The present invention relates to a microbial cell comprising a pathway for the production of butanol and a process for the production of butanol comprising fermenting a microbial cell according to the present invention.

Butanol is an important chemical and is suitable as an alternative engine fuel having improved properties over ethanol. Butanol also finds use as a solvent for a wide variety of chemical and textile processes, in the organic synthesis of plastics, as a chemical intermediate and as a solvent in the coating and food and flavour industry. Butanol can be produced from biomass (biobutanol) as well as fossil fuels.

The fermentation of carbohydrates to acetone, butanol, and ethanol by solventogenic Clostridium species (e.g. Clostridium acetobutylicum), the classical ABE fermentation, is well known since decades. However, Clostridia are sensitive to oxygen, and therefore C/osfr/d/um-fermentations need to be operated under strict anaerobic conditions, which makes it difficult to operate such fermentations on a large scale. In addition, Clostridium, like most bacteria, is sensitive to bacteriophages, causing lysis of the bacterial cells during fermentation. Since Clostridia fermentations are carried out at neutral pH, sterile conditions are essential to prevent contamination of the fermentation broth by e.g. lactic acid bacteria, which lead to high costs for fermentations on an industrial scale (Zverlov et al., 2006, Appl. Microbiol. Biotechnol 71 :587-597).

Alternative butanol-producing microorganisms are known from WO2008/052991 and WO2008/074794, which disclose a recombinant microorganism, which is transformed with a butanol pathway derived from Clostridium. Another alternative pathway for the production of alcohols in Escherichia coli was developed by Atsumi et al. (2008, Nature 45:86-90), which started from 2-keto acids which are intermediates in amino acid biosynthesis. 2-Keto acids can be converted to aldehydes by 2-ketoacid decarboxylases and then to alcohols by alcohol dehydrogenases. In the butanol pathway developed by Atsumi et al. butanol is produced from 2-ketovalerate. A disadvantage of this alternative butanol biosynthesis pathway is that it comprises 14 different steps starting from pyruvate. In addition, the formation of 2- ketovalerate from 2-ketobutyrate requires side activities of enzymes in leucine biosynthesis. Despite the attempts that have been made to improve biosynthesis processes for the production of butanol, there remains a need for alternative processes for the fermentative production of butanol.

The aim of the present invention is a microorganism comprising an alternative butanol biosynthesis pathway.

Summary of the invention

The aim is achieved according to the present invention with a microbial cell comprising genes encoding enzymes that catalyse the following reactions: a) pyruvate to acetolactate, b) acetolactate to 2,3-dihydroxyisovalerate, c) 2,3-dihydroxyisovalerate to 2-ketoisovalerate, d) 2-ketoisovalerate to isobutyryl-CoA, e) isobutyryl-CoA to butyryl-CoA, f) butyryl-CoA to butyraldehyde, and g) butyraldehyde to butanol, wherein the cell produces butanol.

The alternative butanol biosynthesis pathway in the microbial cell according to the present invention was found advantageous because it comprises only 6 to 7 reaction steps to butanol starting from pyruvate, which is a similar number of steps as in the natural Clostridium butanol pathway starting from acetyl-CoA.

In another aspect the invention relates to a process for the production of butanol comprising fermenting the microbial cell according to the present invention in a suitable fermentation medium enabling it to produce butanol.

Definitions

The term "gene", as used herein, refers to a nucleic acid sequence containing a template for a nucleic acid polymerase, in eukaryotes, RNA polymerase II. Genes are transcribed into mRNAs that are then translated into protein.

The term "nucleic acid" as used herein, includes reference to a deoxyribonucleotide or ribonucleotide polymer, i.e. a polynucleotide, in either single-or double-stranded form, and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single- stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids). A polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof.

The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The essential nature of such analogues of naturally occurring amino acids is that, when incorporated into a protein, that protein is specifically reactive to antibodies elicited to the same protein but consisting entirely of naturally occurring amino acids. The terms "polypeptide", "peptide" and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma- carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

The term "enzyme" as used herein is defined as a protein which catalyses a (bio)chemical reaction in a cell.

An enzyme catalysing any of the reactions of the butanol pathway in the microbial cell according to the present invention may be any naturally occurring enzyme (wild type) or a mutant of a naturally occurring enzyme with suitable activity. Properties of a naturally occurring enzyme may be improved by biological techniques known to the skilled person in the art, such as e.g. molecular evolution or rational design. Mutants of wild-type enzymes can for example be made by modifying the encoding DNA using mutagenesis techniques known to the person skilled in the art (random mutagenesis, site-directed mutagenesis, directed evolution, gene recombination, etc.). In particular the DNA may be modified such that it encodes an enzyme that differs by at least one amino acid from the wild-type enzyme, so that it encodes an enzyme that comprises one or more amino acid substitutions, deletions and/or insertions compared to the wild-type, or such that the mutants combine sequences of two or more parent enzymes or by effecting the expression of the thus modified DNA in a suitable (host) cell. The latter may be achieved by methods known to the skilled person in the art such as codon optimisation or codon pair optimisation, e.g. based on a method as described in WO 2008/000632.

A mutant enzyme may have improved properties, for instance with respect to one or more of the following aspects: selectivity towards the substrate, activity, stability, solvent tolerance, pH profile, temperature profile, substrate profile, susceptibility to inhibition, cofactor utilisation and substrate-affinity. Mutants with improved properties can be identified by applying e.g. suitable high through-put screening or selection methods based on such methods known to the skilled person in the art

Genes encoding the enzymes of the butanol pathway in a microbial cell of the present invention may be present on a vector (plasmid) or may be integrated into the genome of the microbial cell. Preferably the genes are integrated into the genome of the microbial cell.

Usually, a nucleotide sequence encoding an enzyme is operably linked to a promoter that causes sufficient expression of the corresponding nucleotide sequence in a microbial cell. As used herein, the term "operably linked" refers to a linkage of polynucleotide elements (or coding sequences or nucleic acid sequence) in a functional relationship. A nucleic acid sequence is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For instance, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the coding sequence. As used herein, the term "promoter" refers to a nucleic acid fragment that functions to control the transcription of one or more genes, located upstream with respect to the direction of transcription of the transcription initiation site of the gene, and is structurally identified by the presence of a binding site for DNA-dependent RNA polymerase, transcription initiation sites and any other DNA sequences known to one of skilled in the art. A "constitutive" promoter is a promoter that is active under most environmental and developmental conditions. An "inducible" promoter is a promoter that is active under environmental or developmental regulation.

The promoter that could be used to achieve expression of a nucleotide sequence coding for an enzyme, may be not native to the nucleotide sequence coding for the enzyme to be expressed, i.e. a promoter that is heterologous to the nucleotide sequence (coding sequence) to which it is operably linked. Preferably, the promoter is homologous, i.e. endogenous to the host cell.

Usually a nucleotide sequence encoding an enzyme comprises a terminator. Any terminator, which is functional in the cell, may be used in the present invention. Preferred terminators are obtained from natural genes of the host cell. Suitable terminator sequences are well known in the art. Preferably, such terminators are combined with mutations that prevent nonsense mediated mRNA decay in the host cell of the invention (see for example: Shirley et al., 2002, Genetics 161 :1465-1482). In a preferred embodiment, a gene (nucleotide sequence) encoding an enzyme catalysing any of the reactions a) to g) of the butanol pathway in a microbial cell of the invention is overexpressed.

There are known methods in the art for overexpressing nucleotide sequences encoding enzymes. A nucleotide sequence encoding an enzyme may be overexpressed by increasing the copy number of the gene coding for the enzyme in the cell, e.g. by integrating additional copies of the gene in the cell's genome, by expressing the gene from a centromeric vector (in an eukaryotic cell), from an episomal multicopy expression vector or by introducing an (episomal) expression vector that comprises multiple copies of one or more gene(s). Preferably, overexpression of a nucleotide sequence encoding an enzyme according to the invention is achieved with a (strong) constitutive promoter.

Sequence identity is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (polynucleotide) sequences, as determined by comparing the sequences. Usually, sequence identities are compared over the whole length of the sequences compared. In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences.

Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include BLASTP, BLASTN (Altschul, S. F. et al., J. MoI. Biol. 215:403-410 (1990), publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, MD 20894). Preferred parameters for amino acid sequences comparison using BLASTP are gap open 1 1.0, gap extension 1 , Blosum 62 matrix.

The term "homologous", "endogenous "or "similar" is used to indicate the relation between a given (recombinant) nucleic acid or polypeptide molecule and a given host organism or host cell, is understood to mean that in nature the nucleic acid or polypeptide molecule is produced by a host cell or organisms of the same species, preferably of the same variety or strain.

