operatively linked to a non-hALG-2LP, sALG- 2LP, or mALG-2LP polypeptide to form a fusion protein. In addition, the hALG-2LP, sALG-2LP, or mALG-2LP protein or a biologically active portion thereof can be incorporated into a pharmaceutical composition comprising the protein and a pharmaceutically acceptable carrier.

The hALG-2LP, sALG-2LP, or mALG-2LP protein of the invention, or portions or fragments thereof, can be used to prepare anti-hALG-2LP, anti sALG-2LP, or anti mALG-2LP antibodies. Accordingly, the invention also provides an antigenic peptide of hALG-2LP, sALG-2LP, or mALG-2LP which comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NO: 2,5, or 8, respectively, and encompasses an epitope of hALG-2LP, sALG-2LP, or mALG-2LP such that an antibody raised against the hALG-2LP, sALG-2LP, or mALG-2LP peptide forms a specific immune complex with hALG-2LP, sALG-2LP, or mALG-2LP, respectively. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues. The invention further provides an antibody that specifically binds hALG-2LP, sALG-2LP, or mALG-2LP. In one embodiment, the

antibody is monoclonal. In another embodiment, the antibody is coupled to a detectable substance. In yet another embodiment, the antibody is incorporated into a pharmaceutical composition comprising the antibody and a pharmaceutically acceptable carrier.

The invention also pertains to methods for detecting genetic lesions in a hALG- 2LP, sALG-2LP, or mALG-2LP gene, thereby determining if a subject with the lesioned gene is at risk for (or is predisposed to have) a disorder characterized by aberrant or abnormal hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP, or mALG-2LP protein activity, e. g., a disorder characterized by deregulated programmed cell death. In preferred embodiments, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by an alteration affecting the integrity of a gene encoding a hALG-2LP, sALG-2LP, or mALG-2LP protein, or the misexpression of the hALG-2LP, sALG-2LP, or mALG-2LP gene.

Another aspect of the invention pertains to methods for detecting the presence of hALG-2LP, sALG-2LP, or mALG-2LP in a biological sample. In a preferred embodiment, the methods involve contacting a biological sample with a compound or an agent capable of detecting hALG-2LP, sALG-2LP, or mALG-2LP protein or hALG- 2LP, sALG-2LP, or mALG-2LP mRNA such that the presence of hALG-2LP, sALG- 2LP, or mALG-2LP is detected in the biological sample. The compound or agent can be, for example, a labeled or labelable nucleic acid probe capable of hybridizing to hALG-2LP, sALG-2LP, or mALG-2LP mRNA or a labeled or labelable antibody capable of binding to hALG-2LP, sALG-2LP, or mALG-2LP protein. The invention further provides methods for diagnosis of a subject with, for example, a disorder characterized by deregulated programmed cell death, based on detection of hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA. In one embodiment, the method involves contacting a cell or tissue sample (e. g., a brain cell sample) from the subject with an agent capable of detecting hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA, determining the amount of hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA expressed in the cell or tissue sample, comparing the amount of hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA expressed in the cell or tissue sample to a control

sample and forming a diagnosis based on the amount of hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA expressed in the cell or tissue sample as compared to the control sample. Preferably, the cell sample is a brain cell sample. Kits for detecting hALG-2LP, sALG-2LP, or mALG-2LP in a biological sample are also within the scope of the invention.

Brief Description of the Drawings Figure 1 depicts the human ALG-2LP (hALG-2LP) nucleotide (SEQ ID NO: 1) and amino acid (SEQ ID NO: 2) sequence. The coding region without the 5'and 3' untranslated regions of the human ALG-2LP gene is shown in SEQ ID NO: 3.

Figure 2 depicts the monkey ALG-2LP (sALG-2LP) nucleotide (SEQ ID NO: 4) and amino acid (SEQ ID NO: 5) sequence. The coding region without the 5'and 3' untranslated regions of the monkey ALG-2LP gene is shown in SEQ ID NO: 6.

Figure 3 depicts the partial murine ALG-2LP (mALG-2LP) nucleotide (SEQ ID NO: 7) and amino acid (SEQ ID NO: 8) sequence. The coding region without the 5'and 3'untranslated regions of the murine ALG-2LP gene is shown in SEQ ID NO: 9.

Detailed Description of the Invention The present invention is based, at least in part, on the discovery of novel molecules, referred to herein as hALG-2LP, sALG-2LP, and mALG-2LP nucleic acid and protein molecules that are related to proteins which regulate programmed cell death.

As used herein,"programmed cell death"refers to a genetically regulated process involved in the normal development of multicellular organisms. This process occurs in cells destined for removal in a variety of normal situations, including larval development of the nematode c. elegans, insect metamorphosis, development in mammalian embryos including the nephrogenic zone in the developing kidney, and regression or atrophy (e. g., in the prostrate after castration). Programmed cell death can occur following the withdrawal of growth and trophic factors in many cells, nutritional deprivation, hormone treatment, ultraviolet irradiation, and exposure to toxic and infectious agents including reactive oxygen species and phosphatase inhibitors, e. g., okadaic acid, calcium ionphones, and a number of cancer chemotherapeutic agents. For

a detailed description of programmed cell death see Trump B. F. et al. (1995) FASEB J.

9: 219-228 and Lee S. (1993) Curr. Opin. Cell Biol. 5: 286-291, the contents of which are incorporated herein by reference. Thus the hALG-2LP, sALG-2LP, and mALG-2LP proteins by participating in a programmed cell death pathway, can modulate a programmed cell death pathway activity and provide novel diagnostic targets and therapeutic agents for disorders characterized by deregulated programmed cell death, particularly in cells that express ALG2-LP.

As used herein, a"disorder characterized by deregulated programmed cell death" refers to a disorder, disease or condition which is characterized by a deregulation, e. g., an upregulation or a downregulation, of programmed cell death. Programmed cell death deregulation can lead to deregulation of cellular proliferation and/or cell cycle progression. Examples of disorders characterized by deregulated programmed cell death include neurodegenerative disorders, e. g., Alzheimer's disease, dementias related to Alzheimer's disease (such as Pick's disease), Parkinson's and other Lewy diffuse body diseases, multiple sclerosis, amyotrophic lateral sclerosis, progressive supranuclear palsy, epilepsy, Jakob-Creutzfieldt disease, or AIDS related dementias; or profilerative disorders, e. g., cancer such as chronic lymphocytic leukemia or colorectal cancer.

An abnormality in the function of hALG-2LP, sALG-2LP, or mALG-2LP protein can lead to a disorder characterized by deregulated programmed cell death.

Thus, one aspect of the invention pertains to methods for detecting genetic lesions in a hALG-2LP, sALG-2LP, or mALG-2LP gene, to thereby determine if a subject with the lesioned gene is at risk for (or is predisposed to have) a disorder characterized by aberrant or abnormal hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP, or mALG-2LP protein activity, e. g., a disorder characterized by deregulated programmed cell death.

The apoptosis linked gene-2 like protein nucleic acid molecules described herein, e. g., hALG-2LP, sALG-2LP, and mALG-2LP, were identified from human, monkey, and mouse brain cDNA libraries, respectively, using the Blast Algorithm. A cDNA library was prepared from mRNA isolated from disected monkey brain striatum. A homology search of sequences obtained from the cDNA library revealed a cDNA sequence that had 42% homology (62 of 144 amino acids) with rat ALG-2 protein.

Additional clones from the cDNA library were sequences and multiple sequences were contiged to obtain a full length monkey cDNA sequence, SEQ ID NO: 4. The monkey clone was used to screen a human heart cDNA library and a murine whole brain library.

Sequencing of positive clones yielded the human sequence, SEQ ID NO: 1, and the partial murine sequence, SEQ ID NO: 7.

The nucleotide sequence of hALG-2LP cDNA and the predicted amino acid sequence of the hALG-2LP protein are shown in Figure 1 and in SEQ ID NOs: 1 and 2, respectively. A plasmid containing the full length nucleotide sequence encoding human ALG-2LP (with the DNA insert name of) was deposited with ATCC on and assigned Accession Number. This deposit will be maintained under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. This deposit was made merely as a convenience for those of skill in the art and is not an admission that a deposit is required under 35 U. S. C. §112.

The hALG-2LP gene, which is approximately 1667 nucleotides in length, encodes a protein having a molecular weight of approximately 32.7 kD and which is approximately 284 amino acid residues in length. The hALG-2LP protein is expressed in all tissues examined (brain, heart, kidney, liver, lung, skeletal muscle, testis, placenta, pancreas, colon, prostate, ovaries, small intestine, and spleen). No expressio was seen in the hypothalamus.

Amino acid residues 127 to 139 and 194-206 of the hALG-2LP protein comprise a region showing homology to a calcium binding domain. As used herein, the term "calcium binding domain"refers to an amino acid domain, e. g., an EF hand (described in, for example, Baimbridge K. G. et al. (1992) TINS 15 (8): 303-308, the contents of which are incorporated herein by reference), which is involved in calcium binding.

These EF hands usually have a sequence, which is similar to the consensus sequence: EO-OO-O_KDGD_O F*-OO. (SEQ IDNO: 16).

O can be I, L, V or M, and"-"indicates a position with no strongly preferred residue.

Each residue listed is present in more than 25% of sequences, and those underlined are present in more than 80% of sequences.

The nucleotide sequence of the sALG-2LP cDNA and the predicted amino acid sequence of the sALG-2LP protein are shown in Figure 2 and in SEQ ID NOs: 4 and 5, respectively. The sALG-2LP gene, which is approximately 1525 nucleotides in length, encodes a protein having a molecular weight of approximately 31.8 kD and which is approximately 277 amino acid residues in length.

The nucleotide sequence of the partial mALG-2LP cDNA and the predicted amino acid sequence of the partial mALG-2LP protein are shown in Figure 3 and in SEQ ID NOs: 7 and 8, respectively. The partial mALG-2LP gene, which is approximately 1362 nucleotides in length, encodes a protein having a molecular weight of approximately 31.5 kD and which is approximately 274 amino acid residues in length.

Various aspects of the invention are described in further detail in the following subsections: I. Isolated Nucleic Acid Molecules One aspect of the invention pertains to isolated nucleic acid molecules that encode hALG-2LP, sALG-2LP, or mALG-2LP or biologically active portions thereof, as well as nucleic acid fragments sufficient for use as hybridization probes to identify hALG-2LP, sALG-2LP, or mALG-2LP-encoding nucleic acid (e. g., hALG-2LP, sALG- 2LP, or mALG-2LP mRNA). As used herein, the term"nucleic acid molecule"is intended to include DNA molecules (e. g., cDNA or genomic DNA) and RNA molecules (e. g., mRNA) and analogs of the DNA or RNA generated using nucleotide analogs. The nucleic acid molecule can be single-stranded or double-stranded, but preferably is double-stranded DNA. An"isolated"nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. Preferably, an"isolated"nucleic acid is free of sequences which naturally flank the nucleic acid (i. e., sequences located at the 5'and 3'ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid

molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived (e. g., a brain cell or other cell that expresses ALG2-LP). Moreover, an"isolated"nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized.

A nucleic acid molecule of the present invention, e. g., a nucleic acid molecule having the nucleotide sequence of SEQ ID NOs: 1,4, and 7, or a portion thereof, can be isolated using standard molecular biology techniques and the sequence information provided herein. For example, a human, a monkey, or a mouse ALG-2LP cDNA can be isolated from a human, a monkey, or a mouse brain library, respectively, using all or portion of SEQ ID NO: 1,4, or 7 as a hybridization probe and standard hybridization techniques (e. g., as described in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989). Moreover, a nucleic acid molecule encompassing all or a portion of SEQ ID NO: 1,4, or 7 can be isolated by the polymerase chain reaction using oligonucleotide primers designed based upon the sequence of SEQ ID NO: 1,4, or 7. For example, mRNA can be isolated from normal brain cells (e. g., by the guanidinium-thiocyanate extraction procedure of Chirgwin et al.

(1979) Biochemistry 18: 5294-5299) and cDNA can be prepared using reverse transcriptase (e. g., Moloney MLV reverse transcriptase, available from Gibco/BRL, Bethesda, MD; or AMV reverse transcriptase, available from Seikagaku America, Inc., St. Petersburg, FL). Synthetic oligonucleotide primers for PCR amplification can be designed based upon the nucleotide sequence shown in SEQ ID NO: 1,4, or 7. A nucleic acid of the invention can be amplified using cDNA or, alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to a hALG-2LP, sALG-2LP, or mALG-2LP nucleotide

sequence can be prepared by standard synthetic techniques, e. g., using an automated DNA synthesizer.

In a preferred embodiment, an isolated nucleic acid molecule of the invention comprises the nucleotide sequence shown in SEQ ID NO: 1,4, and 7 or the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. The sequence of SEQ ID NO: 1 corresponds to the human ALG2-LP (hALG2-LP) cDNA. This cDNA comprises sequences encoding the hALG-2LP protein (i. e.,"the coding region", from nucleotides 30 to 881 of SEQ ID NO: 1), as well as 5' untranslated sequences (nucleotides 1-29 of SEQ ID NO: 1) and 3'untranslated sequences (nucleotides 882 to 1667 of SEQ ID NO: 1). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO: 1 (e. g., nucleotides 30 to 881, shown separately as SEQ ID NO: 3). The sequence of SEQ ID NO: 4 corresponds to the monkey ALG-2LP (sALG-2LP) cDNA. This cDNA comprises sequences encoding the sALG-2LP protein (i. e.,"the coding region", from nucleotides 10 to 840 of SEQ ID NO: 4), as well as 5'untranslated sequences (nucleotides 1-9 of SEQ ID NO: 4) and 3'untranslated sequences (nucleotides 841 to 1525 of SEQ ID NO: 4). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO: 4 (e. g., nucleotides 10 to 840, shown separately as SEQ ID NO: 6). The sequence of SEQ ID NO: 7 corresponds to the partial mouse ALG-2LP (mALG-2LP) cDNA. This cDNA comprises sequences encoding the partial mALG-2LP protein (i. e.,"the coding region", from nucleotides 177 to 998 of SEQ ID NO: 7), as well as 5'untranslated sequences (nucleotides 1 to 176 of SEQ ID NO: 7) and 3'untranslated sequences (nucleotides 999 to 1362 of SEQ ID NO: 7). Alternatively, the nucleic acid molecule can comprise only the coding region of SEQ ID NO: 7 (e. g., nucleotides 177 to 998, shown separately as SEQ ID NO: 9).

