TITLE: ALKALOID BIOSYNTHESIS FACILITATING PROTEINS AND METHODS OF USE

FIELD OF THE DISCLOSURE

[001] The methods and systems disclosed herein relate to a class of chemical compounds known as alkaloids and methods of making alkaloids, including benzylisoquinoline compounds, and further in particular to biosynthetic methods for making alkaloids.

BACKGROUND OF THE DISCLOSURE

[002] The following paragraphs are provided by way of background to the present disclosure.

[003] Alkaloids are a class of nitrogenous organic chemical compounds that are naturally produced by opium poppy {Papaver somniferum), and a range of other plant species belonging to the Papaveraceae family of plants, as well as other plant families including, for example the Lauraceae, Annonaceae, Euphorbiaceae and the Moraceae. The interest of the art in alkaloid compounds is well established and can be explained by the pharmacological properties of these compounds, as well as their utility as feedstock materials in the manufacture of pharmaceutical compounds.

[004] The manufacture of alkaloid compounds can involve the conversion of precursor alkaloid compounds into one or more intermediary alkaloid compounds to yield a desired alkaloid compound, for example, a desired benzylisoquinoline compound. In biosynthetic production systems, enzymes can catalyze the conversion reaction of precursor alkaloid compounds into intermediate alkaloid compounds, or into a desired product alkaloid. However in many biosynthetic production systems, alkaloid compounds are not efficiently converted into the desired products, for example, due to substrate inhibition, or they can be converted into products other than the desired alkaloids products, each of which results into low alkaloid product yields. Thus the yields of biosynthetic production systems are frequently lower than desired, while costs are higher than desired.

[005] There exists therefore a need in the art for improved processes to produce alkaloid compounds. SUMMARY OF THE DISCLOSURE

[006] The following paragraphs are intended to introduce the reader to the more detailed description, not to define or limit the claimed subject matter of the present disclosure.

[007] In one aspect, the present disclosure relates to alkaloid compounds.

[008] In another aspect, the present disclosure relates to biosynthetic systems for making alkaloid compounds.

[009] Accordingly, in one aspect, the present disclosure provides, in at least one embodiment, a method of producing a product alkaloid compound in a host cell, the method comprising:

(a) providing a host cell having an enzyme complement to biosynthetically produce one or more product alkaloid compounds;

(b) introducing a chimeric nucleic acid into the host cell, a chimeric nucleic acid comprising as operably linked components (i) a nucleic acid sequence encoding at least one alkaloid biosynthesis facilitating protein; and (ii) a nucleic acid sequence capable of controlling expression of the alkaloid biosynthesis facilitating protein in the host cell; and

(c) growing the host cell to produce the alkaloid biosynthesis facilitating protein, and the one or more product alkaloid compounds from a substrate by the host cell enzyme complement.

[0010] The present disclosure demonstrates that the production of the alkaloid is increased in the presence of an alkaloid biosynthesis facilitating protein (ABFP). Specifically, sixteen ABFP proteins were tested which share common protein motifs which are indicated as motif 1, motif 2 and motif 3. Accordingly, in one embodiment, the alkaloid biosynthesis facilitating protein comprises one or more motifs selected from motif 1, motif 2 and motif 3 shown in FIG. 10. In another embodiment, the alkaloid biosynthesis facilitating protein comprises all 3 motifs shown in FIG. 10.

[0011] In one embodiment, the ABFP protein comprises:

(a) Motif 1 sequence selected from any one of SEQ.ID NO: 109 to SEQ.ID NO: 121, or a sequence that is at least 75% identical thereto; and/or (b] Motif 2 sequence selected from any one of SEQ.ID NO: 122 to SEQ.ID NO: 137, or a sequence that is at least 75% identical thereto; and/or

(c] Motif 3 sequence selected from any one of SEQ.ID NO: 138 to SEQ.ID NO: 153, or a sequence that is at least 75% identical thereto.

[0012] In some embodiments, the sequence motif (a], (b] and/or (c], can be at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to the polypeptide sequence motif of (a], (b] and/or (c]

[0013] In some embodiments, the alkaloid biosynthesis facilitating protein can comprise a polypeptide sequence motif that is identical or substantially identical to

(a] a first alkaloid biosynthesis facilitating protein sequence motif selected from

SEQ.ID NO: 109, SEQ.ID NO: 110, SEQ.ID NO: 111, SEQ.ID NO: 112, SEQ.ID NO: 113, SEQ.ID NO: 114, SEQ.ID NO: 115, SEQ.ID NO: 116, SEQ.ID NO: 117, SEQ.ID NO: 118, SEQ.ID NO: 119, SEQ.ID NO: 120; and SEQ.ID NO: 121; and/or

(b] a second alkaloid biosynthesis facilitating protein sequence motif selected from

SEQ.ID NO: 122, SEQ.ID NO: 123, SEQ.ID NO: 124, SEQ.ID NO: 125, SEQ.ID NO: 126, SEQ.ID NO: 127, SEQ.ID NO: 128, SEQ.ID NO: 129, SEQ.ID NO: 130, SEQ.ID NO: 131, SEQ.ID NO: 132, SEQ.ID NO: 133, SEQ.ID NO: 134, SEQ.ID NO: 135, SEQ.ID NO: 136, and SEQ.ID NO: 137; and/or

(c] a third alkaloid biosynthesis facilitating protein sequence motif selected from

SEQ.ID NO: 138, SEQ.ID NO: 139, SEQ.ID NO: 140, SEQ.ID NO: 141, SEQ.ID NO: 142, SEQ.ID NO: 143, SEQ.ID NO: 144, SEQ.ID NO: 145, SEQ.ID NO: 146, SEQ.ID NO: 147, SEQ.ID NO: 148, SEQ.ID NO: 149, SEQ.ID NO: 150, SEQ.ID NO: 151, SEQ.ID NO: 152, and SEQ.ID NO: 153. [0014] In some embodiments, the alkaloid biosynthesis facilitating protein can be a protein expressed by a nucleic acid sequence selected from the nucleic acid sequences consisting of

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID NO: 9,

SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17,

SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24,

SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32,

SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40,

SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47,

SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO: 161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO: 165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO: 169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO: 173, SEQ.ID NO: 174 or SEQ.ID NO: 175;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34,

SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34,

SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and (g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b], (c], (d], (e] or (f).

[0015] In some embodiments, the product alkaloid compound can be a benzylisoquinoline precursor compound.

[0016] In some embodiments, the product alkaloid compound can be a benzylisoquinoline compound.

[0017] In some embodiments, the product alkaloid compound can be a benzylisoquinoline precursor compound selected from L-dihydroxyphenyl alanine (L-DOPA], dopamine, tyramine, 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA], and 4-hydroxy-phenylacetaldehyde (4-HPAA]

[0018] In some embodiments, the product alkaloid compound can be a benzylisoquinoline compound selected from (S]-norcoclaurine, (5]- norlaudanosoline, (5]-6-0-methyl-norlaudanosoline, (5]-coclaurine, ( S]-N - methylcoclaurine, (5]-3’-hydroxy-/V-methylcoclaurine, (5]-reticuline, (7?]-reticuline, salutaridine, salutaridinol, salutaridinol-7-0-acetate, thebaine, oripavine, neopine, neopinone, codeinone, codeine, neomorphinone, neomorphine, morphinone, and morphine.

[0019] In some embodiments, the substrate can be a substrate benzylisoquinoline precursor compound.

[0020] In some embodiments, the substrate can be a substrate benzylisoquinoline compound.

[0021] In some embodiments, the substrate can be a benzylisoquinoline precursor compound selected from L-tyrosine, L-dihydroxyphenyl alanine (L- DOPA], dopamine, tyramine, 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA], and 4- hydroxy-phenylacetaldehyde (4-HPAA]

[0022] In some embodiments, the substrate can be a benzylisoquinoline compound selected from (S]-norcoclaurine, (S]-norlaudanosoline, (5] -6-0-methyl - norlaudanosoline, (S]-coclaurine, (5]-/V-methylcoclaurine, (5] -3’ -hydroxy -/V- methylcoclaurine, (5] -reticuline, (/?]-reticuline, salutaridine, salutaridinol, salutaridinol-7-0-acetate, thebaine, neopinone, codeinone, codeine, oripavine, neomorphinone, and morphinone.

[0023] In some embodiments, the host cell enzyme complement can be a benzylisoquinoline precursor enzyme complement. [0024] In some embodiments, the host cell enzyme complement can be a benzylisoquinoline enzyme complement.

[0025] In some embodiments, the benzylisoquinoline precursor enzyme complement can comprise one or more benzylisoquinoline precursor biosynthetic enzymes, and the enzymes can be tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], or monoamine oxidase (MAO]

[0026] In some embodiments, the benzylisoquinoline enzyme complement can comprise one or more benzylisoquinoline biosynthetic enzymes, and the enzymes can be norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S]-N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-0-demethylase (T60DM], neopinone isomerase (NISO], codeinone reductase (COR], or codeine-O-demethylase (CODM]

[0027] In some embodiments, the substrate can be converted into a product alkaloid compound in a single enzymatically catalyzed chemical step.

[0028] In some embodiments, the substrate can be converted into a product alkaloid compound in two or more enzymatically catalyzed chemical steps.

[0029] In some embodiments, the product benzylisoquinoline precursor compound can be 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA], the benzylisoquinoline precursor enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA], and the enzymes can be selected from monoamine oxidase (MAO] and tyrosine hydroxylase (TYR]

[0030] In some embodiments, the product benzylisoquinoline precursor compound can be 4-hydroxy-phenylacetaldehyde (4-HPAA], the benzylisoquinoline precursor enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline precursor compound into 4-hydroxy- phenylacetaldehyde (4-HPAA], and the enzyme can be tyrosine decarboxylase (TYDC] [0031] In some embodiments, the product benzylisoquinoline precursor compound can be dopamine, the benzylisoquinoline precursor enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into dopamine, and the enzymes can be selected from tyrosine hydroxylase (TYR], tyrosine decarboxylase (TYDC] and dihydroxyphenyl alanine decarboxylase (DODC]

[0032] In some embodiments, the product benzylisoquinoline precursor compound can be L-DOPA, the benzylisoquinoline precursor enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline precursor compound into L-DOPA, and the enzyme can be tyrosine reductase (TYR] [0033] In some embodiments, the product benzylisoquinoline precursor compound can be tyramine, the benzylisoquinoline precursor enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline precursor compound into tyramine, and the enzyme can be tyrosine decarboxylase (TYDC]

[0034] In some embodiments, the product benzylisoquinoline compound can be thebaine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into thebaine and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S] -N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase (SalAT], or thebaine synthase (TS]

[0035] In some embodiments, the product benzylisoquinoline compound can be thebaine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into thebaine and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4'-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], or thebaine synthase (TS], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0036] In some embodiments, the product benzylisoquinoline compound can be salutaridinol-7-0-acetate, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridinol-7-0-acetate and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], or salutaridinol-7 -O-acetyltransferase (SalAT] .

[0037] In some embodiments, the product benzylisoquinoline compound can be salutaridinol-7-0-acetate, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridinol-7-0-acetate, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], or salutaridinol-7-0-acetyltransferase (SalAT], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0038] In some embodiments, the product benzylisoquinoline compound can be salutaridinol, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridinol, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V- methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], or salutaridine reductase (SalR]

[0039] In some embodiments, the product benzylisoquinoline compound can be salutaridinol, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into salutaridinol, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], or salutaridine reductase (SalR], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0040] In some embodiments, the product benzylisoquinoline compound can be salutaridine, the substrate can be a substrate benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-iV-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], or salutaridine synthase (SalSyn]

[0041] In some embodiments, the product benzylisoquinoline compound can be salutaridine, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into salutaridine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-iV- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], or salutaridine synthase (SalSyn], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0042] In some embodiments, the product benzylisoquinoline compound can be (R] -reticuline, the substrate can be a substrate benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into (R] -reticuline, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V- methylcoclaurine 4’-0-methyltransferase (4ΌMT], or reticuline epimerase (REPI]

[0043] In some embodiments, the product benzylisoquinoline compound can be (R] -reticuline, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (R] -reticuline, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], or reticuline epimerase (REPI], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0044] In some embodiments, the product benzylisoquinoline compound can be (5] -reticuline, the substrate can be a substrate benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into (5]- reticuline, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], or 3’-hydroxy-/V- methylcoclaurine 4’-0-methyltransferase (4ΌMT] [0045] In some embodiments, the product benzylisoquinoline compound can be (S]-reticuline, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (5]-reticuline, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase or (4ΌMT], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0046] In some embodiments, the product benzylisoquinoline compound can be (5]-3’-hydroxy-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound to (S]-3’-hydroxy-/V-methylcoclaurine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase, or (NMCH]

[0047] In some embodiments, the product benzylisoquinoline compound can be (S]-3'-hydroxy-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S]-3’-hydroxy-/V- methylcoclaurine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-iV- methyltransferase (CNMT], (5]-/V-methylcoclaurine, or 3’-hydroxylase (NMCH] and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO] [0048] In some embodiments, the product benzylisoquinoline compound can be (S]-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound to (S]-/V-methylcoclaurine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], or coclaurine-/V- methyltransferase (CNMT]

[0049] In some embodiments, the product benzylisoquinoline compound can be (S]-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S]-/V-methylcoclaurine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], or coclaurine-/V-methyltransferase (CNMT], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0050] In some embodiments, the product benzylisoquinoline compound can be (S]-coclaurine, the substrate can be a benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound to (S]-coclaurine, wherein the enzymes are selected from norcoclaurine synthase (NCS], and norcoclaurine 6-0-methyltransferase (60MT]

[0051] In some embodiments, the product benzylisoquinoline compound can be (5]-coclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (5]-coclaurine, and the enzymes can be selected from norcoclaurine synthase (NCS] or norcoclaurine 6-0-methyltransferase (60MT] and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO] [0052] In some embodiments, the product benzylisoquinoline compound can be (5] -norcoclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (5] -norcoclaurine, and the enzyme can be norcoclaurine synthase (NCS] and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0053] In some embodiments, the product benzylisoquinoline compound can be (S]-norlaudanosoline, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S]-norlaudanosoline, and the enzyme can be norcoclaurine synthase (NCS] and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0054] In some embodiments, the product benzylisoquinoline compound can be (S]-6-0-methyl-norlaudanosoline, the substrate can be a benzylisoquinoline compound, and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound (S]-6-0-methyl-norlaudanosoline, wherein the enzymes are selected from norcoclaurine synthase (NCS] and 60MT.

[0055] In some embodiments, the product benzylisoquinoline compound can be (S]-6-0-methyl-norlaudanosoline, the substrate can be a substrate benzylisoquinoline precursor compound, the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S]-6-0-methyl- norlaudanosoline, and the enzymes can be selected from 60MT or norcoclaurine synthase (NCS] and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0056] In some embodiments, the product benzylisoquinoline compound can be morphine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into morphine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S] -N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], neopinone isomerase (NISO], codeinone reductase (COR], codeine-O-demethylase (CODM], or thebaine 6-O-demethylase (T60DM]

[0057] In some embodiments, the product benzylisoquinoline compound can be morphine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into morphine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-O-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4'-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase, (SalAT], thebaine synthase (TS], neopinone isomerase (NISO], codeinone reductase (COR], codeine-O-demethylase (CODM], or thebaine 6-O-demethylase (T60DM] and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0058] In some embodiments, the product benzylisoquinoline compound can be codeine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into codeine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S]-N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], neopinone isomerase (NISO], codeinone reductase (COR], codeine-O-demethylase (CODM], or thebaine 6-O-demethylase (T60DM]

[0059] In some embodiments, the product benzylisoquinoline compound can be codeine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into codeine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase, (SalAT], thebaine synthase (TS], neopinone isomerase (NISO], codeinone reductase (COR], codeine-O-demethylase (CODM], or thebaine 6-O-demethylase (T60DM]and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0060] In some embodiments, the product benzylisoquinoline compound can be codeinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can be an enzyme capable of converting the substrate benzylisoquinoline compound into codeinone, and the enzyme can be norcoclaurine synthase (NCS], norcoclaurine 6 -O-methyl transferase (60MT], coclaurine-/V-methyltransferase (CNMT], (S]-/V-methylcoclaurine 3’- hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or neopinone isomerase (NISO]

[0061] In some embodiments, the product benzylisoquinoline compound can be codeinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into codeinone, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S] -N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase, (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or neopinone isomerase (NISO], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0062] In some embodiments, the product benzylisoquinoline compound can be neopine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neopine, and the enzyme can be norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (S]-/V-methylcoclaurine 3’- hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeinone reductase (COR]

[0063] In some embodiments, the product benzylisoquinoline compound can be neopine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into neopine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase, (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeinone reductase (COR], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0064] In some embodiments, the product benzylisoquinoline compound can be neopinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neopinone, and the enzyme can be norcoclaurine synthase (NCS], norcoclaurine 6 -0-methyl transferase (60MT], coclaurine-/V-methyltransferase (CNMT], (S]-/V-methylcoclaurine 3’- hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase (SalAT], thebaine synthase (TS], or thebaine 6-O-demethylase (T60DM]

[0065] In some embodiments, the product benzylisoquinoline compound can be neopinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into neopinone, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 0 methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase, (SalAT], thebaine synthase (TS], or thebaine 6-0-demethylase (T60DM], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0066] In some embodiments, the product benzylisoquinoline compound can be morphinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into morphinone, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-iV-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], codeinone reductase (COR], codeine-O-demethylase (CODM], or neopinone isomerase (NISO]

[0067] In some embodiments, the product benzylisoquinoline compound can be morphinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into morphinone, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-O-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S] -N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase, (SalAT] thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], neopinone isomerase (NISO], or codeinone reductase (COR], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0068] In some embodiments, the product benzylisoquinoline compound can be neomorphinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neomorphinone and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-O- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4'-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeinone reductase (COR], or codeine-O-demethylase (CODM]

[0069] In some embodiments, the product benzylisoquinoline compound can be neomorphinone, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into neomorphinone, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-O-methyltransferase (60MT], coclaurine-/V- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol- 7-O-acetyltransferase, (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeine-O-demethylase reductase (CODM], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0070] In some embodiments, the product benzylisoquinoline compound can be neomorphine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neomorphine, and the enzymes can be norcoclaurine synthase (NCS], norcoclaurine 6-O- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V- methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeine-O- demethylase (CODM], or codeinone reductase (COR]

[0071] In some embodiments, the product benzylisoquinoline compound can be neomorphine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into neomorphine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-O-methyltransferase (60MT], coclaurine-iV- methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol- 7-O-acetyltransferase, (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], codeinone reductase (COR], or codeine-O-demethylase reductase (CODM], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0072] In some embodiments, the product benzylisoquinoline compound can be oripavine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into oripavine, and the enzymes can be norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S]-N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeine-O- demethylase (CODM]

[0073] In some embodiments, the product benzylisoquinoline compound can be oripavine, the substrate can be a substrate benzylisoquinoline compound and the benzylisoquinoline enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into oripavine, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V- methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O- acetyltransferase, (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], or codeine-O-demethylase reductase (CODM], and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[0074] In some embodiments, the host cell can further include an electron transfer facilitating protein.

[0075] In some embodiments, the electron transfer facilitating protein can be a cytochrome P450 reductase (CPR] [0076] In some embodiments, the host cell can further include a benzylisoquinoline uptake protein (BUP]

[0077] In some embodiments, BUP can comprise SEQ.ID NO: 108.

[0078] In some embodiments, BUP can be encoded by SEQ.ID NO: 107 or SEQ.ID NO: 158.

[0079] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 107;

(b] a nucleic acid sequence that is substantially identical to SEQ.ID NO: 107;

(c] a nucleic acid sequence that is substantially identical to SEQ.ID NO: 107 but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to SEQ.ID NO: 107;

(e] a nucleic acid sequence encoding a polypeptide having the amino acid sequence set forth in SEQ.ID NO: 108;

(f] a nucleic acid sequence that encodes a functional variant of the amino acid sequence set forth in SEQ.ID NO: 108; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline biosynthetic enzyme in the host cell.

[0080] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme; and

(B] a second nucleic acid sequence capable of controlling expression of the benzylisoquinoline biosynthetic enzyme in the host cell. [0081] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(B] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(f] SEQ.ID NO: 54, SEQ.ID NO: 56, SEQ.ID NO: 58, SEQ.ID. NO: 60, SEQ.ID NO: 62, SEQ.ID NO: 64, SEQ.ID NO: 66, SEQ.ID NO: 68; SEQ.ID NO: 70, SEQ.ID NO: 72, SEQ.ID NO: 82, SEQ.ID NO: 84, SEQ.ID NO: 90, SEQ.ID NO: 92, SEQ.ID NO: 94, SEQ.ID NO: 154, or SEQ.ID NO: 156;

(g] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(h] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(i] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

Q] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 55 SEQ.ID NO: 57, SEQ.ID NO: 59, SEQ.ID. NO: 61, SEQ.ID NO: 63, SEQ.ID NO: 65, SEQ.ID NO: 67, SEQ.ID NO: 69, SEQ.ID NO: 71, SEQ.ID NO: 73, SEQ.ID NO: 83, SEQ.ID NO: 85, SEQ.ID NO: 91, SEQ.ID NO: 93, SEQ.ID NO: 95, SEQ. ID NO: 155, or SEQ.ID NO: 157;

(f) a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 55 SEQ.ID NO: 57, SEQ.ID NO: 59, SEQ.ID. NO: 61, SEQ.ID NO: 63, SEQ.ID NO: 65, SEQ.ID NO: 67, SEQ.ID NO: 69, SEQ.ID NO: 71, SEQ.ID NO: 73, SEQ.ID NO: 83, SEQ.ID NO: 85, SEQ.ID NO: 91, SEQ.ID NO: 93, SEQ.ID NO: 95, SEQ. ID NO: 155, or SEQ.ID NO: 157; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f]; and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline biosynthetic enzyme in the host cell. [0082] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline precursor biosynthetic enzyme; and

(C] a second nucleic acid sequence capable of controlling expression of the benzylisoquinoline precursor biosynthetic enzyme in the second cell.

[0083] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A) a first nucleic acid sequence encoding a benzylisoquinoline precursor biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 74, SEQ.ID NO: 76, SEQ.ID NO: 78, or SEQ.ID NO: 80;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 75, SEQ.ID NO: 77, SEQ.ID NO: 79, or SEQ.ID NO: 81;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 75, SEQ.ID NO: 77, SEQ.ID NO: 79, or SEQ.ID NO: 81; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline precursor biosynthetic enzyme in the second cell.

[0084] In some embodiments, the method can further include a step comprising recovering the product alkaloid compound, product benzylisoquinoline compound or product benzylisoquinoline precursor compound. [0085] In some embodiments, the host cell can be a microbial cell.

[0086] In some embodiments, the host cell can be a bacterial cell.

[0087] In some embodiments, the host cell can be a yeast cell.

[0088] In some embodiments, the yeast cells can be Saccharomyces cerevisiae cells, or Yarrowia lipolytica cells.

[0089] In some embodiments, the host cell can be an algal cell.

[0090] In some embodiments, the host cell can be a plant cell.

[0091] In some embodiments, the host cell can be grown in a medium comprising a substrate compound, wherein the substrate compound can be biosynthetically converted into the product alkaloid compound.

[0092] In another aspect, the present disclosure provides, in at least one embodiment, a host cell having an enzyme complement to biosynthetically produce alkaloid compounds, the host cell comprising a chimeric nucleic acid comprising as operably linked components (i] a nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein; and (ii] a nucleic acid sequence capable of controlling expression of the alkaloid biosynthesis facilitating protein in the host cell, and the host cell capable of producing the alkaloid biosynthesis facilitating protein and a product alkaloid compound when provided with a substrate compound.