The term "heterologous" or "exogenous" when used with respect to a nucleic acid (DNA or RNA) or protein refers to a nucleic acid or protein that does not occur naturally as part of the organism, cell, genome or DNA or RNA sequence in which it is present, or that is found in a cell or location or locations in the genome or DNA or RNA sequence that differ from that in which it is found in nature. Heterologous nucleic acids or proteins are not endogenous to the cell into which it is introduced, but have been obtained from another cell or synthetically or recombinantly produced. A microbial cell according to the present invention commonly is a recombinant microbial cell. A recombinant microbial cell is herein defined as a cell which contains, or is transformed or genetically modified with a nucleotide sequence that does not naturally occur in the microbial cell, or it contains additional copy or copies of an endogenous nucleic acid sequence. A wild-type microbial cell is herein defined as the parental cell of the recombinant cell.

Detailed description

A microbial cell according to the present invention may comprise any suitable genes encoding enzymes catalysing the reactions a) to g) as shown herein above. Preferably, a microbial cell comprises genes encoding enzymes catalysing the reaction a) to g), wherein the enzyme that catalyses reaction a) is an acetolactate synthase, and / or the enzyme that catalyses reaction b) is a ketol-acid reductoisomerase, and / or the enzyme that catalyses reaction c) is a dihydroxy-acid dehydratase, and / or the enzyme that catalyses reaction d) is a ketoacid dehydrogenase, and / or the enzyme that catalyses reaction e) is an isobutyryl-CoA mutase, and/or the enzyme that catalyses reaction f) and g) is an acyl-CoA reductase and an alcohol dehydrogenase, respectively, or the enzyme that catalyses reaction f) and g) is a bifunctional acetaldehyde/alcohol dehydrogenase.

Preferably, a microbial cell comprises genes encoding enzymes, wherein the enzyme that catalyses reaction a) is an acetolactate synthase, the enzyme that catalyses reaction b) is a ketol-acid reductoisomerase, the enzyme that catalyses reaction c) is a dihydroxy-acid dehydratase, the enzyme that catalyses reaction d) is a ketoacid dehydrogenase, the enzyme that catalyses reaction e) is an isobutyryl-CoA mutase, the enzyme that catalyses reaction f) and g) is an acyl-CoA reductase and an alcohol dehydrogenase, respectively, or the enzyme that catalyses reaction f) and g) is a bifunctional acetaldehyde/alcohol dehydrogenase.

Genes encoding enzymes which catalyse the reactions a) to g) may be any homologous or heterologous gene. Suitable enzymes and its encoding enzymes that catalyse the reactions a) to g) are listed in Table 1. Table 1.

1. Catalytic subunit of acetolactate synthase 2. Regulatory subunit of acetolactate synthase

Preferably, a microbial cell according to the present invention comprises genes encoding enzymes which catalyse any one of the reactions a) to g) as described herein below.

In one embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the conversion of pyruvate to acetolactate (reaction a), wherein the enzyme preferably is an acetolactate synthase (E. C. number 2.2.1.6). A gene encoding an acetolactate synthase may be derived from any microorganism, preferably from a microorganism that is able to produce alpha- ketoisovalerate or metabolites derived therefrom, for example, valine, pantoate or pantothenate. An acetolactate synthase may be bifunctional, which means that it may catalyze the conversion of two molecules of pyruvate to acetolactate as well as the conversion of pyruvate and 2-ketobutyrate to 2-aceto-2-hydroxybutyrate. Preferably, a microbial cell according to the present invention comprises an acetolactate synthase that shows a substrate preference for pyruvate so that acetolactate is predominately or solely produced.

Preferably, a microbial cell according to the present invention comprises a gene encoding an acetolactate synthase which is resistant to valine feedback inhibition. An acetolactate synthase which is resistant to valine feedback inhibition can be measured by a higher enzymatic activity in the presence of valine as compared to an acetolactate synthase which is not resistant to valine feedback inhibition. An acetolactate synthase which is resistant to valine feedback inhibition may be a mutant acetolactate synthase, e.g. obtained as described in Elisakova, 2005, Appl Environ Microbiol 71:207-213, and in Kopecky et al., 1999, Biochem Biophys Res Commun 266: 162-166, or a non-mutant acetolactate synthase such as for instance B. subtilis acetolactate synthase AIsS (Holtzclaw and Chapman, 1975, J. Bacteriol. 121 :917-925).

Acetolactate synthases may have two subunits, such as a catalytic and a regulatory subunit, encoded by e.g. NvB and NvN, respectively, from e.g. E. coli or B. subtilis (Table 1 ). Alternatively, acetolactate synthases may have a single unit, encoded by e.g. AIsS from B. subtilis (Table 1 ) and pH6 ALS from K. aerogenes, as reported in Gollop et al. 1990. J. Bacteriol. 172: 3444-3449.

Preferably, a microbial cell according to the present invention comprises a gene encoding an acetolactate synthase which has at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 42 (S. subtilis AIsS), or two genes encoding two subunits of an acetolactate synthase which have at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence SEQ ID NO: 30 and SEQ ID NO: 42 (S. subtilis mutant ilvBW490L and ilvN, respectively).

The invention also relates to an enzyme having acetolactate synthase activity according to an amino acid sequence selected from the group consisting of SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 and a microbial cell comprising said amino acid sequence.

In another embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the conversion of acetolactate to 2,3-dihydroxyisovalerate (reaction b), wherein the enzyme preferably is a ketol-acid reductoisomerase, using either NADPH or NADH as an electron donor. Ketol-acid reductoisomerases using NADPH as an electron donor are known by the EC number 1.1.1.86. The cofactor specificity of this enzyme can be altered to NADH by site-directed mutagenesis as described in Rane et al. 1997, Arch. Biochem. Biophys. 338:83-89. Preferably a gene encoding a ketol-acid reductoisomerase is derived from a microorganism that is able to produce alpha-ketoisovalerate or metabolites derived thereof, for example, valine, pantoate or pantothenate. A ketol-acid reductoisomerase can be bifuntioncal: it can use both acetolactate and 2-aceto-2-hydorxybutyrate as a substrate. Preferably, a microbial cell according to the present invention comprises a ketol-acid reductoisomerase which shows a higher substrate affinity and/or higher maximum enzyme activity with acetolactate than with 2-aceto-2-hydroxybutyrate. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis- Menten constant Km) can be measured in in vitro enzyme assay for purified ketol-acid reductoisomerases, such as described in Hofler et al. 1975, J. Biol. Chem. 250: 877-882. Preferably, a microbial cell according to the present invention comprises a gene encoding a ketol-acid reductoisomerase which has at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 44.

The present invention also relates to an enzyme having ketol-acid reductoisomerase activity according to amino acid sequence SEQ ID NO: 35, and a microbial cell comprising said enzyme.

In another preferred embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the reaction of 2,3- dihydroxyisovalerate to 2-ketoisovalerate (reaction c), wherein the enzyme preferably is a dihydroxy-acid dehydratase (EC number 4.2.1.9.). Preferably, a dihydroxy-acid dehydratase is derived from a microorganism that is able to produce α-ketoisovalerate or metabolites derived therefrom, for example, valine, pantoate or pantothenate. A dihydroxy-acid dehydratase can be bifunctional: it may be able to use both 2,3- dihydroxy-3-methylvalerate and 2,3-dihydroxyisovalerate as a substrate. Preferably, a microbial cell according to the present invention comprises a dihydroxy-acid dehydratase which shows a higher substrate affinity and/or higher maximum enzyme activity with 2,3- dihydroxyisovalerate than with 2,3-dihydroxy-3-methylvalerate. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis-Menten constant Km) can be determined in in vitro enzyme assays for purified dihydroxy-acid dehydratases, such as described in Flint et al., 1993, J. Biol. Chem. 268: 14732-14742.

Preferably, a microbial cell according to the present invention comprises a gene encoding a dihydroxy-acid dehydratase which has at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 45.

In another preferred embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the conversion of 2- ketoisovalerate to isobutyryl-CoA, wherein the enzyme preferably is a branched-chain ketoacid dehydrogenase. As used herein, the word branched-chain ketoacid dehydrogenase may also be defined as an enzyme complex including a 3-methyl-2- oxobutanoate dehydrogenase (E. C. 1.2.4.4), a dihydrolipoyl dehydrogenase (E. C. 1.8.1.4) and a dihydrolipoyllysine-residue (2-methyl-propanoyl)transferase (E. C.