In another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleic acid molecule which is a complement of the nucleotide sequence shown in SEQ ID NO: 1,4, or 7, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCCW as Accession Number, or a portion of these nucleotide sequences. A nucleic acid molecule which is complementary to the nucleotide sequence shown in SEQ ID NO: 1,4, or 7 is one which is sufficiently

complementary to the nucleotide sequence shown in SEQ ID NO: 1,4, or 7 such that it can hybridize to the nucleotide sequence shown in SEQ ID NO: 1,4, or 7, respectively, thereby forming a stable duplex.

In still another preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which is at least 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the nucleotide sequence shown in SEQ ID NO: 1,4, or 7, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number, or a portion of these nucleotide sequences. In an additional preferred embodiment, an isolated nucleic acid molecule of the invention comprises a nucleotide sequence which hybridizes, e. g., hybridizes under stringent conditions, to the nucleotide sequence shown in SEQ ID NO: 1,4, or 7, the nucleotide sequence of the DNA insert of the plasmid deposited with ATCCt) as Accession Number or a portion of these nucleotide sequences.

Moreover, the nucleic acid molecule of the invention can comprise only a portion of the coding region of SEQ ID NO: 1,4, or 7, for example a fragment which can be used as a probe or primer or a fragment encoding a biologically active portion of hALG-2LP, sALG-2LP, or mALG-2LP. The nucleotide sequence determined from the cloning of the hALG-2LP, sALG-2LP, or mALG-2LP gene from a mammal allows for the generation of probes and primers designed for use in identifying and/or cloning hALG- 2LP, sALG-2LP, or mALG-2LP homologues in other cell types, e. g., from other tissues, as well as hALG-2LP, sALG-2LP, or mALG-2LP homologues from other mammals, e. g., rats. The probe/primer typically comprises substantially purified oligonucleotide.

The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, preferably about 25, more preferably about 40,50,75,100,150,200,300,400,500,520,540,550, or 600 consecutive nucleotides of SEQ ID NO: 1,4, or 7 sense, an anti-sense sequence of SEQ ID NO: 1,4, or 7, or naturally occurring mutants thereof. Primers based on the nucleotide sequence in SEQ ID NO: 1,4, or 7 can be used in PCR reactions to clone hALG-2LP, sALG-2LP, or mALG-2LP homologues. Probes based on the hALG-2LP, sALG-2LP, or mALG- 2LP nucleotide sequences can be used to detect transcripts or genomic sequences

encoding the same or homologous proteins. In preferred embodiments, the probe further comprises a label group attached thereto, e. g., the label group can be a radioisotope, a fluorescent compound, an enzyme, or an enzyme co-factor. Such probes can be used as a part of a diagnostic test kit for identifying cells or tissue which misexpress a hALG- 2LP, sALG-2LP, or mALG-2LP protein, such as by measuring a level of a hALG-2LP, sALG-2LP, or mALG-2LP-encoding nucleic acid in a sample of cells from a subject e. g., detecting hALG-2LP, sALG-2LP, or mALG-2LP mRNA levels or determining whether a genomic hALG-2LP, sALG-2LP, or mALG-2LP gene has been mutated or deleted.

In one embodiment, the nucleic acid molecule of the invention encodes a protein or portion thereof which includes an amino acid sequence which is sufficiently homologous to an amino acid sequence of SEQ ID NO: 2,5, or 8 or an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number such that the protein or portion thereof maintains the ability to modulate a programmed cell death related activity. As used herein, the language"sufficiently homologous"refers to proteins or portions thereof which have amino acid sequences which include a minimum number of identical or equivalent (e. g., an amino acid residue which has a similar side chain as an amino acid residue in SEQ ID NO: 2,5, or 8) amino acid residues to an amino acid sequence of SEQ ID NO: 2,5, or 8 or an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCCt) as Accession Number ____ such that the protein or portion thereof is able to modulate a programmed cell death related activity. In another embodiment, the protein is at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8.

Portions of proteins encoded by the hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid molecules of the invention are preferably biologically active portions of the hALG-2LP, sALG-2LP, or mALG-2LP proteins. As used herein, the term"biologically active portion of hALG-2LP, sALG-2LP, or mALG-2LP"is intended to include a portion, e. g., a domain/motif, of hALG-2LP, sALG-2LP, or mALG-2LP that has one or more of the following activities: 1) it can interact with a programmed cell death pathway

associated molecule, e. g., an ALG-2 interacting protein; and 2) it can modulate cell death, e. g., programmed cell death, in a cell, e. g., a brain cell and other cells that express ALG2-LP.

Standard binding assays, e. g., immunoprecipitations and yeast two-hybrid assays as described herein, can be performed to determine the ability of a hALG-2LP, sALG- 2LP, or mALG-2LP protein or a biologically active portion thereof to interact with (e. g., bind to) another programmed cell death pathway associated protein, e. g., ALG-2, or portion thereof. To determine whether a hALG-2LP, sALG-2LP, or mALG-2LP protein or a biologically active portion thereof can modulate programmed cell death in a cell such as a T cell, T cells e. g., T cell hybridomas (3DO) which have been cross-linked with a T cell receptor to induce programmed cell death (as described in Ashwell J. D. et al. (1990) J. Immunol. 144: 3326) can be transfected with a nucleic acid encoding the hALG-2LP, sALG-2LP, or mALG-2LP protein or biologically active portion thereof, cloned in, for example, a pLTP vector (as described in Vito P. et al. (1996) Science 271: 521-525). The ability of the transfected nucleic acid molecules to protect the recipient cells form cell death can then be monitored.

Additional nucleic acid fragments encoding biologically active portions of hALG-2LP, sALG-2LP, or mALG-2LP can be prepared by isolating a portion of SEQ ID NO: 2,5, or 8, respectively, expressing the encoded portion of hALG-2LP, sALG- 2LP, or mALG-2LP protein or peptide (e. g., by recombinant expression in vitro) and assessing the activity of the encoded portion of hALG-2LP, sALG-2LP, or mALG-2LP protein or peptide.

The invention further encompasses nucleic acid molecules that differ from the nucleotide sequence shown in SEQ ID NO: 1,4, or 7 (and portions thereof) due to degeneracy of the genetic code and thus encode the same hALG-2LP, sALG-2LP, or mALG-2LP protein as that encoded by the nucleotide sequence shown in SEQ ID NO: 1, 4, or 7, respectively. In another embodiment, an isolated nucleic acid molecule of the invention has a nucleotide sequence encoding a protein having an amino acid sequence shown in SEQ ID NO: 2,5, or 8 or a protein having an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. In a still further embodiment, the nucleic acid molecule of

the invention encodes a full length human protein which is substantially homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8 (encoded by the open reading frame shown in SEQ ID NO: 3,6, or 9) or an amino acid sequence encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number ____.

In addition to the hALG-2LP, sALG-2LP, and mALG-2LP nucleotide sequences shown in SEQ ID NOs: l, 4, and 7, it will be appreciated by those skilled in the art that DNA sequence polymorphisms that lead to changes in the amino acid sequences of hALG-2LP, sALG-2LP, and mALG-2LP may exist within a population (e. g., the human population). Such genetic polymorphism in the hALG-2LP, sALG-2LP, and mALG- 2LP genes may exist among individuals within a population due to natural allelic variation. As used herein, the terms"gene"and"recombinant gene"refer to nucleic acid molecules comprising an open reading frame encoding a hALG-2LP, sALG-2LP, or mALG-2LP protein, preferably a mammalian hALG-2LP, sALG-2LP, or mALG-2LP protein. Such natural allelic variations can typically result in 1-5% variance in the nucleotide sequence of the hALG-2LP, sALG-2LP, or mALG-2LP gene. Any and all such nucleotide variations and resulting amino acid polymorphisms in hALG-2LP, sALG-2LP, or mALG-2LP that are the result of natural allelic variation and that do not alter the functional activity of hALG-2LP, sALG-2LP, or mALG-2LP are intended to be within the scope of the invention. Moreover, nucleic acid molecules encoding hALG- 2LP, sALG-2LP, or mALG-2LP proteins from other species, and thus which have a nucleotide sequence which differs from the sequence of SEQ ID NO: 1,4, or 7, are intended to be within the scope of the invention. Nucleic acid molecules corresponding to natural allelic variants and non-human, non-monkey, or non-murine homologues of the hALG-2LP, sALG-2LP, or mALG-2LP cDNA of the invention can be isolated based on their homology to the hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid disclosed herein using the human cDNA, or a portion thereof, as a hybridization probe according to standard hybridization techniques under stringent hybridization conditions.

Accordingly, in another embodiment, an isolated nucleic acid molecule of the invention is at least 15 nucleotides in length and hybridizes under stringent conditions to the nucleic acid molecule comprising the nucleotide sequence of SEQ ID NO: 1,4, or 7 or

the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. In other embodiments, the nucleic acid is at least 30,50, 100,250,300,350,400,450,500,520,540,550, or 600 nucleotides in length. As used herein, the term"hybridizes under stringent conditions"is intended to describe conditions for hybridization and washing under which nucleotide sequences at least 60% homologous to each other typically remain hybridized to each other. Preferably, the conditions are such that sequences at least about 65%, more preferably at least about 70%, and even more preferably at least about 75% or more homologous to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), A preferred, non-limiting example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65°C.

Preferably, an isolated nucleic acid molecule of the invention that hybridizes under stringent conditions to the sequence of SEQ ID NO: 1,4, or 7 corresponds to a naturally- occurring nucleic acid molecule. As used herein, a"naturally-occurring"nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e. g., encodes a natural protein). In one embodiment, the nucleic acid encodes a natural human hALG-2LP, sALG-2LP, or mALG-2LP.

In addition to naturally-occurring allelic variants of the hALG-2LP, sALG-2LP, or mALG-2LP sequence that may exist in the population, the skilled artisan will further appreciate that changes can be introduced by mutation into the nucleotide sequence of SEQ ID NO: 1,4, or 7, thereby leading to changes in the amino acid sequence of the encoded hALG-2LP, sALG-2LP, or mALG-2LP protein, without altering the functional ability of the hALG-2LP, sALG-2LP, or mALG-2LP protein. For example, nucleotide substitutions leading to amino acid substitutions at"non-essential"amino acid residues can be made in the sequence of SEQ ID NO: 1,4, or 7. A"non-essential"amino acid residue is a residue that can be altered from the wild-type sequence of hALG-2LP, sALG-2LP, or mALG-2LP (e. g., the sequence of SEQ ID NO: 2,5, or 8) without altering the activity of hALG-2LP, sALG-2LP, or mALG-2LP, whereas an"essential"amino acid residue is required for hALG-2LP, sALG-2LP, or mALG-2LP activity. For

example, amino acid residues that are conserved among the ALG-2LP proteins of the present invention, are predicted to be particularly unamenable to alteration (e. g., the conserved aspartate, lysine, and glutamate residues present in the EF hand). Other amino acid residues, however, (e. g., those that are not conserved or only semi-conserved in the EF hand) may not be essential for activity and thus are likely to be amenable to alteration without altering hALG-2LP, sALG-2LP, or mALG-2LP activity.

Accordingly, another aspect of the invention pertains to nucleic acid molecules encoding hALG-2LP, sALG-2LP, or mALG-2LP proteins that contain changes in amino acid residues that are not essential for hALG-2LP, sALG-2LP, or mALG-2LP activity.

Such hALG-2LP, sALG-2LP, or mALG-2LP proteins differ in amino acid sequence from SEQ ID NO: 2,5, or 8, respectively, yet retain at least one of the hALG-2LP, sALG-2LP, or mALG-2LP activities described herein. In one embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence encoding a protein, wherein the protein comprises an amino acid sequence at least 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8 and is capable of modulating programmed cell death.

To determine the percent homology of two amino acid sequences (e. g., SEQ ID NO: 2,5, or 8 and a mutant form thereof) or of two nucleic acids, the sequences are aligned for optimal comparison purposes (e. g., gaps can be introduced in the sequence of one protein or nucleic acid for optimal alignment with the other protein or nucleic acid).

The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in one sequence (e. g., SEQ ID NO: 2,5, or 8) is occupied by the same amino acid residue or nucleotide as the corresponding position in the other sequence (e. g., a mutant form of hALG-2LP, sALG- 2LP, or mALG-2LP, respectively), then the molecules are homologous at that position (i. e., as used herein amino acid or nucleic acid"homology"is equivalent to amino acid or nucleic acid"identity"). The percent homology between the two sequences is a function of the number of identical positions shared by the sequences (i. e., % homology = # of identical positions/total # of positions x 100).

The comparison of sequences and determination of percent homology between two sequences can be accomplished using a mathematical algorithm. A preferred, non- limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87: 2264-68, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-77. Such an algorithm is incorporated into the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (1990) J. Mol. Biol. 215: 403-10. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to the hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid molecules of the invention. BLAST protein searches can also be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to the hALG-2LP, sALG-2LP, or mALG-2LP protein molecules of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al., (1997) Nucleic Acids Res. 25 (17): 3389-3402.

When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e. g., XBLAST and NBLAST) can be used. See http://www. ncbi. nlm. nih. gov. Another preferred, non-limiting example of a mathematical algorithm utilized for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). Such an algorithm is incorporated into the ALIGN program (version 2.0) which is part of the GCG sequence alignment software package.

When utilizing the ALIGN program for comparing amino acid sequences, a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4 can be used.

An isolated nucleic acid molecule encoding a hALG-2LP, sALG-2LP, or mALG- 2LP protein homologous to the protein of SEQ ID NO: 2,5, or 8, respectively, can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence of SEQ ID NO: 1,4, or 7 such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into SEQ ID NO: 1,4, or 7 by standard techniques, such as site- directed mutagenesis and PCR-mediated mutagenesis. Preferably, conservative amino acid substitutions are made at one or more predicted non-essential amino acid residues.