[0093] In some embodiments, the product alkaloid compound can be a benzylisoquinoline precursor compound selected from L-dihydroxyphenyl alanine (L-DOPA], dopamine, tyramine, 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA], and 4-hydroxy-phenylacetaldehyde (4-HPAA]

[0094] In some embodiments, the product alkaloid compound can be a benzylisoquinoline compound selected from (S]-norcoclaurine, (5]- norlaudanosoline, (5]-6-0-methyl-norlaudanosoline, (5]-coclaurine, ( S]-N - methylcoclaurine, (5]-3’-hydroxy-/V-methylcoclaurine, (5]-reticuline, (7?]-reticuline, salutaridine, salutaridinol, salutaridinol-7-0-acetate, thebaine, oripavine, neopine, neopinone, codeinone, codeine, neomorphinone, neomorphine, morphinone, and morphine.

[0095] In some embodiments, the substrate can be a benzylisoquinoline precursor compound selected from L-tyrosine, L-dihydroxyphenyl alanine (L- DOPA], dopamine, tyramine, 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA], and 4- hydroxy-phenylacetaldehyde (4-HPAA]

[0096] In some embodiments, the substrate can be a benzylisoquinoline compound selected from (5] -norcoclaurine, (S]-norlaudanosoline, (5] -6-O-methyl - norlaudanosoline, (S]-coclaurine, (5]-/V-methylcoclaurine, (5] -3’ -hydroxy -/V- methylcoclaurine, (5] -reticuline, (R]-reticuline, salutaridine, salutaridinol, salutaridinol-7-0-acetate, thebaine neopinone, codeinone, codeine, oripavine, neomorphinone, and morphinone.

[0097] In some embodiments, the benzylisoquinoline enzyme complement can comprise one or more benzylisoquinoline biosynthetic enzymes, wherein the enzymes can be norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S] -N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-0-demethylase (T60DM], neopinone isomerase (NISO], codeinone reductase (COR], or codeine-O-demethylase (CODM]

[0098] In some embodiments, the alkaloid biosynthesis facilitating protein can comprise a polypeptide sequence motif that is identical or substantially identical to

(a] a first alkaloid biosynthesis facilitating protein sequence motif selected from

SEQ.ID NO: 109, SEQ.ID NO: 110, SEQ.ID NO: 111, SEQ.ID NO: 112, SEQ.ID NO: 113, SEQ.ID NO: 114, SEQ.ID NO: 115, SEQ.ID NO: 116, SEQ.ID NO:

117, SEQ.ID NO: 118, SEQ.ID NO: 119, SEQ.ID NO: 120; and SEQ.ID NO:

121; and/or

(b] a second alkaloid biosynthesis facilitating protein sequence motif selected from

SEQ.ID NO: 122, SEQ.ID NO: 123, SEQ.ID NO: 124, SEQ.ID NO: 125, SEQ.ID NO: 126, SEQ.ID NO: 127, SEQ.ID NO: 128, SEQ.ID NO: 129, SEQ.ID NO:

130, SEQ.ID NO: 131, SEQ.ID NO: 132, SEQ.ID NO: 133, SEQ.ID NO: 134,

SEQ.ID NO: 135, SEQ.ID NO: 136, and SEQ.ID NO: 137; and/or (c] a third alkaloid biosynthesis facilitating protein sequence motif selected from

SEQ.ID NO: 138, SEQ.ID NO: 139, SEQ.ID NO: 140, SEQ.ID NO: 141, SEQ.ID NO: 142, SEQ.ID NO: 143, SEQ.ID NO: 144, SEQ.ID NO: 145, SEQ.ID NO: 146, SEQ.ID NO: 147, SEQ.ID NO: 148, SEQ.ID NO: 149, SEQ.ID NO: 150, SEQ.ID NO: 151, SEQ.ID NO: 152, and SEQ.ID NO: 153.

[0099] In some embodiments, the sequence motif (a], (b] and/or (c], can be at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to the polypeptide sequence motifs of (a], (b] and/or (c]

[00100] In some embodiments, the alkaloid biosynthesis facilitating protein can be a protein expressed by a nucleic acid sequence selected from the nucleic acid sequences consisting of

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID NO: 9,

SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17,

SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24,

SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32,

SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40,

SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47,

SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO: 161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO: 165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO: 169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO: 173, SEQ.ID NO: 174 or SEQ.ID NO: 175;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a]; (e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34,

SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34,

SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b], (c], (d], (e] or (f).

[00101] In some embodiments, the host cell enzyme complement can have a benzylisoquinoline precursor enzyme complement.

[00102] In some embodiments, the host cell enzyme complement can have a benzylisoquinoline enzyme complement.

[00103] In some embodiments, the benzylisoquinoline precursor enzyme complement can comprise one or more benzylisoquinoline precursor biosynthetic enzymes, and the enzymes can be selected from tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[00104] In some embodiments, the benzylisoquinoline enzyme complement can comprise one or more benzylisoquinoline biosynthetic enzymes, and the enzymes can be selected from norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S]-N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], thebaine 6-O-demethylase (T60DM], neopinone isomerase (NISO], codeinone reductase (COR], codeine-O-demethylase (CODM] [00105] In some embodiments, the substrate can be converted into a product alkaloid compound in a single enzymatically catalyzed chemical step.

[00106] In some embodiments, the substrate can be converted into a product alkaloid compound in two or more enzymatically catalyzed chemical steps.

[00107] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme; and

(B] a second nucleic acid sequence capable of controlling expression of the benzylisoquinoline biosynthetic enzyme in the host cell.

[00108] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 54, SEQ.ID NO: 56, SEQ.ID NO: 58, SEQ.ID. NO: 60, SEQ.ID NO: 62, SEQ.ID NO: 64, SEQ.ID NO: 66, SEQ.ID NO: 68; SEQ.ID NO: 70, SEQ.ID NO: 72, SEQ.ID NO: 82, SEQ.ID NO: 84, SEQ.ID NO: 90, SEQ.ID NO: 92, SEQ.ID NO: 94, SEQ. ID NO: 154, or SEQ.ID NO: 156;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 55 SEQ.ID NO: 57, SEQ.ID NO: 59, SEQ.ID. NO: 61, SEQ.ID NO: 63, SEQ.ID NO: 65, SEQ.ID NO: 67, SEQ.ID NO: 69, SEQ.ID NO: 71, SEQ.ID NO: 73, SEQ.ID NO: 83, SEQ.ID NO: 85, SEQ.ID NO: 91, SEQ.ID NO: 93, SEQ.ID NO: 95, SEQ. ID NO: 155, or SEQ.ID NO: 157;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 55 SEQ.ID NO: 57, SEQ.ID NO: 59, SEQ.ID. NO: 61, SEQ.ID NO: 63, SEQ.ID NO: 65, SEQ.ID NO: 67, SEQ.ID NO: 69, SEQ.ID NO: 71, SEQ.ID NO: 73, SEQ.ID NO: 83, SEQ.ID NO: 85, SEQ.ID NO: 91, SEQ.ID NO: 93, SEQ.ID NO: 95, SEQ. ID NO: 155, or SEQ.ID NO: 157; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a],

(b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline biosynthetic enzyme in the host cell.

[00109] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline precursor biosynthetic enzyme; and

(B] a second nucleic acid sequence capable of controlling expression of the benzylisoquinoline precursor biosynthetic enzymes in the second cell.

[00110] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A) a first nucleic acid sequence encoding a benzylisoquinoline precursor biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 74, SEQ.ID NO: 76, SEQ.ID NO: 78, or SEQ.ID NO: 80;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 75, SEQ.ID NO: 77, SEQ.ID NO: 79, or SEQ.ID NO: 81;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 75, SEQ.ID NO: 77, SEQ.ID NO: 79, or SEQ.ID NO: 81; and (g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], 00, (C), (d), (e) or (f); and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline precursor biosynthetic enzyme in the host cell.

[00111] In some embodiments, the host cell can be a microbial cell.

[00112] In some embodiments, the host cell can be a bacterial cell.

[00113] In some embodiments, the host cell can be a yeast cell.

[00114] In some embodiments, the yeast cells can be Saccharomyces cerevisiae cells, or Yarrowia lipolytica cells.

[00115] In some embodiments, the host cell can be an algal cell.

[00116] In some embodiments, the host cell can be a plant cell.

[00117] In another aspect, the present disclosure provides, in at least one embodiment, a chimeric nucleic acid construct, the chimeric nucleic acid construct comprising as operably linked components:

(A] a first nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID

NO: 9, SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17, SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24, SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32, SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40, SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47, SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO:

161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO:

165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO:

169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO:

173, SEQ.ID NO: 174 or SEQ.ID NO: 175;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a]; (c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence encoding a second nucleic acid sequence capable of controlling the expression of the alkaloid biosynthesis facilitating protein in the host cell.

[00118] In another aspect, the present disclosure provides, in at least one embodiment, a recombinant expression vector suitable for expression in a host cell comprising a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID NO: 9, SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17, SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24, SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32, SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40, SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47, SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO:

161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO:

165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO:

169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO:

173, SEQ.ID NO: 174 or SEQ.ID NO: 175;;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence encoding a second nucleic acid sequence capable of controlling the expression of the alkaloid biosynthesis facilitating protein in the host cell. [00119] In another aspect, the present disclosure provides, in at least one embodiment, a use of a cell according to the present disclosure to convert a substrate alkaloid compound and form a product alkaloid compound, benzylisoquinoline compound or benzylisoquinoline precursor compound.

[00120] In another aspect, the present disclosure provides, in at least one embodiment, a product alkaloid compound, benzylisoquinoline compound or benzylisoquinoline precursor compound produced in accordance with any one of the method of the present disclosure.

[00121] Other features and advantages will become apparent from the following detailed description. It should be understood, however, that the detailed description, while indicating preferred implementations of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those of skill in the art from the detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS AND TABLES

[00122] The disclosure is in the hereinafter provided paragraphs described, by way of example, in relation to the attached figures. The figures provided herein are provided for a better understanding of the example embodiments and to show more clearly how the various embodiments may be carried into effect. The figures are not intended to limit the present disclosure.

[00123] FIGS. 1A, IB and 2C depict prototype structures of benzylisoquinoline compounds.

[00124] FIGS. 2 A, 2B, 2C, 2D, 2E, 2F, 2G and 2H depict the chemical structures of certain example benzylisoquinoline compounds, notably (5]- norcoclaurine (FIG. 2A], (5]-coclaurine (FIG. 2B], (5]-/V-methylcoclaurine (FIG. 2C], (S]-3’-hydroxy-/V-methylcoclaurine (FIG. 2D], (S]-reticuline (FIG. 2E], (7?]-reticuline (FIG. 2F], (5]-norlaudanosoline (FIG. 2G], and (5]-6-0-methyl-norlaudanosoline (FIG. 2H]

[00125] FIGS. 3 A, 3B, 3C, 3D, 3E, 3F, 3G and 3H depict the chemical structures of certain further example benzylisoquinoline compounds, notably salutaridine (FIG. 3 A], salutaridinol (FIG. 3B], salutaridinol-7-0-acetate (FIG. 3C], thebaine (FIG. 3D], codeinone (FIG. 3E], codeine (FIG. 3F], morphine (FIG. 3G] and neopinone (FIG. 3H] [00126] FIGS. 4 A, 4B, 4C, 4D, and 4E depict the chemical structures of certain further example benzylisoquinoline compounds, notably neopine (FIG. 4A], oripavine (FIG. 4B], neomorphinone (FIG. 4C], neomorphine (FIG. 4D] and morphinone (FIG. 4E]

[00127] FIGS. 5 A, 5B, 5C, 5D, 5E and 5F depict the chemical structures of certain example benzylisoquinoline precursor compounds, notably L-tyrosine (FIG. 5A], L-dihydroxyphenyl alanine (L-DOPA] (FIG. 5B], dopamine (FIG. 5C], tyramine (FIG. 5D], 4-hydroxyphenylacetaldehyde (4-HPAA] (FIG. 5E] and 3,4- hydroxyphenylacetaldehyde (3, 4-HPAA] (FIG. 5F]

[00128] FIG. 6 depicts certain chemical reactions involving the conversion of certain example benzylisoquinoline precursor compounds.

[00129] FIG. 7 depicts certain chemical reactions involving the conversion of certain example benzylisoquinoline compounds.

[00130] FIG. 8 depicts certain further chemical reactions involving the conversion of certain example benzylisoquinoline compounds.

[00131] FIGS. 9 A, 9B and 9C depict certain example experimental results in the form of bar graphs, notably relative levels of PR10-3 (FIG.9A), PR10-4 (FIG. 9B], and PR10-5 (FIG. 9C] transcripts in opium poppy plants subjected to virus induced gene silencing (VIGS], using pTRV2 as empty vector control and pTRV2-PR10-3, pTRV2-PR10-4, and pTRV2-PR10-5 constructs. Transcript suppression was significant in each case as determined using Student’s t test at the indicated P values.

[00132] FIG. 10 shows a polypeptide sequence alignment of the alkaloid biosynthesis facilitating proteins; PR10-3; PR10-8, PR10-9, PR10-10, PR10-5, PR10- 4, PR10-11, PR10-12, PR10-21, PR10-17, PR10-18, PR10-19, PR10-20, PR10-15, PR10-14, PR10-16.

[00133] FIG. 11 depicts certain experimental results in the form of bar graphs, notably, the relative levels of reticuline in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10- 14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control. [00134] FIG. 12 depicts certain experimental results in the form of bar graphs, notably, the relative levels of salutaridine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10- 14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00135] FIG. 13 depicts certain experimental results in the form of bar graphs, notably, the relative levels of thebaine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10- 14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00136] FIG. 14 depicts certain experimental results in the form of bar graphs, notably, the relative levels of reticuline in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins and supplied with L-DOPA in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10- 17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00137] FIG. 15 depicts certain experimental results in the form of bar graphs, notably, the relative levels of salutaridine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins and supplied with L-DOPA in the growth medium,, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10- 17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00138] FIG. 16 depicts certain experimental results in the form of bar graphs, notably, the relative levels of thebaine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins, and supplied with L-DOPA in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10- 17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00139] FIG. 17 depicts certain experimental results in the form of bar graphs, notably, the relative levels of salutaridine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins and supplied with (S] -Reticuline in the growth medium,, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10- 5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10- 17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00140] FIG. 18 depicts certain experimental results in the form of bar graphs, notably, the relative levels of thebaine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins, and supplied with (S]-Reticuline in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10- 5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10- 17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00141] FIG. 19 depicts certain experimental results in the form of bar graphs, notably, the relative levels of N-methyl-coclaurine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins, and supplied with L-DOPA in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00142] FIG. 20 depicts certain experimental results in the form of bar graphs, notably, the relative levels of salutaridine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins and BUP and supplied with (S]-Reticuline in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00143] FIG. 21 depicts certain experimental results in the form of bar graphs, notably, the relative levels of thebaine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins and BUP, and supplied with (S]-Reticuline in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00144] FIG. 22 depicts certain experimental results in the form of bar graphs, notably, the relative levels of thebaine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins and an additional thebaine synthase gene, and supplied with L-DOPA in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10- 12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00145] FIG. 23 depicts certain experimental results in the form of bar graphs, notably, the relative levels of thebaine in a yeast strain transformed with certain alkaloid biosynthesis facilitating proteins BUP and an additional thebaine synthase gene, and supplied with L-DOPA in the growth medium, notably, as indicated on the horizontal axis PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10- 12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00146] FIG. 24 depicts certain example experimental results in the form of bar graphs, notably relative levels of PR10-18, and PR10-21 transcripts in opium poppy plants subjected to virus induced gene silencing (VIGS], using pTRV2 as empty vector control and pTRV2-PR10-18/PR10-21constructs. Transcript suppression was significant in each case as determined using Student’s t test at the indicated P values.

[00147] TABLE 1 shows certain primer sequences used for qRT-PCR analysis to determine the relative abundance of PR10-3, PR10-4, PR10-5 transcript levels in opium poppy plants.

[00148] TABLE 2 shows the relative abundance of major alkaloids in opium poppy plants containing substantially reduced quantities of PR10-3, PR10-4 or PR10-5 transcript levels. Where alkaloids are shown in bold this indicates significantly higher or lower levels in comparison to control plants.

[00149] The figures together with the following detailed description make apparent to those skilled in the art how the disclosure may be implemented in practice.

DETAILED DESCRIPTION

[00150] Various compositions, systems or processes will be described below to provide an example of an embodiment of each claimed subject matter. No embodiment described below limits any claimed subject matter and any claimed subject matter may cover processes, compositions or systems that differ from those described below. The claimed subject matter is not limited to compositions, processes or systems having all of the features of any one composition, system or process described below or to features common to multiple or all of the compositions, systems or processes described below. It is possible that a composition, system or process described below is not an embodiment of any claimed subject matter. Any subject matter disclosed in a composition, system or process described below that is not claimed in this document may be the subject matter of another protective instrument, for example, a continuing patent application, and the applicant(s), inventor(s) or owner(s) do not intend to abandon, disclaim or dedicate to the public any such subject matter by its disclosure in this document.

[00151] As used herein and in the claims, the singular forms, such "a”, "an” and "the” include the plural reference and vice versa unless the context clearly indicates otherwise. Throughout this specification, unless otherwise indicated, "comprise,” "comprises” and "comprising” are used inclusively rather than exclusively, so that a stated integer or group of integers may include one or more other non-stated integers or groups of integers. The term "or” is inclusive unless modified, for example, by "either”.

[00152] When ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formulae, all combinations and sub-combinations of ranges and specific embodiments therein are intended to be included. Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about.” The term "about” when referring to a number or a numerical range means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the number or numerical range may vary between 1% and 15% of the stated number or numerical range, as will be readily recognized by context. Furthermore any range of values described herein is intended to specifically include the limiting values of the range, and any intermediate value or sub -range within the given range, and all such intermediate values and sub-ranges are individually and specifically disclosed [e.g. a range of 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.90, 4, and 5). Similarly, other terms of degree such as "substantially" and "approximately" as used herein mean a reasonable amount of deviation of the modified term such that the end result is not significantly changed. These terms of degree should be construed as including a deviation of the modified term if this deviation would not negate the meaning of the term it modifies.

[00153] Unless otherwise defined, scientific and technical terms used in connection with the formulations described herein shall have the meanings that are commonly understood by those of ordinary skill in the art. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[00154] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

Terms and definitions

[00155] The terms "alkaloid”, or "alkaloid compound”, as may be used interchangeably herein, refer to organic compounds containing one or more benzene ring structures, are most preferably nitrogenous, and include, without limitation, the herein mentioned benzylisoquinoline compounds and benzylisoquinoline precursor compounds.

[00156] The terms "benzylisoquinoline”, or "benzylisoquinoline compound”, as may be used interchangeably herein, are chemical compounds having the prototype structure set forth in FIGS. 1A, IB or 1C. It is noted that certain ring closure reactions of compounds having the prototype structure shown in FIG. 1A can lead to the formation of compounds having the prototype structure shown in FIG. IB or FIG. 1C. Benzylisoquinoline compounds are further intended to include, without limitation, (S]-norcoclaurine, (5]-norlaudanosoline, (S]-6-0-methyl- norlaudanosoline, (S]-coclaurine, (5]-/V-methylcoclaurine, (S] -3’ -hydroxy -/V- methylcoclaurine, (5]-reticuline, (7?]-reticuline, salutaridine, salutaridinol, neopine, neopinone, codeinone, codeine, neomorphinone, oripavine, neomorphine, morphinone, morphine, papaverine and noscapine.

[00157] The term "benzylisoquinoline precursor compound” refers to a chemical compound that can be converted into a benzylisoquinoline compound and includes, without limitation, L-tyrosine, L-dihydroxyphenyl alanine (L-DOPA], dopamine, tyramine, 3,4-hydroxy-phenylacetaldehyde (3,4-HPAA] and 4-hydroxy- phenylacetaldehyde (4-HPAA] Benzylisoquinoline precursor compounds include compounds that can be directly converted into benzylisoquinoline compound, or compounds that can be converted into benzylisoquinoline compound via another benzylisoquinoline precursor compound.

[00158] The term "(S]-norcoclaurine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2A.

[00159] The term "(S]-coclaurine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2B.

[00160] The term "(S]-/V-methylcoclaurine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2C.

[00161] The term "(S]-3’-hydroxy-/V-methylcoclaurine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2D.

[00162] The term "(S]-reticuline”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2E.

[00163] The term "(7?]-reticuline”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2F.

[00164] The term "(S]-norlaudanosoline”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2G.

[00165] The term "(5]-6-0-methyl-norlaudanosoline”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 2H.

[00166] The term "salutaridine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3A.

[00167] The term "salutaridinol”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3B.

[00168] The term "salutaridinol-7-0-acetate”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3C.

[00169] The term "thebaine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3D.

[00170] The term "codeinone”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3E. [00171] The term "codeine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3F.

[00172] The term "morphine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3G.

[00173] The term "neopinone”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 3H.

[00174] The term "neopine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 4A.

[00175] The term "oripavine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 4B.

[00176] The term "neomorphinone”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 4C.

[00177] The term "neomorphine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 4D.

[00178] The term "morphinone”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 4E.

[00179] The term "L-tyrosine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 5A.

[00180] The terms "L-dihydroxyphenyl alanine” or "L-DOPA”, as may be used interchangeably herein, refer to a chemical compound having the chemical structure set forth in FIG. 5B,

[00181] The term "dopamine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 5C.

[00182] The term "tyramine”, as used herein, refers to a chemical compound having the chemical structure set forth in FIG. 5D.

[00183] The terms "4-hydroxy-phenylacetaldehyde” or "4-HPAA”, as may be interchangeably used herein, refer to a chemical compound having the structure set forth in FIG. 5E.

[00184] The terms "3, 4-hydroxy-phenylacetaldehyde” or "3, 4-HPAA”, as may be interchangeably used herein, refer to a chemical compound having the structure set forth in FIG. 5F.

[00185] The term "benzylisoquinoline biosynthetic enzyme”, as used herein, refers to a polypeptide capable of facilitating the chemical conversion of a first benzylisoquinoline compound into a second benzylisoquinoline compound, or the chemical conversion of a benzylisoquinoline precursor compound into a benzylisoquinoline compound in a single chemical step. Benzylisoquinoline biosynthetic enzymes include norcoclaurine synthase (NCS], norcoclaurine 6-0- methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], ( S]-N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4 '-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase (SalAT], thebaine synthase (TS], neopinone isomerase (NISO], codeinone reductase (COR], thebaine 6-O-demethylase (T60DM] and codeine demethylase (CODM]

[00186] The term "benzylisoquinoline precursor biosynthetic enzyme”, as used herein, refers to one or more benzylisoquinoline precursor biosynthetic enzymes, which when provided with a substrate benzylisoquinoline precursor compound, can produce a product benzylisoquinoline precursor compound, which is chemically different from the substrate benzylisoquinoline precursor compound. Benzylisoquinoline precursor biosynthetic enzymes that can be included in a benzylisoquinoline precursor enzyme complement include tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[00187] By the phrase "host cell having an enzyme complement to biosynthetically produce one or more product alkaloid compounds”, it is meant that a host cell when grown under suitable growth conditions, can in vivo produce at least one product alkaloid compound, e.g. a benzylisoquinoline compound or a benzylisoquinoline precursor compound, by chemically converting a substrate compound into a product alkaloid compound via an enzyme-catalyzed reaction, wherein the enzyme, or enzymes, as the case may be, are present in the host cell.