2.3.1.168). Branched-chain ketoacid dehydrogenases may be able to use a number of branched-chain ketoacids as substrates, for example, 2-ketoisovalerate, 2- ketoisocaproate and 3-methyl-2-oxopentanoate. Preferably, a microbial cell according to the present invention comprises a branched-chain ketoacid dehydrogenase showing a higher substrate affinity and/or higher maximum enzyme activity with 2-ketoisovalerate as compared to 2-ketoisocaproate and 3-methyl-2-oxopentanoate. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis-Menten constant Km) can be determined in in vitro enzyme assays for purified branched-chain ketoacid dehydrogenases, such as described in Sokatch et al. 1981 , J. Bacteriol. 148:647-652. A suitable branched-chain ketoacid dehydrogenase may be derived from any suitable microbial origin, such as from Bacillus species represented by the Bacillus sensu stricto group, in particular Bacillus subtilis, Bacillus lentimorbus, Bacillus lentus, Bacillus anthracis, Bacillus firmus, Bacillus pantothenticus, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus megaterium, Bacillus thuringiensis, Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus pumilus, Bacillus halodurans. Alternatively, a branched-chain ketoacid dehydrogenase may be derived from genera of the Bacillus sensu lato group, such as Geobacillus and Brevibacillus, or from Corynebacterium, Lactobacillus, Lactococci, Streptomyces, Pseudomonas, Enterococcus or from fungi such as Penicillium chrysogenum. Also preferred are branched-chain ketoacid dehydrogenases derived from microorganisms that can utilize valine as a carbon source. Preferably, a branched-chain ketoacid dehydrogenase is endogenous (homologous) to the microbial cell of the invention. Suitable genes encoding a branched-chain ketoacid dehydrogenase are listed in Table 1. A branched-chain ketoacid dehydrogenase usually comprises four subunits. Preferably, a microbial cell according to the present invention comprises four genes encoding four subunits of a branched-chain ketoacid dehydrogenase which have at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49, respectively. The present invention also relates to an enzyme having branched-chain ketoacid dehydrogenase activity comprising the subunits according to amino acid sequence SEQ ID NO:38, SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41 , and a microbial cell comprising said enzyme having branched-chain ketoacid dehydrogenase activity comprising said amino acid sequences. In another embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the conversion of isobutyryl-CoA to butyryl-CoA wherein the enzyme preferably is an isobutyryl-CoA mutase (E. C. 5.4.99.13). Preferably, a microbial cell according to the present invention comprises an isobutyryl-CoA mutase which has a higher affinity and/or higher maximum enzyme activity with isobutyryl-CoA as a substrate as compared to butyryl-CoA. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis-Menten constant Km) can be determined in in vitro enzyme assays for purified isobutyryl-CoA mutases, such as described in Ratnatilleke et al. 1999, J. Biol. Chem. 274: 31679- 31685. An isobutyryl-CoA mutase usually comprises two subunits, i.e. subunit A and subunit B. Suitable genes encoding subunits of an isobutyryl-CoA mutase are listed in Table 1. Preferably, a microbial cell according to the present invention comprises a gene encoding an isobutyryl-CoA mutase subunit A which has at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 50 and a gene encoding an isobutyryl-CoA mutase subunit B which has at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 51.

In another embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the conversion of butyryl-CoA to butyrylaldehyde (reaction f), wherein the enzyme preferably is an acyl-CoA reductase, using either NADH or NADPH as electron donor. Preferably, an acyl-CoA reductase is selected from the group of aldehyde dehydrogenases (acetylating), (E. C. number 1.2.1.10); fatty acyl-CoA reductases, (E. C. 1.2.1.42); Iong-chain-fatty-acyl-CoA reductases, (E. C. 1.2.1.50); butanal dehydrogenases, (E. C. 1.2.1.57) and CoA- dependent succinate semialdehyde dehydrogenases (Sohling et al., 1993. Eur. J. Biochem. 212: 121-7). Preferably, a microbial cell according to the present invention comprises an acyl-CoA reductase which is specific for short chain acyl-CoA's wherein the acyl-group preferably comprises 2 - 6 carbon atoms, more preferably 4 carbon atoms. More preferred is an acyl-CoA reductase having higher affinity and / or activity with butyryl-CoA as compared to isobutyryl-CoA and acetyl-CoA. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis-Menten constant Km) can be determined in in vitro enzyme assays for purified acyl-CoA reductases, such as described in Yan and Chen, 1990, Appl. Environ. Microbiol. 56: 2591-2599.

Preferably, a microbial cell according to the present invention comprises a gene encoding an acyl-CoA reductase which has at least 80%, 90%, 95% or 100% sequence identity to amino acid sequence of SEQ ID NO: 52.

In another embodiment, a microbial cell according to the present invention comprises a gene encoding an enzyme that catalyses the conversion of butyrylaldehyde to butanol (reaction g), wherein the enzyme preferably is an alcohol dehydrogenase using either NADH or NADPH as an electron donor, (E. C. number 1.1.1.-). An alcohol dehydrogenase may be a NAD ⁺ -dependent alcohol dehydrogenase, known by the EC number 1.1.1.1 , a NADP ⁺ -dependent alcohol dehydrogenase, known by the EC number 1.1.1.2 or a NAD ⁺ - and NADP ⁺ -dependent alcohol dehydrogenase, known by the EC number 1.1.1.71. Preferably an alcohol dehydrogenase is specific for alcohols containing 2 - 6 carbon atoms, more preferably 4 carbon atoms. Preferably, a microbial cell according to the present invention comprises a gene encoding an alcohol dehydrogenase which has a higher substrate affinity and / or activity with butyraldehyde as compared to isobutyraldehyde. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis-Menten constant Km) can be determined in in vitro enzyme assays for purified alcohol dehydrogenases, such as described in Welch et al.

1989, Arch. Biochem. Biophys. 273: 309-318.

Preferably, a microbial cell according to the present invention comprises a gene encoding an alcohol dehydrogenase which has at least 80%, 90%, 95% or 100% sequence identity with amino acid sequence of SEQ ID NO: 53.

Alternatively, step f and step g may be catalysed by a single bifunctional enzyme, known as an aldehyde-alcohol dehydrogenase, for example, by the adhE and adhE1 gene products from Clostridium acetobutylicum, known by EC number 1.1.1.1/1.2.1.10.

Preferably, a microbial cell according to the present invention comprises a bifunctional aldehyde/alcohol dehydrogenase which is specific for short chain acyl-CoA's wherein the acyl-group preferably comprises 2 - 6 carbon atoms, more preferably 4 carbon atoms. More preferred is a bifunctional aldehyde/alcohol dehydrogenase having higher affinity and / or activity with butyryl-CoA as compared to isobutyryl-CoA and acetyl-CoA. Maximum enzyme activity and substrate affinity (usually expressed as the Michaelis-Menten constant Km) can be determined in in vitro enzyme assays for purified bifunctional aldehyde/alcohol dehydrogenases, such as described in Yan and Chen,

1990, Appl. Environ. Microbiol. 56: 2591-2599.

Preferably, a microbial cell according to the present invention comprises a gene encoding a bifunctional aldehyde/alcohol dehydrogenase which has at least 80%, 90%, 95% or 100% sequence identity with amino acid sequence SEQ ID NO: 54.

The enzymes of the butanol pathway in the microbial cell as described above may be located in the mitochondrion / peroxisome (in a eukaryotic cell) or in the cytosol. Preferably, the enzymes catalysing the reactions a) to g) are located in the cytosol. In the event one of the enzymes for the butanol pathway as described above is targeted to cellular compartments such as a mitochondrion or a peroxisome (for production in an eukaryotic cell), it may be preferred to localise the enzyme to the cytosol by deleting the mitochondrial/peroxisomal targeting signal from the encoding gene. Methods to delete a mitochondrial or peroxisomal targeting signal are known in the art.

A microbial cell according to the present invention may be a bacterium, a filamentous fungus, a yeast or an alga. Preferably, a microbial cell according to the present invention belongs to a genus of Bacillus, Geobacillus, Brevibacillus, Lactobacillus, Lactococcus, Corynebacterium, Escherichia, Pseudomonas, Propionibacterium, Clostridium, Streptomyces, Aspergillus, Trichoderma, Penicillium, Saccharomyces, Kluyveromyces, or Pichia. Preferably, the microbial cell belong to species of Bacillus subtilis, Lactobacillus plantarum, Escherichia coli, Aspergillus niger, A. oryzae, Penicillium chrysogenum, Saccharomyces cerevisiae, Kluyveromyces lactis, Pichia pastoris. Also preferable are other Bacillus species closely related to B. subtilis (Bacillus sensu stricto group; Zeigler, D. and Perkins, J. B., 2008, Practical Handbook of Microbiology", Second Edition (E. Goldman and L. Green, eds.), pp 301-329, CRC Press, Boca Raton, FL) in particular, Bacillus lentimorbus, Bacillus lentus, Bacillus anthracis, Bacillus firmus, Bacillus pantothenticus, Bacillus cereus, Bacillus circulans, Bacillus coagulans, Bacillus megaterium, Bacillus thuringiensis, Bacillus licheniformis, Bacillus amyloliquefaciens, Bacillus pumilus, and Bacillus halodurans. Preferably, a microbial cell according to the present invention has a high tolerance to butanol. A high tolerance to butanol is herein defined as the ability of a microbial cell to grow in the presence of at least 0.5, 0.8, 1 , 1.2, 1.5, 1.8. or at least 2 w/w% of butanol.