A"conservative amino acid substitution"is one in which the amino acid residue is

replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e. g., lysine, arginine, histidine), acidic side chains (e. g., aspartic acid, glutamic acid), uncharged polar side chains (e. g., glycine, asparagine, glutamine, serine, threonine, tyrosine. cysteine), nonpolar side chains (e. g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta- branched side chains (e. g., threonine, valine, isoleucine) and aromatic side chains (e. g., tyrosine, phenylalanine, tryptophan, histidine). Thus, a predicted nonessential amino acid residue in hALG-2LP, sALG-2LP, or mALG-2LP is preferably replaced with another amino acid residue from the same side chain family. Alternatively, in another embodiment, mutations can be introduced randomly along all or part of a hALG-2LP, sALG-2LP, or mALG-2LP coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for a hALG-2LP, sALG-2LP, or mALG-2LP activity described herein to identify mutants that retain hALG-2LP, sALG-2LP, or mALG-2LP activity. Following mutagenesis of SEQ ID NO: 1,4, or 7, the encoded protein can be expressed recombinantly (e. g., as described in Examples 3 and 4) and the activity of the protein can be determined using, for example, assays described herein.

In addition to the nucleic acid molecules encoding hALG-2LP, sALG-2LP, or mALG-2LP proteins described above, another aspect of the invention pertains to isolated nucleic acid molecules which are antisense thereto. An"antisense"nucleic acid comprises a nucleotide sequence which is complementary to a"sense"nucleic acid encoding a protein, e. g., complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence. Accordingly, an antisense nucleic acid can hydrogen bond to a sense nucleic acid. The antisense nucleic acid can be complementary to an entire hALG-2LP, sALG-2LP, or mALG-2LP coding strand, or to only a portion thereof. In one embodiment, an antisense nucleic acid molecule is antisense to a"coding region"of the coding strand of a nucleotide sequence encoding hALG-2LP, sALG-2LP, or mALG-2LP.

The term"coding region"refers to the region of the nucleotide sequence comprising codons which are translated into amino acid residues, e. g., the entire coding region of SEQ ID NO: 1 comprises nucleotides 30 to 881 (shown separately as SEQ ID

NO: 3), the entire coding region of SEQ ID N0: 4 comprises nucleotides 10 to 840<BR> <BR> <BR> <BR> <BR> <BR> <BR> (shown separately as SEQ ID N0: 6), and the entire coding region of SEQ ID N0: 7<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> comprises nucleotides 177 to 998 (shown separately as SEQ ID N0: 9). In another embodiment, the antisense nucleic acid molecule is antisense to a"noncoding region"of the coding strand of a nucleotide sequence encoding hALG-2LP, sALG-2LP, or mALG- 2LP. The term"noncoding region"refers to 5'and 3'sequences which flank the coding region that are not translated into amino acids (i. e., also referred to as 5'and 3' untranslated regions). An example of an antisense molecule which is complementary to a fragment of the 5'untranslated region of SEQ ID NO: 1 and which also includes the start codon is a nucleic acid molecule which includes nucleotides which are <BR> <BR> <BR> <BR> <BR> complementary to nucleotides 20 to 38 of SEQ ID NO: 1. This antisense molecule has the following nucleotide sequence: 5'CAGAATCACCATGGCCAGC 3' (SEQ ID <BR> <BR> <BR> <BR> <BR> NO: 17). An example of an antisense molecule which is complementary to a portion of<BR> <BR> <BR> <BR> <BR> <BR> <BR> the 3'untranslated region of SEQ ID NO: 1 is a nucleic acid molecule which includes<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> nucleotides which are complementary to nucleotides 885 to 905 of SEQ ID NO: 1. This antisense molecule has the following sequence: 5'CCCAACCATCTGTGGAGAGTG 3' <BR> <BR> <BR> <BR> <BR> (SEQ ID NO: 18). An example of an antisense molecule which is complementary to a<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> fragment of the 5'untranslated region of SEQ ID N0: 4 and which also includes the start codon is a nucleic acid molecule which includes nucleotides which are complementary <BR> <BR> <BR> <BR> <BR> to nucleotides 1 to 15 of SEQ ID N0: 4. This antisense molecule has the following<BR> <BR> <BR> <BR> <BR> <BR> <BR> nucleotide sequence: 5'CGCGTGGGCATGGCC 3' (SEQ ID NO: 19). An example of an antisense molecule which is complementary to a portion of the 3'untranslated region <BR> <BR> <BR> <BR> <BR> of SEQ ID N0: 4 is a nucleic acid molecule which includes nucleotides which are<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> complementary to nucleotides 844 to 862 of SEQ ID N0: 4. This antisense molecule has<BR> <BR> <BR> <BR> <BR> <BR> <BR> the following sequence: 5'CCCAACCCATCTGTGGAGA 3' (SEQ ID N0: 20). An example of an antisense molecule which is complementary to a fragment of the 5' <BR> <BR> <BR> <BR> <BR> untranslated region of SEQ ID N0: 7 and which also includes the start codon is a nucleic acid molecule which includes nucleotides which are complementary to nucleotides 170 <BR> <BR> <BR> to 182 of SEQ ID N0: 7. This antisense molecule has the following nucleotide<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> sequence: 5'CGGCACGAGCAGC 3' (SEQ ID N0: 21). An example of an antisense<BR> <BR> <BR> <BR> <BR> <BR> <BR> molecule which is complementary to a portion of the 3'untranslated region of SEQ ID

NO: 7 is a nucleic acid molecule which includes nucleotides which are complementary to nucleotides 992 to 1008 of SEQ ID NO: 7. This antisense molecule has the following sequence: 5'GATGCTATGACCCAGCC 3' (SEQ ID NO: 22).

Given the coding strand sequences encoding hALG-2LP, sALG-2LP, and mALG-2LP disclosed herein (e. g., SEQ ID NOs: l, 4, and 7, respectively), antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of hALG-2LP, sALG-2LP, or mALG-2LP mRNA, but more preferably is an oligonucleotide which is antisense to only a portion of the coding or noncoding region of hALG-2LP, sALG-2LP, or mALG-2LP mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of hALG-2LP, sALG-2LP, or mALG-2LP mRNA. An antisense oligonucleotide can be, for example, about 5,10,15,20,25,30,35,40,45 or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e. g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e. g., phosphorothioate derivatives and acridine substituted nucleotides can be used. Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-

oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3- (3- amino-3-N-2-carboxypropyl) uracil, (acp3) w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i. e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a hALG-2LP, sALG-2LP, or mALG-2LP protein to thereby inhibit expression of the protein, e. g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarity to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule which binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of an antisense nucleic acid molecule of the invention includes direct injection at a tissue site. Alternatively, an antisense nucleic acid molecule can be modified to target selected cells and then administered systemically. For example, for systemic administration, an antisense molecule can be modified such that it specifically binds to a receptor or an antigen expressed on a selected cell surface, e. g., by linking the antisense nucleic acid molecule to a peptide or an antibody which binds to a cell surface receptor or antigen. The antisense nucleic acid molecule can also be delivered to cells using the vectors described herein. To achieve sufficient intracellular concentrations of the antisense molecules, vector constructs in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter are preferred.

In yet another embodiment, the antisense nucleic acid molecule of the invention is an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual (3-units, the strands run parallel to each other (Gaultier et al. (1987) Nucleic Acids.

Res. 15: 6625-6641). The antisense nucleic acid molecule can also comprise a 2'-o- methylribonucleotide (Inoue et al. (1987) Nucleic Acids Res. 15: 6131-6148) or a chimeric RNA-DNA analogue (Inoue et al. (1987) FEBS Lett. 215: 327-330).

In still another embodiment, an antisense nucleic acid of the invention is a ribozyme. Ribozymes are catalytic RNA molecules with ribonuclease activity which are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e. g., hammerhead ribozymes (described in Haselhoff and Gerlach (1988) Nature 334: 585-591)) can be used to catalytically cleave hALG-2LP, sALG-2LP, or mALG-2LP mRNA transcripts to thereby inhibit translation of hALG-2LP, sALG-2LP, or mALG-2LP mRNA. A ribozyme having specificity for a hALG-2LP, sALG-2LP, or mALG-2LP-encoding nucleic acid can be designed based upon the nucleotide sequence of a hALG-2LP, sALG-2LP, or mALG-2LP cDNA disclosed herein (i. e., SEQ ID NO: 1,4, or 7, respectively). For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a hALG- 2LP, sALG-2LP, or mALG-2LP-encoding mRNA. See, e. g., Cech et al. U. S. Patent No.

4,987,071 and Cech et al. U. S. Patent No. 5,116,742. Alternatively, hALG-2LP, sALG- 2LP, or mALG-2LP mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e. g., Bartel, D. and Szostak, J. W. (1993) Science 261: 1411-1418.

Alternatively, hALG-2LP, sALG-2LP, or mALG-2LP gene expression can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the hALG-2LP, sALG-2LP, or mALG-2LP (e. g., the hALG-2LP, sALG-2LP, or mALG- 2LP promoter and/or enhancers) to form triple helical structures that prevent transcription of the hALG-2LP, sALG-2LP, or mALG-2LP gene in target cells. See generally, Helene, C. (1991) Anticancer Drug Des. 6 (6): 569-84; Helene, C. et al. (1992) Ann. N. Y. Acad. Sci. 660: 27-36 ; and Maher, L. J. (1992) Bioassays 14 (12): 807-15.

II. Recombinant Expression Vectors and Host Cells Another aspect of the invention pertains to vectors, preferably expression vectors, containing a nucleic acid encoding hALG-2LP, sALG-2LP, or mALG-2LP (or a portion thereof). As used herein, the term"vector"refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a"plasmid", which refers to a circular double stranded DNA loop into which

additional DNA segments can be ligated. Another type of vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e. g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e. g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as"expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of plasmids. In the present specification, "plasmid"and"vector"can be used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors, such as viral vectors (e. g., replication defective retroviruses, adenoviruses and adeno-associated viruses), which serve equivalent functions.

The recombinant expression vectors of the invention comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a host cell, which means that the recombinant expression vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. Within a recombinant expression vector,"operably linked"is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence (s) in a manner which allows for expression of the nucleotide sequence (e. g., in an in vitro transcription/translation system or in a host cell when the vector is introduced into the host cell). The term"regulatory sequence"is intended to includes promoters, enhancers and other expression control elements (e. g., polyadenylation signals). Such regulatory sequences are described, for example, in Goeddel; Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990). Regulatory sequences include those which direct constitutive expression of a nucleotide sequence in many types of host cell and those which direct expression of the nucleotide sequence only in certain host cells (e. g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art

that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, etc. The expression vectors of the invention can be introduced into host cells to thereby produce proteins or peptides, including fusion proteins or peptides, encoded by nucleic acids as described herein (e. g., hALG-2LP, sALG-2LP, or mALG-2LP proteins, mutant forms of hALG-2LP, sALG-2LP, or mALG-2LP, fusion proteins, and the like).

The recombinant expression vectors of the invention can be designed for expression of hALG-2LP, sALG-2LP, or mALG-2LP in prokaryotic or eukaryotic cells.

For example, hALG-2LP, sALG-2LP, or mALG-2LP can be expressed in bacterial cells such as E. coli, insect cells (using baculovirus expression vectors) yeast cells or mammalian cells. Suitable host cells are discussed further in Goeddel, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, CA (1990).

Alternatively, the recombinant expression vector can be transcribed and translated in vitro, for example using T7 promoter regulatory sequences and T7 polymerase.

Expression of proteins in prokaryotes is most often carried out in E. coli with vectors containing constitutive or inducible promoters directing the expression of either fusion or non-fusion proteins. Fusion vectors add a number of amino acids to a protein encoded therein, usually to the amino terminus of the recombinant protein. Such fusion vectors typically serve three purposes: 1) to increase expression of recombinant protein; 2) to increase the solubility of the recombinant protein; and 3) to aid in the purification of the recombinant protein by acting as a ligand in affinity purification. Often, in fusion expression vectors, a proteolytic cleavage site is introduced at the junction of the fusion moiety and the recombinant protein to enable separation of the recombinant protein from the fusion moiety subsequent to purification of the fusion protein. Such enzymes, and their cognate recognition sequences, include Factor Xa, thrombin and enterokinase.

Typical fusion expression vectors include pGEX (Pharmacia Biotech Inc; Smith, D. B. and Johnson, K. S. (1988) Gene 67: 31-40), pMAL (New England Biolabs, Beverly, MA) and pRIT5 (Pharmacia, Piscataway, NJ) which fuse glutathione S-transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein.

In one embodiment, the coding sequence of the hALG-2LP, sALG-2LP, or mALG-2LP is cloned into a pGEX expression vector to create a vector encoding a fusion protein

comprising, from the N-terminus to the C-terminus, GST-thrombin cleavage site-hALG- 2LP, sALG-2LP, or mALG-2LP. The fusion protein can be purified by affinity chromatography using glutathione-agarose resin. Recombinant hALG-2LP, sALG-2LP, or mALG-2LP unfused to GST can be recovered by cleavage of the fusion protein with thrombin.

Examples of suitable inducible non-fusion E. coli expression vectors include pTrc (Amann et al. (1988) Gene 69: 301-315) and pET 1 lad (Studier et al. Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 60-89). Target gene expression from the pTrc vector relies on host RNA polymerase transcription from a hybrid trp-lac fusion promoter. Target gene expression from the pET 1 lad vector relies on transcription from a T7 gnlO-lac fusion promoter mediated by a coexpressed viral RNA polymerase (T7 gnl). This viral <BR> <BR> polymerase is supplied by host strains BL21 (DE3) or HMS 174 (DE3) from a resident X prophage harboring a T7 gnl gene under the transcriptional control of the lacUV 5 promoter.

One strategy to maximize recombinant protein expression in E. coli is to express the protein in a host bacteria with an impaired capacity to proteolytically cleave the recombinant protein (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, California (1990) 119-128). Another strategy is to alter the nucleic acid sequence of the nucleic acid to be inserted into an expression vector so that the individual codons for each amino acid are those preferentially utilized in E. coli (Wada et al. (1992) Nucleic Acids Res. 2011-2118).

Such alteration of nucleic acid sequences of the invention can be carried out by standard DNA synthesis techniques.

In another embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP expression vector is a yeast expression vector. Examples of vectors for expression in yeast S. cerivisae include pYepSecl (Baldari, et al. (1987) Embo J. 6: 229-234), pMFa (Kurjan and Herskowitz, (1982) Cell 30: 933-943), pJRY88 (Schultz et al. (1987) Gene 54: 113- 123), and pYES2 (Invitrogen Corporation, San Diego, CA).