[00188] The terms "6-0-methyltransferase” or "60MT”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any norcoclaurine 6-0-methyltransferase polypeptide set forth herein, including, for example, SEQ.ID NO: 55, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any norcoclaurine 6-0-methyltransferase polypeptide set forth herein, but for the use of synonymous codons.

[00189] The terms "coclaurine-/V-methyltransferase” or "CNMT”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any coclaurine-/V-methyltransferase polypeptide set forth herein, including, for example, SEQ.ID NO: 57, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any coclaurine-/V-methyltransferase polypeptide set forth herein, but for the use of synonymous codons.

[00190] The terms "(S]-/V-methylcoclaurine 3’-hydroxylase” or "NMCH”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any (S]-/V-methylcoclaurine 3’-hydroxylase polypeptide set forth herein, including, for example, SEQ.ID NO: 59, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any (S]-/V-methylcoclaurine 3’-hydroxylase polypeptide set forth herein, but for the use of synonymous codons.

[00191] The terms "3’-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase” or "4ΌMT”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any 3’-hydroxy-/V-methylcoclaurine 4 0 methyltransferase polypeptide set forth herein, including, for example, SEQ.ID NO: 61, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any 3’- hydroxy-/V-methylcoclaurine 4’-0-methyltransferase set forth herein, but for the use of synonymous codons.

[00192] The terms "reticuline epimerase” or "REPI”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any reticuline epimerase polypeptide set forth herein, including, for example, SEQ.ID NO: 63, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any reticuline epimerase polypeptide set forth herein, but for the use of synonymous codons.

[00193] The terms "salutaridine synthase” or "SalSyn”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any salutaridine synthase polypeptide set forth herein, including, for example, SEQ.ID NO: 65, or (if) encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any salutaridine synthase polypeptide set forth herein, but for the use of synonymous codons.

[00194] The terms "salutaridine reductase” or "SalR”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any salutaridine reductase polypeptide set forth herein, including, for example, SEQ.ID NO: 67, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any salutaridine reductase polypeptide set forth herein, but for the use of synonymous codons.

[00195] The terms "salutaridinol-7-0-acetyltransferase” or "SalAT”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any salutaridinol-7-0-acetyltransferase polypeptide set forth herein, including, for example, SEQ.ID NO: 95, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any salutaridinol-7-0-acetyl transferase polypeptide set forth herein, but for the use of synonymous codons.

[00196] The terms "thebaine synthase” or "TS”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any thebaine synthase polypeptide set forth herein, including, for example, SEQ.ID NO: 91, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any thebaine synthase polypeptide set forth herein, but for the use of synonymous codons.

[00197] The terms "neopinone isomerase” or "NISO”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any neopinone isomerase polypeptide set forth herein, including, for example, SEQ.ID NO: 69, or (if) encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any neopinone isomerase polypeptide set forth herein, but for the use of synonymous codons.

[00198] The terms "codeinone reductase” or "COR”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any codeinone reductase polypeptide set forth herein, including, for example, SEQ.ID NO: 71, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any codeinone reductase polypeptide set forth herein, but for the use of synonymous codons.

[00199] The terms "codeine-O-demethylase” or "CODM”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any codeine-O-demethylase polypeptide set forth herein, including, for example, SEQ.ID NO: 73, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any codeine-O-demethylase polypeptide set forth herein, but for the use of synonymous codons.

[00200] The terms "thebaine 6-0-demethylase” or "T60DM”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any thebaine 6-0-demethylase polypeptide set forth herein, including, for example, SEQ.ID NO: 85, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any thebaine 6-O-demethylase polypeptide set forth herein, but for the use of synonymous codons.

[00201] The terms "cytochrome P450 reductase” or "CPR”, as may be used interchangeably herein, refer to any and all enzymes comprising a sequence of amino acid residues which is (i) substantially identical to the amino acid sequences constituting any set cytochrome P450 reductase polypeptide set forth herein, including, for example, SEQ.ID NO: 87, or (ii) encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any cytochrome P450 reductase polypeptide set forth herein, but for the use of synonymous codons.

[00202] The term "alkaloid biosynthesis facilitating protein”, refers to certain proteins capable of facilitating the production of an alkaloid compound from a substrate compound in conjunction with one or more benzylisoquinoline biosynthetic enzymes or a benzylisoquinoline precursor biosynthetic enzymes. In the presence of the alkaloid biosynthesis facilitating protein, the conversion of substrate into product alkaloid occurs substantially more efficiently, for example, more product alkaloid can be formed in the presence of an alkaloid biosynthesis facilitating protein. Thus, in the presence of an alkaloid biosynthesis facilitating protein, for example, 10%, 20%, 30% 40%, 50%, 60%, 70%, 80%, 90% (w/w) or more, product alkaloid can be formed, or the production rate may be increased. An alkaloid biosynthesis facilitating proteins may participate in a catalytic step with a benzylisoquinoline biosynthetic enzyme or a benzylisoquinoline precursor biosynthetic enzyme, and thereby, for example, lower the activation energy (Ea), or an alkaloid biosynthesis facilitating protein may coordinate or stabilize an alkaloid substrate or product in a specific configuration, or locate an alkaloid substrate or alkaloid product in a specific location, for example, a specific subcellular location. Alkaloid biosynthesis facilitating proteins include all proteins referred to herein as "PR10” followed by a numerical designation, including PRT10-1, PRT10-2, PRT10-3, PRT10-4, PRT10-5, PRT10-8, PRT10-9, PRT10-10, PRT10-11, PRT10-12, PRT10-14, PRT10-15, PRT10-16, PRT10-17, PR10-18, PRT10-19, PRT10-20 and PRT10-21, and further include proteins comprising one or more of motifs 1, 2 and 3 shown in FIG. 10 or SEQ.ID NOs: 109-121 (motif 1); SEQ.ID NOs: 122-137 (motif 2); and SEQ.ID NOs: 138-153 (motif 3). An example of an alkaloid biosynthesis protein is SEQ.ID NO: 2. It is noted that certain alkaloid biosynthesis facilitating proteins were referred to as "MLP1", "MLP2”, "MLP3”, "MLP4” "MLP15” and "Betvl" in the priority U.S. Provisional Patent Application No 62/636,389, but it is now preferred to refer to these proteins as "PR10” followed by a numerical designation. Alkaloid biosynthesis facilitating proteins further include any and all proteins comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any alkaloid biosynthesis facilitating protein set forth herein, including, for example, SEQ.ID NO: 1, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any alkaloid biosynthesis facilitating protein set forth herein, but for the use of synonymous codons.

[00203] The term "tyrosine hydroxylase”, or "TYR” refers to any and all enzymes comprising a sequence of amino acid residues which is (f) substantially identical to the amino acid sequences constituting any tyrosine hydroxylase polypeptide set forth herein, including, for example, SEQ.ID NO: 75, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any tyrosine hydroxylase polypeptide set forth herein, but for the use of synonymous codons.

[00204] The term "tyrosine decarboxylase” or "TYDC”, refers to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any tyrosine decarboxylase polypeptide set forth herein, including, for example, SEQ.ID NO: 77, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any tyrosine decarboxylase polypeptide set forth herein, but for the use of synonymous codons.

[00205] The term "dihydroxyphenyl alanine decarboxylase” or "DODC”, refers to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any dihydroxyphenyl alanine decarboxylase polypeptide set forth herein, including, for example, SEQ.ID NO: 79, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any dihydroxyphenyl alanine decarboxylase set forth herein, but for the use of synonymous codons. [00206] The term "monoamine oxidase” or "MAO”, refers to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any monoamine oxidase polypeptide set forth herein, including, for example, SEQ.ID NO: 81, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any monoamine oxidase polypeptide set forth herein, but for the use of synonymous codons.

[00207] The term "norcoclaurine synthase” or "NCS”, refers to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any norcoclaurine synthase polypeptide set forth herein, including, for example, SEQ.ID NO: 83, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any norcoclaurine synthase polypeptide set forth herein, but for the use of synonymous codons.

[00208] The terms "benzylisoquinoline uptake permease” or "BUP”, refer to any and all enzymes comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequences constituting any benzylisoquinoline uptake permease polypeptide set forth herein, including, for example. SEQ.ID NO: 108, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding any benzylisoquinoline uptake permease polypeptide set forth herein, but for the use of synonymous codons.

[00209] The terms "nucleic acid sequence encoding 6-0-methyltransferase”, and "nucleic acid sequence encoding a norcoclaurine 6-0-methyltransferase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a norcoclaurine 6-0-methyltransferase polypeptide, including, for example, SEQ.ID NO: 54. Nucleic acid sequences encoding a norcoclaurine 6-0-methyltransferase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the norcoclaurine 6-0-methyltransferase polypeptide sequences set forth herein; or (ii] hybridize to any norcoclaurine 6-0-methyltransferase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00210] The terms "nucleic acid sequence encoding coclaurine-/V- methyltransferase”, and "nucleic acid sequence encoding a coclaurine-/V- methyltransferase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a coclaurine-/V-methyltransferase polypeptide, including, for example, SEQ.ID NO: 56. Nucleic acid sequences encoding a coclaurine-/V-methyltransferase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the coclaurine-/V-methyltransferase polypeptide sequences set forth herein; or (ii] hybridize to any coclaurine-iV-methyltransferase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00211] The terms "nucleic acid sequence encoding (5]-/V-methylcoclaurine 3’-hydroxylase”, and "nucleic acid sequence encoding a (5]-/V-methylcoclaurine 3’- hydroxylase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a (5] -/V-methylcoclaurine 3’-hydroxylase polypeptide, including, for example, SEQ.ID NO: 58. Nucleic acid sequences encoding a (S]-/V-methylcoclaurine 3’-hydroxylase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the (5]-/V-methylcoclaurine 3’-hydroxylase polypeptide sequences set forth herein; or (ii] hybridize to any (S]-/V-methylcoclaurine 3’-hydroxylase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00212] The terms "nucleic acid sequence encoding 3’-hydroxy-/V- methylcoclaurine 4’-0-methyltransferase”, and "nucleic acid sequence encoding a 3’-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a 3’-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase polypeptide, including, for example, SEQ.ID NO: 60. Nucleic acid sequences encoding a 3’-hydroxy -/V- methylcoclaurine 4’-0-methyltransferase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the 3'-hydroxy-/V-methylcoclaurine 4’-0-methyltransferase polypeptide sequences set forth herein; or (ii] hybridize to any 3’ -hydroxy -/V-methylcoclaurine 4’-0-methyltransferase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00213] The terms "nucleic acid sequence encoding reticuline epimerase”, and "nucleic acid sequence encoding a reticuline epimerase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a reticuline epimerase polypeptide, including, for example, SEQ.ID NO: 62. Nucleic acid sequences encoding a reticuline epimerase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the reticuline epimerase polypeptide sequences set forth herein; or (ii] hybridize to any reticuline epimerase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00214] The terms "nucleic acid sequence encoding salutaridine synthase”, and "nucleic acid sequence encoding a salutaridine synthase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a salutaridine synthase polypeptide, including, for example, SEQ.ID NO: 64. Nucleic acid sequences encoding a salutaridine synthase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the salutaridine synthase polypeptide sequences set forth herein; or (ii] hybridize to any salutaridine synthase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00215] The terms "nucleic acid sequence encoding salutaridine reductase”, and "nucleic acid sequence encoding a salutaridine reductase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a salutaridine reductase polypeptide, including, for example, SEQ.ID NO: 66. Nucleic acid sequences encoding a salutaridine reductase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the salutaridine reductase polypeptide sequences set forth herein; or (ii] hybridize to any salutaridine reductase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00216] The terms "nucleic acid sequence encoding salutaridinol-7-0- acetyltransferase”, and "nucleic acid sequence encoding a salutaridinol-7-0- acetyltransferase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a salutaridinol-7-0-acetyltransferase polypeptide, including, for example, SEQ.ID NO: 94. Nucleic acid sequences encoding a salutaridinol-7-0-acetyltransferase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the salutaridinol-7-0-acetyltransferase polypeptide sequences set forth herein; or (ii] hybridize to any salutaridinol-7-0-acetyltransferase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00217] The terms "nucleic acid sequence encoding thebaine synthase”, and "nucleic acid sequence encoding a thebaine synthase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a thebaine synthase polypeptide, including, for example, SEQ.ID NO: 90. Nucleic acid sequences encoding a thebaine synthase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the thebaine synthase polypeptide sequences set forth herein; or (ii] hybridize to any thebaine synthase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00218] The terms "nucleic acid sequence encoding neopinone isomerase”, and "nucleic acid sequence encoding a neopinone isomerase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a neopinone isomerase polypeptide, including, for example, SEQ.ID NO: 68. Nucleic acid sequences encoding a neopinone isomerase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the neopinone isomerase polypeptide sequences set forth herein; or (ii] hybridize to any neopinone isomerase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00219] The terms "nucleic acid sequence encoding codeinone reductase”, and "nucleic acid sequence encoding a codeinone reductase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a codeinone reductase polypeptide, including, for example, SEQ.ID NO: 70. Nucleic acid sequences encoding a codeinone reductase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the codeinone reductase polypeptide sequences set forth herein; or (ii] hybridize to any codeinone reductase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00220] The terms "nucleic acid sequence encoding codeine-O-demethylase”, and "nucleic acid sequence encoding a codeine-O-demethylase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a codeine-O-demethylase polypeptide, including, for example, SEQ.ID NO: 72. Nucleic acid sequences encoding a codeine-O-demethylase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the codeine-O-demethylase polypeptide sequences set forth herein; or (ii] hybridize to any codeine-O-demethylase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00221] The terms "nucleic acid sequence encoding thebaine 6-0- demethylase”, and "nucleic acid sequence encoding a thebaine 6-0-demethylase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a codeine-O-demethylase polypeptide, including, for example, SEQ.ID NO: 84. Nucleic acid sequences encoding a thebaine 6 0 demethylase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the thebaine 6 0 demethylase polypeptide sequences set forth herein; or (ii] hybridize to any thebaine 6-0-demethylase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00222] The terms "nucleic acid sequence encoding cytochrome P450 reductase”, and "nucleic acid sequence encoding a cytochrome P450 reductase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a cytochrome P450 reductase polypeptide, including, for example, SEQ.ID NO: 86. Nucleic acid sequences encoding a cytochrome P450 reductase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the cytochrome P450 reductase polypeptide sequences set forth herein; or (ii] hybridize to any cytochrome P450 reductase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00223] The terms "nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein”, and "nucleic acid sequence encoding an alkaloid biosynthesis facilitating polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding an alkaloid biosynthesis facilitating polypeptide (ABFP], including a protein comprising one or more of motifs 1, 2 and 3 shown in FIG. 10 or SEQ.ID NOs: 109-121 (motif 1]; SEQ.ID NOs: 122-137 (motif 2]; and SEQ.ID NOs: 138-153 (motif 3] An example of an alkaloid biosynthesis protein is SEQ.ID NO: 2. Nucleic acid sequences encoding an alkaloid biosynthesis facilitating polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the alkaloid biosynthesis facilitating polypeptide sequences set forth herein; or (ii] hybridize to any alkaloid biosynthesis facilitating polypeptide nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00224] The terms "nucleic acid sequence encoding tyrosine hydroxylase”, and "nucleic acid sequence encoding a tyrosine hydroxylase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a tyrosine hydroxylase polypeptide, including, for example, SEQ.ID NO: 74. Nucleic acid sequences encoding a tyrosine hydroxylase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the tyrosine hydroxylase polypeptide sequences set forth herein; or (ii] hybridize to any tyrosine hydroxylase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00225] The terms "nucleic acid sequence encoding tyrosine decarboxylase”, and "nucleic acid sequence encoding a tyrosine decarboxylase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a tyrosine decarboxylase polypeptide, including, for example, SEQ.ID NO: 76. Nucleic acid sequences encoding a tyrosine decarboxylase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the tyrosine decarboxylase polypeptide sequences set forth herein; or (ii] hybridize to any tyrosine decarboxylase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00226] The terms "nucleic acid sequence encoding dihydroxyphenyl alanine decarboxylase”, and "nucleic acid sequence encoding a dihydroxyphenyl alanine decarboxylase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a dihydroxyphenyl alanine decarboxylase polypeptide, including, for example, SEQ.ID NO: 78. Nucleic acid sequences encoding a dihydroxyphenyl alanine decarboxylase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the dihydroxyphenyl alanine decarboxylase polypeptide sequences set forth herein; or (ii] hybridize to any dihydroxyphenyl alanine decarboxylase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00227] The terms "nucleic acid sequence encoding monoamine oxidase”, and "nucleic acid sequence encoding a monoamine oxidase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a monoamine oxidase polypeptide, including, for example, SEQ.ID NO: 80. Nucleic acid sequences encoding a monoamine oxidase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the monoamine oxidase polypeptide sequences set forth herein; or (ii] hybridize to any monoamine oxidase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00228] The terms "nucleic acid sequence encoding norcoclaurine synthase”, and "nucleic acid sequence encoding a norcoclaurine synthase polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a norcoclaurine synthase polypeptide, including, for example, SEQ.ID NO: 82. Nucleic acid sequences encoding a norcoclaurine synthase polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the norcoclaurine synthase polypeptide sequences set forth herein; or (ii] hybridize to any norcoclaurine synthase nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00229] The terms "nucleic acid sequence encoding a benzylisoquinoline uptake permease”, "nucleic acid sequence encoding a benzylisoquinoline uptake permease polypeptide”, as may be used interchangeably herein, refer to any and all nucleic acid sequences encoding a benzylisoquinoline uptake permease polypeptide, including, for example, SEQ.ID NO: 107. Nucleic acid sequences encoding a benzylisoquinoline uptake permease polypeptide further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the benzylisoquinoline uptake permease polypeptide sequences set forth herein; or (ii] hybridize to any benzylisoquinoline uptake permease nucleic acid sequences set forth herein under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00230] The terms "nucleic acid”, or "nucleic acid sequence”, as used herein, refer to a sequence of nucleoside or nucleotide monomers, consisting of naturally occurring bases, sugars and intersugar (backbone] linkages. The term also includes modified or substituted sequences comprising non-naturally occurring monomers or portions thereof. The nucleic acids of the present disclosure may be deoxyribonucleic nucleic acids (DNA] or ribonucleic acids (RNA] and may include naturally occurring bases including adenine, guanine, cytosine, thymidine and uracil. The nucleic acids may also contain modified bases. Examples of such modified bases include aza and deaza adenine, guanine, cytosine, thymidine and uracil, and xanthine and hypoxanthine. A sequence of nucleotide or nucleoside monomers may be referred to as a polynucleotide sequence, nucleic acid sequence, a nucleotide sequence or a nucleoside sequence.

[00231] The term "polypeptide”, as used herein in conjunction with a reference SEQ.ID NO, refers to any and all polypeptides comprising a sequence of amino acid residues which is (i] substantially identical to the amino acid sequence constituting the polypeptide having such reference SEQ.ID NO, or (ii] encoded by a nucleic acid sequence capable of hybridizing under at least moderately stringent conditions to any nucleic acid sequence encoding the polypeptide having such reference SEQ.ID NO, but for the use of synonymous codons. A sequence of amino acid residues may be referred to as an amino acid sequence, or polypeptide sequence.

[00232] The term "nucleic acid sequence encoding a polypeptide”, as used herein in conjunction with a reference SEQ.ID NO, refers to any and all nucleic acid sequences encoding a polypeptide having such reference SEQ.ID NO. Nucleic acid sequences encoding a polypeptide, in conjunction with a reference SEQ.ID NO, further include any and all nucleic acid sequences which (i] encode polypeptides that are substantially identical to the polypeptide having such reference SEQ.ID NO; or (ii] hybridize to any nucleic acid sequences encoding polypeptides having such reference SEQ.ID NO under at least moderately stringent hybridization conditions or which would hybridize thereto under at least moderately stringent conditions but for the use of synonymous codons.

[00233] By the term "substantially identical” it is meant that two amino acid sequences preferably are at least 70% identical, and more preferably are at least 85% identical and most preferably at least 95% identical, for example 96%, 97%, 98% or 99% identical. In order to determine the percentage of identity between two amino acid sequences the amino acid sequences of such two sequences are aligned, using for example the alignment method of Needleman and Wunsch (J. Mol. Biol., 1970, 48: 443], as revised by Smith and Waterman (Adv. Appl. Math., 1981, 2: 482] so that the highest order match is obtained between the two sequences and the number of identical amino acids is determined between the two sequences. Methods to calculate the percentage identity between two amino acid sequences are generally art recognized and include, for example, those described by Carillo and Lipton (SIAM J. Applied Math., 1988, 48:1073] and those described in Computational Molecular Biology, Lesk, e.d. Oxford University Press, New York, 1988, Biocomputing: Informatics and Genomics Projects. Generally, computer programs will be employed for such calculations. Computer programs that may be used in this regard include, but are not limited to, GCG (Devereux et al, Nucleic Acids Res., 1984, 12: 387] BLASTP, BLASTN and FASTA (Altschul et al, J. Mol. Biol., 1990:215:403] A particularly preferred method for determining the percentage identity between two polypeptides involves the Clustal W algorithm (Thompson, J D, Higgines, D G and Gibson T J, 1994, Nucleic Acid Res 22(22]: 4673-4680 together with the BLOSUM 62 scoring matrix (Henikoff S & Henikoff, J G, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919 using a gap opening penalty of 10 and a gap extension penalty of 0.1, so that the highest order match obtained between two sequences wherein at least 50% of the total length of one of the two sequences is involved in the alignment.

[00234] By "at least moderately stringent hybridization conditions” it is meant that conditions are selected which promote selective hybridization between two complementary nucleic acid molecules in solution. Hybridization may occur to all or a portion of a nucleic acid sequence molecule. The hybridizing portion is typically at least 15 ( e.g . 20, 25, 30, 40 or 50] nucleotides in length. Those skilled in the art will recognize that the stability of a nucleic acid duplex, or hybrids, is determined by the Tm, which in sodium containing buffers is a function of the sodium ion concentration and temperature (Tm=81.5° C.-16.6 (LoglO [Na+]]+0.41(% (G+C]-600/l], or similar equation]. Accordingly, the parameters in the wash conditions that determine hybrid stability are sodium ion concentration and temperature. In order to identify molecules that are similar, but not identical, to a known nucleic acid molecule a 1% mismatch may be assumed to result in about a 1° C. decrease in Tm, for example if nucleic acid molecules are sought that have a >95% identity, the final wash temperature will be reduced by about 5° C. Based on these considerations those skilled in the art will be able to readily select appropriate hybridization conditions. In preferred embodiments, stringent hybridization conditions are selected. By way of example the following conditions may be employed to achieve stringent hybridization: hybridization at 5x sodium chloride/sodium citrate (SSC]/5xDenhardt's solution/1.0% SDS at Tm (based on the above equation] -5° C, followed by a wash of 0.2xSSC/0.1% SDS at 60° C. Moderately stringent hybridization conditions include a washing step in 3xSSC at 42° C. It is understood however that equivalent stringencies may be achieved using alternative buffers, salts and temperatures. Additional guidance regarding hybridization conditions may be found in: Current Protocols in Molecular Biology, John Wiley & Sons, N.Y., 1989, 6.3.1.-6.3.6 and in: Sambrook et ah, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, 1989, Vol. 3.