In another preferred embodiment, the microbial cell according to the invention is able to take up coenzyme B12 and / or is able to synthesize coenzyme B12 de novo either from endogenous genes or exogenously introduced genes that encode the enzyme for B12 production. It was found advantageous that the cell was able to take up or synthesize coenzyme B12, since coenzyme B12 enhances isobutyryl-CoA mutase activity (step e). In another aspect the invention relates to a process for the production of butanol, comprising fermenting a microbial cell according to the present invention in a suitable fermentation medium, and optionally recovery of butanol.

The fermentation medium used in the process for the production of butanol may be any suitable fermentation medium which allows growth of a microbial cell according to the present invention. The essential elements of the fermentation medium are known to the person skilled in the art and may be adapted to a microbial cell selected.

Preferably, the fermentation medium comprises a suitable source of carbon, nitrogen and phosphate. Suitable carbon sources include, but are not limited to, carbohydrates, hydrocarbons, fats, oils, fatty acids, organic acids, and alcohols. Suitable nitrogen sources include, but are not limited to, peptone, yeast extract, meat extract, soy extract, pea extract, urea, ammonium sulfate, ammonium nitrate, ammonium chloride, and ammonium phosphate. Suitable phosphate sources include, but are not limited to, phosphoric acid and its sodium and potassium salts; and trace elements including magnesium, iron, manganese, calcium, zinc, copper, boron, molybdenum, and/or cobalt salts.

Preferably, a source of carbon comprises a C5 sugar such as arabinose or xylose and/or a C6 sugar (monosaccharides) such as glucose. Raw materials such as sugarcane, maize, wheat, barley, sugarbeets, rapeseed, and sunflower may also be suitable as a carbon source. In some instances the raw material may be pre-digested by enzymatic treatment. Most preferably a carbon source comprises lignocellulose, which is composed of mainly cellulose, hemicellulose, pectin, and lignin. Lignocellulose is found, for example, in the stems, leaves, hulls, husks, and cobs of plants. Hydrolysis of these polymers by specific enzymatic treatment releases a mixture of neutral sugars including glucose, xylose, mannose, galactose, and arabinose. Lignocellulosic materials, such as wood, herbaceous material, agricultural residues, corn fiber, waste paper, pulp and paper mill residues can be used to produce butanol. Hydrolysing enzymes are for instance beta-linked glucans for the hydrolysis of cellulose (these enzymes include endoglucanases, cellobiohydrolases, glucohydrolases and beta-glucosidases); beta- glucosidases hydrolyze cellobiose; endo-acting and exo-acting hemicellulases and cellobiases for hydrolysis of hemicellulose, and acetylesterases and esterases that hydrolyze lignin glycoside bonds. These and other methods for hydrolysis of lignocellulose are well known in the art. The fermentation process for the production of butanol according to the present invention may be an aerobic or an anaerobic fermentation process. Preferably the process according to the present invention is carried out under anaerobic conditions. It was found advantageous that fermenting the microbial cell was carried out under anaerobic conditions in case the microbial cell comprises a bifunctional aldehyde/alcohol dehydrogenase. It was found that a bifunctional aldehyde/alcohol dehydrogenase (adhE) was more active under anaerobic conditions.

An anaerobic fermentation process is herein defined as a fermentation process run in the absence of oxygen or in which substantially no oxygen is consumed, preferably less than 5, 2.5 or 1 mmol/L/h. Optionally, molecules other than oxygen can serve as electron acceptors (such as nitrate for Bacillus subtilis; Clements et al., 2002, Syst Appl Microbiol 25:284-286). The fermentation process according to the present invention may also first be run under aerobic conditions and subsequently under anaerobic conditions. The process for the production of butanol according to the present invention may be run at any suitable temperature, preferably between 10 and 65 degrees Celsius, preferably between 20 and 50, and more preferably between 20 and 35, or between 25 and 40 degrees Celsius. The process for the production of butanol according to the present invention may be carried out at any suitable pH value, for instance between 2 and 9, preferably between 4 and 8, preferably between pH 5.5 to 7.5.

Preferably, the process for the production of butanol further comprises recovery of butanol from the fermentation medium. Recovery of butanol from the fermentation medium may be performed by known methods in the art, for instance by distillation, vacuum extraction, solvent extraction, or pervaporation. Preferably, butanol is purified.

The present invention also relates to a fermentation medium comprising butanol obtainable by the process for the production of butanol according to the invention.

In another aspect the present invention relates to the process for the production of butanol and optionally recovery of butanol, wherein the butanol is used as a chemical or as a (bio)fuel.

Examples of the use of butanol as a chemical is the use of butanol as a solvent, for instance in the organic chemistry, or as a raw material for the production of butyl esters or ethers, for instance butyl acrylate. Alternatively, butanol of the invention may be used as a fuel for instance as an additive to fuels such as gasoline or diesel.

FIGURES

Figure 1. Production of butanol using an alternative pathway derived from a valine biosynthetic pathway. 1 ) acetolactate synthase; 2) ketol-acid reductoisomerase; 3) dihydroxy-acid dehydratase; 4) branched-chain ketoacid dehydrogenase; 5) isobutyryl- CoA mutase; 6) acyl-CoA reductase; 7) alcohol dehydrogenase; 6) + 7) bifunctional aldehyde/alcohol dehydrogenase.

Figure 2: Butyric acid concentrations in a 0.1 mM isobutyryl-CoA solution (col. 1 ), a crude extract (1 mg crude extract proteins) (col. 2), and a crude extract (1 mg of crude extract proteins) incubated with the 0.1 mM isobutyryl-CoA solution (col. 3), after 30 min incubation. EXAMPLES General Methods

Strains and plasmids. Bacillus subtilis strains of the present invention are derived from strain 1A747 (Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA), which is a prototrophic derivative of B. subtilis 168 {trpC2) (GenBank AL009126). The chloramphenicol-resistance gene (cat) cassette is obtained from plasmid pC194 (GeneBank M19465, Cat# 1 E17 Bacillus Genetic Stock Center, The Ohio State University, Columbus, Ohio 43210 USA). Three different plasmids used for ectopic integrations by double-crossing over in

B. subtilis are used in this patent. Plasmid pDG364 (Karmazyn-Campelli et al. 1989. Genes Dev. 3:150-157; BGSC-ECE46) integrates at the non-essential amyE locus under chloramphenciol selection. Plasmid pDG1664 (Genebank U46201 ; Guerout-Fleury et al. 1995 Gene 167:335-336) integrates at the thrC site under erythrocycin selection. Plasmid pAX01 (httρ://btbqn1.bio.uni-bayreuth.de/lsqenetik1/schumann ρaxO1.htrn:

BGSC ECE137; Hartl, B. et al. 2001 J. Bacteriol. 183:2696-2700) integrates at the lacA site under erythromycin selection. pSac-Kan (Genebank AY464563; BGSC ECE175; Middleton and Hofmeister. 2004. Plasmid 51_:238-45) integrates at the sacA site under kanamycin selection.

Media. Standard minimal medium (MM) for B. subtilis contains 1X Spizizen salts,

0.04% sodium glutamate, and 0.5% glucose. Standard solid complete medium is

Tryptone Blood Agar Broth (TBAB, Difco). Standard liquid complete medium is Veal

Infusion-Yeast Extract broth (VY). The compositions of these media are described below:

TBAB medium: 33g Difco Tryptone Blood Agar Base (Catalog # 0232), 1 L water.

Autoclave.

VY medium: 25g Difco Veal Infusion Broth (Catalog # 0344), 5g Difco Yeast Extract

(Catalog #0127), 1 L water. Autoclave. Spizizen Minimal Medium (SMM): 100ml 10X Spizizen salts; 10 ml 50% glucose; 1 ml

40% sodium glutamate, qsp 1 L water.

10X Spizizen salts: 14Og K ₂ HPO ₄ ; 2Og (NhU) ₂ SO ₄ ; 6Og KH ₂ PO ₄ ; 10g Na ₃ citrate.2H ₂ O;

2g MgSO ₄ .7H ₂ O; qsp 1 L with water.

10X VFB minimal medium (10X VFB MM): 2.5g Na-glutamate; 15.7g KH ₂ PO ₄ ; 15.7g K ₂ HPO ₄ ; 27.4 g Na ₂ HPO ₄ -^H ₂ O; 4Og NH ₄ CI; 1 g citric acid; 68 g (NH ₄ ) ₂ SO ₄ ; qsp 1 L water.