Alternatively, hALG-2LP, sALG-2LP, or mALG-2LP can be expressed in insect cells using baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e. g., Sf 9 cells) include the pAc series (Smith et al.

(1983) Mol. Cell Biol. 3: 2156-2165) and the pVL series (Lucklow and Summers (1989) Virology 170: 31-39).

In yet another embodiment, a nucleic acid of the invention is expressed in mammalian cells using a mammalian expression vector. Examples of mammalian expression vectors include pCDM8 (Seed, B. (1987) Nature 329: 840) and pMT2PC (Kaufman et al. (1987) EMBO J. 6: 187-195). When used in mammalian cells, the expression vector's control functions are often provided by viral regulatory elements.

For example, commonly used promoters are derived from polyoma, Adenovirus 2, cytomegalovirus and Simian Virus 40. For other suitable expression systems for both prokaryotic and eukaryotic cells see chapters 16 and 17 of Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

In another embodiment, the recombinant mammalian expression vector is capable of directing expression of the nucleic acid preferentially in a particular cell type (e. g., tissue-specific regulatory elements are used to express the nucleic acid). Tissue- specific regulatory elements are known in the art. Non-limiting examples of suitable tissue-specific promoters include the albumin promoter (liver-specific; Pinkert et al.

(1987) Genes Dev. 1: 268-277), lymphoid-specific promoters (Calame and Eaton (1988) Adv. Immunol. 43: 235-275), in particular promoters of T cell receptors (Winoto and Baltimore (1989) EMBO J. 8: 729-733) and immunoglobulins (Banerji et al. (1983) Cell 33: 729-740; Queen and Baltimore (1983) Cell 33: 741-748), neuron-specific promoters (e. g., the neurofilament promoter; Byrne and Ruddle (1989) PNAS 86: 5473-5477), pancreas-specific promoters (Edlund et al. (1985) Science 230: 912-916), and mammary gland-specific promoters (e. g., milk whey promoter; U. S. Patent No. 4,873,316 and European Application Publication No. 264,166). Developmentally-regulated promoters are also encompassed, for example the murine hox promoters (Kessel and Gruss (1990)

Science 249: 374-379) and the a-fetoprotein promoter (Campes and Tilghman (1989) Genes Dev. 3: 537-546).

The invention further provides a recombinant expression vector comprising a DNA molecule of the invention cloned into the expression vector in an antisense orientation. That is, the DNA molecule is operatively linked to a regulatory sequence in a manner which allows for expression (by transcription of the DNA molecule) of an RNA molecule which is antisense to hALG-2LP, sALG-2LP, or mALG-2LP mRNA.

Regulatory sequences operatively linked to a nucleic acid cloned in the antisense orientation can be chosen which direct the continuous expression of the antisense RNA molecule in a variety of cell types, for instance viral promoters and/or enhancers, or regulatory sequences can be chosen which direct constitutive, tissue specific or cell type specific expression of antisense RNA. The antisense expression vector can be in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense nucleic acids are produced under the control of a high efficiency regulatory region, the activity of which can be determined by the cell type into which the vector is introduced. For a discussion of the regulation of gene expression using antisense genes see Weintraub, H. et al., Antisense RNA as a molecular tool for genetic analysis, Reviews-Trends in Genetics, Vol. 1 (1) 1986.

Another aspect of the invention pertains to host cells into which a recombinant expression vector of the invention has been introduced. The terms"host cell"and "recombinant host cell"are used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

A host cell can be any prokaryotic or eukaryotic cell. For example, hALG-2LP, sALG-2LP, or mALG-2LP protein can be expressed in bacterial cells such as E. coli, insect cells, yeast or mammalian cells (such as Chinese hamster ovary cells (CHO) or COS cells). Other suitable host cells are known to those skilled in the art.

Vector DNA can be introduced into prokaryotic or eukaryotic cells via conventional transformation or transfection techniques. As used herein, the terms "transformation"and"transfection"are intended to refer to a variety of art-recognized techniques for introducing foreign nucleic acid (e. g., DNA) into a host cell, including calcium phosphate or calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, or electroporation. Suitable methods for transforming or transfecting host cells can be found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989), and other laboratory manuals.

For stable transfection of mammalian cells, it is known that, depending upon the expression vector and transfection technique used, only a small fraction of cells may integrate the foreign DNA into their genome. In order to identify and select these integrants, a gene that encodes a selectable marker (e. g., resistance to antibiotics) is generally introduced into the host cells along with the gene of interest. Preferred selectable markers include those which confer resistance to drugs, such as G418, hygromycin and methotrexate. Nucleic acid encoding a selectable marker can be introduced into a host cell on the same vector as that encoding hALG-2LP, sALG-2LP, or mALG-2LP or can be introduced on a separate vector. Cells stably transfected with the introduced nucleic acid can be identified by drug selection (e. g., cells that have incorporated the selectable marker gene will survive, while the other cells die).

A host cell of the invention, such as a prokaryotic or eukaryotic host cell in culture, can be used to produce (i. e., express) hALG-2LP, sALG-2LP, or mALG-2LP protein. Accordingly, the invention further provides methods for producing hALG-2LP, sALG-2LP, or mALG-2LP protein using the host cells of the invention. In one embodiment, the method comprises culturing the host cell of invention (into which a recombinant expression vector encoding hALG-2LP, sALG-2LP, or mALG-2LP has been introduced) in a suitable medium until hALG-2LP, sALG-2LP, or mALG-2LP is produced. In another embodiment, the method further comprises isolating hALG-2LP, sALG-2LP, or mALG-2LP from the medium or the host cell.

The host cells of the invention can also be used to produce nonhuman transgenic animals. The nonhuman transgenic animals can be used in screening assays designed to identify agents or compounds, e. g., drugs, pharmaceuticals, etc., which are capable of ameliorating detrimental symptoms of selected disorders such as disorders characterized by deregulated cell death. For example, in one embodiment, a host cell of the invention is a neuronal cell into which hALG-2LP, sALG-2LP, or mALG-2LP-coding sequences have been introduced. Moreover, methods of the invention can be used to create non- human transgenic animals in which exogenous hALG-2LP or sALG-2LP sequences have been introduced into the mouse genome, or homologous recombinant animals in which endogenous sALG-2LP, or mALG-2LP sequences have been altered. Such animals are useful for studying the function and/or activity of hALG-2LP, sALG-2LP, or mALG-2LP and for identifying and/or evaluating modulators of hALG-2LP, sALG-2LP, or mALG-2LP activity. As used herein, a"transgenic animal"is a nonhuman animal, preferably a mammal, more preferably a rodent such as a rat or mouse, in which one or more of the cells of the animal includes a transgene. Other examples of transgenic animals include nonhuman primates, sheep, dogs, cows, goats, chickens, amphibians, etc. A transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal, thereby directing the expression of an encoded gene product in one or more cell types or tissues of the transgenic animal. As used herein, a"homologous recombinant animal"is a nonhuman animal, preferably a mammal, more preferably a mouse, in which an endogenous sALG-2LP, or mALG-2LP gene has been altered by homologous recombination between the endogenous gene and an exogenous DNA molecule introduced into a cell of the animal, e. g., an embryonic cell of the animal, prior to development of the animal.

A transgenic animal of the invention can be created by introducing hALG-2LP, sALG-2LP, or mALG-2LP-encoding nucleic acid into the male pronuclei of a fertilized oocyte, e. g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. The hALG-2LP, sALG-2LP, or mALG-2LP cDNA sequence of SEQ ID NO: 1,4, or 7 can be introduced as a transgene into the genome of a nonhuman animal. Alternatively, a non-human, non-monkey, or non-

murine homologue of the hALG-2LP, sALG-2LP, or mALG-2LP gene, such as a human hALG-2LP, sALG-2LP, or mALG-2LP gene, can be isolated based on hybridization to the hALG-2LP, sALG-2LP, or mALG-2LP cDNA (described further in subsection I above) and used as a transgene. Intronic sequences and polyadenylation signals can also be included in the transgene to increase the efficiency of expression of the transgene. A tissue-specific regulatory sequence (s) can be operably linked to the hALG-2LP, sALG- 2LP, or mALG-2LP transgene to direct expression of hALG-2LP, sALG-2LP, or mALG-2LP protein to particular cells. Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U. S. Patent Nos.

4,736,866 and 4,870,009, both by Leder et al., U. S. Patent No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the hALG-2LP, sALG-2LP, or mALG-2LP transgene in its genome and/or expression of hALG-2LP, sALG-2LP, or mALG-2LP mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene encoding hALG-2LP, sALG-2LP, or mALG-2LP can further be bred to other transgenic animals carrying other transgenes.

To create a homologous recombinant animal, a vector is prepared which contains at least a portion of a hALG-2LP, sALG-2LP, or mALG-2LP gene into which a deletion, addition or substitution has been introduced to thereby alter, e. g., functionally disrupt, the hALG-2LP, sALG-2LP, or mALG-2LP gene. The hALG-2LP, sALG-2LP, or mALG-2LP gene can be a human gene (e. g., from a human genomic clone isolated from a human genomic library screened with the cDNA of SEQ ID NO: 1,4, or 7), but more preferably, is a nonhuman homologue of a human hALG-2LP, sALG-2LP, or mALG- 2LP gene. For example, a rat ALG-2LP gene can be isolated from a rat genomic DNA library using the human ALG-2LP, monkey ALG-2LP, or partial murine ALG-2LP cDNA of SEQ ID NO: 1,4, or 7 as a probe. The rat ALG-2LP gene then can be used to construct a homologous recombination vector suitable for altering an endogenous ALG-

2LP gene in the rat genome. In a preferred embodiment, the vector is designed such that, upon homologous recombination, the endogenous ALG-2LP gene is functionally disrupted (i. e., no longer encodes a functional protein; also referred to as a"knock out" vector). Alternatively, the vector can be designed such that, upon homologous recombination, the endogenous ALG-2LP gene is mutated or otherwise altered but still encodes functional protein (e. g., the upstream regulatory region can be altered to thereby alter the expression of the endogenous ALG-2LP protein). In the homologous recombination vector, the altered portion of the ALG-2LP gene is flanked at its 5'and 3' ends by additional nucleic acid of the ALG-2LP gene to allow for homologous recombination to occur between the exogenous hALG-2LP, sALG-2LP, or mALG-2LP gene carried by the vector and an endogenous ALG-2LP gene in an embryonic stem cell.

The additional flanking hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid is of sufficient length for successful homologous recombination with the endogenous gene.

Typically, several kilobases of flanking DNA (both at the 5'and 3'ends) are included in the vector (see e. g., Thomas, K. R. and Capecchi, M. R. (1987) Cell 51: 503 for a description of homologous recombination vectors). The vector is introduced into an embryonic stem cell line (e. g., by electroporation) and cells in which the introduced hALG-2LP, sALG-2LP, or mALG-2LP gene has homologously recombined with the endogenous ALG-2LP gene are selected (see e. g., Li, E. et al. (1992) Cell 69: 915). The selected cells are then injected into a blastocyst of an animal (e. g., a mouse) to form aggregation chimeras (see e. g., Bradley, A. in Teratocarcinomas and Embryonic Stem Cells: A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987) pp. 113-152). A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term. Progeny harboring the homologously recombined DNA in their germ cells can be used to breed animals in which all cells of the animal contain the homologously recombined DNA by germline transmission of the transgene. Methods for constructing homologous recombination vectors and homologous recombinant animals are described further in Bradley, A. (1991) Current Opinion in Biotechnology 2: 823-829 and in PCT International Publication Nos.: WO 90/11354 by Le Mouellec et al.; WO 91/01140 by Smithies et al.; WO 92/0968 by Zijlstra et al.; and WO 93/04169 by Berns et al.

In another embodiment, transgenic nonhuman animals can be produced which contain selected systems which allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system ofbacteriophage PI. For a description ofthe cre/loxP recombinase system, see, e. g., Lakso et al. (1992) PNAS 89: 6232-6236. Another example of a recombinase system is the FLP recombinase system of Saccharomyces cerevisiae (O'Gorman et al. (1991) Science 251: 1351-1355. If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein are required. Such animals can be provided through the construction of"double"transgenic animals, e. g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.

Clones of the nonhuman transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. (1997) Nature 385: 810- 813 and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell, e. g., a somatic cell, from the transgenic animal can be isolated and induced to exit the growth cycle and enter Go phase. The quiescent cell can then be fused, e. g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring borne of this female foster animal will be a clone of the animal from which the cell, e. g., the somatic cell, is isolated.

III. Isolated hALG-2LP, sALG-2LP, and mALG-2LP Proteins and Anti-hALG- 2LP, Anti-sALG-2LP, and Anti-mALG-2LP Antibodies Another aspect of the invention pertains to isolated hALG-2LP, sALG-2LP, and mALG-2LP proteins, and biologically active portions thereof, as well as peptide fragments suitable for use as immunogens to raise anti-hALG-2LP, anti-sALG-2LP, and anti-mALG-2LP antibodies. An"isolated"or"purified"protein or biologically active portion thereof is substantially free of cellular material when produced by recombinant DNA techniques, or chemical precursors or other chemicals when chemically synthesized. The language"substantially free of cellular material"includes preparations

of hALG-2LP, sALG-2LP, or mALG-2LP protein in which the protein is separated from cellular components of the cells in which it is naturally or recombinantly produced. In one embodiment, the language"substantially free of cellular material"includes preparations of hALG-2LP, sALG-2LP, or mALG-2LP protein having less than about 30% (by dry weight) of non-hALG-2LP, sALG-2LP, or mALG-2LP protein (also referred to herein as a"contaminating protein"), more preferably less than about 20% of non-hALG-2LP, sALG-2LP, or mALG-2LP protein, still more preferably less than about 10% of non-hALG-2LP, sALG-2LP, or mALG-2LP protein, and most preferably less than about 5% non-hALG-2LP, sALG-2LP, or mALG-2LP protein. When the hALG-2LP, sALG-2LP, or mALG-2LP protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i. e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation. The language"substantially free of chemical precursors or other chemicals"includes preparations of hALG-2LP, sALG-2LP, or mALG-2LP protein in which the protein is separated from chemical precursors or other chemicals which are involved in the synthesis of the protein. In one embodiment, the language"substantially free of chemical precursors or other chemicals"includes preparations of hALG-2LP, sALG- 2LP, or mALG-2LP protein having less than about 30% (by dry weight) of chemical precursors or non-hALG-2LP, sALG-2LP, or mALG-2LP chemicals, more preferably less than about 20% chemical precursors or non-hALG-2LP, sALG-2LP, or mALG-2LP chemicals, still more preferably less than about 10% chemical precursors or non-hALG- 2LP, sALG-2LP, or mALG-2LP chemicals, and most preferably less than about 5% chemical precursors or non-hALG-2LP, sALG-2LP, or mALG-2LP chemicals. In preferred embodiments, isolated proteins or biologically active portions thereof lack contaminating proteins from the same animal from which the hALG-2LP, sALG-2LP, or mALG-2LP protein is derived. Typically, such proteins are produced by recombinant expression of, for example, a human ALG-2LP protein in a nonhuman cell.