[00235] The term "functional variant”, as used herein in reference to polynucleotides or polypeptides, refers to polynucleotides or polypeptides capable of performing the same function as a noted reference polynucleotide or polypeptide. Thus, for example, a functional variant of the polypeptide set forth in SEQ.ID NO: 1, refers to a polypeptide capable of performing the same function as the polypeptide set forth in SEQ.ID NO: 1. Functional variants include modified a polypeptide wherein, relative to a noted reference polypeptide, the modification includes a substitution, deletion or addition of one or more amino acids. In some embodiments, substitutions are those that result in a replacement of one amino acid with an amino acid having similar characteristics. Such substitutions include, without limitation (i] glutamic acid and aspartic acid; (i] alanine, serine, and threonine; (iii] isoleucine, leucine and valine, (iv] asparagine and glutamine, and (v] tryptophan, tyrosine and phenylalanine. Functional variants further include polypeptides having retained or exhibiting an enhanced benzylisoquinoline biosynthetic bioactivity.

[00236] The term "chimeric”, as used herein in the context of nucleic acids, refers to at least two linked nucleic acids which are not naturally linked. Chimeric nucleic acids include linked nucleic acids of different natural origins. For example, a nucleic acid constituting a microbial promoter linked to a nucleic acid encoding a plant polypeptide is considered chimeric. Chimeric nucleic acids also may comprise nucleic acids of the same natural origin, provided they are not naturally linked. For example, a nucleic acid constituting a promoter obtained from a particular cell-type may be linked to a nucleic acid encoding a polypeptide obtained from that same cell-type, but not normally linked to the nucleic acid constituting the promoter. Chimeric nucleic acids also include nucleic acids comprising any naturally occurring nucleic acids linked to any non-naturally occurring nucleic acids.

[00237] The terms "substantially pure” and "isolated”, as may be used interchangeably herein describe a compound, e.g., a benzylisoquinoline, a benzylisoquinoline precursor, a nucleic acid or a polypeptide, which has been separated from components that naturally accompany it. Typically, a compound is substantially pure when at least 60%, more preferably at least 75%, more preferably at least 90%, 95%, 96%, 97%, or 98%, and most preferably at least 99% of the total material (by volume, by wet or dry weight, or by mole percent or mole fraction] in a sample is the compound of interest. Purity can be measured by any appropriate method, e.g., in the case of polypeptides, by chromatography, gel electrophoresis or HPLC analysis.

[00238] The term "recovered” as used herein in association with an enzyme, protein, alkaloid, benzylisoquinoline precursor compound or a benzylisoquinoline compound, refers to a more or less pure form of the enzyme, protein, alkaloid, benzylisoquinoline precursor compound, or benzylisoquinoline compound.

General Implementation

[00239] As hereinbefore mentioned, the present disclosure relates to alkaloids. The current disclosure further relates to certain nucleic acids and polypeptides that can be used to make alkaloids. The herein provided methods and compositions are useful in that they facilitate a novel and efficient means of making certain alkaloid compounds, notably benzylisoquinoline compounds and benzylisoquinoline precursor compounds. The methods and compositions can yield substantial quantities of product benzylisoquinoline compounds, including codeinone, codeine, morphine, and other benzylisoquinoline compounds, and benzylisoquinoline precursor compounds. The current disclosure involves the use of alkaloid biosynthesis facilitating proteins to facilitate the production of benzylisoquinoline compounds and benzylisoquinoline precursor compounds.

[00240] In general, in the presence of the alkaloid biosynthesis facilitating protein, the conversion of alkaloid substrate, benzylisoquinoline compounds or benzylisoquinoline precursor compounds into product alkaloid, product benzylisoquinoline compounds, or product benzylisoquinoline precursor compounds occurs substantially more efficiently, for example, more product alkaloids, product benzylisoquinoline compounds or product benzylisoquinoline precursor compounds can be formed. Thus, by the introduction of the alkaloid biosynthesis facilitating protein into the host cell, for example, 10%, 20%, 30% 40%, 50%, 60%, 70%, 80%, 90% (w/w] or more product alkaloid, product benzylisoquinoline compound, or product benzylisoquinoline precursor compound can be formed by the cell, or the production rate may be increased.

[00241] In an embodiment, the present disclosure provides a method of making benzylisoquinoline compounds or benzylisoquinoline precursor compounds in a host cell comprising an alkaloid biosynthesis facilitating protein. The alkaloid biosynthesis facilitating protein can be recombinantly expressed in the host cell. The product benzylisoquinoline compound or benzylisoquinoline precursor compound can be produced from a substrate benzylisoquinoline compound, or a substrate benzylisoquinoline precursor compound. The substrate benzylisoquinoline compound or the substrate benzylisoquinoline precursor compound can be included in the growth medium for the host cell. It has been found by the inventors that benzylisoquinoline compounds and benzylisoquinoline precursor compounds can be unexpectedly efficiently produced in cells comprising alkaloid biosynthesis facilitating proteins. The cells may be used as a source whence the benzylisoquinoline compounds or benzylisoquinoline precursor compounds can economically be extracted. The benzylisoquinoline compounds or benzylisoquinoline precursor compounds produced in accordance with the present disclosure are useful inter alia in the manufacture of pharmaceutical compositions.

[00242] In what follows several example methods involving the growth of host cells to produce product alkaloid compounds from substrate compounds will be described.

[00243] Thus, the present disclosure provides, in at least one aspect, and in at least one embodiment a method of producing a product alkaloid compound in a host cell, the method comprising:

(a] providing a host cell having an enzyme complement to biosynthetically produce one or more product alkaloid compounds;

(b] introducing a chimeric nucleic acid into the host cell, the chimeric nucleic acid comprising as operably linked components (i] a nucleic acid sequence encoding at least one alkaloid biosynthesis facilitating protein; and (ii] a nucleic acid sequence capable of controlling expression of the alkaloid biosynthesis facilitating protein in the host cell; and

(c] growing the host cell to produce the alkaloid biosynthesis facilitating protein, and the one or more product alkaloid compounds from a substrate by the host cell enzyme complement.

[00244] In some embodiments, the substrate can be an alkaloid compound.

[00245] In some embodiments, the substrate can be a substrate benzylisoquinoline compound.

[00246] In some embodiments, the substrate can be a substrate benzylisoquinoline precursor compound.

[00247] Referring now to FIG. 7 and FIG. 8, shown therein are certain example biosynthetic pathways showing the conversion of certain benzylisoquinoline compounds into other benzylisoquinoline compounds in a specified order. Thus, as can be appreciated from FIG. 7, for example, (5]- norcoclaurine can be a substrate benzylisoquinoline compound that can be converted into the product benzylisoquinoline compound (S]-coclaurine; or the substrate benzylisoquinoline compound (5] -coclaurine can be converted into the product benzylisoquinoline compound (S]-/V-methylcoclaurine; or as can be appreciated from FIG. 8, codeine can be a substrate benzylisoquinoline compound that can be converted into morphine. In some embodiments, a substrate benzylisoquinoline compound can be any benzylisoquinoline compound that can be converted into another benzylisoquinoline compound, namely the product benzylisoquinoline compound, in a single chemical step, i.e. a step forming no or no substantial amounts of free stable intermediate compounds. In some embodiments, a substrate benzylisoquinoline compound can be any benzylisoquinoline compound that can be converted into another benzylisoquinoline compound, namely the product benzylisoquinoline compound, in two or more chemical steps, for example, 3, 4, 5, 6, or 7 steps, and each step forming a stable intermediate compound, notably a stable intermediate benzylisoquinoline compound. Those of skill in the art will be familiar with other benzylisoquinoline compounds and other benzylisoquinoline biosynthetic pathways and thus will be able to identify other substrate benzylisoquinoline compounds and product benzylisoquinoline compounds.

[00248] In one embodiment, a variety of substrate benzylisoquinoline precursor compounds can be used to provide to the host cell for the biosynthetic production of a product benzylisoquinoline compound, or another benzylisoquinoline precursor compound, by the conversion of the substrate benzylisoquinoline precursor compound to a product benzylisoquinoline compound or to a product benzylisoquinoline precursor compound. In some embodiments, the substrate benzylisoquinoline precursor compound can initially be converted to another benzylisoquinoline precursor compound, and thereafter into a benzylisoquinoline product compound

[00249] Referring now to FIG. 6, shown therein is an example biosynthetic pathway showing the conversion of certain alkaloid compounds, notably substrate benzylisoquinoline precursor compounds into product benzylisoquinoline precursor compounds and product benzylisoquinoline compounds, in a specified order. Thus, as can be appreciated from FIG. 6, for example, the substrate benzylisoquinoline precursor compound L-tyrosine can be converted into product benzylisoquinoline precursor compound, L-DOPA; or the substrate benzylisoquinoline precursor compound L-DOPA can be converted into product benzylisoquinoline precursor compound, dopamine; or the substrate benzylisoquinoline precursor compounds dopamine and 3,4-hydroxy- phenylacetaldehyde (3,4-HPAA] can be converted into product benzylisoquinoline compound (S]-norlaudanosoline. In some embodiments, a substrate benzylisoquinoline precursor compound can be any compound, that can be converted into a product benzylisoquinoline precursor compound or a product benzylisoquinoline compound, in a single chemical step, i.e. a step forming no or no substantial amounts of free stable intermediate compounds. Those of skill in the art will be familiar with other substrate benzylisoquinoline precursor compounds and benzylisoquinoline biosynthetic pathways and thus will be able to identify other substrate benzylisoquinoline precursor compounds.

[00250] The conversion from a substrate benzylisoquinoline compound into a product benzylisoquinoline compound can be catalyzed, in different embodiments, by benzylisoquinoline biosynthetic enzymes, constituting a benzylisoquinoline enzyme complement, including, for example, norcoclaurine synthase (NCS], norcoclaurine 6-0-methyltransferase (60MT], coclaurine-/V-methyltransferase (CNMT], (5]-/V-methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V- methylcoclaurine 4’-0-methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-0- acetyltransferase (SalAT], thebaine synthase (TS], codeinone reductase (COR], neopinone isomerase (NISO], thebaine 6-0-demethylase (T60DM] and codeine-0- demethylase (CODM]

[00251] The conversion of a substrate benzylisoquinoline precursor compound into a product benzylisoquinoline precursor compound can be catalyzed, in different embodiments, by benzylisoquinoline precursor biosynthetic enzymes, constituting a benzylisoquinoline precursor enzyme complement. The benzylisoquinoline precursor enzymes can include one or more of the following benzylisoquinoline precursor enzymes: tyrosine hydroxylase (TYR], dihydroxyphenyl alanine decarboxylase (DODC], tyrosine decarboxylase (TYDC], and monoamine oxidase (MAO]

[00252] Next, example methods are described involving, in different examples, various possible combinations of substrates and enzymes present in the biosynthetic benzylisoquinoline enzyme complement, or in the benzylisoquinoline precursor enzyme complement, all of which can be used to make two specific example product benzylisoquinoline compounds, namely thebaine or codeine, and a specific product benzylisoquinoline precursor compound, namely 3,4-HPAA. From his description it will become clear to those of skill in the art how, using methods of the present disclosure, the product benzylisoquinoline compound thebaine and codeine, and the product benzylisoquinoline precursor compound 3,4-HPAA can be made. Furthermore, those of skill in the art will readily be able to employ and adjust the methods to make other product benzylisoquinoline compounds or product benzylisoquinoline precursor compounds, and it is emphasized that the methods provided herein are by no means limited in their application to make thebaine, codeine or 3,4-HPAA. By using the methods of the present disclosure other product benzylisoquinoline compounds can be made including, for example, (5)- norcoclaurine, (S)-norlaudanosoline, (S)-6-0-methyl-norlaudanosoline, (5)- coclaurine, (5]-/V-methylcoclaurine, (S)-3’-hydroxy-/V-methylcoclaurine, (5)- reticuline, ( ?)-reticuline, salutaridine, salutaridinol, salutaridinol-7-0-acetate, oripavine, neopine, neopinone, codeinone, morphine, morphinone, neomorphinone and neomorphine. Furthermore product benzylisoquinoline precursor compounds that can be made in accordance with the methods of the present disclosure include 4-HPAA, tyramine, dopamine and L-DOPA. Depending on the desired product benzylisoquinoline compound or product benzylisoquinoline precursor compound a variety of substrates can be selected and combined with a cell which has a compatible biosynthetic enzyme capacity to convert the substrate into the product benzylisoquinoline compound or product benzylisoquinoline precursor compound, in a similar manner as various substrates can be selected and combined with a cell with a compatible biosynthetic enzyme capacity to convert these substrates into thebaine or codeine, as hereinafter by way of example is described.

[00253] Thus, initially illustrating the production of thebaine as an example product benzylisoquinoline compound, referring now to FIG. 7, in one example embodiment, thebaine can be made using salutaridinol-7-0-actetate as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzyme TS.

[00254] Continuing to refer to FIG. 7 now, in one example embodiment, thebaine can be made using salutaridinol as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes SalAT and TS. [00255] Continuing to refer to FIG. 7 now, in one example embodiment, thebaine can be made using salutaridine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, SalR, SalAT and TS.

[00256] Continuing to refer to FIG. 7, in one example embodiment, thebaine can be made using (7?]-reticuline as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzyme SalSyn, SalR, SalAT and TS.

[00257] Continuing to refer to FIG. 7, in one example embodiment, thebaine can be made using (S]-reticuline as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes REPI, SalSyn SalR, SalAT and TS.

[00258] Continuing to refer to FIG. 7, in one example embodiment, thebaine can be made using (5]-3’-hydroxy-/V-methylcoclaurine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00259] Continuing to refer to FIG. 7, in one example embodiment, thebaine can be made using (5]-/V-methylcoclaurine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00260] Continuing to refer to FIG. 7, in one example embodiment, thebaine can be made using (5]-coclaurine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00261] Continuing to refer to FIG. 7, in one example embodiment, thebaine can be made using (5]-norcoclaurine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS. [00262] Referring now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using dopamine and 4-HPAA as a substrate benzylisoquinoline precursor compounds, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00263] Referring now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine, can be made using dopamine and 3, 4-HPAA as a substrate benzylisoquinoline precursor compounds, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00264] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-DOPA and dopamine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzyme MAO.

[00265] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-DOPA and tyramine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzyme MAO.

[00266] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-tyrosine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzymes TYR, DODC and MAO.

[00267] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-DOPA as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS, the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzymes DODC and MAO.

[00268] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using dopamine and L-tyrosine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS, the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzymes TYR and MAO.

[00269] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using tyramine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00270] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-tyrosine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzyme TYDC.

[00271] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using dopamine and L-tyrosine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS, the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzyme TYDC.

[00272] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using tyramine and dopamine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS.

[00273] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-tyrosine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS, the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzymes TYDC, TYR, DODC, and MAO.

[00274] Continuing to refer now to FIG. 7 in conjunction with FIG. 6, in one example embodiment, thebaine can be made using L-tyrosine as a substrate benzylisoquinoline precursor compounds, using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes, NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, SalAT and TS, the cell further comprising benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor enzymes TYDC, TYR, and DODC.

[00275] Turning now to the production of codeine as another example product benzylisoquinoline compound, referring now to FIG. 8, in one example embodiment, codeine can be made using codeinone as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzyme COR.

[00276] Continuing to refer to FIG. 8 now, in one example embodiment, codeine can be made using neopinone as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes NISO and COR.

[00277] Continuing to refer to FIG. 8 now, in one example embodiment, codeine can be made using thebaine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes T60DM, NISO and COR.

[00278] Continuing to refer to FIG. 8 now, in one example embodiment, codeine can be made using thebaine as a substrate benzylisoquinoline compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline biosynthetic enzymes T60DM, CODM, NISO and COR.

[00279] It will be clear to those of skill in the art that the substrate thebaine, in turn, can be formed in accordance with the present disclosure, using a variety of benzylisoquinoline substrate compounds or benzylisoquinoline precursor substrate compounds, in conjunction with benzylisoquinoline biosynthetic enzymes, or benzylisoquinoline precursor biosynthetic enzymes, and as hereinbefore described, and further illustrated in FIG. 6 and FIG. 7.

[00280] Turning now to the production of 3,4-HPAA as an example product benzylisoquinoline precursor compound, referring now to FIG. 6, in one example embodiment, 3,4-HPAA can be made using L-DOPA as a substrate benzylisoquinoline precursor compound, and using a cell comprising a benzylisoquinoline enzyme complement comprising the benzylisoquinoline precursor biosynthetic enzyme MAO.

[00281] Continuing to refer to FIG. 6 now, in one example embodiment, 3,4- HPAA can be made using L-tyrosine as a substrate benzylisoquinoline precursor compound, and using a cell comprising a benzylisoquinoline precursor enzyme complement comprising the benzylisoquinoline precursor biosynthetic enzymes TYR and MAO.

[00282] It will now be clear from the foregoing that the product benzylisoquinoline compounds thebaine or codeine, or the product benzylisoquinoline precursor compound 3,4-HPAA can be made in accordance with the methods of present disclosure using a variety of substrate benzylisoquinoline compounds or substrate precursor benzylisoquinoline compounds in combination with a cell including a compatible benzylisoquinoline enzyme complement or a benzylisoquinoline precursor enzyme complement. As noted, other example product benzylisoquinoline compounds that can be made in accordance herewith are (5]-norcoclaurine, (S]-norlaudanosoline, (S]-6-0-methyl-norlaudanosoline, (5]- coclaurine, (5]-/V-methylcoclaurine, (S]-3’-hydroxy-/V-methylcoclaurine, (5]- reticuline, (7?]-reticuline, salutaridine, salutaridinol, salutaridinol-7-0-actetate, oripavine, neopine, neopinone, codeinone, morphine, morphinone, neomorphinone and neomorphine. Thus, the present disclosure further includes methods to make these product benzylisoquinoline compounds. As further noted, other example product benzylisoquinoline precursor compounds that can be made in accordance herewith are: 4-HPAA, tyramine, dopamine and L-DOPA.

[00283] In what follows next, the production of the aforementioned benzylisoquinoline compounds and benzylisoquinoline precursor compounds is described in some further detail. It will be clear that for each alkaloid product a variety of substrate compounds can be selected, and that depending on the selected substrate compound an operable enzyme complement can be selected, or conversely that depending on the enzyme complement present in a host cell, operable substrate compounds can be selected. It is noted that not every possible enzyme complement combination is specifically described for each of these product compounds, as was done above for thebaine, codeine and 3, 4-HPAA. These specific enzyme complement combinations are nevertheless all intended to be included herein. Specific operable substrate and enzyme complement combinations to achieve a desired benzylisoquinoline compound or benzylisoquinoline precursor compound represent variations hereof which can readily be selected by a person of skill in the art by referring to FIGS 6, 7 and 8, and following the general principles described herein, and the teachings provided herein with respect to thebaine, codeine and 3, 4-HPAA.

[00284] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be salutaridinol-7-0-actetate, the substrate can be a substrate benzylisoquinoline compound and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridinol, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR and SalAT. [00285] In some embodiments, referring to FIG. 6 in conjunction with FIG. 7, the product benzylisoquinoline compound can be salutaridinol, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into salutaridinol, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, SalR, and SalAT and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00286] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be salutaridinol, the substrate can be a substrate benzylisoquinoline compound and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridinol, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, and SalR.

[00287] In some embodiments, referring to FIG. 6 in conjunction with FIG. 7, the product benzylisoquinoline compound can be salutaridinol, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into salutaridinol, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, SalSyn, and SalR, and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00288] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be salutaridine, the substrate can be a substrate benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into salutaridine, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, and SalSyn.

[00289] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be salutaridine, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into salutaridine, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT, REPI, and SalSyn, and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00290] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be (R)-reticuline, the substrate can be a substrate benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into (R) -reticuline, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT and REPI.

[00291] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (R)-reticuline, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (R)-reticuline, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, 4ΌMT and REPI, and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00292] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be (5]-reticuline, the substrate can be a substrate benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into (5]-reticuline, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, and 4ΌMT.

[00293] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (5]-reticuline, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (5]-reticuline, wherein the enzymes are selected from NCS, 60MT, CNMT, NMCH, and 4ΌMT, and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00294] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be (S)-3’-hydroxy-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound to (5]-3’-hydroxy-/V-methylcoclaurine, wherein the enzymes are selected from NCS, 60MT, CNMT, and NMCH.

[00295] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (5) -3’-hydroxy -/V- methylcoclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S)-3’- hydroxy-/V-methylcoclaurine, wherein the enzymes are selected from NCS, 60MT, CNMT, and NMCH, and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00296] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be (5]-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound to (S)-/V-methylcoclaurine, wherein the enzymes are selected from NCS, 60MT, and CNMT.

[00297] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (5]-/V-methylcoclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S)-/V-methylcoclaurine, wherein the enzymes are selected from NCS, 60MT, and CNMT and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00298] In some embodiments, referring to FIG. 7, the product benzylisoquinoline compound can be (S)-coclaurine, the substrate can be a benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound to (S)-coclaurine, wherein the enzymes are selected from NCS and 60MT. [00299] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (S)-coclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S)-coclaurine, wherein the enzymes are selected from NCS and 60MT and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00300] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (5) -norcoclaurine, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (5) -norcoclaurine, wherein the enzyme is NCS and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes TYR, DODC, TYDC and MAO.

[00301] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (S)-norlaudanosoline, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S)-norlaudanosoline, and the enzyme can be norcoclaurine synthase (NCS) and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR), dihydroxyphenyl alanine decarboxylase (DODC), tyrosine decarboxylase (TYDC) and monoamine oxidase (MAO).

[00302] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (S)-6-0-methyl-norlaudanosoline, the substrate can be a benzylisoquinoline compound, and the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound (5)-6-0-methyl-norlaudanosoline, wherein the enzymes are selected from norcoclaurine synthase (NCS) and norcoclaurine 6 0 methyltransferase (60MT). [00303] In some embodiments, referring to FIG. 7 in conjunction with FIG. 6, the product benzylisoquinoline compound can be (S)-6-0-methyl-norlaudanosoline, the substrate can be a substrate benzylisoquinoline precursor compound, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into (S)-6-0-methyl- norlaudanosoline, and the enzymes can be selected from 60MT and norcoclaurine synthase (NCS) and the cell can further have a benzylisoquinoline precursor enzyme complement comprising one or more of the enzymes tyrosine hydroxylase (TYR), dihydroxyphenyl alanine decarboxylase (DODC), tyrosine decarboxylase (TYDC) and monoamine oxidase (MAO).

[00304] In some embodiments, the host cell can further comprise an electron transfer facilitating protein.

[00305] In some embodiments, the electron transfer facilitating protein can be a cytochrome P450 reductase (CPR). In particular, in embodiments hereof involving the use of the enzymes REPI or SalSyn, it is preferred that the cells include a cytochrome P450 reductase (CPR). The CPR polypeptide may be naturally present in the host cell, or a nucleic acid expressing a CPR polypeptide, including SEQ.ID NO: 93 and SEQ.ID NO: 95, and including, a nucleic acid comprising nucleic acid sequences SEQ.ID NO: 92 and SEQ.ID NO: 94, may be introduced into the host cell, to thereby recombinantly produce the CPR polypeptide in the host cell.

[00306] In some embodiments, the host cell can further include a benzylisoquinoline uptake protein (BUP). The benzylisoquinoline uptake protein may enhance the uptake of benzylisoquinoline compounds or benzylisoquinoline precursor compounds into the host cell when grown in a medium comprising these compounds.

[00307] In some embodiments, BUP can comprise SEQ.ID NO: 108.

[00308] In some embodiments, the BUP can be encoded by SEQ.ID NO: 107 or

SEQ.ID NO: 158.