Trace elements solution: 1.4g MnSO ₄ H ₂ O; 0.4g CoCI ₂ -6H ₂ O; 0.15g (NH ₄ ) ₆ Mo ₇ O ₂₄ -4H ₂ O;

0.1 g AICI ₃ -6H ₂ O; 0.075g CuCI ₂ -2H ₂ O; qsp 200 ml water. Fe solution: 0.21 g FeSO ₄ .7H ₂ O; qsp 10 ml water.

CaCI? solution: 15.6g CaCI ₂ .2H ₂ O; qsp 500 ml water.

Mα/Zn solution: 10Og MgSO ₄ JH ₂ O; 0.4g ZnSO ₄ JH ₂ O; qsp 200 ml water.

VFB MM medium: 100 ml 1OX VFB MM; 10 ml 50% glucose; 2 ml Trace elements solution; 2 ml Fe solution; 2 ml CaCI ₂ solution; 2 ml Mg/Zn solution; 882 ml sterile distilled water.

Anaerobic growth. Anaerobic cultures were performed according to Nakano, M. et al. (1997 J. Bacteriol. 179: 6749-6755). Defined medium for anaerobic growth was Spizizen minimum medium supplemented with 1% glycerol, 0.2% glutamate, and 0.2% KNO3 for growth by nitrate respiration. Cultures were inoculated (1/100 v/v) by cells grown aerobically overnight at 37 ⁰ C in SMM medium supplemented with 0.5% glucose. Anaerobic growth conditions were maintained in sealed vessel for 24h by static incubation after the inoculated medium was flushed with N ₂ for 1 min. Pxyl promoter expression was obtained by addition of 0.6% xylose at the start of the culture. In some cases, vitamin B12 was added at a final concentration of 33 nM.

Molecular and genetic techniques. Standard genetic and molecular biology techniques are generally known in the art (Sambrook and Russel (2001 ) "Molecular Cloning: A Laboratory Manual (3 ^rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, or F. Ausubel et al, eds., "Current protocols in molecular biology", Green Publishing and Wiley Interscience, New York (1987). DNA transformation, PBS1 generalized transduction, and other standard B. subtilis genetic techniques are also generally known in the art and have been described previously (Molecular Biological Methods for Bacillus, 1992, Harwood, CR. and Cutting, S. M., eds, John Wiley & Sons, New York)

Crude extract preparation. Cells from overnight cultures were resupended in 10 mM Tris pH7.6 10 mM MgCI ₂ 1 mM DTT and anti-protease cocktail Compete (Roche). The crude extract was prepared by passing twice the cell suspension through a French press before centrifugation.

Isobutyryl-CoA mutase assay. The isobutyryl-CoA mutase activity was measured according to Birch et al. (1993 J. Bacteriol. 175: 3511-3519). Practically, 1 mg protein extract was incubated during 30 minutes at 3O ⁰ C in presence of 1 μM cobalamine B12 and 0.1 mM n-butyryl CoA. Reaction was stopped by addition of KOH (0.5 N final) containing valeric acid as internal standard before acidification by H ₂ SO ₄ saturated by HCI (4% final, v/v). Extraction was made using ethyl acetate. Assay was made by gas chromatography using a HP-FFAP (25 m X 0.32 mm X 0.5 μM) column.

Alcohol-dehydrogenase assay. The alcohol-dehydrogenase activity was measured according to Welch, R. et al. (1989, Arch. Biochem. Biophys. 273: 309-318). The assay was performed by following the oxidation of NADH over the time on a spectrophotometer at 340 nM. Practically 5OmM butanal were incubated in 50 mM 2-(N- morpholino)ethanesulfonic acid (MES) pH 6.0 in presence of 0.4 mM NADH and 250 υg of crude extract protein.

Butanol analysis by HS-GC. Samples are analyzed on a HS-GC equipped with a flame ionization detector and an automatic injection system. Column HP-FFAP length 25 m, id 0.32 mm, df 0.5 μm. The following conditions are used: helium as carrier gas with a flow rate of 5 ml/min. The column temperature is set at 110 ⁰ C. The temperature of the injector is set at 140 ⁰ C and the detector performed at 300 ⁰ C. The data are achieved using Chromeleon software. Samples are heated at 60 ⁰ C for 20 min in the headspace sampler. One ml of the headspace volatiles are automatically injected onto the column.

HPLC analysis of butanol. Butanol is detected in the culture medium using HPLC. The HPLC analysis is carried out as follows: pre-column: Biorad Microguard Cation H+ cartridge. Column: Biorad Aminex HPX-87H. Mobile phase: 0.01 N H ₂ SO ₄ . Precipitation reagent: 3.3N HCIO ₄ . Rl detection: Waters 410 differential refractometer. Description sequence listing (as referred to in the examples)

SEQ ID NO: 23. Sequence of the PΪSicmAB overexpressing cassette. 1 >6 BamHI cloning site; 2293>2298: EcoRI cloning site; 143>148 and 1868>1873: Shine-Delgarno sequences (ribosomal binding sites); 157>1857: icmA codon-optimized orf; 1882>2289: icmB codon-optimized orf. icmAB encode a isobutyryl-CoA mutase (step e). SEQ ID NO: 24. Sequence of the Pxyl-adhE codon pair-optimized overexpressing cassette.1 >195 Pxyl promoter region; 196>201 : Spel cloning site; 215>220 Shine- Delgarno site; 229>2805: adhE codon-optimized orf; 2809>2814: BamHI cloning site. adhE encodes an aldehyde-alcohol dehydrogenase (step f and g).

SEQ ID NO: 25. Sequence of the Pλb_ald_bdhA expression cassette. 1 >6 BamHI cloning site; 143>148 and 1574>1579: Shine-Delgarno sites; 157>1563 aid codon- optimized orf; 1588>2757: bdhA codon-optimzed orf; 2758>2763: EcoRI cloning site, aid and bdhA code for an aldehyde-alcohol dehydrogenase activity (step f and g) SEQ ID NO: 26. DNA sequence of the B. subtilis P26-ilvBNC expression cassette. 1 >6: BamHI cloning site; 3697>3702: Spel cloning site; 158>163: Shine-Delgarno; 175>3996: ilvBNC orf. ilvBNC encode the acetolactate synthase and ketol-acid reductoisomerase activities (step 1 and 2). SEQ ID NO: 27. DNA sequence of the B. subtilis Pilv_CggR_//ι/SΛ/C expression cassette. The Pilv_CggR transcript stabilizing DNA sequence is italized. 1 >6: BamHI cloning site; 500>506: Shine Delgarno; 514>4035: ilvBNC; 8>513: Pilv_cggR transcript stabilizing DNA sequence. ilvBNC orf. ilvBNC encode the acetolactate synthase and ketol-acid reductoisomerase activities (step 1 and 2). SEQ ID NO: 28. DNA sequence of the B. subtilis P26- llvB _W490 JlvNC expression cassette. 1 >6: BamHI cloning site; 3697>3702: Spel cloning site; 158>163: Shine- Delgarno; 175>3996: ilvBNC orf; 1642>1644: mutated codon. ilvBNC encode the acetolactate synthase and ketol-acid reductoisomerase activities (step 1 and 2).

EXAMPLE 1 (Prophetic) - Production of butanol in a wild-type Bacillus subtilis strain containing heterologous genes icmAB integrated at amyE and adhE integrated at thrC

This example describes the construction of a strain designed to produce butanol by overexpressing simultaneously the heterologous isobutyryl-CoA mutase (from Streptomyces cinnamonensis; AAC08713 and CAB59633) and the bifunctional aldehyde/alcohol dehydrogenase (from Clostridium acetobutylicum; NP_149199) activities in a wild-type B. subtilis genetic background. The strong constitutive promoter used in these constructions is P15 from bacteriophage SPO1 and is well known for people skilled in the art (Lee, G. and J. Pero. 1981. J. MoI. Biol. 152:247-265). The P'\ 5-icmAB expression cassette (SEQ ID NO:23) is synthesized according to a DNA whole synthesis metod of Cello et al. 2002. Science 297:1016-8. The S. cinnamonensis icmA and icmB genes are codon pair-optimized for optimally expression in B. subtilis using the design procedures described in patent WO2008/000362 (excluding Shine Delgarno, BamHI, EcoRI and Hindi 11 sites). The resulting DNA cassette is cloned between the BamHI and Hindi 11 sites of the pDG364 B. subtilis integration vector, generating plasmid pBT1. The P15-/cm>AS-carrying plasmid is then transformed into strain 1A747 using standard chloramphenicol selection to integrate a single-copy of the Pϊb-icmAB cassette into the non-essential amyE locus. One Cm ^r colony is selected and renamed B. subtilis BSBT1. The P'\ 5-adhE overexpressing cassette (SEQ ID NO:24) is prepared by in vitro

DNA synthesis methods before insertion between the BamHI and Hindi 11 sites of the B. subtilis integration vector pDG1664, generating plasmid pBT2. The adhE gene is codon- pair optimized for optimal B. subtilis expression using the same procedure as for the icmA and icmB genes. The P15-ac//?£-carrying plasmid is transformed into the P15- /cm>AS::amy£-containing strain BSBT1, selecting for erythromycin-resistant colonies by standard methods in order to integrate the P15-ac//7E cassette into the thrC locus. One Erm ^r colony is selected and named B. subtilis BSBT2. This strain contains a single-copy of the P15-/cm>4S cassette integrated at the amyE locus and a single-copy of the P 15- adhE cassette integrated at the thrC locus. Strain BSBT2 is grown overnight at 37 ⁰ C in shake flask containing minimal medium. The cells are removed and the butanol content of the supernatant iss measured by the procedure described in the General Methods section.