An isolated hALG-2LP, sALG-2LP, or mALG-2LP protein or a portion thereof of the invention can modulate programmed cell death. In preferred embodiments, the protein or portion thereof comprises an amino acid sequence which is sufficiently

homologous to an amino acid sequence of SEQ ID NO: 2,5, or 8 such that the protein or portion thereof maintains the ability to modulate programmed cell death. The portion of the protein is preferably a biologically active portion as described herein. In another preferred embodiment, the hALG-2LP protein (i. e., amino acid residues 1-284 of SEQ ID NO: 2), sALG-2LP protein (i. e., amino acid residues 1-277 of SEQ ID NO: 5), or mALG-2LP protein (i. e., amino acid residues 1-274 of SEQ ID NO: 8) has an amino acid sequence shown in SEQ ID NO: 2,5, or 8, respectively, or an amino acid sequence which is encoded by the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. In yet another preferred embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP protein has an amino acid sequence which is encoded by a nucleotide sequence which hybridizes, e. g., hybridizes under stringent conditions, to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. In still another preferred embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP protein has an amino acid sequence which is encoded by a nucleotide sequence that is at least about 32%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number. The preferred hALG-2LP, sALG-2LP, or mALG-2LP proteins of the present invention also preferably possess at least one of the hALG-2LP, sALG-2LP, or mALG-2LP activities described herein. For example, a preferred hALG- 2LP, sALG-2LP, or mALG-2LP protein of the present invention includes an amino acid sequence encoded by a nucleotide sequence which hybridizes, e. g., hybridizes under stringent conditions, to the nucleotide sequence of the DNA insert of the plasmid deposited with ATCC as Accession Number and which can modulate programmed cell death.

In other embodiments, the hALG-2LP, sALG-2LP, or mALG-2LP protein is substantially homologous to the amino acid sequence of SEQ ID NO: 2,5, or 8 and retains the functional activity of the protein of SEQ ID NO: 2,5, or 8 yet differs in amino acid sequence due to natural allelic variation or mutagenesis, as described in detail in subsection I above. Accordingly, in another embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP protein is a protein which comprises an amino acid sequence which is at

least about 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to the entire amino acid sequence of SEQ ID NO: 2,5, or 8 and which has at least one of the hALG-2LP, sALG-2LP, or mALG-2LP activities described herein. In other embodiment, the invention pertains to a full length human protein which is substantially homologous to the amino acid sequence of SEQ ID NO: 2, 5, or8 Biologically active portions of the hALG-2LP, sALG-2LP, or mALG-2LP protein include peptides comprising amino acid sequences derived from the amino acid sequence of the hALG-2LP, sALG-2LP, or mALG-2LP protein, e. g., the amino acid sequence shown in SEQ ID NO: 2,5, or 8, respectively or the amino acid sequence of a protein homologous to the hALG-2LP, sALG-2LP, or mALG-2LP protein, which contains less amino acids than the full length hALG-2LP, sALG-2LP, or mALG-2LP protein or the full length protein which is homologous to the hALG-2LP, sALG-2LP, or mALG-2LP protein, and exhibits at least one activity of the hALG-2LP, sALG-2LP, or mALG-2LP protein. Typically, biologically active portions (peptides, e. g., peptides which are, for example, 5,10,15,20,30,35,36,37,38,39,40,50,100 or more amino acids in length) comprise a domain or motif, e. g., a domain showing homology to a calcium binding domain such as an EF hand, derived from a human and is at least about 38%, 42%, 44%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or more homologous to SEQ ID NO: 10,11,12,13, or 15. Moreover, other biologically active portions, in which other regions of the proteins are deleted, can be prepared by recombinant techniques and evaluated for one or more of the activities described herein.

Preferably, the biologically active portions of the hALG-2LP, sALG-2LP, or mALG- 2LP protein include one or more selected domains/motifs or portions thereof having biological activity. hALG-2LP, sALG-2LP, and mALG-2LP proteins are preferably produced by recombinant DNA techniques. For example, a nucleic acid molecule encoding the protein is cloned into an expression vector (as described above), the expression vector is introduced into a host cell (as described above) and the hALG-2LP, sALG-2LP, or mALG-2LP protein is expressed in the host cell. The hALG-2LP, sALG-2LP, or mALG-2LP protein can then be isolated from the cells by an appropriate purification

scheme using standard protein purification techniques. Alternative to recombinant expression, a hALG-2LP, sALG-2LP, or mALG-2LP protein, polypeptide, or peptide can be synthesized chemically using standard peptide synthesis techniques. Moreover, native hALG-2LP, sALG-2LP, or mALG-2LP protein can be isolated from cells (e. g., brain cells or other cells that express ALG2-LP) for example using an anti-hALG-2LP. sALG-2LP, or mALG-2LP antibody (described further below).

The invention also provides hALG-2LP, sALG-2LP, or mALG-2LP chimeric or fusion proteins. As used herein, a hALG-2LP, sALG-2LP, or mALG-2LP"chimeric protein"or"fusion protein"comprises a hALG-2LP, sALG-2LP, or mALG-2LP polypeptide operatively linked to a non-hALG-2LP, sALG-2LP, or mALG-2LP polypeptide. A"hALG-2LP, sALG-2LP, or mALG-2LP polypeptide"refers to a polypeptide having an amino acid sequence corresponding to hALG-2LP, sALG-2LP, or mALG-2LP, whereas a"non-hALG-2LP, sALG-2LP, or mALG-2LP polypeptide"refers to a polypeptide having an amino acid sequence corresponding to a protein which is not substantially homologous to the hALG-2LP, sALG-2LP, or mALG-2LP protein, e. g., a protein which is different from the hALG-2LP, sALG-2LP, or mALG-2LP protein and which is derived from the same or a different organism. Within the fusion protein, the term"operatively linked"is intended to indicate that the hALG-2LP, sALG-2LP, or mALG-2LP polypeptide and the non-hALG-2LP, sALG-2LP, or mALG-2LP polypeptide are fused in-frame to each other. The non-hALG-2LP, sALG-2LP, or mALG-2LP polypeptide can be fused to the N-terminus or C-terminus of the hALG- 2LP, sALG-2LP, or mALG-2LP polypeptide. For example, in one embodiment the fusion protein is a GST-hALG-2LP, GST-sALG-2LP, or GST-mALG-2LP fusion protein in which the hALG-2LP, sALG-2LP, or mALG-2LP sequences are fused to the C-terminus of the GST sequences. Such fusion proteins can facilitate the purification of recombinant hALG-2LP, sALG-2LP, or mALG-2LP. In another embodiment, the fusion protein is a hALG-2LP, sALG-2LP, or mALG-2LP protein containing a heterologous signal sequence at its N-terminus. In certain host cells (e. g., mammalian host cells), expression and/or secretion of hALG-2LP, sALG-2LP, or mALG-2LP can be increased through use of a heterologous signal sequence.

Preferably, a hALG-2LP, sALG-2LP, or mALG-2LP chimeric or fusion protein of the invention is produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different polypeptide sequences are ligated together in- frame in accordance with conventional techniques, for example by employing blunt- ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and reamplified to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al. John Wiley & Sons: 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e. g., a GST polypeptide). A GST encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the hALG-2LP, sALG-2LP, or mALG-2LP protein.

The present invention also pertains to homologues of the hALG-2LP, sALG- 2LP, or mALG-2LP proteins which function as either a hALG-2LP, sALG-2LP, or mALG-2LP agonist (mimetic) or a hALG-2LP, sALG-2LP, or mALG-2LP antagonist.

In a preferred embodiment, the hALG-2LP, sALG-2LP, or mALG-2LP agonists and antagonists stimulate or inhibit, respectively, a subset of the biological activities of the naturally occurring form of the hALG-2LP, sALG-2LP, or mALG-2LP protein. Thus, specific biological effects can be elicited by treatment with a homologue of limited function. In one embodiment, treatment of a subject with a homologue having a subset of the biological activities of the naturally occurring form of the protein has fewer side effects in a subject relative to treatment with the naturally occurring form of the hALG- 2LP, sALG-2LP, or mALG-2LP protein.

Homologues of the hALG-2LP, sALG-2LP, or mALG-2LP protein can be generated by mutagenesis, e. g., discrete point mutation or truncation of the hALG-2LP, sALG-2LP, or mALG-2LP protein. As used herein, the term"homologue"refers to a

variant form of the hALG-2LP, sALG-2LP, or mALG-2LP protein which acts as an agonist or antagonist of the activity of the hALG-2LP, sALG-2LP, or mALG-2LP protein. An agonist of the hALG-2LP, sALG-2LP, or mALG-2LP protein can retain substantially the same, or a subset, of the biological activities of the hALG-2LP, sALG- 2LP, or mALG-2LP protein. An antagonist of the hALG-2LP, sALG-2LP, or mALG- 2LP protein can inhibit one or more of the activities of the naturally occurring form of the hALG-2LP, sALG-2LP, or mALG-2LP protein, by, for example, competitively binding to a downstream or upstream member of the hALG-2LP, sALG-2LP, or mALG- 2LP cascade which includes the hALG-2LP, sALG-2LP, or mALG-2LP protein. Thus, the mammalian hALG-2LP, sALG-2LP, or mALG-2LP protein and homologues thereof of the present invention can be either positive or negative regulators of a programmed cell death transduction pathway activity.

In an alternative embodiment, homologues of the hALG-2LP, sALG-2LP, or mALG-2LP protein can be identified by screening combinatorial libraries of mutants, e. g., truncation mutants, of the hALG-2LP, sALG-2LP, or mALG-2LP protein for hALG-2LP, sALG-2LP, or mALG-2LP protein agonist or antagonist activity. In one embodiment, a variegated library of hALG-2LP, sALG-2LP, or mALG-2LP variants is generated by combinatorial mutagenesis at the nucleic acid level and is encoded by a variegated gene library. A variegated library of hALG-2LP, sALG-2LP, or mALG-2LP variants can be produced by, for example, enzymatically ligating a mixture of synthetic oligonucleotides into gene sequences such that a degenerate set of potential hALG-2LP, sALG-2LP, or mALG-2LP sequences is expressible as individual polypeptides, or alternatively, as a set of larger fusion proteins (e. g., for phage display) containing the set of hALG-2LP, sALG-2LP, or mALG-2LP sequences therein. There are a variety of methods which can be used to produce libraries of potential hALG-2LP, sALG-2LP, or mALG-2LP homologues from a degenerate oligonucleotide sequence. Chemical synthesis of a degenerate gene sequence can be performed in an automatic DNA synthesizer, and the synthetic gene then ligated into an appropriate expression vector.

Use of a degenerate set of genes allows for the provision, in one mixture, of all of the sequences encoding the desired set of potential hALG-2LP, sALG-2LP, or mALG-2LP sequences. Methods for synthesizing degenerate oligonucleotides are known in the art

(see, e. g., Narang, S. A. (1983) Tetrahedron 39: 3; Itakura et al. (1984) Annu. Rev.

Biochem. 53: 323; Itakura et al. (1984) Science 198: 1056; Ike et al. (1983) Nucleic Acid Res. 11: 477).

In addition, libraries of fragments of the hALG-2LP, sALG-2LP, or mALG-2LP protein coding can be used to generate a variegated population of hALG-2LP, sALG- 2LP, or mALG-2LP fragments for screening and subsequent selection of homologues of a hALG-2LP, sALG-2LP, or mALG-2LP protein. In one embodiment, a library of coding sequence fragments can be generated by treating a double stranded PCR fragment of a hALG-2LP, sALG-2LP, or mALG-2LP coding sequence with a nuclease under conditions wherein nicking occurs only about once per molecule, denaturing the double stranded DNA, renaturing the DNA to form double stranded DNA which can include sense/antisense pairs from different nicked products, removing single stranded portions from reformed duplexes by treatment with S 1 nuclease, and ligating the resulting fragment library into an expression vector. By this method, an expression library can be derived which encodes N-terminal, C-terminal and internal fragments of various sizes of the hALG-2LP, sALG-2LP, or mALG-2LP protein.

Several techniques are known in the art for screening gene products of combinatorial libraries made by point mutations or truncation, and for screening cDNA libraries for gene products having a selected property. Such techniques are adaptable for rapid screening of the gene libraries generated by the combinatorial mutagenesis of hALG-2LP, sALG-2LP, or mALG-2LP homologues. The most widely used techniques, which are amenable to high through-put analysis, for screening large gene libraries typically include cloning the gene library into replicable expression vectors, transforming appropriate cells with the resulting library of vectors, and expressing the combinatorial genes under conditions in which detection of a desired activity facilitates isolation of the vector encoding the gene whose product was detected. Recrusive ensemble mutagenesis (REM), a new technique which enhances the frequency of functional mutants in the libraries, can be used in combination with the screening assays to identify hALG-2LP, sALG-2LP, or mALG-2LP homologues (Arkin and Yourvan (1992) PNAS 89: 7811-7815; Delgrave et al. (1993) Protein Engineering 6 (3): 327-331).

In one embodiment, cell based assays can be exploited to analyze a variegated hALG-2LP, sALG-2LP, or mALG-2LP library. For example, a library of expression vectors can be transfected into a cell line, e. g., a T cell hybridoma (3DO) which has been cross-linked with a T cell receptor to induce programmed cell death (as described in Ashwell J. D. et al. (1990) J. Immunol. 144: 3326). The effect of the hALG-2LP, sALG- 2LP, or mALG-2LP mutant on programmed cell death can then be detected, e. g., by monitoring nuclear chromatin changes. Plasmid DNA can then be recovered from the cells which score for inhibition, or alternatively, stimulation of programmed cell death, and the individual clones further characterized.