[00309] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A) a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a) SEQ.ID NO: 107; (b] a nucleic acid sequence that is substantially identical to SEQ.ID NO: 107;

(c] a nucleic acid sequence that is substantially identical to SEQ.ID NO: 107 but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to SEQ.ID NO: 107;

(e] a nucleic acid sequence encoding a polypeptide having the amino acid sequence set forth in SEQ.ID NO: 108;

(f] a nucleic acid sequence that encodes a functional variant of the amino acid sequence set forth in SEQ.ID NO: 108; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

[00310] (B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline biosynthetic enzyme in the host cell.

[00311] In some embodiments, referring to FIG. 8, the product benzylisoquinoline compound can be morphine, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into morphine, wherein the enzymes are selected from thebaine 6-0-demethylase (T60DM], neopinone isomerase (NISO], codeinone reductase (COR] and codeine-O-demethylase (CODM]

[00312] In some embodiments, referring now to FIG. 8, the product benzylisoquinoline compound can be codeine, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into codeine, wherein the enzymes are selected from thebaine 6-0-demethylase (T60DM], neopinone isomerase (NISO], and codeinone reductase (COR]

[00313] In some embodiments, referring further to FIG. 8, the product benzylisoquinoline compound can be codeinone, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into codeinone, wherein the enzymes are selected from thebaine 6-0- demethylase (T60DM] and isomerase (NISO] [00314] In some embodiments, referring further to FIG. 8, the product benzylisoquinoline compound can be neopinone, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neopinone, wherein the enzyme is thebaine 6-0-demethylase (T60DM]

[00315] In some embodiments, referring further to FIG. 8, the product benzylisoquinoline compound can be neopine, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neopine, wherein the enzymes are selected from codeinone reductase (COR] and thebaine 6-0-demethylase (T60DM]

[00316] In some embodiments, referring further to FIG. 8, the product benzylisoquinoline compound can be morphinone, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline compound into morphinone, wherein the enzymes are selected from thebaine 6-0-demethylase (T60DM], neopinone isomerase (NISO] and codeine-O-demethylase (CODM]

[00317] In some embodiments, referring further to FIG. 8, the product benzylisoquinoline compound can be neomorphinone, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neomorphinone, wherein the enzyme is selected from thebaine 6-0- demethylase (T60DM] and codeine-O-demethylase (CODM]

[00318] In some embodiments, referring to further FIG. 8, the product benzylisoquinoline compound can be neomorphine, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into neomorphine, wherein the enzyme is selected from codeinone reductase (COR], codeine-O-demethylase (CODM] and thebaine 6-0-demethylase (T60DM]

[00319] In some embodiments, referring further to FIG. 8, the product benzylisoquinoline compound can be oripavine, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline compound into oripavine, wherein the enzyme is codeine-O-demethylase (CODM]

[00320] In some embodiments, referring now to FIG. 6, the product benzylisoquinoline precursor compound can be 3,4-HPAA, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into 3,4-HPAA, wherein the enzymes are selected from tyrosine reductase (TYR], tyrosine decarboxylase (TYDC], dihydroxyphenyl alanine decarboxylase (DODC] and monoamine oxidase (MAO] [00321] In some embodiments, referring further to FIG. 6, the product benzylisoquinoline precursor compound can be 4-HPAA, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline precursor compound into 4-HPAA, wherein the enzyme is tyrosine decarboxylase (TYDC]

[00322] In some embodiments, referring further to FIG. 6, the product benzylisoquinoline precursor compound can be dopamine, the enzyme complement can comprise one or more enzymes capable of converting the substrate benzylisoquinoline precursor compound into dopamine, wherein the enzymes are selected from tyrosine reductase (TYR], tyrosine decarboxylase (TYDC], and dihydroxyphenyl alanine decarboxylase (DODC]

[00323] In some embodiments, referring further to FIG. 6, the product benzylisoquinoline precursor compound can be L-DOPA, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline precursor compound into L-DOPA, wherein the enzyme is tyrosine reductase (TYR] [00324] In some embodiments, referring further to FIG. 6, the product benzylisoquinoline precursor compound can be tyramine, the enzyme complement can comprise an enzyme capable of converting the substrate benzylisoquinoline precursor compound into tyramine, wherein the enzyme is tyrosine decarboxylase (TYDC]

[00325] In some embodiments, upon the cell having produced the product benzylisoquinoline compound or the benzylisoquinoline precursor compound, the product can be further converted in the host cell to form further derivative benzylisoquinoline derivative compounds or benzylisoquinoline precursor derivative compounds.

[00326] In some embodiments, the product benzylisoquinoline compound or the derivative benzylisoquinoline can be recovered, for example, by obtaining the medium and separating the product benzylisoquinoline compound or the derivative benzylisoquinoline from other medium constituents. A variety of purification techniques and methodologies may be used, as will be known to those of skill in the art, for example chromatographical techniques, and in this manner a substantially pure product benzylisoquinoline compound or product benzylisoquinoline precursor compound may be obtained.

[00327] Turning now to the host cells that can be used in accordance with the present disclosure. Initially it is noted that in accordance herewith the host cell includes at least one alkaloid biosynthesis facilitating protein.

[00328] A variety of alkaloid biosynthesis facilitating proteins can be used. It is noted in this regard that PRT10 proteins show substantial amino acid sequence similarity, as further can be appreciated with reference to FIG. 10. FIG. 10 depicts the polypeptide sequence alignment of 16 different alkaloid biosynthesis facilitating proteins. The alkaloid biosynthesis facilitating proteins share common motifs which are indicated as motif 1, motif 2 and motif 3. Accordingly, in one embodiment, the alkaloid biosynthesis facilitating protein comprises one or more motifs selected from motif 1, motif 2 and motif 3 shown in FIG. 10. In another embodiment, the alkaloid biosynthesis facilitating protein comprises all 3 motifs shown in FIG. 10. Thus, in particular embodiments, in a accordance herewith an alkaloid biosynthesis facilitating protein characterized by one or more PR10 polypeptide sequence motifs can be selected, and in particular, a first, second or third polypeptide sequence motif selected from a polypeptide sequence motif that is identical or substantially identical to

(a]Motif 1 sequence selected from any one of SEQ.ID NO: 109 to SEQ.ID NO: 121, or a sequence that is at least 75% identical thereto; and/or

(b] Motif 2 sequence selected from any one of SEQ.ID NO: 122 to SEQ.ID NO:

137, or a sequence that is at least 75% identical thereto; and/or

(c] Motif 3 sequence selected from any one of SEQ.ID NO: 138 to SEQ.ID NO:

153, or a sequence that is at least 75% identical thereto.

[00329] The polypeptide sequence (a], (b] and/or (c], can be at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to the polypeptide sequences of (a], (b] and/or (c]. [00330] It is noted that the first sequence motif, second sequence motif, and third sequence motif are shown in FIG. 10 as Motif 1, Motif 2 and Motif 3, respectively. In general, Motif 1 is located N-terminal relative to Motif 2, and Motif 2 is located N-terminal relative to Motif 3.

[00331] In some embodiments, the alkaloid biosynthesis facilitating protein is a protein selected PRT10-1 (SEQ.ID NO: 1], PRT10-2 (SEQ.ID NO: 3], PRT10-3 (SEQ.ID NO: 5; SEQ.ID NO: 8], PRT10-4 (SEQ.ID NO: 10], PRT10-5 (SEQ.ID NO: 13]„ PRT10-8 (SEQ.ID NO: 16], PRT10-9 (SEQ.ID NO: 19], PRT10-10 (SEQ.ID NO: 22], PRT10-11 (SEQ.ID NO: 25], PRT10-12 (SEQ.ID NO: 28], PRT10-14 (SEQ.ID NO: 31], PRT10-15 (SEQ.ID NO: 34], PRT10-16 (SEQ.ID NO: 37], PRT10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PRT10-19 (SEQ.ID NO: 45], PRT10-20 (SEQ.ID NO: 48] and PRT10-21 (SEQ.ID NO: 51]

[00332] In some embodiments, the at least one alkaloid biosynthesis facilitating protein are at least two alkaloid biosynthesis facilitating proteins independently selected from PRT10-1 (SEQ.ID NO: 1], PRT10-2 (SEQ.ID NO: 3], PRT10-3 (SEQ.ID NO: 5; SEQ.ID NO: 8], PRT10-4 (SEQ.ID NO: 10], PRT10-5 (SEQ.ID NO: 13]„ PRT10-8 (SEQ.ID NO: 16], PRT10-9 (SEQ.ID NO: 19], PRT10-10 (SEQ.ID NO: 22], PRT10-11 (SEQ.ID NO: 25], PRT10-12 (SEQ.ID NO: 28], PRT10-14 (SEQ.ID

NO: 31], PRT10-15 (SEQ.ID NO: 34], PRT10-16 (SEQ.ID NO: 37], PRT10-17 (SEQ.ID

NO: 39], PR10-18 (SEQ.ID NO: 42], PRT10-19 (SEQ.ID NO: 45], PRT10-20 (SEQ.ID NO: 48] and PRT10-21 (SEQ.ID NO: 51]

[00333] In some embodiments, the at least one alkaloid biosynthesis facilitating protein are at least three alkaloid biosynthesis facilitating proteins independently selected from PRT10-1 (SEQ.ID NO: 1], PRT10-2 (SEQ.ID NO: 3], PRT10-3 (SEQ.ID NO: 5; SEQ.ID NO: 8], PRT10-4 (SEQ.ID NO: 10], PRT10-5 (SEQ.ID NO: 13]„ PRT10-8 (SEQ.ID NO: 16], PRT10-9 (SEQ.ID NO: 19], PRT10-10 (SEQ.ID NO: 22], PRT10-11 (SEQ.ID NO: 25], PRT10-12 (SEQ.ID NO: 28], PRT10-14 (SEQ.ID

NO: 31], PRT10-15 (SEQ.ID NO: 34], PRT10-16 (SEQ.ID NO: 37], PRT10-17 (SEQ.ID

NO: 39], PR10-18 (SEQ.ID NO: 42], PRT10-19 (SEQ.ID NO: 45], PRT10-20 (SEQ.ID NO: 48] and PRT10-21 (SEQ.ID NO: 51]

[00334] In some embodiments, the at least one alkaloid biosynthesis facilitating protein are at least four alkaloid biosynthesis facilitating proteins independently selected from PRT10-1 (SEQ.ID NO: 1], PRT10-2 (SEQ.ID NO: 3], PRT10-3 (SEQ.ID NO: 5; SEQ.ID NO: 8], PRT10-4 (SEQ.ID NO: 10], PRT10-5 (SEQ.ID NO: 13]„ PRT10-8 (SEQ.ID NO: 16], PRT10-9 (SEQ.ID NO: 19], PRT10-10 (SEQ.ID NO: 22], PRT10-11 (SEQ.ID NO: 25], PRT10-12 (SEQ.ID NO: 28], PRT10-14 (SEQ.ID NO: 31], PRT10-15 (SEQ.ID NO: 34], PRT10-16 (SEQ.ID NO: 37], PRT10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PRT10-19 (SEQ.ID NO: 45], PRT10-20 (SEQ.ID NO: 48] and PRT10-21 (SEQ.ID NO: 51]

[00335] In some embodiments, the at least one alkaloid biosynthesis facilitating protein are at least five alkaloid biosynthesis facilitating proteins independently selected from PRT10-1 (SEQ.ID NO: 1], PRT10-2 (SEQ.ID NO: 3], PRT10-3 (SEQ.ID NO: 5; SEQ.ID NO: 8], PRT10-4 (SEQ.ID NO: 10], PRT10-5 (SEQ.ID NO: 13]„ PRT10-8 (SEQ.ID NO: 16], PRT10-9 (SEQ.ID NO: 19], PRT10-10 (SEQ.ID NO: 22], PRT10-11 (SEQ.ID NO: 25], PRT10-12 (SEQ.ID NO: 28], PRT10-14 (SEQ.ID NO: 31], PRT10-15 (SEQ.ID NO: 34], PRT10-16 (SEQ.ID NO: 37], PRT10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PRT10-19 (SEQ.ID NO: 45], PRT10-20 (SEQ.ID NO: 48] and PRT10-21 (SEQ.ID NO: 51]

[00336] In some embodiments, the at least one alkaloid biosynthesis facilitating protein are at six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, fifteen, sixteen, seventeen, eighteen, or nineteen alkaloid biosynthesis facilitating proteins independently selected from PRT10-1 (SEQ.ID NO: 1], PRT10-2 (SEQ.ID NO: 3], PRT10-3 (SEQ.ID NO: 5; SEQ.ID NO: 8], PRT10-4 (SEQ.ID NO: 10], PRT10-5 (SEQ.ID NO: 13]„ PRT10-8 (SEQ.ID NO: 16], PRT10-9 (SEQ.ID NO: 19], PRT10-10 (SEQ.ID NO: 22], PRT10-11 (SEQ.ID NO: 25], PRT10-12 (SEQ.ID NO: 28], PRT10-14 (SEQ.ID NO: 31], PRT10-15 (SEQ.ID NO: 34], PRT10-16 (SEQ.ID NO: 37], PRT10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PRT10-19 (SEQ.ID NO: 45], PRT10-20 (SEQ.ID NO: 48] and PRT10-21 (SEQ.ID NO: 51]

[00337] In some embodiments, the at least one alkaloid biosynthesis facilitating protein comprise at least one polypeptide sequence that is identical or substantially identical to a polypeptide sequence selected from (a] SEQ.ID NO: 109, SEQ.ID NO: 110, SEQ.ID NO: 111, SEQ.ID NO: 112, SEQ.ID NO: 113, SEQ.ID NO: 114, SEQ.ID NO: 115, SEQ.ID NO: 116, SEQ.ID NO: 117, SEQ.ID NO: 118, SEQ.ID NO: 119, SEQ.ID NO: 120; and SEQ.ID NO: 121.

[00338] In some embodiments, the at least one alkaloid biosynthesis facilitating protein comprise at least one polypeptide sequence selected from (b] SEQ.ID NO: 122, SEQ.ID NO: 123, SEQ.ID NO: 124, SEQ.ID NO: 125, SEQ.ID NO: 126, SEQ.ID NO: 127, SEQ.ID NO: 128, SEQ.ID NO: 129, SEQ.ID NO: 130, SEQ.ID NO: 131, SEQ.ID NO: 132, SEQ.ID NO: 133, SEQ.ID NO: 134, SEQ.ID NO: 135, SEQ.ID NO: 136, and SEQ.ID NO: 137.

[00339] In some embodiments, the at least one alkaloid biosynthesis facilitating protein comprise at least one polypeptide sequence selected from (c] SEQ.ID NO: 138, SEQ.ID NO: 139, SEQ.ID NO: 140, SEQ.ID NO: 141, SEQ.ID NO: 142, SEQ.ID NO: 143, SEQ.ID NO: 144, SEQ.ID NO: 145, SEQ.ID NO: 146, SEQ.ID NO: 147, SEQ.ID NO: 148, SEQ.ID NO: 149, SEQ.ID NO: 150, SEQ.ID NO: 151, SEQ.ID NO: 152, and SEQ.ID NO: 153.

[00340] In some embodiments, the at least one alkaloid biosynthesis facilitating protein comprise at least one of the polypeptide sequences selected from (a] and (b]; (a] and (c]; (b] and (c]; or (a], (b] and (c]

[00341] In some embodiments, the polypeptide sequence (a], (b] and/or (c], can be at least 75% identical, at least 80% identical, at least 85% identical, at least 90% identical, at least 91% identical, at least 92% identical, at least 93% identical, at least 94% identical, at least 95% identical, at least 96% identical, at least 97% identical, at least 98% identical or at least 99% identical to the polypeptide sequences of (a], (b] and/or (c]

[00342] In some embodiments, the alkaloid biosynthesis facilitating protein can a protein expressed by a nucleic acid sequence selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID NO: 9, SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17,

SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24,

SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32,

SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40,

SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47,

SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO: 161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO: 165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO: 169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO: 173, SEQ.ID NO: 174 or SEQ.ID NO: 175; (b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34,

SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34,

SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b], (c], (d], (e] or (f).

[00343] Furthermore, as hereinbefore noted, the cell is selected or modulated to comprise a biosynthetic capability that can convert a substrate to form the product benzylisoquinoline compound or product benzylisoquinoline precursor product.

[00344] The host cell can be any cell capable of producing a product benzylisoquinoline compound, including any microbial cell, plant cell or algal cell.

[00345] In some embodiments, the benzylisoquinoline biosynthetic enzymefs] or the benzylisoquinoline precursor biosynthetic enzymefs] can be naturally present therein.

[00346] In accordance herewith, the host cell is a cell which in the absence of the alkaloid biosynthesis facilitating protein, is unable to convert or unable to efficiently convert a substrate into alkaloid product. For example, when comparing a host cell comprising an alkaloid biosynthesis facilitating protein, with a host cell devoid of the alkaloid biosynthesis facilitating protein, substrate to product conversion occurs substantially less efficiently in the host cell devoid of the alkaloid biosynthesis facilitating protein. Thus, by the introduction of the alkaloid biosynthesis facilitating protein into the host cell, for example, 10%, 20%, 30% 40%, 50%, 60%, 70%, 80%, 90% (w/w] or more of the alkaloid product can be produced by the cell in the presence of the alkaloid biosynthesis facilitating protein.

[00347] The mechanism by which the alkaloid biosynthesis facilitating proteins facilitate alkaloid biosynthesis may vary, for example, alkaloid biosynthesis facilitating proteins may participate in a catalytic step with a benzylisoquinoline biosynthetic enzyme or a benzylisoquinoline precursor biosynthetic enzyme, and thereby, for example lower the activation energy (Ea], or alkaloid biosynthesis facilitating proteins may coordinate or stabilize an alkaloid substrate or product in a specific configuration, or locate an alkaloid substrate or alkaloid product in a specific location, for example, a specific subcellular location.

[00348] In some embodiments, the host cell can be grown in a medium comprising a substrate compound, wherein the substrate compound can be biosynthetically converted into the product alkaloid compound.

[00349] In some embodiments, the host cell can be a cell that has been modulated to produce the product benzylisoquinoline compound, for example, the host cell can be a cell comprising one or more recombinant nucleic acids permitting production of one or more product benzylisoquinoline compounds, as is described further below.

[00350] In some embodiments, the cell can be a cell, which, but for the presence of the substrate compound in the medium, is not capable of producing the product benzylisoquinoline compound.

[00351] In some embodiments, the cell can be a cell, which, but for the presence of the substrate compound in the medium, produces substantially less of the product benzylisoquinoline compound, for example, at least about 2 times less, at least about 5 times less, or at least about 10 times less.

[00352] In some embodiments, the cell can be a microbial cell.

[00353] In some embodiments, the microbial cell can be a bacterial cell.

[00354] In some embodiments, the bacterial cell can be an Escherichia coli cell.

[00355] In some embodiments, the microbial cell can be a yeast cell. [00356] In some embodiments, the yeast cell can be Saccharomyces cerevisiae cells, or Yarrowia lipolytica cell.

[00357] In some embodiments, the cell can be an algal cell.

[00358] In some embodiments, the cell can be a plant cell.

[00359] In some embodiments, the plant cell can be selected from a cell obtainable from plants belonging to the plant families of Eupteleaceae, Lardizabalaceae, Circaeasteraceae, Menispermaceae, Berberidaceae, Ranunculaceae, and Papaveraceae (including those belonging to the subfamilies of Pteridophylloideae, Papaveroideae and Fumarioideae], and further including plants belonging to the genus Argemone, including Argemone mexicana (Mexican Prickly Poppy], plants belonging to the genus Berberis, including Berberis thunbergii (Japanese Barberry], plants belonging to the genus Chelidonium, including Chelidonium majus (Greater Celandine], plants belonging to the genus Cissampelos, including Cissampelos mucronata (Abuta], plants belonging to the genus Cocculus, including Cocculus trilobus (Korean Moonseed], plants belonging to the genus Corydalis, including Corydalis chelanthifolia (Ferny Fumewort], Corydalis cava; Corydalis ochotenis; Corydalis ophiocarpa; Corydalis platycarpa; Corydalis tuberosa; and Cordyalis bulbosa, plants belonging to the genus Eschscholzia, including Eschscholzia californica (California Poppy], plants belonging to the genus Glaucium, including Glaucium flavum (Yellowhorn Poppy], plants belonging to the genus Hydrastis, including Hydrastis canadensis (Goldenseal], plants belonging to the genus Jeffersonia, including Jeffersonia diphylla (Rheumatism Root], plants belonging to the genus Mahonia, including Mahonia aquifolium (Oregon Grape], plants belonging to the genus Menispermum, including Menispermum canadense (Canadian Moonseed], plants belonging to the genus Nandina, including Nandina domestica (Sacred Bamboo], plants belonging to the genus Nigella, including Nigella sativa (Black Cumin], plants belonging to the genus Papaver, including Papaver bracteatum (Persian Poppy], Papaver somniferum, Papaver cylindricum , Papaver decaisnei, Papaver fug ax, Papaver nudicale, Papaver oreophyllum, Papaver orientale, Papaver paeonifolium, Papaver persicum, Papaver pseudo-orientale, Papaver rhoeas, Papaver rhopalothece, Papaver armeniacum, Papaver setigerum, Papaver tauricolum, and Papaver triniaefolium, plants belonging to the genus Sanguinaria, including Sanguinaria canadensis (Bloodroot], plants belonging to the genus Stylophorum, including Stylophorum diphyllum (Celandine Poppy], plants belonging to the genus Thalictrum, including Thalictrum flavum (Meadow Rue], plants belonging to the genus Tinospora, including Tinospora cordifolia (Heartleaf Moonseed], plants belonging to the genus Xanthoriza, including Xanthoriza simplicissima (Yellowroot] and plants belonging to the genus Romeria including Romeria carica.

[00360] In accordance herewith, the host cells are grown to produce the alkaloid biosynthesis facilitating protein and the product benzylisoquinoline compound or the product benzylisoquinoline precursor compound. Growth media and growth conditions can vary depending on the cell that is selected, as will be readily appreciated to those of ordinary skill in the art. Example media include liquid culture media for the growth of yeast cells and bacterial cells including, but not limited to, Luria-Broth, Dulbecco-Eagle modified medium (DMEM] or Optimem. Further media and growth conditions can be found in Sambrook et ai, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, 2001, Third Ed. In embodiments where plant cells are used the plant cells may be cultured and developed and regenerated to grow mature plants capable of producing the product alkaloid compound, including in plant parts, for example in seeds.

[00361] In some embodiments, the host cell comprises a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID NO: 9, SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17, SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24, SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32, SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40, SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47, SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO:

161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO:

165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO:

169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO:

173, SEQ.ID NO: 174 or SEQ.ID NO: 175; (b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f).

[00362] As noted, in some embodiments, the host cells can be modulated to include a compatible biosynthetic enzyme complement to synthesize the product benzylisoquinoline compound from a substrate. The biosynthetic enzyme complement can include, for example, norcoclaurine synthase (NCS], norcoclaurine 6-O-methyltransferase (60MT], coclaurine-iV-methyltransferase (CNMT], ( S]-N - methylcoclaurine 3’-hydroxylase (NMCH], 3’-hydroxy-/V-methylcoclaurine 4’-0- methyltransferase (4ΌMT], reticuline epimerase (REPI], salutaridine synthase (SalSyn], salutaridine reductase (SalR], salutaridinol-7-O-acetyltransferase, (SalAT], thebaine synthase (TS], and/or thebaine 6-O-demethylase (T60DM] The biosynthetic enzyme complement can be introduced into the host cell, for example, by genomic integration of nucleic acids encoding one or more of the noted enzymes, or by inclusion of such nucleic acids in a plasmid introduced in a host cell. It is noted that in some embodiments, it may be beneficial for the host cell to produce substantial quantities of thebaine synthase. Thus in some embodiments, the host cells may include two or more nucleic acid sequences encoding thebaine synthase (TS], as further illustrated in Example 13 below.

