FIELD OF THE INVENTION

The present invention concerns compounds suitable as binders of RNA. RNA binders are useful in the treatment of RNA viruses. The present invention concerns specific compounds for use in methods of treatment of viruses comprising RNA.

BACKGROUND OF THE INVENTION

DNA is an important target for drug action. DNA binders are typically classified by their mode of binding - either as intercalators or as groove binders. DNA intercalators are typically planar, aromatic compounds and are able to fit in between the base pairs of DNA, whilst groove binders are typically aromatic compounds and are able to bind to either or both of the two channels on the outer surface of double-helical DNA (typically in B-form), namely the major and minor grooves. The major groove contains approximately twice the number of potential hydrogen-bonding contacts than the minor groove. In view of this, the major groove is the preferred recognition site for cellular proteins such as control proteins, promoters and repressors. In contrast, the minor groove is relatively unoccupied. The vulnerability of the minor groove makes it a particularly useful target for compounds that bind to DNA and it is the binding site for some naturally occurring antibiotics (such as netropsin and distamycin).

RNA is the genetic material of many pathogenic viruses, and so is an important target for drug action. RNA exists in either single- or double- stranded forms, and is commonly single-stranded. RNA fluctuates in structure but most often exists in a helical conformation known as the A-form. Double-stranded RNA also typically adopts an A- form helical conformation. The minor and major grooves of A-form RNA duplexes differ significantly from those of B-form DNA: the minor and major grooves are different in shape (the major groove is narrower and deeper and the minor groove is wider and shallower in A-form RNA with respect to B-form DNA) and in chemical environment the 2’-OH of RNA is situated in the minor groove.

Although a number of molecules are reported to bind to DNA, fewer RNA binders are known. The intercalation of Quinacrine (QNA) (known to be a DNA intercalator) into RNA is described by R. Sinha, M. Hossain and S. Kumar in Biochimica et Biophysica Acta, 2007, 1770, 1636-1650, i.e. quinacrine is found to interact with RNA and DNA in a similar manner. However, not all DNA binders bind to RNA (see, for example, F. A. Tanious et al., Biochemistry, 1992, 31 , 3103-3112, in which it is reported that distamycin (a minor groove binder (MGB) of DNA) is not able to bind to RNA).

Often DNA binders bind to RNA in a different way. For example, L. Dassonneville et al., in Nucleic Acids Res., 1997, 25, 22, 4487-4492, describe the ability of the compound Hoechst 33258 (a minor groove binder (MGB) of DNA) to bind to a specific site in the transactivation response region (TAR) of RNA of the human immunodeficiency virus type-1 (HIV-1 ). D. Pilch et al., in Biochemistry, 1995, 34, 9962-9976, report that berenil (a MGB of DNA) is able to bind to RNA and exhibits properties of both an intercalator and a MGB. In addition, DAPI (4',6-diamidino-2-phenylindole), which is another MGB of DNA, is reported to intercalate into RNA rather than bind at the minor groove. Indeed, the authors comment that “there are, at present, no paradigms for the design of RNA groove-binding molecules”.

More recently, I. Stolic et al., in Eur. J. Med. Chem., 2011 , 46, 743-755, describe the synthesis of 2,5-bis(amidinophenyl)-3,4-ethylenedioxythiophenes and the ability of these compounds to bind to DNA as MGBs. The same compounds are reported to bind to RNA, which the authors describe as “not common for typical DNA minor groove binders”. The authors propose that the compounds are likely binding to the major groove of RNA or are intercalating into the RNA. Thus, although the compounds bind to the minor groove of DNA, they are not thought to bind to the minor groove of RNA.