An isolated hALG-2LP, sALG-2LP, or mALG-2LP protein, or a portion or fragment thereof, can be used as an immunogen to generate antibodies that bind hALG- 2LP, sALG-2LP, or mALG-2LP using standard techniques for polyclonal and monoclonal antibody preparation. The full-length hALG-2LP, sALG-2LP, or mALG- 2LP protein can be used or, alternatively, the invention provides antigenic peptide fragments of hALG-2LP, sALG-2LP, or mALG-2LP for use as immunogens. The antigenic peptide of hALG-2LP, sALG-2LP, or mALG-2LP comprises at least 8 amino acid residues of the amino acid sequence shown in SEQ ID NO: 2,5, or 8 and encompasses an epitope of hALG-2LP, sALG-2LP, or mALG-2LP such that an antibody raised against the peptide forms a specific immune complex with hALG-2LP, sALG- 2LP, or mALG-2LP. Preferably, the antigenic peptide comprises at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of hALG-2LP, sALG-2LP, or mALG-2LP that are located on the surface of the protein, e. g., hydrophilic regions.

A hALG-2LP, sALG-2LP, or mALG-2LP immunogen typically is used to prepare antibodies by immunizing a suitable subject, (e. g., rabbit, goat, mouse or other mammal) with the immunogen. An appropriate immunogenic preparation can contain, for example, recombinantly expressed hALG-2LP, sALG-2LP, or mALG-2LP protein or a chemically synthesized hALG-2LP, sALG-2LP, or mALG-2LP peptide. The preparation can further include an adjuvant, such as Freund's complete or incomplete adjuvant, or similar immunostimulatory agent. Immunization of a suitable subject with

an immunogenic hALG-2LP, sALG-2LP, or mALG-2LP preparation induces a polyclonal anti-hALG-2LP, anti-sALG-2LP, or anti-mALG-2LP antibody response.

Accordingly, another aspect of the invention pertains to anti-hALG-2LP, anti- sALG-2LP, or anti-mALG-2LP antibodies. The term"antibody"as used herein refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i. e., molecules that contain an antigen binding site which specifically binds (immunoreacts with) an antigen, such as hALG-2LP, sALG-2LP, or mALG-2LP.

Examples of immunologically active portions of immunoglobulin molecules include F (ab) and F (ab') 2 fragments which can be generated by treating the antibody with an enzyme such as pepsin. The invention provides polyclonal and monoclonal antibodies that bind hALG-2LP, sALG-2LP, or mALG-2LP. The term"monoclonal antibody"or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one species of an antigen binding site capable of immunoreacting with a particular epitope of hALG-2LP, sALG-2LP, or mALG-2LP. A monoclonal antibody composition thus typically displays a single binding affinity for a particular hALG-2LP, sALG-2LP, or mALG-2LP protein with which it immunoreacts.

Polyclonal anti-hALG-2LP, sALG-2LP, or mALG-2LP antibodies can be prepared as described above by immunizing a suitable subject with a hALG-2LP, sALG- 2LP, or mALG-2LP immunogen. The anti-hALG-2LP, sALG-2LP, or mALG-2LP antibody titer in the immunized subject can be monitored over time by standard techniques, such as with an enzyme linked immunosorbent assay (ELISA) using immobilized hALG-2LP, sALG-2LP, or mALG-2LP. If desired, the antibody molecules directed against hALG-2LP, sALG-2LP, or mALG-2LP can be isolated from the mammal (e. g., from the blood) and further purified by well known techniques, such as protein A chromatography to obtain the IgG fraction. At an appropriate time after immunization, e. g., when the anti-hALG-2LP, sALG-2LP, or mALG-2LP antibody titers are highest, antibody-producing cells can be obtained from the subject and used to prepare monoclonal antibodies by standard techniques, such as the hybridoma technique originally described by Kohler and Milstein (1975) Nature 256: 495-497) (see also, Brown et al. (1981) J. Immunol. 127: 539-46; Brown et al. (1980) J. Biol. Chem . 255: 4980-83; Yeh et al. (1976) PNAS 76: 2927-31; and Yeh et al. (1982) Int. J. Cancer

29: 269-75), the more recent human B cell hybridoma technique (Kozbor et al. (1983) Immunol Today 4: 72), the EBV-hybridoma technique (Cole et al. (1985), Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96) or trioma techniques.

The technology for producing monoclonal antibody hybridomas is well known (see generally R. H. Kenneth, in Monoclonal Antibodies: A New Dimension In Biological Analyses, Plenum Publishing Corp., New York, New York (1980); E. A. Lerner (1981) Yale J. Biol. Med., 54: 387-402; M. L. Gefter et al. (1977) Somatic Cell Genet.

3: 231-36). Briefly, an immortal cell line (typically a myeloma) is fused to lymphocytes (typically splenocytes) from a mammal immunized with a hALG-2LP, sALG-2LP, or mALG-2LP immunogen as described above, and the culture supernatants of the resulting hybridoma cells are screened to identify a hybridoma producing a monoclonal antibody that binds hALG-2LP, sALG-2LP, or mALG-2LP.

Any of the many well known protocols used for fusing lymphocytes and immortalized cell lines can be applied for the purpose of generating an anti-hALG-2LP, sALG-2LP, or mALG-2LP monoclonal antibody (see, e. g., G. Galfre et al. (1977) Nature 266: 55052; Gefter et al. Somatic Cell Genet., cited supra; Lerner, Yale J. Biol.

Med., cited supra; Kenneth, Monoclonal Antibodies, cited supra). Moreover, the ordinarily skilled worker will appreciate that there are many variations of such methods which also would be useful. Typically, the immortal cell line (e. g., a myeloma cell line) is derived from the same mammalian species as the lymphocytes. For example, murine hybridomas can be made by fusing lymphocytes from a mouse immunized with an immunogenic preparation of the present invention with an immortalized mouse cell line.

Preferred immortal cell lines are mouse myeloma cell lines that are sensitive to culture medium containing hypoxanthine, aminopterin and thymidine ("HAT medium"). Any of a number of myeloma cell lines can be used as a fusion partner according to standard techniques, e. g., the P3-NSl/l-Ag4-1, P3-x63-Ag8.653 or Sp2/O-Agl4 myeloma lines.

These myeloma lines are available from ATCC. Typically, HAT-sensitive mouse myeloma cells are fused to mouse splenocytes using polyethylene glycol ("PEG").

Hybridoma cells resulting from the fusion are then selected using HAT medium, which kills unfused and unproductively fused myeloma cells (unfused splenocytes die after several days because they are not transformed). Hybridoma cells producing a

monoclonal antibody of the invention are detected by screening the hybridoma culture supernatants for antibodies that bind hALG-2LP, sALG-2LP, or mALG-2LP, e. g., using a standard ELISA assay.

Alternative to preparing monoclonal antibody-secreting hybridomas, a monoclonal anti-hALG-2LP, sALG-2LP, or mALG-2LP antibody can be identified and isolated by screening a recombinant combinatorial immunoglobulin library (e. g., an antibody phage display library) with hALG-2LP, sALG-2LP, or mALG-2LP to thereby isolate immunoglobulin library members that bind hALG-2LP, sALG-2LP, or mALG- 2LP. Kits for generating and screening phage display libraries are commercially available (e. g., the Pharmacia Recombinant Phage Antibody System, Catalog No. 27- 9400-01; and the Stratagene SurfZAPTM Phage Display Kit, Catalog No. 240612).

Additionally, examples of methods and reagents particularly amenable for use in generating and screening antibody display library can be found in, for example, Ladner et al. U. S. Patent No. 5,223,409; Kang et al. PCT International Publication No. WO 92/18619; Dower et al. PCT International Publication No. WO 91/17271; Winter et al.

PCT International Publication WO 92/20791; Markland et al. PCT International Publication No. WO 92/15679; Breitling et al. PCT International Publication WO 93/01288; McCafferty et al. PCT International Publication No. WO 92/01047; Garrard et al. PCT International Publication No. WO 92/09690; Ladner et al. PCT International Publication No. WO 90/02809; Fuchs et al. (1991) Bio/Technology 9: 1370-1372; Hay et al. (1992) Hum. Antibod. Hybridomas 3: 81-85; Huse et al. (1989) Science 246: 1275- 1281; Griffiths et al. (1993) EMBO J 12: 725-734; Hawkins et al. (1992) J. Mol. Biol.

226: 889-896; Clarkson et al. (1991) Nature 352: 624-628; Gram et al. (1992) PNAS 89: 3576-3580; Garrad et al. (1991) Bio/Technology 9: 1373-1377; Hoogenboom et al.

(1991) Nuc. Acides. 19: 4133-4137; Barbas et al. (1991) PNAS 88: 7978-7982; and McCafferty et al. Nature (1990) 348: 552-554.

Additionally, recombinant anti-hALG-2LP, sALG-2LP, or mALG-2LP antibodies, such as chimeric and humanized monoclonal antibodies, comprising both human and non-human portions, which can be made using standard recombinant DNA techniques, are within the scope of the invention. Such chimeric and humanized monoclonal antibodies can be produced by recombinant DNA techniques known in the

art, for example using methods described in Robinson et al. International Application No. PCT/US86/02269; Akira, et al. European Patent Application 184,187; Taniguchi, M., European Patent Application 171,496; Morrison et al. European Patent Application 173,494; Neuberger et al. PCT International Publication No. WO 86/01533; Cabilly et al. U. S. Patent No. 4,816,567; Cabilly et al. European Patent Application 125,023; Better et al. (1988) Science 240: 1041-1043; Liu et al. (1987) PNAS 84: 3439-3443; Liu et al. (1987) J. Immunol. 139: 3521-3526; Sun et al. (1987) PNAS 84: 214-218; Nishimura et al. (1987) Canc. Res. 47: 999-1005; Wood et al. (1985) Nature 314: 446-449; and Shaw et al. (1988) J. Natl. Cancer Inst. 80: 1553-1559); Morrison, S. L. (1985) Science 229: 1202-1207; Oi et al. (1986) BioTechniques 4: 214; Winter U. S. Patent 5,225,539; Jones et al. (1986) Nature 321: 552-525; Verhoeyan et al. (1988) Science 239: 1534; and Beidler et al. (1988) J. Immunol. 141: 4053-4060.

An anti-hALG-2LP, sALG-2LP, or mALG-2LP antibody (e. g., monoclonal antibody) can be used to isolate hALG-2LP, sALG-2LP, or mALG-2LP by standard techniques, such as affinity chromatography or immunoprecipitation. An anti-hALG- 2LP, sALG-2LP, or mALG-2LP antibody can facilitate the purification of natural hALG-2LP, sALG-2LP, or mALG-2LP from cells and of recombinantly produced hALG-2LP, sALG-2LP, or mALG-2LP expressed in host cells. Moreover, an anti- hALG-2LP, sALG-2LP, or mALG-2LP antibody can be used to detect hALG-2LP, sALG-2LP, or mALG-2LP protein (e. g., in a cellular lysate or cell supernatant) in order to evaluate the abundance and pattern of expression of the hALG-2LP, sALG-2LP, or mALG-2LP protein. Anti-hALG-2LP, sALG-2LP, or mALG-2LP antibodies can be used diagnostically to monitor protein levels in tissue as part of a clinical testing procedure, e. g., to, for example, determine the efficacy of a given treatment regimen.

Detection can be facilitated by coupling (i. e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, P-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein,

fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include 125I, 13lI, 35S or 3H.

IV. Pharmaceutical Compositions The hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid molecules, hALG-2LP, sALG-2LP, or mALG-2LP proteins, and anti-hALG-2LP, sALG-2LP, or mALG-2LP antibodies (also referred to herein as"active compounds") of the invention can be incorporated into pharmaceutical compositions suitable for administration to a subject, e. g., a human. Such compositions typically comprise the nucleic acid molecule, protein, or antibody and a pharmaceutically acceptable carrier. As used herein the language "pharmaceutically acceptable carrier"is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, such media can be used in the compositions of the invention. Supplementary active compounds can also be incorporated into the compositions.

A pharmaceutical composition of the invention is formulated to be compatible with its intended route of administration. Examples of routes of administration include parenteral, e. g., intravenous, intradermal, subcutaneous, oral (e. g., inhalation), transdermal (topical), transmucosal, and rectal administration. Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide. The parenteral preparation can be

enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.

Pharmaceutical compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. For intravenous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS). In all cases, the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof. The proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition. Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate and gelatin.

Sterile injectable solutions can be prepared by incorporating the active compound (e. g., a hALG-2LP, sALG-2LP, or mALG-2LP protein or anti-hALG-2LP, anti-sALG- 2LP, or anti-mALG-2LP antibody) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are

vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.

Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition. The tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.

For administration by inhalation, the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e. g., a gas such as carbon dioxide, or a nebulizer.

Systemic administration can also be by transmucosal or transdermal means. For transmucosal or transdermal administration, penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives. Transmucosal administration can be accomplished through the use of nasal sprays or suppositories. For transdermal administration, the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.

The compounds can also be prepared in the form of suppositories (e. g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.

In one embodiment, the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.

Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid.

Methods for preparation of such formulations will be apparent to those skilled in the art.

The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc. Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U. S. Patent No. 4,522,811.

It is especially advantageous to formulate oral or parenteral compositions in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.

The nucleic acid molecules of the invention can be inserted into vectors and used as gene therapy vectors. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U. S. Patent 5,328,470) or by stereotactic injection (see e. g., Chen et al. (1994) PNAS 91: 3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e. g. retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

The pharmaceutical compositions can be included in a container, pack, or dispenser together with instructions for administration.

V. Uses and Methods of the Invention The nucleic acid molecules, proteins, protein homologues, and antibodies described herein can be used in, for example, diagnostic assays. The isolated nucleic acid molecules of the invention can be used to detect hALG-2LP, sALG-2LP, or mALG- 2LP mRNA (e. g., in a biological sample) or a genetic lesion in a hALG-2LP, sALG- 2LP, or mALG-2LP gene. In addition, the anti-hALG-2LP, anti-sALG-2LP, or anti- mALG-2LP antibodies of the invention can be used to detect and isolate hALG-2LP, sALG-2LP, or mALG-2LP protein and modulate hALG-2LP, sALG-2LP, or mALG- 2LP protein activity.