[00363] Accordingly, in some embodiments, the host cell can be manipulated to obtain a cell comprising a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme; and

(B] a second nucleic acid sequence capable of controlling expression of the benzylisoquinoline biosynthetic enzyme in the host cell.

[00364] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 54, SEQ.ID NO: 56, SEQ.ID NO: 58, SEQ.ID. NO: 60, SEQ.ID NO: 62, SEQ.ID NO: 64, SEQ.ID NO: 66, SEQ.ID NO: 68; SEQ.ID NO: 70, SEQ.ID NO: 72, SEQ.ID NO: 82, SEQ.ID NO: 84, SEQ.ID NO: 90, SEQ.ID NO: 92, SEQ.ID NO: 94, SEQ. ID NO: 154, or SEQ.ID NO: 156;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 55 SEQ.ID NO: 57, SEQ.ID NO: 59, SEQ.ID. NO: 61, SEQ.ID NO: 63, SEQ.ID NO: 65, SEQ.ID NO: 67, SEQ.ID NO: 69, SEQ.ID NO: 71, SEQ.ID NO: 73, SEQ.ID NO: 83, SEQ.ID NO: 85, SEQ.ID NO: 91, SEQ.ID NO: 93, SEQ.ID NO: 95, SEQ. ID NO: 155, or SEQ.ID NO: 157; (f) a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 55 SEQ.ID NO: 57, SEQ.ID NO: 59, SEQ.ID. NO: 61, SEQ.ID NO: 63, SEQ.ID NO: 65, SEQ.ID NO: 67, SEQ.ID NO: 69, SEQ.ID NO: 71, SEQ.ID NO: 73, SEQ.ID NO: 83, SEQ.ID NO: 85, SEQ.ID NO: 91, SEQ.ID NO: 93, SEQ.ID NO: 95, SEQ. ID NO: 155, or SEQ.ID NO: 157; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline biosynthetic enzyme in the second cell.

[00365] In some embodiments, the host cell can include one or more benzylisoquinoline precursor biosynthetic enzymes, for example, tyrosine reductase (TYR], tyrosine decarboxylase (TYDC], dihydroxyphenyl alanine decarboxylase (DODC] and/or monoamine oxidase (MAO] In some embodiments, the host cell can be manipulated to obtain a cell comprising a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding a benzylisoquinoline precursor biosynthetic enzyme; and

(B] a second nucleic acid sequence capable of controlling expression of the benzylisoquinoline precursor biosynthetic enzyme in the second cell.

[00366] In some embodiments, the host cell can comprise a chimeric nucleic acid sequence comprising as operably linked components:

(A) a first nucleic acid sequence encoding a benzylisoquinoline precursor biosynthetic enzyme selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 74, SEQ.ID NO: 76, SEQ.ID NO: 78, or SEQ.ID NO: 80;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code; (d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 75, SEQ.ID NO: 77, SEQ.ID NO: 79, or SEQ.ID NO: 81;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 75, SEQ.ID NO: 77, SEQ.ID NO: 79, or SEQ.ID NO: 81; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], 00, (C), (d), (e) or (f); and

(B] a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline precursor biosynthetic enzyme in the second cell.

[00367] A variety of techniques and methodologies to manipulate cells to introduce nucleic acid sequences in cells and attain expression exists and are well known to the skilled artisan and can, for example be found in Sambrook et al, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, 2001, Third Ed.

[00368] Nucleic acid sequences capable of controlling expression in cells that may be used herein include any transcriptional promoter capable of controlling expression of polypeptides in host cells. Generally, promoters obtained from bacterial cells are used when a bacterial host is selected in accordance herewith, while a fimgal promoter will be used when a fimgal host cell is selected, a plant promoter will be used when a plant cell is selected, and so on. Further nucleic acid elements capable elements of controlling expression in a host cell include transcriptional terminators, enhancers and the like, all of which may be included in the chimeric nucleic acid sequences of the present disclosure.

[00369] In accordance with the present disclosure, the chimeric nucleic acid sequences comprising a promoter capable of controlling expression in host cell linked to a nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein or a benzylisoquinoline biosynthetic enzyme, or a benzylisoquinoline precursor biosynthetic enzyme can be integrated into a recombinant expression vector which ensures good expression in the host cell, wherein the expression vector is suitable for expression in a host cell. The term "suitable for expression in a host cell” means that the recombinant expression vector comprises the chimeric nucleic acid sequence linked to genetic elements required to achieve expression in a cell. Genetic elements that may be included in the expression vector in this regard include a transcriptional termination region, one or more nucleic acid sequences encoding marker genes, one or more origins of replication and the like. In preferred embodiments, the expression vector further comprises genetic elements required for the integration of the vector or a portion thereof in the host cell's genome, for example if a plant host cell is used the T-DNA left and right border sequences which facilitate the integration into the plant's nuclear genome.

[00370] Pursuant to the present disclosure, the expression vector may further contain a marker gene. Marker genes that may be used in accordance with the present disclosure include all genes that allow the distinction of transformed cells from non-transformed cells, including all selectable and screenable marker genes. A marker gene may be a resistance marker such as an antibiotic resistance marker against, for example, kanamycin or ampicillin. Screenable markers that may be employed to identify transformants through visual inspection include b- glucuronidase (GUS] (U.S. Pat. Nos. 5,268,463 and 5,599,670] and green fluorescent protein (GFP] (Niedz et al, 1995, Plant Cell Rep., 14: 403]

[00371] One host cell that conveniently may be used is Escherichia coli. The preparation of the E. coli vectors may be accomplished using commonly known techniques such as restriction digestion, ligation, gelelectrophoresis, DNA sequencing, the Polymerase Chain Reaction (PCR] and other methodologies. A wide variety of cloning vectors is available to perform the necessary steps required to prepare a recombinant expression vector. Among the vectors with a replication system functional in E. coli, are vectors such as pBR322, the pUC series of vectors, the M13 mp series of vectors, pBluescript etc. Typically, these cloning vectors contain a marker allowing selection of transformed cells. Nucleic acid sequences may be introduced in these vectors, and the vectors may be introduced in E. coli by preparing competent cells, electroporation or using other well known methodologies to a person of skill in the art. E. coli may be grown in an appropriate medium, such as Luria-Broth medium and harvested. Recombinant expression vectors may readily be recovered from cells upon harvesting and lysing of the cells. Further, general guidance with respect to the preparation of recombinant vectors and growth of recombinant organisms may be found in, for example: Sambrook et ai, Molecular Cloning, a Laboratory Manual, Cold Spring Harbor Laboratory Press, 2001, Third Ed.

[00372] In another aspect, the present disclosure provides a chimeric nucleic acid construct, the chimeric nucleic acid construct comprising as operably linked components:

(A] a first nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID

NO: 9, SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17, SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24, SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32, SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40, SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47, SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO:

161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO:

165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO:

169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO:

173, SEQ.ID NO: 174 or SEQ.ID NO: 175;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a];

(c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide having any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f) a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B) a second nucleic acid sequence encoding a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline precursor biosynthetic enzyme in the host cell.

[00373] In another aspect, the present disclosure provides a recombinant expression vector suitable for expression in a host cell comprising a chimeric nucleic acid sequence comprising as operably linked components:

(A] a first nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein selected from the nucleic acid sequences consisting of:

(a] SEQ.ID NO: 2, SEQ.ID NO: 4, SEQ.ID NO: 6, SEQ.ID NO: 7, SEQ.ID

NO: 9, SEQ.ID NO: 11, SEQ.ID NO: 12, SEQ.ID NO: 14, SEQ.ID NO: 15, SEQ.ID NO: 17, SEQ.ID NO: 18, SEQ.ID NO: 20, SEQ.ID NO: 21, SEQ.ID NO: 23, SEQ.ID NO: 24, SEQ.ID NO: 26, SEQ.ID NO: 27, SEQ.ID NO: 29, SEQ.ID NO: 30, SEQ.ID NO: 32, SEQ.ID NO: 33, SEQ.ID NO: 35, SEQ.ID NO: 36, SEQ.ID NO: 38, SEQ.ID NO: 40, SEQ.ID NO: 41, SEQ.ID NO: 43, SEQ.ID NO: 44, SEQ.ID NO: 46, SEQ.ID NO: 47, SEQ.ID NO: 49, SEQ.ID NO: 50, SEQ.ID NO: 52, SEQ.ID NO: 53, SEQ.ID NO: 160, SEQ.ID NO:

161, SEQ.ID NO: 162, SEQ.ID NO: 163, SEQ.ID NO: 164, SEQ.ID NO:

165, SEQ.ID NO: 166, SEQ.ID NO: 167, SEQ.ID NO: 168, SEQ.ID NO:

169, SEQ.ID NO: 170, SEQ.ID NO: 171, SEQ.ID NO: 172, SEQ.ID NO:

173, SEQ.ID NO: 174 or SEQ.ID NO: 175;

(b] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a]; (c] a nucleic acid sequence that is substantially identical to any one of the nucleic acid sequences of (a] but for the degeneration of the genetic code;

(d] a nucleic acid sequence that is complementary to any one of the nucleic acid sequences of (a];

(e] a nucleic acid sequence encoding a polypeptide havingany one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51;

(f] a nucleic acid sequence that encodes a functional variant of any one of the amino acid sequences set forth in SEQ.ID NO: 1, SEQ.ID NO: 3, SEQ.ID NO: 5, SEQ.ID NO: 8, SEQ.ID NO: 10, SEQ.ID NO: 13, SEQ.ID NO: 16, SEQ.ID NO: 19, SEQ.ID NO: 22, SEQ.ID NO: 25, SEQ.ID NO: 28, SEQ.ID NO: 31, SEQ.ID NO: 34, SEQ.ID NO: 37, SEQ.ID NO: 39, SEQ.ID NO: 42, SEQ.ID NO: 45, SEQ.ID NO: 48, and SEQ.ID NO: 51; and

(g] a nucleic acid sequence that hybridizes under stringent conditions to any one of the nucleic acid sequences set forth in (a], (b), (c), (d), (e) or (f); and

(B] a second nucleic acid sequence encoding a second nucleic acid sequence capable of controlling the expression of the benzylisoquinoline precursor biosynthetic enzyme in the host cell.

[00374] In another aspect, the present disclosure provides, in at least one embodiment, a host cell having an enzyme complement to biosynthetically produce alkaloid compounds, benzylisoquinoline compounds or benzylisoquinoline precursor compounds, the host cell comprising a chimeric nucleic acid comprising as operably linked components (i] a nucleic acid sequence encoding an alkaloid biosynthesis facilitating protein; and (ii] a nucleic acid sequence capable of controlling expression of the alkaloid biosynthesis facilitating protein in the host cell, and the host cell capable of producing the alkaloid biosynthesis facilitating protein and a product alkaloid compound, benzylisoquinoline compound or product benzylisoquinoline precursor compound when provided with a substrate compound.

[00375] It will be clear form the foregoing that the methods of the present disclosure may be used to make a variety of alkaloid compounds, benzylisoquinoline compounds and benzylisoquinoline precursor compounds. The obtained alkaloid compounds, benzylisoquinoline compounds or benzylisoquinoline precursor compounds may be formulated for use as a pharmaceutical drug, therapeutic agent or medicinal agent. Thus the present disclosure further includes a pharmaceutical composition comprising an alkaloid compound, benzylisoquinoline compound or a benzylisoquinoline precursor compound prepared in accordance with the methods of the present disclosure. Pharmaceutical drug preparations comprising an alkaloid compound, a benzylisoquinoline compound or benzylisoquinoline precursor compound in accordance with the present disclosure can comprise vehicles, excipients and auxiliary substances, such as wetting or emulsifying agents, pH buffering substances and the like. These vehicles, excipients and auxiliary substances are generally pharmaceutical agents that may be administered without undue toxicity. Pharmaceutically acceptable excipients include, but are not limited to, liquids such as water, saline, polyethyleneglycol, hyaluronic acid, glycerol and ethanol. Pharmaceutically acceptable salts can also be included therein, for example, mineral acid salts such as hydrochlorides, phosphates, sulfates, and the like; and the salts of organic acids such as acetates, propionates, benzoates, and the like. It is also preferred, although not required, that the preparation will contain a pharmaceutically acceptable excipient that serves as a stabilizer. Examples of suitable carriers that also act as stabilizers for peptides include, without limitation, pharmaceutical grades of dextrose, sucrose, lactose, sorbitol, inositol, dextran, and the like. Other suitable carriers include, again without limitation, starch, cellulose, sodium or calcium phosphates, citric acid, glycine, polyethylene glycols (PEGs], and combinations thereof. The pharmaceutical composition may be formulated for oral and intravenous administration and other routes of administration as desired. Dosing may vary and may be optimized using routine experimentation.

[00376] In another aspect, the present disclosure further provides, in an embodiment, a use of an alkaloid compound, benzylisoquinoline compound or benzylisoquinoline precursor compound prepared in accordance with any one of the methods of the present disclosure to prepare a pharmaceutical composition comprising the alkaloid compound, benzylisoquinoline compound or benzylisoquinoline precursor compound.

[00377] In further embodiments, the present disclosure provides methods for treating a patient with a pharmaceutical composition comprising an alkaloid compound, a benzylisoquinoline compound or a benzylisoquinoline precursor compound prepared in accordance with the present disclosure. Accordingly, the present disclosure further provides a method for treating a patient with an alkaloid compound, a benzylisoquinoline compound or a benzylisoquinoline precursor compound prepared according to the methods of the present disclosure, the method comprising administering to the patient a pharmaceutical composition comprising an alkaloid compound, a benzylisoquinoline compound or a benzylisoquinoline precursor compound, wherein the pharmaceutical composition is administered in an amount sufficient to ameliorate a medical condition in the patient.

SUMMARY OF SEQUENCES

[00378] SEQ.ID NO: 1 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-1.

[00379] SEQ.ID NO: 2 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-1.

[00380] SEQ.ID NO: 3 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-2.

[00381] SEQ.ID NO: 4 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-2.

[00382] SEQ.ID NO: 5 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-3.

[00383] SEQ.ID NO: 6 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-3.

[00384] SEQ.ID NO: 7 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-3.

[00385] SEQ.ID NO: 8 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-3. [00386] SEQ.ID NO: 9 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-3.

[00387] SEQ.ID NO: 10 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-4.

[00388] SEQ.ID NO: 11 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-4.

[00389] SEQ.ID NO: 12 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-4.

[00390] SEQ.ID NO: 13 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-5.

[00391] SEQ.ID NO: 14 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-5.

[00392] SEQ.ID NO: 15 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-5.

[00393] SEQ.ID NO: 16 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-8.

[00394] SEQ.ID NO: 17 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-8.

[00395] SEQ.ID NO: 18 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-8.

[00396] SEQ.ID NO: 19 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-9.

[00397] SEQ.ID NO: 20 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-9.

[00398] SEQ.ID NO: 21 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-9.

[00399] SEQ.ID NO: 22 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-10.

[00400] SEQ.ID NO: 23 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-10.

[00401] SEQ.ID NO: 24 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-10. [00402] SEQ.ID NO: 25 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-11.

[00403] SEQ.ID NO: 26 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-11.

[00404] SEQ.ID NO: 27 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-11.

[00405] SEQ.ID NO: 28 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-12.

[00406] SEQ.ID NO: 29 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-12.

[00407] SEQ.ID NO: 30 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-12.

[00408] SEQ.ID NO: 31 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-14.

[00409] SEQ.ID NO: 32 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-14.

[00410] SEQ.ID NO: 33 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-14.

[00411] SEQ.ID NO: 34 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-15.

[00412] SEQ.ID NO: 35 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-15.

[00413] SEQ.ID NO: 36 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-15.

[00414] SEQ.ID NO: 37 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-16.

[00415] SEQ.ID NO: 38 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-16.

[00416] SEQ.ID NO: 39 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-17.

[00417] SEQ.ID NO: 40 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-17. [00418] SEQ.ID NO: 41 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-17.

[00419] SEQ.ID NO: 42 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-18.

[00420] SEQ.ID NO: 43 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-18.

[00421] SEQ.ID NO: 44 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-18.

[00422] SEQ.ID NO: 45 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-19.

[00423] SEQ.ID NO: 46 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-19.

[00424] SEQ.ID NO: 47 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-19.

[00425] SEQ.ID NO: 48 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-20.

[00426] SEQ.ID NO: 49 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-20.

[00427] SEQ.ID NO: 50 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-20.

[00428] SEQ.ID NO: 51 sets forth a deduced amino acid sequence of alkaloid biosynthesis facilitating protein PR10-21.

[00429] SEQ.ID NO: 52 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-21.

[00430] SEQ.ID NO: 53 sets forth a nucleic acid sequence encoding alkaloid biosynthesis facilitating protein PR10-21.

[00431] SEQ.ID NO: 54 sets forth a nucleic acid sequence encoding a 60MT polypeptide.

[00432] SEQ.ID NO: 55 sets forth a deduced amino acid sequence of a 60MT polypeptide.

[00433] SEQ.ID NO: 56 sets forth a nucleic acid sequence encoding a CNMT polypeptide. [00434] SEQ.ID NO: 57 sets forth a deduced amino acid sequence of a CNMT polypeptide.

[00435] SEQ.ID NO: 58 sets forth a nucleic acid sequence encoding an NMCH polypeptide.

[00436] SEQ.ID NO: 59 sets forth a deduced amino acid sequence of an NMCH polypeptide.

[00437] SEQ.ID NO: 60 sets forth a nucleic acid sequence encoding a 4ΌMT polypeptide.

[00438] SEQ.ID NO: 61 sets forth a deduced amino acid sequence of a 4ΌMT polypeptide.

[00439] SEQ.ID NO: 62 sets forth a nucleic acid sequence encoding a REPI polypeptide.

[00440] SEQ.ID NO: 63 sets forth a deduced amino acid sequence of a REPI polypeptide.

[00441] SEQ.ID NO: 64 sets forth a nucleic acid sequence encoding a SalSyn polypeptide.

[00442] SEQ.ID NO: 65 sets forth a deduced amino acid sequence of a SalSyn polypeptide.

[00443] SEQ.ID NO: 66 sets forth a nucleic acid sequence encoding a SalR polypeptide.

[00444] SEQ.ID NO: 67 sets forth a deduced amino acid sequence of a SalR polypeptide.

[00445] SEQ.ID NO: 68 sets forth a nucleic acid sequence encoding a NISO polypeptide.

[00446] SEQ.ID NO: 69 sets forth a deduced amino acid sequence of a NISO polypeptide.

[00447] SEQ.ID NO: 70 sets forth a nucleic acid sequence encoding a COR polypeptide.

[00448] SEQ.ID NO: 71 sets forth a deduced amino acid sequence of a COR polypeptide.

[00449] SEQ.ID NO: 72 sets forth a nucleic acid sequence encoding a CODM polypeptide. [00450] SEQ.ID NO: 73 sets forth a deduced amino acid sequence of a CODM polypeptide.

[00451] SEQ.ID NO: 74 sets forth a nucleic acid sequence encoding a TYR polypeptide.

[00452] SEQ.ID NO: 75 sets forth a deduced amino acid sequence of a TYR polypeptide.

[00453] SEQ.ID NO: 76 sets forth a nucleic acid sequence encoding a TYDC polypeptide.

[00454] SEQ.ID NO: 77 sets forth a deduced amino acid sequence of a TYDC polypeptide.

[00455] SEQ.ID NO: 78 sets forth a nucleic acid sequence encoding a DODC polypeptide.

[00456] SEQ.ID NO: 79 sets forth a deduced amino acid sequence of a DODC polypeptide.

[00457] SEQ.ID NO: 80 sets forth a nucleic acid sequence encoding a MAO polypeptide.

[00458] SEQ.ID NO: 81 sets forth a deduced amino acid sequence of a MAO polypeptide.

[00459] SEQ.ID NO: 82 sets forth a nucleic acid sequence encoding an NCS polypeptide.

[00460] SEQ.ID NO: 83 sets forth a deduced amino acid sequence of an NCS polypeptide.

[00461] SEQ.ID NO: 84 sets forth a nucleic acid sequence encoding a T60DM polypeptide.

[00462] SEQ.ID NO: 85 sets forth a deduced amino acid sequence of a T60DM polypeptide.

[00463] SEQ.ID NO: 86 sets forth a nucleic acid sequence encoding a CPR polypeptide.

[00464] SEQ.ID NO: 87 sets forth a deduced amino acid sequence of a CPR polypeptide.

[00465] SEQ.ID NO: 88 sets forth a nucleic acid sequence encoding a CPR polypeptide. [00466] SEQ.ID NO: 89 sets forth a deduced amino acid sequence of a CPR polypeptide.

[00467] SEQ.ID NO: 90 sets forth a nucleic acid sequence encoding a TS polypeptide.

[00468] SEQ.ID NO: 91 sets forth a deduced amino acid sequence of a TS polypeptide.

[00469] SEQ.ID NO: 92 sets forth a nucleic acid sequence encoding a TS polypeptide.

[00470] SEQ.ID NO: 93 sets forth a deduced amino acid sequence of a TS polypeptide.

[00471] SEQ.ID NO: 94 sets forth a nucleic acid sequence encoding a SalAT polypeptide.

[00472] SEQ.ID NO: 95 sets forth a deduced amino acid sequence of a SalAT polypeptide.

[00473] SEQ.ID NO: 96 sets forth a nucleic acid sequence representing a VIGS fragment of PR10-3 (as shown in Table 1]

[00474] SEQ.ID NO: 97 sets forth an artificial nucleic acid sequence representing a VIGS fragment of PR10-4 (as shown in Table 1]

[00475] SEQ.ID NO: 98 sets forth an artificial nucleic acid sequence representing a VIGS fragment of PR10-5 (as shown in Table 1]

[00476] SEQ.ID NO: 99 sets forth an artificial nucleic acid sequence representing an MSC1 vector primer (as shown in Table 1]

[00477] SEQ.ID NO: 100 sets forth an artificial nucleic acid sequence representing an MSC2 vector primer (as shown in Table 1]

[00478] SEQ.ID NO: 101 sets forth an artificial nucleic acid sequence representing an PR10-3 forward primer.

[00479] SEQ.ID NO: 102 sets forth an artificial nucleic acid sequence representing an PR10-3 reverse primer.

[00480] SEQ.ID NO: 103 sets forth an artificial nucleic acid sequence representing an PR10-4 forward primer.

[00481] SEQ.ID NO: 104 sets forth an artificial nucleic acid sequence representing an PR10-4 reverse primer. [00482] SEQ.ID NO: 105 sets forth an artificial nucleic acid sequence representing a PR10-5 forward primer.

[00483] SEQ.ID NO: 106 sets forth an artificial nucleic acid sequence representing an PR10-5 reverse primer.

[00484] SEQ.ID NO: 107 sets forth a nucleic acid sequence encoding BUP.

[00485] SEQ.ID NO: 108 sets forth a BUP polypeptide sequence.

[00486] SEQ.ID NO: 109 sets for a partial polypeptide sequence of PR10-3.

[00487] SEQ.ID NO: 110 sets for a partial polypeptide sequence of PR10-8; PR10-9 and PR10-10.

[00488] SEQ.ID NO: 111 sets for a partial polypeptide sequence of PR10-5.

[00489] SEQ.ID NO: 112 sets for a partial polypeptide sequence of PR10-4.

[00490] SEQ.ID NO: 113 sets for a partial polypeptide sequence of PR10-11.

[00491] SEQ.ID NO: 114 sets for a partial polypeptide sequence of PR10-12.