Owing to the structural complexity of RNA (the ability of the structure to fluctuate) and the structural differences relative to DNA, designing agents to bind to RNA can be challenging. Molecules that bind to DNA to produce a specific effect might not also bind to RNA to produce the analogous effect (see A. Paul et al., Molecules, 2019, 24, 946, 1 - 22). For a review on the challenges associated with designing small molecules to target RNA, see J. Gallego and G Varani, Acc. Chem. Res., 2001 , 34, 836-843. Further papers in which the challenges of targeting RNA are described include Disney, M.D.; Yildirim, I.; and Childs-Disney, J.L. Org. Biomol. Chem. 2013, 12, 1029-1039; Hermann, T., WIREs RNA, 2016, 7, 726-743; Wong, C.-H. et al., J. Am. Chem. Soc. 2014, 136, 6355-6361 ; and A.E. Hargrove, Chem. Commun. 2020, 56, 15744-14756.

Compounds having an affinity for DNA (particularly MGBs) are described in WO 2008/038018 (University of Strathclyde). Binding of these compounds to RNA is not described.

As described above, compounds that bind to DNA to produce a specific effect might not also bind to RNA to produce the analogous effect. Consequently, designing molecules that are able to bind to RNA can be challenging. There is a need in the art for alternative RNA binders and the present invention addresses this need.

SUMMARY OF THE INVENTION

The inventors have found that the specific compounds described herein are able to bind to RNA. Accordingly, the present invention provides alternative RNA binders. These binders are useful for the treatment of RNA viruses.

Viewed from a first aspect, the present invention provides a compound of formula wherein:

R ¹ is H, NHC(O)(Ci. ₄ alkyl), NO ₂ or N(R ^2a )R ^2b ,;

Q ^a and Q ^b are independently selected from the group consisting of: Het ³ ; any one of formulae la, Id and If: wherein the wavy line indicated with an asterisk crosses the bond to the right and the other wavy line crosses the bond to the left; and naphthylene, optionally substituted with one or more substituents selected from the group consisting of halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl, Ci-3haloalkyl, Ci-3alkoxy and Ci-shaloalkoxy;

L is any one of formulae laa, Ibb and Icc: laa Ibb Icc wherein the dashed lines indicate optional cis- or trans-stereochemistry and the wavy line indicated with an asterisk crosses the bond to the right and the other wavy line crosses the bond to the left; each Q ^c is independently selected from formulae la and Id; a is 1 , 2 or 3;

A is Ci-6alkylene or C-i-ehaloalkylene; b is 0 or 1 ;and

D is any one selected from the group consisting of formulae Ila to lid:

Ila lib lie lid wherein the wavy line crosses the bond that connects D to A;

Het ³ is a 9- or 10-membered, bivalent, bicyclic heterocyclic group containing one or more heteroatoms selected from N, O and S, and is optionally substituted with one or more substituents selected from the group consisting of =O, halo, cyano, nitro, N(R ^2a )R ^2b , Het ^a , Ci-4alkyl, Ci-4haloalkyl and OR ^a ;

R ^a is selected from the group consisting of H, Ci-4alkyl, Ci-4haloalkyl and aryl, wherein the aryl is optionally substituted with one or more substituents selected from the group consisting of OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy, Ci-4haloalkoxy and Het ^b ;

Het ^a and Het ^b are each independently 4- to 12-membered heterocyclic groups containing one or more heteroatoms selected from N, O and S, and are each optionally substituted with one or more substituents selected from =O, OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy and Ci-4haloalkoxy;

G ² is CH or N;

R ¹⁰ is selected from the group consisting of OH, halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl, Ci-3haloalkyl, Ci-3alkoxy and Ci-shaloalkoxy; c is 0, 1 , 2 or 3;

R ⁵ is Ci-ealkyl or C-i-ehaloalkyl;

R ⁸ is H, Ci-salkyl, Cs-zcycloalkyl or C-i-shaloalkyl;

R ^2a and R ^2b are independently selected from H, methyl, ethyl, halomethyl and haloethyl; each R ^3a is independently selected from the group consisting of H, Ci-4alkyl and Ci-4haloalkyl; R ^3b is selected from the group consisting of Ci-4alkyl, oxide and Ci-4haloalkyl; d is 0 or 1 ;

Z is selected from the group consisting of O, C(R ^3c )2 and NR ^3d ; each R ^3c is independently selected from the group consisting of H, Ci-4alkoxy, Ci. 4alkoxyCi-4alkoxy, Ci-4haloalkoxy and C- haloalkoxyC haloalkoxy; and

R ^3d is Ci-4alkyl or Ci-4haloalkyl; for use in the treatment of a virus comprising RNA.