Accordingly, the invention provides a method for detecting the presence of hALG-2LP, sALG-2LP, or mALG-2LP in a biological sample. The method involves contacting the biological sample with a compound or an agent capable of detecting hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA such that the presence of hALG-2LP, sALG-2LP, or mALG-2LP is detected in the biological sample. A preferred agent for detecting hALG-2LP, sALG-2LP, or mALG-2LP mRNA is a labeled or labelable nucleic acid probe capable of hybridizing to hALG-2LP, sALG-2LP, or mALG-2LP mRNA. The nucleic acid probe can be, for example, the full-length hALG- 2LP, sALG-2LP, or mALG-2LP cDNA of SEQ ID NO: 1,4, or 7, or a portion thereof, such as an oligonucleotide of at least 15,30,50,100,250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to hALG-2LP, sALG- 2LP, or mALG-2LP mRNA. A preferred agent for detecting hALG-2LP, sALG-2LP, or mALG-2LP protein is a labeled or labelable antibody capable of binding to hALG-2LP, sALG-2LP, or mALG-2LP protein. Antibodies can be polyclonal, or more preferably, monoclonal. An intact antibody, or a fragment thereof (e. g., Fab or F (ab') 2) can be used.

The term"labeled or labelable", with regard to the probe or antibody, is intended to encompass direct labeling of the probe or antibody by coupling (i. e., physically linking) a detectable substance to the probe or antibody, as well as indirect labeling of the probe or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be

detected with fluorescently labeled streptavidin. The term"biological sample"is intended to include tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject. That is, the detection method of the invention can be used to detect hALG-2LP, sALG-2LP, or mALG-2LP mRNA or protein in a biological sample in vitro as well as in vivo. For example, in vitro techniques for detection of hALG-2LP, sALG-2LP, or mALG-2LP mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detection of hALG-2LP, sALG-2LP, or mALG-2LP protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.

Alternatively, hALG-2LP, sALG-2LP, or mALG-2LP protein can be detected in vivo in a subject by introducing into the subject a labeled anti-hALG-2LP, sALG-2LP, or mALG-2LP antibody. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques.

The invention also encompasses kits for detecting the presence of hALG-2LP, sALG-2LP, or mALG-2LP in a biological sample. For example, the kit can comprise a labeled or labelable compound or agent capable of detecting hALG-2LP, sALG-2LP, or mALG-2LP protein or mRNA in a biological sample; means for determining the amount of hALG-2LP, sALG-2LP, or mALG-2LP in the sample; and means for comparing the amount of hALG-2LP, sALG-2LP, or mALG-2LP in the sample with a standard. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect hALG-2LP, sALG-2LP, or mALG-2LP mRNA or protein.

The methods of the invention can also be used to detect genetic lesions in a hALG-2LP, sALG-2LP, or mALG-2LP gene, thereby determining if a subject with the lesioned gene is at risk for a disorder, e. g., a disorder characterized by deregulated programmed cell death, characterized by aberrant or abnormal hALG-2LP, sALG-2LP, or mALG-2LP nucleic acid expression or hALG-2LP, sALG-2LP, or mALG-2LP protein activity as defined herein. In preferred embodiments, the methods include detecting, in a sample of cells from the subject, the presence or absence of a genetic lesion characterized by at least one of an alteration affecting the integrity of a gene

encoding a hALG-2LP, sALG-2LP, or mALG-2LP protein, or the misexpression of the hALG-2LP, sALG-2LP, or mALG-2LP gene. For example, such genetic lesions can be detected by ascertaining the existence of at least one of 1) a deletion of one or more nucleotides from a hALG-2LP, sALG-2LP, or mALG-2LP gene; 2) an addition of one or more nucleotides to a hALG-2LP, sALG-2LP, or mALG-2LP gene; 3) a substitution of one or more nucleotides of a hALG-2LP, sALG-2LP, or mALG-2LP gene, 4) a chromosomal rearrangement of a hALG-2LP, sALG-2LP, or mALG-2LP gene; 5) an alteration in the level of a messenger RNA transcript of a hALG-2LP, sALG-2LP, or mALG-2LP gene, 6) aberrant modification of a hALG-2LP, sALG-2LP, or mALG-2LP gene, such as of the methylation pattern of the genomic DNA, 7) the presence of a non- wild type splicing pattern of a messenger RNA transcript of a hALG-2LP, sALG-2LP, or mALG-2LP gene, 8) a non-wild type level of a hALG-2LP, sALG-2LP, or mALG-2LP- protein, 9) allelic loss of a hALG-2LP, sALG-2LP, or mALG-2LP gene, and 10) inappropriate post-translational modification of a hALG-2LP, sALG-2LP, or mALG- 2LP-protein. As described herein, there are a large number of assay techniques known in the art which can be used for detecting lesions in a hALG-2LP, sALG-2LP, or mALG-2LP gene.

In certain embodiments, detection of the lesion involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e. g. U. S. Patent Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e. g., Landegran et al. (1988) Science 241: 1077-1080; and Nakazawa et al. (1994) PNAS 91: 360-364), the latter of which can be particularly useful for detecting point mutations in the hALG-2LP, sALG-2LP, or mALG-2LP-gene (see Abravaya et al. (1995) Nucleic Acids Res. 23 : 675-682). This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e. g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to a hALG-2LP, sALG-2LP, or mALG-2LP gene under conditions such that hybridization and amplification of the hALG-2LP, sALG-2LP, or mALG-2LP-gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample.

In an alternative embodiment, mutations in a hALG-2LP, sALG-2LP, or mALG- 2LP gene from a sample cell can be identified by alterations in restriction enzyme cleavage patterns. For example, sample and control DNA is isolated, amplified (optionally), digested with one or more restriction endonucleases, and fragment length sizes are determined by gel electrophoresis and compared. Differences in fragment length sizes between sample and control DNA indicates mutations in the sample DNA.

Moreover, the use of sequence specific ribozymes (see, for example, U. S. Patent No.

5,498, 531) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site.

In yet another embodiment, any of a variety of sequencing reactions known in the art can be used to directly sequence the hALG-2LP, sALG-2LP, or mALG-2LP gene and detect mutations by comparing the sequence of the sample hALG-2LP, sALG-2LP, or mALG-2LP with the corresponding wild-type (control) sequence. Examples of sequencing reactions include those based on techniques developed by Maxam and Gilbert ( (1977) PNAS 74: 560) or Sanger ( (1977) PNAS 74: 5463). A variety of automated sequencing procedures can be utilized when performing the diagnostic assays ( (1995) Biotechniques 19: 448), including sequencing by mass spectrometry (see, e. g., PCT International Publication No. WO 94/16101; Cohen et al. (1996) Adv. Chromatogr.

36: 127-162; and Griffin et al. (1993) Appl. Biochem. Biotechnol. 38: 147-159).

Other methods for detecting mutations in the hALG-2LP, sALG-2LP, or mALG- 2LP gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes (Myers et al. (1985) Science 230: 1242); Cotton et al. (1988) PNAS 85: 4397; Saleeba et al. (1992) Meth. Enzymol.

217: 286-295), electrophoretic mobility of mutant and wild type nucleic acid is compared (Orita et al. (1989) PNAS 86: 2766; Cotton (1993) Mutat Res 285: 125-144; and Hayashi (1992) Genet Anal Tech Appl 9: 73-79), and movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (Myers et al (1985) Nature 313: 495). Examples of other techniques for detecting point mutations include, selective oligonucleotide hybridization, selective amplification, and selective primer extension.

VI. Uses of Partial hALG-2LP, sALG-2LP, and mALG-2LP Sequences Portions or fragments of the cDNA sequences identified herein (and the corresponding complete gene sequences) can be used in numerous ways as polynucleotide reagents. For example, these sequences can be used to: (a) map their respective genes on a chromosome; and, thus, locate gene regions associated with genetic disease; (b) identify an individual from a minute biological sample (tissue typing); and (c) aid in forensic identification of a biological sample. These applications are described in the subsections below. a. Chromosome Mapping Once the sequence (or a portion of the sequence) of a gene has been isolated, this sequence can be used to map the location of the gene on a chromosome. This process is called chromosome mapping. Accordingly, portions or fragments of the hALG-2LP, sALG-2LP, and mALG-2LP, sequences, described herein, can be used to map the location of the hALG-2LP, sALG-2LP, and mALG-2LP genes, respectively, on a chromosome. The mapping of the hALG-2LP, sALG-2LP, and mALG-2LP sequences to chromosomes is an important first step in correlating these sequences with genes associated with disease.

Briefly, hALG-2LP, sALG-2LP, and mALG-2LP genes can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp in length) from the hALG-2LP, sALG-2LP, and mALG-2LP sequences. Computer analysis of the hALG- 2LP, sALG-2LP, and mALG-2LP, sequences can be used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers can then be used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the hALG-2LP, sALG-2LP, and mALG-2LP sequences will yield an amplified fragment.

Somatic cell hybrids are prepared by fusing somatic cells from different mammals (e. g., human and mouse cells). As hybrids of human and mouse cells grow and divide, they gradually lose human chromosomes in random order, but retain the mouse chromosomes. By using media in which mouse cells cannot grow, because they

lack a particular enzyme, but human cells can, the one human chromosome that contains the gene encoding the needed enzyme, will be retained. By using various media, panels of hybrid cell lines can be established. Each cell line in a panel contains either a single human chromosome or a small number of human chromosomes, and a full set of mouse chromosomes, allowing easy mapping of individual genes to specific human chromosomes. (D'Eustachio P. et al. (1983) Science 220: 919-924). Somatic cell hybrids containing only fragments of human chromosomes can also be produced by using human chromosomes with translocations and deletions.

PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular sequence to a particular chromosome. Three or more sequences can be assigned per day using a single thermal cycler. Using the hALG-2LP, sALG-2LP, and mALG-2LP sequences to design oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes. Other mapping strategies which can similarly be used to map a hALG-2LP, sALG-2LP, or mALG-2LP sequence to its chromosome include in situ hybridization (described in Fan, Y. et al.

(1990) PNAS, 87: 6223-27), pre-screening with labeled flow-sorted chromosomes, and pre-selection by hybridization to chromosome specific cDNA libraries.

Fluorescence in situ hybridization (FISH) of a DNA sequence to a metaphase chromosomal spread can further be used to provide a precise chromosomal location in one step. Chromosome spreads can be made using cells whose division has been blocked in metaphase by a chemical like colcemid that disrupts the mitotic spindle. The chromosomes can be treated briefly with trypsin, and then stained with Giemsa. A pattern of light and dark bands develops on each chromosome, so that the chromosomes can be identified individually. The FISH technique can be used with a DNA sequence as short as 500 or 600 bases. However, clones larger than 1,000 bases have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. Preferably 1,000 bases, and more preferably 2,000 bases will suffice to get good results at a reasonable amount of time. For a review of this technique, see Verma et al., Human Chromosomes: A Manual of Basic Techniques (Pergamon Press, New York 1988).

Reagents for chromosome mapping can be used individually to mark a single chromosome or a single site on that chromosome, or panels of reagents can be used for marking multiple sites and/or multiple chromosomes. Reagents corresponding to noncoding regions of the genes actually are preferred for mapping purposes. Coding sequences are more likely to be conserved within gene families, thus increasing the chance of cross hybridizations during chromosomal mapping.

Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. (Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man, available on-line through Johns Hopkins University Welch Medical Library). The relationship between genes and disease, mapped to the same chromosomal region, can then be identified through linkage analysis (co-inheritance of physically adjacent genes), described in, for example, Egeland, J. et al. (1987) Nature, 325: 783-787.

Moreover, differences in the DNA sequences between individuals affected and unaffected with a disease associated with the hALG-2LP, sALG-2LP, or mALG-2LP gene, can be determined. If a mutation is observed in some or all of the affected individuals but not in any unaffected individuals, then the mutation is likely to be the causative agent of the particular disease. Comparison of affected and unaffected individuals generally involves first looking for structural alterations in the chromosomes, such as deletions or translocations that are visible from chromosome spreads or detectable using PCR based on that DNA sequence. Ultimately, complete sequencing of genes from several individuals can be performed to confirm the presence of a mutation and to distinguish mutations from polymorphisms. b. Tissue Typing The hALG-2LP, sALG-2LP, and mALG-2LP sequences of the present invention can also be used to identify individuals from minute biological samples. The United States military, for example, is considering the use of restriction fragment length polymorphism (RFLP) for identification of its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identification. This method does not suffer

from the current limitations of"Dog Tags"which can be lost, switched, or stolen, making positive identification difficult. The sequences of the present invention are useful as additional DNA markers for RFLP (described in U. S. Patent 5,272,057).

Furthermore, the sequences of the present invention can be used to provide an alternative technique which determines the actual base-by-base DNA sequence of selected portions of an individual's genome. Thus, the hALG-2LP, sALG-2LP, or mALG-2LP sequences described herein can be used to prepare two PCR primers from the 5'and 3'ends of the sequences. These primers can then be used to amplify an individual's DNA and subsequently sequence it.

Panels of corresponding DNA sequences from individuals, prepared in this manner, can provide unique individual identifications, as each individual will have a unique set of such DNA sequences due to allelic differences. The sequences of the present invention can be used to obtain such identification sequences from individuals and from tissue. The hALG-2LP, sALG-2LP, or mALG-2LP sequences of the invention uniquely represent portions of the human genome. Allelic variation occurs to some degree in the coding regions of these sequences, and to a greater degree in the noncoding regions. It is estimated that allelic variation between individual humans occurs with a frequency of about once per each 500 bases. Each of the sequences described herein can, to some degree, be used as a standard against which DNA from an individual can be compared for identification purposes. Because greater numbers of polymorphisms occur in the noncoding regions, fewer sequences are necessary to differentiate individuals.

The noncoding sequences of SEQ ID NOs: 1,4, and 7, can comfortably provide positive individual identification with a panel of perhaps 10 to 1,000 primers which each yield a noncoding amplified sequence of 100 bases. If predicted coding sequences, such as those in SEQ ID NOs: 3,6, and 9, are used, a more appropriate number of primers for positive individual identification would be 500-2,000.