[00492] SEQ.ID NO: 115 sets for a partial polypeptide sequence ofPR10-21.

[00493] SEQ.ID NO: 116 sets for a partial polypeptide sequence of PR10-17.

[00494] SEQ.ID NO: 117 sets for a partial polypeptide sequence of PR10-19.

[00495] SEQ.ID NO: 118 sets for a partial polypeptide sequence of PR10-29.

[00496] SEQ.ID NO: 119 sets for a partial polypeptide sequence of PR10-15.

[00497] SEQ.ID NO: 120 sets for a partial polypeptide sequence of PR10-14.

[00498] SEQ.ID NO: 121 sets for a partial polypeptide sequence ofPR10-16.

[00499] SEQ.ID NO: 122 sets for a partial polypeptide sequence of PR10-3.

[00500] SEQ.ID NO: 123 sets for a partial polypeptide sequence of PR10-8.

[00501] SEQ.ID NO: 124 sets for a partial polypeptide sequence of PR10-9.

[00502] SEQ.ID NO: 125 sets for a partial polypeptide sequence of PR10-10.

[00503] SEQ.ID NO: 126 sets for a partial polypeptide sequence of PR10-5.

[00504] SEQ.ID NO: 127 sets for a partial polypeptide sequence of PR10-4.

[00505] SEQ.ID NO: 128 sets for a partial polypeptide sequence of PR10-11.

[00506] SEQ.ID NO: 129 sets for a partial polypeptide sequence of PR10-12.

[00507] SEQ.ID NO: 130 sets for a partial polypeptide sequence ofPR10-21.

[00508] SEQ.ID NO: 131 sets for a partial polypeptide sequence of PR10-17.

[00509] SEQ.ID NO: 132 sets for a partial polypeptide sequence of PR10-18.

[00510] SEQ.ID NO: 133 sets for a partial polypeptide sequence of PR10-19.

[00511] SEQ.ID NO: 134 sets for a partial polypeptide sequence of PR10-20. [00512] SEQ.ID NO: 135 sets for a partial polypeptide sequence of PR10-15.

[00513] SEQ.ID NO: 136 sets for a partial polypeptide sequence of PR10-14.

[00514] SEQ.ID NO: 137 sets for a partial polypeptide sequence of PR10-16.

[00515] SEQ.ID NO: 138 sets for a partial polypeptide sequence of PR10-3.

[00516] SEQ.ID NO: 139 sets for a partial polypeptide sequence of PR10-8.

[00517] SEQ.ID NO: 140 sets for a partial polypeptide sequence of PR10-9.

[00518] SEQ.ID NO: 141 sets for a partial polypeptide sequence of PR10-10.

[00519] SEQ.ID NO: 142 sets for a partial polypeptide sequence of PR10-5.

[00520] SEQ.ID NO: 143 sets for a partial polypeptide sequence of PR10-4.

[00521] SEQ.ID NO: 144 sets for a partial polypeptide sequence of PR10-11.

[00522] SEQ.ID NO: 145 sets for a partial polypeptide sequence of PR10-12.

[00523] SEQ.ID NO: 146 sets for a partial polypeptide sequence of PR10-21.

[00524] SEQ.ID NO: 147 sets for a partial polypeptide sequence of PR10-17.

[00525] SEQ.ID NO: 148 sets for a partial polypeptide sequence of PR10-18.

[00526] SEQ.ID NO: 149 sets for a partial polypeptide sequence of PR10-19.

[00527] SEQ.ID NO: 150 sets for a partial polypeptide sequence of PR10-20.

[00528] SEQ.ID NO: 151 sets for a partial polypeptide sequence of PR10-15.

[00529] SEQ.ID NO: 152 sets for a partial polypeptide sequence of PR10-14.

[00530] SEQ.ID NO: 153 sets for a partial polypeptide sequence of PR10-16.

[00531] SEQ.ID NO: 154 sets forth a nucleic acid sequence encoding a TS polypeptide.

[00532] SEQ.ID NO: 155 sets forth a deduced amino acid sequence of a TS polypeptide.

[00533] SEQ.ID NO: 156 sets forth a nucleic acid sequence encoding a TS polypeptide.

[00534] SEQ.ID NO: 157 sets forth a deduced amino acid sequence of a TS polypeptide.

[00535] SEQ.ID NO: 158 sets for a nucleic acid sequence encoding a BUP protein (yeast codon optimized]

[00536] SEQ.ID NO: 159 sets for a nucleic acid sequence encoding a thebaine synthase protein (yeast codon optimized]

[00537] SEQ.ID NO: 160 sets for a nucleic acid sequence encoding PR10-16 (yeast codon optimized]. [00538] SEQ.ID NO: 161 sets for a nucleic acid sequence encoding a PR10-3 protein (yeast codon optimized]

[00539] SEQ.ID NO: 162 sets for a nucleic acid sequence encoding a PR10-4 protein (yeast codon optimized]

[00540] SEQ.ID NO: 163 sets for a nucleic acid sequence encoding a PR10-5 protein (yeast codon optimized]

[00541] SEQ.ID NO: 164 sets for a nucleic acid sequence encoding a PR10-8 protein (yeast codon optimized]

[00542] SEQ.ID NO: 165 sets for a nucleic acid sequence encoding a PR10-9 protein (yeast codon optimized] .

[00543] SEQ.ID NO: 166 sets for a nucleic acid sequence encoding a PR10-10 protein (yeast codon optimized]

[00544] SEQ.ID NO: 167 sets for a nucleic acid sequence encoding a PR10-11 protein (yeast codon optimized]

[00545] SEQ.ID NO: 168 sets for a nucleic acid sequence encoding a PR10-12 protein (yeast codon optimized]

[00546] SEQ.ID NO: 169 sets for a nucleic acid sequence encoding a PR10-14 protein (yeast codon optimized]

[00547] SEQ.ID NO: 170 sets for a nucleic acid sequence encoding a PR10-15 protein (yeast codon optimized]

[00548] SEQ.ID NO: 171 sets for a nucleic acid sequence encoding a PR10-17 protein (yeast codon optimized]

[00549] SEQ.ID NO: 172 sets for a nucleic acid sequence encoding a PR10-18 protein (yeast codon optimized]

[00550] SEQ.ID NO: 173 sets for a nucleic acid sequence encoding a PR10-19 protein (yeast codon optimized]

[00551] SEQ.ID NO: 174 sets for a nucleic acid sequence encoding a PR10-20 protein (yeast codon optimized]

[00552] SEQ.ID NO: 175 sets for a nucleic acid sequence encoding a PR10-21 protein (yeast codon optimized]

[00553] Hereinafter are provided examples of specific implementations for performing the methods of the present disclosure, as well as implementations representing the compositions of the present disclosure. The examples are provided for illustrative purposes only and are not intended to limit the scope of the present disclosure in any way.

EXAMPLES

Example 1 - Modulation of expression of alkaloid biosynthesis facilitating proteins

[00554] Virus-induced gene silencing (VIGS). Unique regions in PR10-3 , PR10-4 and PR10-5 (Table 1] were selected as targets for gene suppression using VIGS and inserted into the pTRV2 vector resulting in the pTRV2-PR10-3, pTRV2-PR10-4, and pTRV2-PR10-5 constructs. The pTRV2 and the three pTRV2-PR10 vectors were independently mobilized in Agrobacterium tumefaciens GV3101, and the strains were subsequently cultured and infiltrated into opium poppy seedlings. Latex and stem samples were collected from ~30 young plants approximately 6 weeks after seed germination and 4 weeks after infiltration. To confirm successful infection, RT- PCR was performed using the TRV2-MCS (multiple-cloning site] primer pair (SEQ.ID NO: 103; SEQ.ID NO: 104] (Table 1] on RNA isolated from each plant to detect the presence of a mobilized fragment of the VIGS construct. Alkaloids were extracted in acetonitrile from lyophilized latex and analyzed by LC-MS/MS. The relative transcript abundance of PR10-3, PR10-4, and PR10-5 transcripts was determined (FIG. 9A-9C] by qRT-PCR using gene-specific ((PR10-3: SEQ.ID NO: 101; SEQ.ID N0: 102; PR10-4: SEQ.ID NO: 103; SEQ.ID N0:104; and PR10-5: SEQ.ID NO: 105; SEQ.ID NO: 106]; (Table 1]].

[00555] RNA extraction, cDNA synthesis and RT-qPCR. Total RNA was extracted using cetyl trimethyl ammonium bromide (CTAB] from frozen opium poppy tissue samples finely ground using a TissueLyser (Qiagen] cDNA synthesis was performed in a 10-m1 reaction containing approximately 1 pg of total RNA using All-in-One RT mastermix (ABM] according to the manufacturer's instructions. SYBR-green qRT- PCR was used to quantify gene transcript levels. The 10-pL reactions contained IX PowerUp SYBR Green master mix (Applied biosystems], 500 nM of each primer, and 2 pL of a 20-fold diluted cDNA sample. A thermal profile of 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 1 sec, and 60°C for 30 sec (with a dissociation curve at the end] was used to perform qRT-PCR on a QuantiStudio Real-Time PCR System 3 (Applied Biosystems]. Gene-specific primers were used for all qRT-PCR experiments ((PR10-3: SEQ.ID NO: 101; SEQ.ID N0:102; PR10-4: SEQ.ID NO: 103; SEQ.ID N0:104; and PR10-5: SEQ.ID NO: 105; SEQ.ID N0:106]; (Table 1]]. All primer pairs used in qRT-PCR were tested using amplicon dissociation curve analysis (95°C for 15 sec at a ramp rate of 1.6°C/sec, 60°C for 1 min at a ramp rate of 1.6°C/sec, and 95°C for 15 sec at a ramp rate of 0.15°C/sec] to confirm the amplification stringency.

[00556] Liquid chromatography-tandem mass spectrometry (LC-MS/MS). Samples were analyzed using a 6410 Triple Quadrupole LC-MS (Agilent Technologies] to identify and quantify assay reaction products and plant extracted alkaloids. Liquid chromatographic separation was achieved using a Poroshell 120 SB-C18 HPLC column (Agilent Technologies] with a flow rate of 0.6 mL/min and a gradient of solvent A [10 mm ammonium acetate, pH 5.5, 5% (v/v] acetonitrile] and solvent B (100% acetonitrile] as follows: 0-60% solvent B from 0 to 8 min, 60-99% solvent B from 8 to 10 min, isocratic 99% solvent B from 10 to 11 min, 99-0% solvent B from 11 to 11.1 min, 0% solvent B from 11.1 to 14.1 min. Full scan (FS] mass analyses ( m/z range 200-700] and collisional MS/MS experiments were performed. Full scan data was used to generate extracted ion chromatographs (EICs] for m/z of interest. Retention times (Rt] and collision-induced dissociation (CID] spectra of authentic standards were used to empirically assign alkaloid identities, and standard curves of authentic standards were used for alkaloid quantification (Table 2]

[00557] The data show that a reduction in the relative abundance of PR10-3, PR10-4 or PR10-5 transcripts (FIG. 9A-9C, respectively] significantly alters the accumulation of major alkaloids in opium poppy plants (Table 2]

Example 2 - Modulation of reticuline levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a henzylisoquinoline biosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines

[00558] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00559] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based reticuline production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including reticuline - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are not provided exogenous substrate, but instead rely on de novo, endogenous carbon sources, including endogenously available tyrosine, for alkaloid production. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR- Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine 0- demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0- acetyltransferase (PsoSalAT] and Papaver somniferum (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of reticuline or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00560] Construction of plasmids hosting genes encoding alkaloid hiosynthesis facilitating proteins.

[00561] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based reticuline production from de novo , endogenous metabolic sources, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon- optimized (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168;

PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171;

PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175] for Saccharomyces cerevisiae, synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10- 12 (SEQ.ID NO: 28], PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00562] Culturing and analytical validation of alkaloid-producing veast strains.

[00563] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of reticuline in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC]- coupled, high-resolution mass spectrometry (MS] analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016] [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each] collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X- Calibur v. 3.1 was employed for automated peak identification and quantification.

[00564] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing veast strains.

[00565] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of reticuline and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources. As an illustrative embodiment, plasmids constructed as described above, were used to transform a ‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV) devoid of gene(s) encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1) negative control cultures (i.e. alkaloid- producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein) versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2) alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00566] The results are shown in FIG. 11, notably the levels of reticuline produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV) is used as control. Example 3 - Modulation of salutaridine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis enzvme complement for the de novo synthesis of benzylisoquinolines

[00567] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00568] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based salutaridine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including salutaridine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are not provided exogenous substrate, but instead rely on de novo, endogenous carbon sources, including endogenously available tyrosine, for alkaloid production. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR- Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine 0- demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-O-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0- acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0- methyltransferase (Pso60MT] and Papaver somniferum coclaurine N- methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4 '-0- methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of salutaridine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00569] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins.

[00570] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based salutaridine production from de novo, endogenous metabolic sources, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon- optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10- 12 (SEQ.ID NO: 28], PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00571] Culturing and analytical validation of alkaloid-producing yeast strains.

[00572] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of salutaridine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC]- coupled, high-resolution mass spectrometry (MS] analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016] [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each] collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals] were used to identify intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X- Calibur v. 3.1 was employed for automated peak identification and quantification.

[00573] Expression and evaluation of genes encoding alkaloid hiosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00574] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of salutaridine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources. As an illustrative embodiment, plasmids constructed as described above, were used to transform a ‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid- producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00575] The results are shown in FIG. 12, notably the levels of salutaridine produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 4 - Modulation of thebaine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines

[00576] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00577] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based thebaine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including thebaine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are not provided exogenous substrate, but instead rely on de novo, endogenous carbon sources, including endogenously available tyrosine, for alkaloid production. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR- Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine 0- demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0- acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0- methyltransferase (Pso60MT] and Papaver somniferum coclaurine N- methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4 '-0- methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of thebaine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00578] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins.

[00579] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based thebaine production from de novo, endogenous metabolic sources, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon- optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10- 12 (SEQ.ID NO: 28], PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00580] Culturing and analytical validation of alkaloid-producing yeast strains.

[00581] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of thebaine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X- Calibur v. 3.1 was employed for automated peak identification and quantification.

[00582] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00583] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of thebaine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources. As an illustrative embodiment, plasmids constructed as described above, were used to transform a ‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid- producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00584] The results are shown in FIG. 13, notably the levels of thebaine produced.in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00585] Example 5 - Modulation of reticuline levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis enzvme complement for the de novo synthesis of benzylisoquinolines and provided with L-DOPA as a substrate

[00586] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00587] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based reticuline production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including reticuline - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed L-DOPA as a feedstock substrate to supplement alkaloid production. Construction of this ‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102- 5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’- hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of reticuline or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00588] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins.

[00589] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based reticuline production from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid- producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10- 5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10

(SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28], PR10-14

(SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17

(SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20

(SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51] [00590] Culturing and analytical validation of alkaloid-producing veast strains.

[00591] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of reticuline in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific). The overnight culture was then diluted with 500 ml YPD medium containing 1 mM L- DOPA for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00592] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00593] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of reticuline and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9- engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation with L-DOPA feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00594] The results are shown in FIG. 14, notably the levels of reticuline produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 6 - Modulation of salutaridine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines and provided with L-DOPA as a substrate [00595] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00596] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based salutaridine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including salutaridine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed L-DOPA as a feedstock substrate to supplement alkaloid production. Construction of this ‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102- 5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’- hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of salutaridine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00597] Construction of plasmids hosting genes encoding alkaloid hiosynthesis facilitating proteins.

[00598] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based salutaridine production from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid- producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10- 5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10

(SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28], PR10-14

(SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17

(SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20

(SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00599] Culturing and analytical validation of alkaloid-producing yeast strains.

[00600] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of salutaridine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 1 mM L- DOPA for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC]- coupled, high-resolution mass spectrometry (MS] analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016] [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00601] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing veast strains.

[00602] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of salutaridine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9- engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV) devoid of gene(s) encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation with L-DOPA feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1) negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein) versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00603] The results are shown in FIG. 15, notably the levels of salutaridine produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00604] Example 7 - Modulation of thebaine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis enzvme complement for the de novo synthesis of benzylisoquinolines and provided with L-DOPA as a substrate

[00605] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00606] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based thebaine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including thebaine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed L-DOPA as a feedstock substrate to supplement alkaloid production. Construction of this ‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102- 5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’- hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of thebaine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00607] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins.

[00608] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based thebaine production from de novo, endogenous metabolic sources supplemented with L-DOPA feedstock, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid- producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10- 5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10

(SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28], PR10-14

(SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17

(SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20

(SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00609] Culturing and analytical validation of alkaloid-producing yeast strains.

[00610] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of thebaine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 1 mM L- DOPA for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00611] Expression and evaluation of genes encoding alkaloid hiosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00612] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of thebaine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9- engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation with L-DOPA feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00613] The results are shown in FIG. 16, notably the levels of thebaine produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 8 - Modulation of salutaridine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a henzylisoquinoline hiosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines and provided with fSl-reticuline as a substrate

[00614] Engineering of alkaloid-producing host cells for transformation of alkaloid hiosynthesis facilitating proteins.

[00615] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based salutaridine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including salutaridine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed (S]-reticuline as a feedstock substrate to supplement alkaloid production. Construction of this ‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102- 5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’- hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of salutaridine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00616] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins.

[00617] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based salutaridine production from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS- based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10- 5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28], PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51].

[00618] Culturing and analytical validation of alkaloid-producing veast strains.

[00619] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of salutaridine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96- well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 200 mM (S]-reticuline for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC]- coupled, high-resolution mass spectrometry (MS] analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016] [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each] collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals] were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00620] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00621] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of salutaridine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation with (S]-reticuline feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00622] The results are shown in FIG. 17, notably the levels of salutaridine produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00623] Example 9 - Modulation of thebaine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines and provided with fSl-reticuline as a substrate

[00624] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00625] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based thebaine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including thebaine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed (S]-reticuline as a feedstock substrate to supplement alkaloid production. Construction of this ‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102- 5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-O-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’- hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of thebaine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00626] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins.

[00627] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based thebaine production from de novo, endogenous metabolic sources supplemented with (S] -reticuline feedstock, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, as one embodiment, we chose the plasmid pEV2-C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS- based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10- 5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10

(SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28], PR10-14

(SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17

(SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20

(SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00628] Culturing and analytical validation of alkaloid-producing veast strains.

[00629] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of thebaine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96- well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 200 mM (S]-reticuline for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC]- coupled, high-resolution mass spectrometry (MS] analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016] [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each] collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals] were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00630] Expression and evaluation of genes encoding alkaloid hiosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00631] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of thebaine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation with (S]-reticuline feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00632] The results are shown in FIG. 18, notably the levels of thebaine produced.in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00633] Example 10 - Modulation of N-methylcoclaurine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and comprising a benzylisoquinoline biosynthesis complement for the de

novo synthesis of benzylisoquinolines and provided with L-DOPA as a suhstrate

[00634] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00635] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based /V-methylcoclaurine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including /V-methylcoclaurine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed L-DOPA as a feedstock substrate to supplement alkaloid production. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker- containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V- methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of N- methylcoclaurine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co expression of marker-containing plasmids hosting alkaloid biosynthesis facilitating proteins.

[00636] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins. [00637] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based /V-methylcoclaurine production from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock, plasmids hosting genes encoding these proteins were designed. The availability of marker- free, alkaloid-producing, engineered yeast enabled the use of such marker- containing plasmids. For example, as one embodiment, we chose the plasmid pEV2- C for episomal gene expression. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. As one embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12,

SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17,

SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20,

SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10- 12 (SEQ.ID NO: 28], PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00638] Culturing and analytical validation of alkaloid-producing veast strains.

[00639] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of /V-methylcoclaurine in addition to other alkaloid intermediates and products, from de novo, endogenous metabolic sources supplemented with L-DOPA feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96- well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 1 mM L-DOPA for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC]- coupled, high-resolution mass spectrometry (MS] analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016] [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each] collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals] were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00640] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00641] Plasmids containing genes encoding alkaloid biosynthesis facilitating proteins were transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of /V-methylcoclaurine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9- engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following plasmid transformation, four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. LC-MS-based analysis of yeast cultures post-incubation with L-DOPA feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins.

[00642] The results are shown in FIG. 19, notably the levels of N-methyl coclaurine produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10-9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10- 17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 11 - Modulation of salutaridine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and benzylisoquinoline uptake protein (BUP) and comprising a henzylisoquinoline biosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines and provided with (S)-reticuline as a substrate

[00643] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00644] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based salutaridine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including salutaridine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed (S]-reticuline as a feedstock substrate to supplement alkaloid production. As some embodiments of this invention include the use of an alkaloid transporter in the engineered yeast to further illustrate the impact of alkaloid biosynthesis facilitating proteins on yields, this example entails the expression of BUP, a purine uptake permease-type alkaloid importer, in the‘complete’ yeast strain through the inclusion of an additional plasmid (see next section]. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11: 1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker- containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V- methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of salutaridine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker- containing plasmids hosting (1] alkaloid biosynthesis facilitating proteins, and (2] BUP.

[00645] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins and .

[00646] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based salutaridine production from de novo , endogenous metabolic sources supplemented with (S] -reticuline feedstock, in the presence of alkaloid importer BUP, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, in this embodiment, we chose the plasmid pEV2-C for episomal gene expression of alkaloid biosynthesis facilitating proteins. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. In this embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. In addition to pEV2-C which contained alkaloid biosynthesis facilitating proteins, we designed another plasmid, termed pEV2-CP, which could host a gene encoding Papaver somniferum BUP. This pEV2-CP plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes; and (2] a URA- based auxotrophic selection marker. In this embodiment, a gene encoding BUP was codon-optimized for Saccharomyces cerevisiae (SEQ.ID NO: 158], synthesized, and cloned into pEV2-CP by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving empty the other multiple cloning site controlled by TDH3. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28],

PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37],

PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45],

PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51] A nucleic acid sequence encoding BUP (SEQ.ID NO: 108] was used.

[00647] Culturing and analytical validation of alkaloid-producing veast strains.

[00648] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of salutaridine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96- well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 200 mM (S]-reticuline for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00649] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00650] Plasmids containing (1) genes encoding alkaloid biosynthesis facilitating proteins (pEV2-C series), and (2) BUP (pEV2-CP) were successively transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of salutaridine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with (S)- reticuline feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following two successive plasmid transformations for (1] alkaloid biosynthesis facilitating proteins (pEV2-C series] and (2] BUP(pEV2- CP], four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. However, these negative control strains nonetheless contained pEV-2CP with BUP. LC-MS-based analysis of yeast cultures post-incubation with (S]-reticuline feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins. In all experiments, cultures concomitantly harboured plasmid encoding BUP (pEV2-CP]

[00651] The results are shown in FIG. 20, notably the levels of salutaridine produced in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

[00652] Example 12 - Modulation of thebaine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and benzylisoquinoline uptake protein (BUP) and comprising a henzylisoquinoline hiosynthesis enzyme complement for the de novo synthesis of benzylisoquinolines and provided with (S)-reticuline as a substrate

[00653] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00654] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based thebaine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including thebaine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed (S]-reticuline as a feedstock substrate to supplement alkaloid production. As some embodiments of this invention include the use of an alkaloid transporter in the engineered yeast to further illustrate the impact of alkaloid biosynthesis facilitating proteins on yields, this example entails the expression of BUP, a purine uptake permease-type alkaloid importer, in the‘complete’ yeast strain through the inclusion of an additional plasmid (see next section]. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11: 1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker- containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V- methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of thebaine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker- containing plasmids hosting (1] alkaloid biosynthesis facilitating proteins, and (2] BUP.