EXAMPLE 2 - Production of butanol in a wild-type Bacillus subtilis strain containing heterologous genes icmAB integrated at amyE and adhE integrated at lacA

This example describes the construction of a strain designed to produce butanol by overexpressing simultaneously the heterologous isobutyryl-CoA mutase (from Streptomyces cinnamonensis; AAC08713 and CAB59633) and the bifunctional aldehyde/alcohol dehydrogenase (from Clostridium acetobutylicum; NP_149199) activities in a wild-type B. subtilis genetic background. The strong constitutive promoter used in the construction in front of icmAB is P15 from bacteriophage SPO1 and is well known for people skilled in the art (Lee, G. and J. Pero. 1981. J. MoI. Biol. 152:247-265). The xylose-inducible promoter used in the construction in front of adhE was from

Bacillus megaterium and is well known for people skilled in the art (Rygus, T. and Hillen, W. 1991 Appl. Microbiol. Biotechnol. 35: 594-599)

The P'\ 5-icmAB expression cassette (SEQ ID NO:23) was synthesized according to a DNA whole synthesis method of Cello et al. 2002. Science 297:1016-8. The S. cinnamonensis icmA and icmB genes were codon pair-optimized for optimally expression in B. subtilis using the design procedures described in patent WO2008/000362 (excluding Shine Delgarno, BamHI, EcoRI and Hindlll sites). The resulting DNA cassette was cloned between the BamHI and Hindlll sites of the pDG364 B. subtilis integration vector, generating plasmid pBT1. The P15-/cm>AS-carrying plasmid was then transformed into strain 1A747 using standard chloramphenicol selection to integrate a single-copy of the Pi δ-icmAB cassette into the non-essential amyE locus. One Cm ^r colony was selected and renamed B. subtilis BSBT1.

The Pxy\-adhE overexpressing cassette (SEQ ID NO:24) was prepared by in vitro DNA synthesis methods before insertion between the Spel and BamHI sites of the B. subtilis integration vector pAX01 , generating plasmid pBT20. The adhE gene was codon-pair optimized for optimal B. subtilis expression using the same procedure as for the icmA and icmB genes. The Pxyl-ac//?£-carrying plasmid was transformed into the P15-/cm>AS::amy£-containing strain BSBT1, selecting for erythromycin-resistant colonies by standard methods in order to integrate the Pxy\-adhE cassette into the lacA locus. One Erm ^r colony was selected and named B. subtilis BSBT11. This strain contained a single-copy of the P15-/cm>4S cassette integrated at the amyE locus and a single-copy of the Pxy\-adhE cassette integrated at the lacA locus.

Strain BSBT11 was grown overnight at 37 ⁰ C in parallel under aerobic conditions with 0.5% glucose-containing SMM medium and anaerobically in static conditions in potassium nitrate-containing medium described above for anaerobic growth. Both cultures contained 0,6 % xylose for induction of adhE expression. After filtration through a 0.22μM disc, supernatant were measured by GC. The butanol concentration from these samples is presented in Table 2. Table 2. Butanol production in anaerobic vs aerobic cultures.

These results demonstrate a significant butanol production (0.8 microgram/ml) from a low density culture in absence of O ₂ .

EXAMPLE 3. In vitro production of butyryl CoA with crude extract from a strain containing heterologous genes icmAB integrated at amyE This example demonstrates the transformation of isobutyryl-CoA into butyryl-CoA through mediation of IcmAB mutase activity expressed in B. subtilis.

After overnight culture (OD 600nm = 0.6), BSBT1 crude extracts were prepared according to the method described into the general methods section. Crude extracts were incubated for 30 minutes in presence of 0.1 mM isobutyryl-CoA. After stopping the reaction by alkalinisation, samples were acidified, extracted and assessed for the presence of butyric acid (coming from bytyryl CoA after acidification). Results are presented in Figure 2.

Figure 2 demonstrates clearly the capacity of the crude extract from BSBT1 to produce butyryl-CoA (measured as butyric acid after acidification) from isobutyryl-CoA. Isobutyryl- CoA did not chemically transform itself in butyryl-CoA since there is no butyryl-CoA detected in column 1 (Isobutyryl only). The protein extract did not contain butyryl-CoA (column 2). Only the addition of isobutyryl-CoA to the crude extract generated butyryl- CoA (column 3).

EXAMPLE 4. In vitro butanal-to- butanol activity from crude extract from a strain containing heterologous genes adhE integrated at lacA

This example demonstrates in vitro activity from the AdhE enzyme extracted from anaerobically grown cells.

After 24h growth, anaerobic (OD 600nm = 0.1 ) vs aerobic grown (OD 600nm = 0.6) xylose-induced BSBT11 crude extracts were prepared according to the method described under the general methods section. 5 mM dithiotreitol was added to the samples to protect against O ₂ (Yan, R. -T. and Chen, J.-S. 1990 Appl. Environ. Microbiol. 56: 2591-2599). Measurement of NADH consumption linked to the butanal to butanol transformation led to the results presented in Table 3 (Welch R. et al. Arch. Biochem. Biophys. 1989 273: 309-318).

Table 3. AdhE in vitro activity in anaerobic vs aerobic cultures

(1 U = 1 μM NADH oxidized / min)

These results demonstrate butanal-to-butanol activity of AdhE in absence of O ₂ and correlates well with the production of butanol observed in vivo under anaerobic conditions.

EXAMPLE 5 (Prophetic)- Production of butanol in a wild-type Bacillus subtilis strain containing heterologous genes icmAB integrated at amyE and aid and bdhA integrated at thrC .

This example describes the construction of a strain designed to produce butanol by overexpressing simultaneously the heterologous isobutyryl-CoA mutase (from Streptomyces cinnamonensis; AAC08713 and CAB59633), the acyl-CoA reductase (aid from Clostridium beijerinckii, AAD31841 ) and the alcohol dehydrogenase {bdhA from Clostridium acetobutylicum, NP_349892) activities in the wild-type B. subtilis genetic background.

The P'\ 5-ald_bdhA overexpressing cassette (SEQ ID NO: 25) is prepared by standard in vitro DNA synthesis methods and then cloned between the BamHI and EcoRI sites of pDG1664 generating plasmid pBT3. The C. acetobutylicum aid and bhdA genes are codon-pair optimized for optimal expression in B. subtilis using the same procedure as described in Example 1. The P15a/c/_6c//?-containing plasmid is transformed into P15-/cm>AS::amy£-containing strain BSBT1, selecting for erythromycin- resistant colonies by standard methods in order to integrate the P15-ald_bdhA cassette into the thrC locus. One Erm ^r colony is selected and named B. subtilis BSBT3. This strain contains a single-copy of the Pλ b-icmAB cassette integrated at the amyE locus and a single-copy of the P'\ 5-ald_bdhA cassette integrated at the thrC locus. Strain BSBT3 is grown overnight at 37 ⁰ C under anaerobic conditions in shake flask containing minimal medium, supplemented with potassium nitrate. The cells are removed and the butanol content of the supernatant is measured by the procedure described in the General Methods section.

EXAMPLE 6 (Prophetic)- Production of butanol in a Bacillus subtilis strain containing overexpressed endogenous genes alsS and HvD, and overexpressed exogenous genes icmAB integrated at amyE and adhE integrated at thrC or lacA.