Viewed from a second aspect, the invention provides a composition for use in the treatment of a virus comprising RNA, said composition comprising one or more compounds of formula I and a pharmaceutically acceptable excipient.

Viewed from a third aspect, the invention provides a method of treatment of a virus comprising RNA, said method comprising administering an effective amount of a compound as defined in the first aspect or a composition as defined in the second aspect.

Viewed from a fourth aspect, the invention provides use of a compound as defined in the first aspect or a composition as defined in the second aspect for binding RNA, wherein said binding is ex vivo.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Viral RNA detected in throat swabs of hamsters infected with SAR- CoV-2 and either untreated (higher values post challenge) or treated with S-MGB-363 (lower values post challenge). Lines show geometric mean and error bars represent standard deviation. Significance shown is the results of a t-test between the area under the curve.

Figure 2. Viral sub-genomic RNA detected in throat swabs of hamsters infected with SAR-CoV-2 and either untreated (higher values post challenge) or treated with S- MGB-363 (lower values post challenge). Lines show geometric mean and error bars represent standard deviation. Significance shown is the result of a Mann-Whitney U test of the sum area under the curve of each group.

Figure 3. Pathology score measure in hamster lung and nasal cavity of hamsters infected with SAR-CoV-2 and either untreated or treated with S-MGB-363. Significances shown are based on the results of a one-sided Mann-Whitney U test between controls and treated groups.

Figure 4. Percentage area of lung scans to be lesioned of hamsters infected with SAR-CoV-2 and either untreated or treated with S-MGB-363. Significances shown are based on the results of a one-sided Mann-Whitney U test between controls and treated groups. DETAILED DESCRIPTION OF THE INVENTION

As described above, compounds that bind to DNA to produce a specific effect might not also bind to RNA to produce the analogous effect. The inventors have found that compounds of formula I that are able to bind to the minor groove of DNA are, unexpectedly, also able to bind to RNA.

In the discussion that follows, reference is made to a number of terms, which are to be understood to have the meanings provided below, unless a context indicates to the contrary. The nomenclature used herein for defining compounds, in particular the compounds described herein, is intended to be in accordance with the rules of the International Union of Pure and Applied Chemistry (IUPAC) for chemical compounds, specifically the “IUPAC Compendium of Chemical Terminology (Gold Book)” (see A. D. Jenkins et aL, Pure & AppL Chem., 68, 2287-2311 (1996)). For the avoidance of doubt, if an IUPAC rule is contrary to a definition provided herein, the definition herein is to prevail.

The term “comprising” or variants thereof will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.

The term “consisting” or variants thereof will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, and the exclusion of any other element, integer or step or group of elements, integers or steps.

The term “about” herein, when qualifying a number or value, is used to refer to values that lie within ± 5% of the value specified. For example, if a pH is indicated to be about 7.40, pHs of 7.03 to 7.77 are included.

The terms “cis" and “trans" are used to describe the relationship between two features (such as features Q ^a and Q ^b of formula I) attached to separate carbon atoms that are connected by a double bond. If the two features lie on the same side of a plane positioned perpendicularly to the single bonds and passing through the double bond, then the features are cis to one another. If the two features lie on opposite sides of the plane, then they are trans to one another.

The term “alkyl” is well known in the art and defines univalent groups derived from alkanes by removal of a hydrogen atom from any carbon atom, wherein the term “alkane” is intended to define acyclic branched or unbranched hydrocarbons having the general formula C _n H2n+2, wherein n is an integer >1. Examples of alkyl groups include methyl, ethyl, n-propyl, /so-propyl, n-butyl, sec-butyl, /so-butyl and tert-butyl. The term “haloalkyl” refers to alkyl groups in which at least one hydrogen atom has been replaced with a halo atom, such as fluoro, chloro or bromo, typically fluoro. Trifluoromethyl is an example of a haloalkyl.