If a panel of reagents from hALG-2LP, sALG-2LP, or mALG-2LP sequences described herein is used to generate a unique identification database for an individual, those same reagents can later be used to identify tissue from that individual. Using the unique identification database, positive identification of the individual, living or dead, can be made from extremely small tissue samples.

c. Use of Partial hALG-2LP, sALG-2LP, and mALG-2LP Sequences in Forensic Biology DNA-based identification techniques can also be used in forensic biology.

Forensic biology is a scientific field employing genetic typing of biological evidence found at a crime scene as a means for positively identifying, for example, a perpetrator of a crime. To make such an identification, PCR technology can be used to amplify DNA sequences taken from very small biological samples such as tissues, e. g., hair or skin, or body fluids, e. g., blood, saliva, or semen found at a crime scene. The amplified sequence can then be compared to a standard, thereby allowing identification of the origin of the biological sample.

The sequences of the present invention can be used to provide polynucleotide reagents, e. g., PCR primers, targeted to specific loci in the human genome, which can enhance the reliability of DNA-based forensic identifications by, for example, providing another"identification marker" (i. e. another DNA sequence that is unique to a particular individual). As mentioned above, actual base sequence information can be used for identification as an accurate alternative to patterns formed by restriction enzyme generated fragments. Sequences targeted to noncoding regions of SEQ ID NOs: 1,4, and 7 are particularly appropriate for this use as greater numbers of polymorphisms occur in the noncoding regions, making it easier to differentiate individuals using this technique.

Examples of polynucleotide reagents include the hALG-2LP, sALG-2LP, and mALG- 2LP sequences or portions thereof, e. g., fragments derived from the noncoding regions of SEQ ID NOs: 1,4, and 7, having a length of at least 20 bases, preferably at least 30 bases.

The hALG-2LP, sALG-2LP, and mALG-2LP sequences described herein can further be used to provide polynucleotide reagents, e. g., labeled or labelable probes which can be used in, for example, an in situ hybridization technique, to identify a specific tissue, e. g., brain tissue. This can be very useful in cases where a forensic pathologist is presented with a tissue of unknown origin. Panels of such hALG-2LP, sALG-2LP, and mALG-2LP probes can be used to identify tissue by species and/or by organ type.

In a similar fashion, these reagents, e. g., hALG-2LP, sALG-2LP, and mALG- 2LP primers or probes can be used to screen tissue culture for contamination (i. e. screen for the presence of a mixture of different types of cells in a culture).

This invention is further illustrated by the following examples which should not be construed as limiting. The contents of all references, patent applications, patents, and published patent applications cited throughout this application are hereby incorporated by reference.

EXAMPLES EXAMPLE 1: IDENTIFICATION AND CHARACTERIZATION OF hALG-2LP, sALG-2LP, and mALG-2LP cDNA In this example, the hALG-2LP, sALG-2LP, and mALG-2LP nucleic acid molecules were identified by screening appropriate cDNA libraries. An EST (jlkbcO63cO4) was first identified in a monkey brain cDNA library using the Sequence Explorer. A mouse EST (jlmbaO05eO1) was subsequently identified in a mouse brain cDNA library and two human ESTs were also identified by screening proprietary libraries. The positive clones were sequenced, and the sequences were assembled.

A BLASTN search of the EST database revealed the following ESTs having significant homology to the hALG-2LP cDNA: EST Database hits Species Base Pairs Coding ? Covered Identi Accession # AA569956 Human 1149-1630 100 Yes Accession # AA226400 Human 1124-1643 100 Yes Accession # W80352 Human 1208-1657 99 Yes Accession# AA533187 Human 1154-1630 96 Yes Accession # AA633700 Human 1160-1599 99 Yes Accession # N95345 Human 1237-1630 98 Yes Accession # AA431700 Human 873-1305 100 Yes Accession # AA311285 Human 911-1341 100 Yes Accession # AA643585 Human 1202-1629 99. 5 Yes Accession # AA040058 Human 1173-1630 96 Yes A BLASTN"search of the EST database revealed the following ESTs having significant homology to the sALG-2LP cDNA:

EST Database hits Species Base Pairs % Coding ? Covered Identity Accession# AA431700 Human 845-1266 96 No Accession# AA311285 Human 870-1302 94 No Accession# W26197 Human 845-1232 94 No Accession# AA031577 Humari 766-1224 94 No Accession# AA215228 Mouse 135-675 90 Yes Accession# AA110246 Mouse 135-675 Yes A BLASTN"search of the EST database revealed the following ESTs having significant homology to the partial mALG-2LP cDNA:

EST Database hits Species Base Pairs % Coding ? Covered Identi Accession# AA110246 Mouse 283-608 99 Yes Accession# AA215228 Mouse 296-833 99 Yes Accession # W77580 Mouse 664-1000 99 Yes Accession# AA119341 Mouse 888-1107 Yes EXAMPLE 2: TISSUE EXPRESSION OF THE hALG-2LP, sALG-2LP, and mALG-2LP GENES Northern Analysis Human, monkey, and mouse multiple tissue northern (MTN) blots, human MTN I, II, and III blots (Clontech, Palo Alto, CA), containing 2 ###g of poly A+ RNA per lane were probed with hALG-2LP-specific primers (probes). The filters were prehybridized in 10 ml of Express Hyb hybridization solution (Clontech, Palo Alto, CA) at 68°C for 1 hour, after which 100 ng of 32p labeled probe was added. The probe was generated using the Stratagene Prime-It kit, Catalog Number 300392 (Clontech, Palo Alto, CA). Hybridization was allowed to proceed at 68°C for approximately 2 hours.

The filters were washed in a 0.05% SDS/2X SSC solution for 15 minutes at room temperature and then twice with a 0.1% SDS/O. 1X SSC solution for 20 minutes at 50°C and then exposed to autoradiography film overnight at-80°C with one screen. The human and mouse tissues tested included: brain, heart, kidney, liver, lung, skeletal muscle, spleen, testis, placenta, pancreas, colon, prostate, ovaries, small intestine, and hypothalamus.

There was a strong hybridization to all the tissues tested, except hypothalamus, indicating that ALG-2LP gene transcripts are expressed in these tissues.

EXAMPLE 3: EXPRESSION OF RECOMBINANT hALG-2LP, sALG-2LP, and mALG-2LP PROTEINS IN BACTERIAL CELLS In this example, hALG-2LP, sALG-2LP, and mALG-2LP are expressed as recombinant glutathione-S-transferase (GST) fusion proteins in E. coli and the fusion proteins are isolated and characterized. Specifically, hALG-2LP, sALG-2LP, and mALG-2LP are fused to GST and these fusion proteins are expressed in E. coli, e. g., strain PEB199. As hALG-2LP, sALG-2LP, and mALG-2LP are predicted to be 32.7 kD, 31.8 kD, and 31.5 kD, respectively, and GST is predicted to be 26 kD, the fusion proteins are predicted to be 58.7 kD, 57.8 kD, and 57.5 kD in molecular weight, respectively. Expression of the GST-hALG-2LP,-sALG-2LP, and-mALG-2LP fusion proteins in PEB 199 is induced with IPTG. The recombinant fusion proteins are purified from crude bacterial lysates of the induced PEB 199 strain by affinity chromatography on glutathione beads. Using polyacrylamide gel electrophoretic analysis of the proteins purified from the bacterial lysates, the molecular weight of the resultant fusion proteins is determined.

EXAMPLE 4: EXPRESSION OF RECOMBINANT hALG-2LP, sALG-2LP, and mALG-2LP PROTEIN IN COS CELLS To express the hALG-2LP, sALG-2LP, or mALG-2LP gene in COS cells, the pcDNA/Amp vector by Invitrogen Corporation (San Diego, CA) is used. This vector contains an SV40 origin of replication, an ampicillin resistance gene, an E. coli replication origin, a CMV promoter followed by a polylinker region, and an SV40 intron and polyadenylation site. A DNA fragment encoding the entire hALG-2LP, sALG-2LP, or mALG-2LP protein and a HA tag (Wilson et al. (1984) Cell 37: 767) fused in-frame to its 3'end of the fragment is cloned into the polylinker region of the vector, thereby placing the expression of the recombinant protein under the control of the CMV promoter.

To construct the plasmid, the hALG-2LP, sALG-2LP, or mALG-2LP DNA sequence is amplified by PCR using two primers. The 5'primer contains the restriction site of interest followed by approximately twenty nucleotides of the hALG-2LP, sALG- 2LP, or mALG-2LP coding sequence starting from the initiation codon; the 3'end

sequence contains complementary sequences to the other restriction site of interest, a translation stop codon, the HA tag and the last 20 nucleotides of the hALG-2LP, sALG- 2LP, or mALG-2LP coding sequence. The PCR amplified fragment and the pCDNA/Amp vector are digested with the appropriate restriction enzymes and the vector is dephosphorylated using the CIAP enzyme (New England Biolabs, Beverly, MA).

Preferably the two restriction sites chosen are different so that the hALG-2LP, sALG- 2LP, and mALG-2LP gene is inserted in the correct orientation. The ligation mixture is transformed into E. coli cells (strains HB101, DH5a, SURE, available from Stratagene Cloning Systems, La Jolla, CA, can be used), the transformed culture is plated on ampicillin media plates, and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.

COS cells are subsequently transfected with the hALG-2LP, sALG-2LP, or mALG-2LP-pcDNA/Amp plasmid DNA using the calcium phosphate or calcium chloride co-precipitation methods, DEAE-dextran-mediated transfection, lipofection, or electroporation. Other suitable methods for transfecting host cells can be found in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual.

2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989. The expression of the hALG-2LP, sALG-2LP, or mALG- 2LP protein is detected by radiolabelling (35S-methionine or 35S-cysteine available from NEN, Boston, MA, can be used) and immunoprecipitation (Harlow, E. and Lane, D.

Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1988) using an HA specific monoclonal antibody. Briefly, the cells are labelled for 8 hours with 35S-methionine (or 35S-cysteine). The culture media are then collected and the cells are lysed using detergents (RIPA buffer, 150 mM NaCl, 1% NP- 40,0.1% SDS, 0.5% DOC, 50 mM Tris, pH 7.5). Both the cell lysate and the culture media are precipitated with an HA specific monoclonal antibody. Precipitated proteins are then analyzed by SDS-PAGE.

Alternatively, DNA containing the hALG-2LP, sALG-2LP, or mALG-2LP coding sequence is cloned directly into the polylinker of the pCDNA/Amp vector using the appropriate restriction sites. The resulting plasmid is transfected into COS cells in

the manner described above, and the expression of the hALG-2LP, sALG-2LP, or mALG-2LP protein is detected by radiolabelling and immunoprecipitation using a hALG-2LP, sALG-2LP, or mALG-2LP specific monoclonal antibody EXAMPLE 5: CHARACTERIZATION OF hALG-2LP, sALG-2LP, and mALG-2LP PROTEINS In this example, the amino acid sequences of the hALG-2LP, sALG-2LP, and mALG-2LP proteins were compared to amino acid sequences of known proteins and various motifs were identified.

The hALG-2LP protein, the amino acid sequence of which is shown in Figure 1 (SEQ ID NO: 2), is a novel protein which includes 284 amino acid residues. Amino acid residues 127 to 139 and 194-206 of SEQ ID NO: 2 (shown separately as SEQ ID NO: 10 and SEQ ID NO: 11, respectively) comprise domains showing high homology to calcium binding domains, e. g., EF hands.

A BLAST search (Altschul et al. (1990) J. Mol. Biol. 215: 403) of the protein sequences of human ALG-2LP revealed that hALG-2LP is similar to the following proteins: mouse probable calcium binding protein (Accession No. P12815), human Sorcin (Accession No. P30626), mouse Accession No. 50266, mouse calcium binding protein (Accession No. S04970), and Chinese hamster Sorcin (Accession No. P05044).

Human ALG-2LP is 44% identical to mouse probable calcium binding protein (Accession No. P12815) over nucleotides 396-872; 38% identical to human Sorcin (Accession No. P30626) over nucleotides 444-872; 44% identical to mouse Accession No. 50266 over nucleotides 396-872; 44% identical to mouse calcium binding protein (Accession No. S04970) over nucleotides 396-872; and 37% identical to Chinese hamster Sorcin (Accession No. P05044) over nucleotides 444-857, at the amino acid level.

The sALG-2LP protein, the amino acid sequence of which is shown in Figure 2 (SEQ ID NO: 5, is a novel protein which includes 277 amino acid residues. Amino acid residues 120 to 132 and 187-199 of SEQ ID NO: 5 (shown separately as SEQ ID NO: 12 and SEQ ID NO: 13, respectively) comprise doamins showing high homology to calcium binding domains, e. g., EF hands.

A BLAST search (Altschul et al. (1990) J. Mol. Biol. 215: 403) of the protein sequences of monkey ALG-2LP revealed that sALG-2LP is similar to the following proteins: mouse probable calcium binding protein (Accession No. P12815), human Sorcin (Accession No. P30626), and Chinese hamster Sorcin (Accession No. P05044).

Human ALG-2LP is 42% identical to mouse probable calcium binding protein (Accession No. P12815) over nucleotides 376-831; 38% identical to human Sorcin (Accession No. P30626) over nucleotides 376-831; and 37% identical to Chinese hamster Sorcin (Accession No. P05044) over nucleotides 403-816, at the amino acid level.

The mALG-2LP protein, the partial amino acid sequence of which is shown in Figure 3 (SEQ ID NO: 8, is a novel protein which includes 274 amino acid residues.

Amino acid residues 117 to 129 and 184 to 196 of SEQ ID NO: 8 (shown separately as SEQ ID NO: 14 and SEQ ID NO: 15, respectively) comprise domains showing homology to calcium binding domains, e. g., EF hands.

A BLAST search (Altschul et al. (1990) J. Mol. Biol. 215: 403) of the protein sequences of partial murine ALG-2LP revealed that mALG-2LP is similar to the following proteins: mouse probable calcium binding protein (Accession No. P12815), mouse calcium binding protein (Accession No. S04970), and human Sorcin (Accession No. P30626). Partial murine ALG-2LP is 45% identical to mouse probable calcium binding protein (Accession No. P12815) over amino acid residues 115-221; 43% identical to mouse calcium binding protein (Accession No. S04970) over amino acid residues 130-221; and 39% identical to human Sorcin (Accession No. P30626) over amino acid residues 131-227.

Equivalents Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the following claims.