This example describes the overexpression of B. subtilis genes alsS and HvD in a strain containing exogenous icmAB and adhE, in order to overproduce α- ketoisovalerate, the metabolic precursor for butanol in our invention. First, long-flanking homology PCR (LFH-PCR) is used to synthesize in vitro a spectinomycin-interrupted HvD cassette using standard procedures (WO2004/106557). To do this, two PCR fragment "arms" are first amplified using primers P1/ilvD/for and P2/ilvD/r/sp (F1 arm) and primers P3/ilvD/f/sp and P4/ilvD/rev (F2 arm) (Table 4). The resulting F1 and F2 arms are used as primers in a second round of PCR with linearized plasmid containing the spectinomycin resistance gene (spec) cassette (pDG1726; Guerout-Fleury et al. 1995. Gene 167:335-336). The resulting F1 ilvD-spec-F2ilvD DNA fragment product is finally amplified with primers P1/ilvD/for and P4/ilvD/rev in a third round of PCR. The resulting DNA fragment product is transformed into BSBT2 strain, selecting for streptomycin resistance using standard methods. One Spec ^1" colony is recovered and found to require isoleucine for growth on minimal agar plates. This strain is named BSBT4II or BSBT4 and contains a deletion of the HvD gene, interrupted by the spec gene, a single-copy of the P'\ 5-icmAB cassette integrated at the amyE locus, and a single-copy of the P15-ac//7E cassette integrated at the thrC locus, or a single copy of the Pxy\-adhE cassette integrated at the lacA locus, whereupon the strain is named BSBT4.

LFH-PCR is next used to generate DNA fragments containing the strong constitutive P26 promoter (Lee, G. and J. Pero. 1981. J. MoI. Biol. 152:247-265) inserted upstream of HvD (and replacing the native promoter). Two PCR fragment ,,arms" are first amplified using primers P1/ilvD/for and P2/ilvD/f/26 for F1 arm and primers P3/ilvD/r/26 and P4/ilvD/rev (F2 arm) (Table 4). The template is chromosomal DNA of strain 1A747. The resulting F1 and F2 arms are used as primers in a second round of PCR with linearized plasmid pUC18SP01-26 (containing the P26 promoter; Hϋmbelin et al. 1999. J. Ind. Microbiol. Biotechnol. 22:1-7). The resulting F1-P ₂₆ -F2 LFH-PCR product is amplified with primers P1/ilvD/for and P4/ilvD/rev (Table 4) in a third round of PCR. F1- P26-F2 LFH-PCR fragment containing P26-./Λ/D is transformed into BSBT4II or BSBT4, selecting for growth on minimal agar in the absence of isoleucine. One llv+ strain is recovered and found to be sensitive to spectinomycin. This strain is named BSBT6II or BSBT6 and contains the HvD gene under the transcription control of the P26 promoter, a single-copy of the Pϊb-icmAB cassette integrated at the amyE locus, and a single-copy of the P15-ac//?£ cassette integrated at the thrC locus (P26-/Λ/D Pλ b-icmABv.amyE P15- adhEv.thrC), BSBT6II, or a single-copy Pxy\-adhE cassette integrated at the lacA locus (P26-/Λ/D P ^* \5-icmAB::amyE Pxy\-adhE::lacA), BSBT6.

A similar procedure is used to construct a derivative of BSBT4II or BSBT4 in which the native alsS gene is deleted by a kanamycin resistance (kan) gene (from plasmid pDG780; Karmazyn-Campelli et al. 1989. Genes Dev. 3:150-157). Using primers described in Table 5, a DNA fragment containing the kanamycin resistance gene flanked by left and right ends of alsS is first synthesized by long-flanking homology PCR (LFH-PCR) as described above. The DNA product is then transformed into strain BSBT4II, or BSBT4, selecting for kanamycin resistance using standard methods. One Kan ^r colony is recovered and renamed BSBT5. This strain contains a deletion of HvD gene interrupted by the spec gene, a deletion of the alsS gene, interrupted by the kan gene, a single-copy of the Pi δ-icmAB cassette integrated at the amyE locus, and a single-copy of the Pϊb-adhE cassette integrated at the thrC locus, or a single-copy of the Pxy\-adhE cassette integrated at the lacA locus . The DNA fragment containing the kanamycin resistance gene flanked by left and right ends of alsS is similarly introduced into BSBT6II or BSBT6 to generate strain BSBT7II or BSBT7, containing a deletion of the alsS gene, interrupted by the kan gene, a single-copy of P26-/Λ/D at the native chromosomal site, a single-copy of the Pϊb-icmAB cassette integrated at the amyE locus, and a single-copy of the Piδ-adhE cassette integrated at the thrC locus, or a single-copy of the Pxy\-adhE cassette integrated at the lacA locus

A plasmid containing the P26-alsS cassette is next constructed. This is done by employing standard PCR methods using primers described in Table 5. LFH-PCR is used to generate DNA fragments containing the strong constitutive P26 promoter (Lee, G. and J. Pero. 1981. J. MoI. Biol. 152:247-265) inserted upstream of alsS (and replacing the native promoter). Two PCR fragment ,,arms" are first amplified using primers P1/alsS/for and P2/alsS/f/26 for F1 ' arm and primers P3/alsS/r/26 and P4/alsS/rev (F2' arm) (Table 5). The template is chromosomal DNA of strain 1 KIAl . The resulting F1 ' and F2' arms are used as primers in a second round of PCR with linearized plasmid pUC18SP01-26 (containing the P26 promoter; Hϋmbelin et al. 1999. J. Ind. Microbiol. Biotechnol. 22:1- 7). The resulting F1-P ₂₆ -F2 LFH-PCR product is amplified with primers P1/alsS/for and P4/alsS/rev (Table 5) in a third round of PCR. The P26-a/sS PCR DNA is then cloned into Topo pCR2.1 vector (InVitrogen) using standard methods. The plasmid is named pBT4.

Finally, to construct a strain combining a single copy of the P26-a/sS expression cassette at the native chromosomal site with the other integrated single-copy P26-ilvD, Pϊb-icmAB, and P'\5-adhE or Pxy\-adhE expression cassettes, BSBT5 is transformed with two different DNAs, a limiting amount of chromosomal DNA from BSBT7II or BSBT7 and excess amount of plasmid pBT4 DNA at a ratio of 1 :1000. Prototrophic colonies with the ability to grow on minimal medium without the presence of isoleucine are then selected. One Nv ⁺ colony is found to be sensitive to both kanamycin and spectinomycin, and is renamed BSBT8II or BSBT8. Diagnostic PCR and DNA sequencing are used to confirm the presence of the P26-/Λ/D at the native chromosomal site, P26-a/sS at the native chromosomal site, the P15-/cm>4S cassette integrated at the amyE locus, and the P'\ 5-adhE cassette integrated at the thrC locus, or the Pxy\-adhE cassette integrated at the lacA locus

Strain BSBT8II or BSBT8 is grown overnight at 37 ⁰ C under anaerobic conditions in shake flask containing minimal medium, supplemented with potassium nitrate. The cells are removed and the butanol content of the supernatant is measured by the procedure described in the General Methods section.

Table 4 . Primers used to generate AilvDwspec deletion mutation and P26-driven expression of HvD. Underlined sequences are homologous to the HvD region.

Name Nucleotide sequence (5'>3')

Pl/ilvD/for AAACCTGAGCAAGCAGAAGGCGCA

P2/ilvD/r/s _ϋ ^ATGTATTCACGAACGAAAATCGACATGATCTGCACCTTTTTTATCTTTAT

^[ TCG P3/ilvD/f/sϋ ATTTTAGAAAACAATAAACCCTTGCAATGGCAGAATTACGCAGTAATATGAT

P4/ilvD/rev AAATGAAGCGCTCCTTCTTTCTTCG

P2/ilvD/r/26 ^{GGACTGATCTCCAAGCGATGGCATGATCTGCACCT} ^

P3/ilvD/f/26 ^T C ^GAGAA TTAAAGGAGGGTTTCATATGGCAGAATTACGCAGTAATATGAT

Table 5 . Primers used to generate AalsSwkan deletion mutation and P26-driven expression of alsS. Underlined sequences are homologous to the alsS region.

Name Nucleotide sequence (5'>3')

Pl/ _a lsS/for AAATCCATGTATAGAGTAGGCC

P2/alsS/r/kan catccgcaactgtccatactctgGCCAGCAGATCAAACAGCTGG

P3/alsS/f/kan cggtataatcttacctatcacctcGTGTTGACAAAAGCAACAAAAGAA

P4/ _a lsS/rev TTCATTCACAACATCTTGCGG

P2/ _a lsS/r/26 ^GGA CTGATCTCCAAGCGATGGCATGATCTGCCAGCAGATCAAACAGCTGG

P3/ _a lsS/f/26 TCGAGAATTAAAGGAGGGTTTCATGTGTTGACAAAAGCAACAAAAGAA EXAMPLE 7 (Prophetic)- Production of butanol in a Bacillus subtilis strain containing P26-driven overexpressed endogenous HvBNC (strong constitutive promoter) and HvD, and exogenous genes icmAB integrated at amyE and adhE integrated at thrC or lacA.