The term “alkylene” is used synonymously with the term “alkanediyl” and defines bivalent groups derived from alkanes by removal of two hydrogen atoms from any carbon atoms (including the removal of two hydrogen atoms from the same carbon atom). C2- C4alkylene refers to any one selected from the group consisting of ethylene, n-propylene, /so-propylene, n-butylene, sec-butylene, /so-butylene and tert-butylene.

The term “haloalkylene” refers to alkylene groups in which at least one hydrogen atom has been replaced with a halo atom, such as fluoro, chloro or bromo, typically fluoro. Tetrafluoroethylene is an example of a haloalkylene.

The term “cycloalkane” defines saturated monocyclic unbranched hydrocarbons, having the general formula C _n H2n, wherein n is an integer >3. Cs-ecycloalkyl refers to any one selected from the group consisting of cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.

The term “cycloalkyl” defines all monovalent groups derived from cycloalkanes by removal of one hydrogen atom from a ring carbon atom.

The term “alkoxy” defines monovalent groups derived from alcohols by removal of the hydrogen atom bonded to the hydroxyl group. The term “alcohols” defines groups derived from alkanes, in which one hydrogen atom has been replaced with a hydroxyl group. Methoxy is an example of a Cialkoxy group.

The term “haloalkoxy” refers to alkoxy groups in which at least one hydrogen atom has been replaced with a halo atom, such as fluoro, chloro or bromo, typically fluoro. Trifluoromethoxy is an example of a Cihaloalkoxy.

The term “oxacycloalkyl” refers to univalent cyclic ethers, derived from cycloalkanes by the replacement of a methylene group with an oxa group (a bivalent oxygen atom). Tetrahydropyranyl (also known as oxacyclohexanyl) is an example of a C ₅ oxacycloalkyl.

The term “naphthylene” refers to univalent groups derived from naphthalene by removal of a hydrogen atom from a cabon atom.

The term “aryl” defines all univalent groups formed on removing a hydrogen atom from an arene ring carbon. The term “arene” defines monocyclic or polycyclic aromatic hydrocarbons, where “aromatic” defines a cyclically conjugated molecular entity with a stability (due to delocalisation) significantly greater than that of a hypothetical localised structure. The Huckel rule is often used in the art to assess aromatic character; monocyclic planar (or almost planar) systems of trigonally (or sometimes digonally) hybridised atoms that contain (4n+2) Tr-electrons (where n is a non-negative integer) will exhibit aromatic character. The rule is generally limited to n = 0 to 5.

The term "treatment" defines the therapeutic treatment of a subject that may be a human or non-human animal, in order to impede or reduce or halt the rate of progress of a condition, or to ameliorate or cure the condition. Prophylaxis of the condition as a result of treatment is also included. References to prophylaxis are intended herein not to require complete prevention of a condition: its development may instead be hindered through treatment in accordance with the invention.

By an "effective amount" herein defines an amount of any one or a combination of the compounds or compositions described herein that is sufficient to impede a condition and thus produces the desired therapeutic or inhibitory effect.

The term “stereoisomer” is used herein to refer to isomers that possess identical molecular formulae and sequence of bonded atoms, but which differ in the arrangement of their atoms in space.

The term “enantiomer” defines one of a pair of molecular entities that are mirror images of each other and non-superimposable, i.e. cannot be brought into coincidence by translation and rigid rotation transformations. Enantiomers are chiral molecules, i.e. are distinguishable from their mirror image.

The term “racemic” is used herein to pertain to a racemate. A racemate defines a substantially equimolar mixture of a pair of enantiomers.

The term “diastereoisomers” (also known as diastereomers) defines stereoisomers that are not related as mirror images.

The term “solvate” is used herein to refer to a complex comprising a solute, such as a compound or salt of the compound, and a solvent. If the solvent is water, the solvate may be termed a hydrate, for example a mono-hydrate, di-hydrate, tri-hydrate etc, depending on the number of water molecules present per molecule of substrate.