[00655] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins and BUP.

In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based thebaine production from de novo , endogenous metabolic sources supplemented with (S] -reticuline feedstock, in the presence of alkaloid importer BUP, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, in this embodiment, we chose the plasmid pEV2-C for episomal gene expression of alkaloid biosynthesis facilitating proteins. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. In this embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. In addition to pEV2-C which contained alkaloid biosynthesis facilitating proteins, we designed another plasmid, termed pEV2-CP, which could host a gene encoding Papaver somniferum BUP protein. This pEV2-CP plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes; and (2] a URA-based auxotrophic selection marker. In this embodiment, a gene encoding BUP was codon-optimized for Saccharomyces cerevisiae (SEQ.ID NO: 158], synthesized, and cloned into pEV2-CP by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving empty the other multiple cloning sites controlled by TDH3. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10- 11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28], PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37], PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45], PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51] A nucleic acid sequence encoding BUP (SEQ.ID NO: 108] was used.

[00656] Culturing and analytical validation of alkaloid-producing veast strains.

[00657] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of thebaine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with (S]-reticuline feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96- well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 200 mM (S]-reticuline for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00658] Expression and evaluation of genes encoding alkaloid hiosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00659] Plasmids containing (1) genes encoding alkaloid biosynthesis facilitating proteins (pEV2-C series), and (2) BUP (pEV2-CP) were successively transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of thebaine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with (S)- reticuline feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following two successive plasmid transformations for (1] alkaloid biosynthesis facilitating proteins (pEV2-C series] and (2] BUP (pEV2- CP], four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. However, these negative control strains nonetheless contained pEV-2CP with BUP. LC-MS-based analysis of yeast cultures post-incubation with (S]-reticuline feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins. In all experiments, cultures concomitantly harboured plasmid encoding BUP (pEV2-CP]

[00660] The results are shown in FIG. 21, notably the levels of thebaine produced.in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 13 - Modulation of thebaine levels in host cells transformed with alkaloid biosynthesis facilitating proteins and an additional thebaine synthase gene and comprising a benzylisoquinoline biosynthesis enzyme complement for the de novo synthesis of henzylisoquinolines and provided with L-DOPA as a substrate

[00661] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00662] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based thebaine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including thebaine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed L-DOPA as a feedstock substrate to supplement alkaloid production. As some embodiments of this invention include the use of an additional thebaine synthase (THS] gene in the engineered yeast to further illustrate the impact of alkaloid biosynthesis facilitating proteins on yields, this example entails the expression of THS in the‘complete’ yeast strain through the inclusion of an additional plasmid (see next section]. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102-5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR-Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker- containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine O-demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0-acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0-methyltransferase (Pso60MT] and Papaver somniferum coclaurine /V-methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V- methylcoclaurine 4’-0-methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of thebaine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker- containing plasmids hosting (1] alkaloid biosynthesis facilitating proteins, and (2] THS.

[00663] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins and THS.

[00664] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based thebaine production from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock, in the presence of thebaine synthase (THS], plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, in this embodiment, we chose the plasmid pEV2-C for episomal gene expression of alkaloid biosynthesis facilitating proteins. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. In this embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9,

SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12,

SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17,

SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. In addition to pEV2-C which contained alkaloid biosynthesis facilitating proteins, we designed another plasmid, termed pEV2-CT, which could host a gene encoding Papaver somniferum THS. This pEV2-CT plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes; and (2] a URA- based auxotrophic selection marker. In this embodiment, a gene encoding THS was codon-optimized for Saccharomyces cerevisiae (SEQ.ID NO: 159], synthesized, and cloned into pEV2-CT by GenScript USA (www.genscript.com] under control of the TDH3 promoter, leaving empty the other multiple cloning site controlled by PGK1. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19],

PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28],

PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37],

PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45],

PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51]

[00665] Culturing and analytical validation of alkaloid-producing yeast strains.

[00666] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of thebaine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with L-D0PA feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 1 mM L- DOPA for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00667] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00668] Plasmids containing (1) genes encoding alkaloid biosynthesis facilitating proteins (pEV2-C series), and (2) THS (pEV2-CT) were successively transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of thebaine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following two successive plasmid transformations for (1) alkaloid biosynthesis facilitating proteins (pEV2-C series] and (2] THS (pEV2-CT], four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. However, these negative control strains nonetheless contained pEV-2CT with THS. LC-MS-based analysis of yeast cultures post-incubation with L-DOPA feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins. In all experiments, cultures concomitantly harboured plasmid encoding THS (pEV2-CT]

[00669] The results are shown in FIG. 22, notably the levels of thebaine produced.in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 14 - Modulation of thebaine levels in host cells transformed with alkaloid biosynthesis facilitating proteins henzylisoquinoline uptake protein fBUPl and an additional thebaine svnthase gene and comprising a benzylisoquinoline biosynthesis enzvme complement for the de novo synthesis of benzylisoquinolines and provided with L-DOPA as a substrate

[00670] Engineering of alkaloid-producing host cells for transformation of alkaloid biosynthesis facilitating proteins.

[00671] For the purpose of testing potential impact of alkaloid biosynthesis facilitating proteins on yeast-based thebaine production, we engineered a strain of Saccharomyces cerevisiae using CRISPR-aided technologies to produce morphine and all pathway intermediates - including thebaine - de novo from endogenous tyrosine supply. In addition to using endogenous tyrosine to produce morphine and intermediate alkaloids, this strain was capable of using exogenous feeds of upstream precursors such as L-DOPA, dopamine, NLDS (norlaudanosoline], as well as other alkaloids to produce downstream products. Herein, we describe an illustrative embodiment in which yeast cells are exogenously fed L-DOPA as a feedstock substrate to supplement alkaloid production. As some embodiments of this invention include the use of an alkaloid transporter in the engineered yeast, as well as an additional copy of thebaine synthase (THS], to further illustrate the impact of alkaloid biosynthesis facilitating proteins on yields, this example entails the expression of both BUP and THS in the‘complete’ yeast strain through the inclusion of an additional plasmid (see next section]. Construction of this‘complete’ strain required genomic integration of eighteen alkaloid biosynthetic genes, which were introduced to the host genome of Saccharomyces cerevisiae strain CEN.PK102- 5B in pairs. Briefly, coding sequences for biosynthetic genes were codon-optimized and synthesized at GenScript USA (www.genscript.com], followed by subcloning to custom integration vectors using a genomic integrative system employing CRISPR- Cas9 technology and standard methods [Biotechnology J 11:1110, 2016; Cell Systems 1:88, 2015] After each successive transformation and successful genomic integration, cells were maintained without selection to enable the loss of the no longer necessary, marker-containing integration construct, thus permitting re-use of this marker for further transformations and integrations. Donor DNA cassettes each hosted two biosynthetic genes under control of a bi-directional, inducible promoter region comprised of strong constitutive promoters PGK1 and TDH3. Using successive integration events, the following gene pairs under control of a central PGK1 and TDH3 bi-directional promoter region were stably integrated into the genome of Saccharomyces cerevisiae strain CEN.PK102-5B: (1] Papaver somniferum codeinone reductase B (PsoCOR-B] and Papaver somniferum codeine 0- demethylase (PsoCODM]; (2] Papaver somniferum thebaine 6-0-demethylase (PsoT60DM] and Papaver somniferum neopinone isomerase (PsoNISO]; (3] Beta vulgaris tyrosine hydroxylase BvuTyrH and Pseudomonas putida L-DOPA decarboxylase (PpuDODC]; (4] Papaver somniferum salutaridinol 7-0- acetyltransferase (PsoSalAT] and Papaver somniferum thebaine synthase (PsoTHS]; (5] Petroselinum crispum aldehyde synthase (PcrALS] and Papaver somniferum norcoclaurine synthase (PsoNCS]; (6] Papaver somniferum norcoclaurine 6-0- methyltransferase (Pso60MT] and Papaver somniferum coclaurine N- methyltransferase (PsoCNMT]; (7] Papaver somniferum cytochrome P450 reductase (PsoCPR] and Papaver atlanticum /V-methylcoclaurine 3’-hydroxylase (PatlNMCH]; (8] Papaver somniferum 3’-hydroxyl-/V-methylcoclaurine 4 '-0- methyltransferase (Pso4’0MT] and Papaver somniferum reticuline epimerase (PsoREPI]; (9] Papaver somniferum salutaridine synthase (PsoSalSyn] and Papaver somniferum salutaridine reductase (PsoSalR] In other embodiments, alternative variants of these alkaloid biosynthetic enzymes could be used to create an alternative‘complete’ Saccharomyces cerevisiae strain to similarly test impact of alkaloid biosynthesis facilitating proteins on the yield of thebaine or other intermediates and/or products. Following successful genomic integration of these pathway genes, the resulting strain was cultured without the need for selection. The use of such marker-free strain enabled co-expression of marker-containing plasmids hosting (1] alkaloid biosynthesis facilitating proteins, and (2] both BUP and THS.

[00672] Construction of plasmids hosting genes encoding alkaloid biosynthesis facilitating proteins. BUP and THS.

[00673] In order to evaluate the capacity of alkaloid biosynthesis facilitating proteins to increase yeast-based thebaine production from de novo , endogenous metabolic sources supplemented with L-DOPA feedstock, in the presence of BUP and THS, plasmids hosting genes encoding these proteins were designed. The availability of marker-free, alkaloid-producing, engineered yeast enabled the use of such marker-containing plasmids. For example, in this embodiment, we chose the plasmid pEV2-C for episomal gene expression of alkaloid biosynthesis facilitating proteins. This plasmid contained (1] a bi-directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes encoding alkaloid biosynthesis facilitating proteins; and (2] a HIS-based auxotrophic selection marker. In this embodiment, genes encoding alkaloid biosynthesis facilitating proteins were codon-optimized for Saccharomyces cerevisiae (PR10-16, (SEQ.ID NO: 160; PR10-3, SEQ.ID NO: 161; PR10-4, SEQ.ID NO: 162; PR10-5, SEQ.ID NO: 163; PR10-8, SEQ.ID NO: 164; PR10-9, SEQ.ID NO: 165; PR10-10, SEQ.ID NO: 166; PR10-11, SEQ.ID NO: 167; PR10-12, SEQ.ID NO: 168; PR10-14, SEQ.ID NO: 169; PR10-15, SEQ.ID NO: 170; PR10-17, SEQ.ID NO: 171; PR10-18, SEQ.ID NO: 172; PR10-19, SEQ.ID NO: 173; PR10-20, SEQ.ID NO: 174 and PR10-21, SEQ.ID NO: 175], synthesized, and cloned into pEV2-C by GenScript USA (www.genscript.com] under control of the PGK1 promoter, leaving the other multiple cloning site controlled by TDH3 empty. In this embodiment, the impact of each protein on alkaloid biosynthesis could be determined individually. In addition to pEV2-Cwhich contained alkaloid biosynthesis facilitating proteins, we designed another plasmid, termed pEV2-CPT, which could host two genes encoding Papaver somniferum BUP and THS, respectively. This pEV2-CPT plasmid contained (1] a bi directional promoter region comprised of PGK1 and TDH3 promoters driving simultaneous expression of up to two genes; and (2] a URA-based auxotrophic selection marker. In this embodiment, a gene encoding BUP was codon-optimized for Saccharomyces cerevisiae (SEQ.ID NO: 158], synthesized, and cloned into pEV2- CPT by GenScript USA (www.genscript.com] under control of the PGK1 promoter. Similarly, a gene encoding Papaver somniferum THS was codon-optimized for Saccharomyces cerevisiae (SEQ.ID NO: 159], synthesized, and cloned into pEV2-CPT by GenScript USA (www.genscript.com] under control of the TDH3 promoter. Nucleic acid sequences encoding the following alkaloid biosynthesis facilitating proteins were incorporated in the plasmid: PR10-3 (SEQ.ID NO: 8], PR10-4 (SEQ.ID NO: 10], PR10-5 (SEQ.ID NO: 13], PR10-8 (SEQ.ID NO: 16], PR10-9 (SEQ.ID NO: 19], PR10-10 (SEQ.ID NO: 22], PR10-11 (SEQ.ID NO: 25], PR10-12 (SEQ.ID NO: 28],

PR10-14 (SEQ.ID NO: 31], PR10-15 (SEQ.ID NO: 34], PR10-16 (SEQ.ID NO: 37],

PR10-17 (SEQ.ID NO: 39], PR10-18 (SEQ.ID NO: 42], PR10-19 (SEQ.ID NO: 45],

PR10-20 (SEQ.ID NO: 48], and PR10-21 (SEQ.ID NO: 51] A nucleic acid sequence encoding thebaine synthase.

[00674] Culturing and analytical validation of alkaloid-producing veast strains.

[00675] Prior to transformation of the complete strain with plasmids encoding alkaloid biosynthesis facilitating proteins, the yeast was cultured and subjected to mass spectrometry analysis to establish a baseline level for the production of thebaine in addition to other alkaloid intermediates and products, from de novo , endogenous metabolic sources supplemented with L-D0PA feedstock. Yeast strain was inoculated in 500 ml YPD medium for overnight in a 96-well format, using a Fisherbrand Incubating Microplate Shaker (Fisher Scientific] The overnight culture was then diluted with 500 ml YPD medium containing 1 mM L- DOPA for bioconversion. Yeast cultures were grown for additional 24 h at 30°C. Yeast cells were removed by centrifugation and 5 pL of supernatant, containing alkaloid or other pathway intermediate or product secreted by the yeast cells into the culture medium, were subjected to liquid chromatography (LC)- coupled, high-resolution mass spectrometry (MS) analysis. Liquid chromatography was conducted as described [Methods Enzymol 575:143, 2016] for alkaloid analysis using a reverse-phase C18 column and a water/acetonitrile-based solvent gradient. Ionization and MS analysis were conducted in positive mode using a Thermo Scientific LTQ-Orbitrap-XL, with tuning conducted using thebaine analyte. Procedures for calibration, tuning, and operation are described by Morris et al. (2016) [Methods Enzymol 575:143, 2016] The operation method included three scan events in data-dependent, parallel detection mode. The first scan consisted of high-resolution FTMS from 50 to 500 m/z with ion injection time of 500 ms and scan time of approximately 1.5 s. The second and third scans (approximately 0.5 s each) collect CID spectra in the ion trap, where the parent ions represents the first- and second-most abundant alkaloid masses, respectively, as determined by fast Fourier transform preview using a parent ion mass list corresponding to exact masses of known alkaloid products, biosynthetic intermediates, and upstream precursors. Dynamic-exclusion and reject-ion-mass-list features were enabled. External and internal calibration procedures ensured < 2 ppm error. Exact mass, retention time, peak area and CID spectra of authentic standards (Toronto Research Chemicals) were used to identify feedstock, intermediates and products, and construct standard curves for quantitative purposes. The Quan Browser feature of Thermo X-Calibur v. 3.1 was employed for automated peak identification and quantification.

[00676] Expression and evaluation of genes encoding alkaloid biosynthesis facilitating proteins in alkaloid-producing yeast strains.

[00677] Plasmids containing (1) genes encoding alkaloid biosynthesis facilitating proteins (pEV2-C series), and (2) both BUP and THS (pEV2-CPT) were successively transformed to engineered, alkaloid-biosynthesizing yeast to evaluate potential impact on levels of thebaine and other alkaloid pathway intermediates and products, from de novo , endogenous metabolic sources supplemented with L- DOPA feedstock. As an illustrative embodiment, plasmids constructed as described above, were used to transform a‘complete,’ CRISPR-Cas9-engineered, marker-free yeast strain as described above. In this example, transformation and testing proceeded as follows: Following two successive plasmid transformations for (1] alkaloid biosynthesis facilitating proteins (pEV2-C series] and (2] both BUP and THS (pEV2-CPT], four individual colonies were selected per clone for yeast bioconversion assays. Each clone was cultured in the same way described above for routine alkaloid production. To enable reliable comparisons, negative control yeast strains harbouring 'empty vector’ plasmid (EV] devoid of gene(s] encoding alkaloid biosynthesis facilitating proteins were included in the experiment. However, these negative control strains nonetheless contained pEV-2CPT with both BUP and THS. LC-MS-based analysis of yeast cultures post-incubation with L-DOPA feedstock was conducted as described above. Quantitative and qualitative LC-MS results were analyzed to allow direct comparisons between (1] negative control cultures (i.e. alkaloid-producing yeast with 'empty vector,’ devoid of alkaloid biosynthesis facilitating protein] versus alkaloid-producing yeast expressing alkaloid biosynthesis facilitating protein; and (2] alkaloid-producing yeasts expressing different alkaloid biosynthesis facilitating proteins. In all experiments, cultures concomitantly harboured plasmid encoding BUP and THS (pEV2-CPT]

[00678] The results are shown in FIG. 23, notably the levels of thebaine produced.in yeast strains transformed with PR10-3, PR10-4, PR10-5, PR10-8, PR10- 9, PR10-10, PR10-11, PR10-12, PR10-14, PR10-15, PR10-16, PR10-17, PR10-18, PR10-19, PR10-20, PR10-21. An empty vector (EV] is used as control.

Example 15 - Modulation of expression of alkaloid biosynthesis facilitating proteins

[00679] Unique regions in PR10-18 and PR10-21 were selected as targets for gene suppression using VI GS and inserted into the pTRV2 vector resulting in the pTRV2-PR10-18 and pTRV2-PR10-21 constructs. The pTRV2 and the two pTRV2- PR10 vectors were independently mobilized in Agrobacterium tumefaciens GV3101, and the strains were subsequently cultured and infiltrated into opium poppy seedlings. Latex and stem samples were collected from ~30 young plants approximately 6 weeks after seed germination and 4 weeks after infiltration. To confirm successful infection, RT-PCR was performed using the TRV2-MCS (multiple cloning site] primer pair using RNA isolated from each plant to detect the presence of a mobilized fragment of the VIGS construct. Alkaloids were extracted in acetonitrile from lyophilized latex and analyzed by LC -MS/MS. The relative transcript abundance of PR10-18 and PR10-21 transcripts was determined by qRT- PCR using gene-specific primers. Total RNA was extracted using cetyl trimethyl ammonium bromide (CTAB] from frozen opium poppy tissue samples finely ground using a TissueLyser (Qiagen] cDNA synthesis was performed in a 10-m1 reaction containing approximately 1 pg of total RNA using All-in-One RT mastermix (ABM] according to the manufacturer's instructions. SYBR-green qRT-PCR was used to quantify gene transcript levels. The 10-pL reactions contained IX PowerUp SYBR Green master mix (Applied biosystems], 500 nM of each primer, and 2 pL of a 20- fold diluted cDNA sample. A thermal profile of 50°C for 2 min, 95°C for 2 min, 40 cycles of 95°C for 1 sec, and 60°C for 30 sec (with a dissociation curve at the end] was used to perform qRT-PCR on a QuantiStudio Real-Time PCR System 3 (Applied Biosystems]. Gene-specific primers were used for all qRT-PCR experiments. All primer pairs used in qRT-PCR were tested using amplicon dissociation curve analysis (95°C for 15 sec at a ramp rate of 1.6°C/sec, 60°C for 1 min at a ramp rate of 1.6°C/sec, and 95°C for 15 sec at a ramp rate of 0.15°C/sec] to confirm the amplification stringency. Samples were analyzed using a 6410 Triple Quadrupole LC-MS (Agilent Technologies] to identify and quantify assay reaction products and plant extracted alkaloids. Liquid chromatographic separation was achieved using a Poroshell 120 SB-C18 HPLC column (Agilent Technologies] with a flow rate of 0.6 mL/min and a gradient of solvent A [10 mm ammonium acetate, pH 5.5, 5% (v/v] acetonitrile] and solvent B (100% acetonitrile] as follows: 0-60% solvent B from 0 to 8 min, 60-99% solvent B from 8 to 10 min, isocratic 99% solvent B from 10 to 11 min, 99-0% solvent B from 11 to 11.1 min, 0% solvent B from 11.1 to 14.1 min. Full scan (FS] mass analyses {m/z range 200-700] and collisional MS/MS experiments were performed. Full scan data was used to generate extracted ion chromatographs (EICs] for m/z of interest. Retention times (Rt] and collision- induced dissociation (CID] spectra of authentic standards were used to empirically assign alkaloid identities, and standard curves of authentic standards were used for alkaloid quantification.

[00680] The results are shown in FIG. 24, notably relative levels of PR10-18, and PR10-21 transcripts in opium poppy plants subjected to virus induced gene silencing (VIGS], using pTRV2 as empty vector control and pTRV2-PR10-18/PR10- 21 constructs.

TABLE 1

VIGS fragments

Gene Sequence (5' > 3')

GACTGTGTTCTTGATGGTAAGGCGATGAGCGGCAAGGCTTCCTTCCATCAGAACG PR10-3 TTGTGGAAGTTGATTCTCACCTCTGCCTTTCTGAATAAGATGCAAGTACATGAAC

AC P _n R _r 1 _f 0 _/1 -4. GGTTATCTTCTTGAGGGAAAAGAACTGATTGTCAAGTTAAAGAAATTATTGATTT

ATTGTTCTCGATGGACAATTTCAGCTGTTGGTTTGTGTGT AACTACATTCTTGAGGGTAAGGCGCTGATCGCAGTGTTCTTAGTAAAATACATCC GAACTTCAGCGTTGGGTTTAAGTATGCACGTACGATCGTCG

RT-PCR and qRT-PCR primers

Length (base

Primer Sequence (5' > 3') Gene pairs)

MCS1 GGTCAAGGTACGTAGTAGAG 20 Vector

MCS2 CGAGAATGTCAATCTCGTAGG 21 Vector

PR10-3F TCACCGTGAATTGGAAGGAGAC 22 PR10-3

PR10-3R AAAGGGAGCCGGAGAATCTTC 21 PR10-3

PR10-4F CGATACATCATAGCGCAGTAGGAG 24 PR10-4

PR10-4R TCAGAAGCGCAGAGGTGAGAG 21 PR10-4

PR10-5F ACACCGCATAACTGGAGGAGAC 22 PR10-5

PR10-5R GGAGTTGGAGAACCCTCGTTC 21 PR10-5 TABLE 2

PR10-3 silenced

Relative abundance in Relative abundance in , . ,

Alkaloid

pTRV2 plants f%) pTRV2_PR10-3 plants f%) ^{1 1 eSt 1 valueJ}

Reticuline 100 157 0.001802452

Thebaine 100 187 0.007219061

Codeine 100 117 0.194557336

Morphine 100 47 0.040400318

Papaverine 100 114 0.481087944

Noscapine 100 104 0.841070894

PR10-4 silenced

Relative abundance in Relative abundance in

Alkaloid t Test (P value) pTRV2 plants f%) pTRV2_PR10-4 plants f%)

Reticuline 100 163 0.003308699

Thebaine 100 186 0.037869962

Codeine 100 116 0.204531378

Morphine 100 109 0.751577532

Papaverine 100 131 0.178091406

Noscapine 100 99 0.955998038

PR10-5 silenced

Relative abundance in Relative abundance in

Alkaloid t Test (P value)

pTRV2 plants f%) pTRV2 PR10-5 plants f%)

Reticuline 100 103 0.875960556

Thebaine 100 55 0.094456305

Codeine 100 70 0.043375318

Morphine 100 130 0.396500246

Papaverine 100 75 0.258371250

Noscapine 100 57 0.029511822