This example describes the overexpression of the native B. subtilis HvBNC operon and the native HvD gene in a strain containing exogenous icmAB and adhE, in order to overproduce α-ketoisovalerate, the metabolic precursor for butanol in our invention. This procedure involves ectopic integration of a P26-driven overexpressing cassette of the HvBNC genes in the BSBT6II background (P ₂ eHvD P \ ₅ icmAB::amyE P ₁₅ adhE::thrC) or BSBT6 background (P ₂₆ /M3 P ^icmABv.amyE P ^adhEv.lacA)

First, a 4318bp-long PCR DNA fragment (named Fa) comprising the HvBNC gene cluster plus the natural HvC transcription terminator is amplified from genomic DNA of strain 1A747 using primers NvBNCT+ and ilvBNCT- (Table 6). Subsequently, a 174 bp long fragment (named Fb) containing the strong constitutive promoter P26 is amplified from plasmid pUC18SP01-26 (Hϋmbelin et al., 1999. J. MoI. Microbiol. Biotechnol. 22: 1- 7) using primers P1_P26/for and P2_P26_ilvBoverlap/rev (Table 6). A final PCR reaction comprises overlapping fragments Fa and Fb and primers P1_P26/for and ilvBNCT- is used to make a fragment in which the HvBNC gene cluster is under P26 transcriptional control (e.g. P26-ilvBNC; SEQ ID NO: 26). This fragment is then inserted between the BamHI and Spel sites of pSac-Kan plasmid (Genebank AY464563; BGSC ECE175; Middleton and Hofmeister, 2004. Plasmid 51.: 238-245), generating plasmid pBT5. The P26-/M3Λ/C-carrying pBT5 plasmid is transformed into strain BSBT6II, or BSBT6 selecting for kanamycin-resistant colonies. One Kan ^r colony is selected and named BSBT9II or BSBT9. This strain contains a single copy of the P26-/M3Λ/C cassette integrated at the sacA chromosomal locus, the HvD gene under the transcription control of the P26 promoter at the native locus, a single-copy of the Pϊb-icmAB cassette integrated at the amyE locus, and a single-copy of the Pi δ-adhE cassette integrated at the thrC locus, or a single-copy of the Pxy\-adhE cassette integrated at the lacA locus Table 6 . Primers used to generate the P26-/M3Λ/C expression cassette. Spel and BamHI restrictions sites are in bold underlined. Underlined sequences are those homologous to the HvD region.

Name Nucleotide sequence (5'>3')

UvBNCT+ GACGGGGGATCCAAGATATCATTAATGTATGCC

ilvBNCT- ATGCACTAGTGCATCAATATCACCTTTTAC

PiIvUP ACTGGGATCCGCAAGATATCATTAATGTATGCC

Pilv-over-cggstab/for CCGCAATAATATCGGGACTGTTGTCTTTTGTTGAACTCATATTA CG

PiIv over ceestab/rev CGTAATATGAGTTCAACAAAAGACAACAGTCCCGATATTATTG

^ CGG

Pceestab over ilvBorf GGACATGTAATCAGGGGGTAGCTAGCTCCTCCTTTAAATAAGT

^BB GAG ilvBW490L+ GGTCAGACAGC7TCAGGAAATTTTCTATGAAG

ilvBW490L- AATTTCCTGA4 GCTGTCTGACCATTCCGAGAC

Pl P26/for ACGTGGATCCCAGTACCGCCAATATTTCTCC

P2 P26 ilvBoverlap/rev CCTGTACATTAGTCCCCATATGAGTTTCACCTCCTTACTCGAGG

Strain BSBT9II or BSBT9 is grown overnight at 37 ⁰ C in shake flask containing minimal medium. The cells are removed and the butanol content of the supernatant is measured by the procedure described in the General Methodology section. EXAMPLE 8 (Prophetic)- Production of butanol in a Bacillus subtilis strain containing overexpressed endogenous HvBNC (mRNA stabilizing element) and HvD, and exogenous genes icmAB integrated at amyE and adhE integrated at thrC or lacA.

Instead of replacing the native HvB promoter sequence with a strong constitutive exogenous promoter, overexpression of the HvBNC gene cluster can also be achieved by insertion of DNA stabilising within the 5'-UTR region as described in WO 2007/065602. Such an overexpression cassette is designed by inserting between the native HvB promoter and the HvB initial codon ATG the mRNA stabilizing element (including a Shine-Delgarno sequence) located between Bacillus subtilis genes cggR and gapA (SEQ ID NO:27).

First a 324 bp long fragment (named Fl) containing the native promoter of the HvBNC gene cluster is amplified using primers PiIvUP and Pilv-over-cggstab/for (Table 6) and chromosomal DNA from wild type strain 1A747. A second fragment (named FII), 183 bp long and including the stabilizing element located between genes cggR and gapA is independently amplified using primers Pilv-over-cggstab/rev and Pcggstab_over-ilvBorf (Table 6) and chromosomal DNA from strain 1A747. Both Fl and FII DNA fragments are combined by PCR using the overlap sequences present on both fragments, leading to a larger DNA fragment (named Fill) containing the native HvB promoter and the cggR- gapA mRNA stabilizing element. This promoter-stabilizing element cassette is then inserted upstream of the ribosome binding site of HvB of the HvBNC gene cluster through PCR amplification using ilvBNCT- and the fragment Fill as primers (Table 6) and 1A747 chromosomal DNA. The resulting fragment is integrated through its Spel and BamHI end-restriction sites into the pSac-Kan plasmid, leading to plasmid pBT6. pBT6 is subsequently transformed into BSBT6II or BSBT6 following a same procedure as the one described in Example 4. One kanamycin-resistant colony is selected and renamed BSBT10II or BSBT10. This strain contains a single copy of the P26-ilvBNC cassette with the stabilizing element, integrated at the sacA chromosomal locus, the HvD gene under the transcription control of the P26 promoter at the native locus, a single-copy of the Pϊb-icmAB cassette integrated at the amyE locus, and a single-copy of the P'\5-adhE cassette integrated at the thrC locus, or a single-copy of the Pxy\-adhE cassette integrated at the lacA locus.

Strain BSBT10II or BSBT10 is grown overnight at 37 ⁰ C under anaerobic conditions in shake flask containing minimal medium, supplemented with potassium nitrate. The cells are removed and the butanol content of the supernatant is measured by the procedure described in the General Methods section.

EXAMPLE 9 (Prophetic)- Production of butanol in a Bacillus subtilis strain containing overexpressed endogenous /7W3Λ/C with a pyruvate-utilizing HvB mutant at sac A and HvD, and exogenous genes icmAB integrated at amyE and adhE integrated at thrC or lacA.

The B. subtilis wild-type NvB enzyme has a higher preference for 2-ketobutyrate (for the production of the isoleucine precursor acetohydroxybutyrate) than for pyruvate (that leads to acetolactate). A tryptophan-to-leucine mutant at position 464 of the E. coli HvB protein has been identified that increases the relative preference of the NvB for pyruvate (Engel et al. 2004 J. Biol. Chem. 279:24803-24812). Alignment of the NvB proteins from E. coli and B. subtilis shows that this tryptophan residue is conserved. Replacement of this tryptophan codon at amino acid position 490 of the B. subtilis HvB gene with a leucine codon, using standard methods known in the art, results in a mutant strain that has a decreased carbon flux to isoleucine, causing an isoleucine auxotroph, while at the same time still allows proper carbon flow into the valine pathway (i.e. without creating pantothenate or valine auxotrophy). This example describes the introduction of such an NvB mutation into the P26-/M3Λ/C expression cassette contained in strain BSBT6II or BSBT6.

Using the QuickChange procedure (Stratagene) as described by the manufacturer, and primers listed in Table 6, the tryptophan codon of the HvB gene at amino acid position 490 is changed to a leucine codon (CTT) in plasmid pBT5. The resulting plasmid containing a W490L substitution in HvB was confirmed by sequencing and named pBT7. Insertion of the P26-llvB _W49 oJlvNC cassette (SEQ ID NO: 28) into BSBT6II or BSBST6 is performed by standard plasmid transformation, as described in Example 4, leading to strain BSBT12II, or BSBT12. This strain contains a single copy of the P26-ilvB _W4 9oilvNC cassette with the mutated ilvB gene integrated at the sacA chromosomal locus, the HvD gene under the transcription control of the P26 promoter at the native locus, a single-copy of the Pϊb-icmAB cassette integrated at the amyE locus, and a single-copy of the P15-adhE cassette integrated at the thrC locus, or a single-copy of the Pxy\-adhE cassette integrated at the lacA locus

Strain BSBT12II or BSBT12 is grown overnight at 37 ⁰ C under anaerobic conditions in shake flask containing minimal medium supplemented with isoleucine and potassium nitrate. The cells are removed and the butanol content of the supernatant is measured by the procedure described in the General Methods section.