The term “isotope” is used herein to define a variant of a particular chemical element, in which the nucleus necessarily has the same atomic number but has a different mass number owing to it possessing a different number of neutrons.

The term “prodrug” is used herein to refer to a compound which acts as a drug precursor and which, upon administration to a subject, undergoes conversion by metabolic or other chemical processes to yield a compound disclosed herein. The term “pharmaceutically acceptable excipient" defines substances other than a pharmacologically active drug or prodrug, which are included in a pharmaceutical product.

The term “enteral” is used to refer to administration of a compound through the gastrointestinal tract. Enteral administration may be oral administration, i.e. administration through the mouth.

The term “parenteral” is used to refer to administration of a compound into the body via means other than the gastrointestinal tract. Parenteral administration includes intravenous administration (directly into a vein), intramuscular administration (into the muscle), intradermal administration (beneath the skin) or subcutaneous administration (into the fat or skin). Parenteral administration may be carried out via a bolus injection, in which a discrete amount of compound is administered in one injection.

Unless otherwise specified, the term “RNA” refers to either single or double stranded RNA and the term “RNA sequence” includes any part of (or the whole of) an RNA oligomer or polymer spanning three or more bases. "DNA" refers to either single or double-stranded DNA and the term "DNA sequence" includes any part of (or the whole of) a DNA oligomer or polymer spanning three or more base pairs.

The term “virus comprising RNA” is used interchangeably herein with the term “RNA virus” and refers to a virus comprising RNA as its genetic material. RNA viruses are those belonging to Group III, Group IV, Group V or Group VI of the Baltimore classification, i.e. those comprising double stranded RNA, positive sense single stranded RNA (including those with DNA intermediates in their life cycle, such as retroviruses), or antisense (or negative sense) single stranded RNA.

As described above, in a first aspect, the present invention provides a compound of formula I: wherein

R ¹ , Q ^a , L, Q ^b , Q ^c a, A, b and D are as described above, for use in the treatment of viruses comprising RNA.

The inventors have found that compounds of formula I, in which D comprises an amidine, amine, amine oxide, quaternary ammonium, diamine or morpholine group, are surprisingly effective binders of RNA. Without being bound by theory, it is understood that compounds of formula I comprising D groups with a positive charge at physiological pH (about 7.40) are able to bind effectively to RNA. In particular, D groups with a pKa of greater than about 8 (typically a pKa of greater than about 9, such as about 9 to about 12.5) are able to bind to RNA. Thus, compounds of formula I comprising amidine, amine, amine oxide, quaternary ammonium, diamine or morpholine groups are particularly effective RNA binders.

Accordingly, it is to be understood that protonated analogues of D are also included within the scope of the invention. For example, protonation may occur at a nitrogen atom producing, for example, an amidinium ion from an amidine of formula Ila or an aminium ion from an amine of formula lib.

D of formula I is of any one of formulae Ila to lid:

Ila lib lie lid wherein the wavy line crosses the bond that connects D to A; each R ^3a is independently selected from the group consisting of H, Ci-4alkyl and Ci-4haloalkyl; R ^3b is selected from the group consisting of Ci-4alkyl, oxide and Ci-4haloalkyl; Z is selected from the group consisting of O, C(R ^3c )2 and NR ^3d ; and d is 0 or 1 . R ^3a of formulae lib and lid are often independently selected from the group consisting of methyl, H and ethyl. Typically, R ^3a of formula lib are each methyl or H, such as methyl. Typically, R ^3a of formula lid is methyl.

As described above, d of formula He may be 0 or 1 . For the avoidance of doubt, when d is 1 , the nitrogen atom bonded to R ^3b is positively charged. When R ^3b is Ci-4alkyl or Ci-4haloalkyl, the positive charge of the nitrogen to which R ^3b is bonded may be (and typically is) stabilised by a counterion, i.e. the compound is typically a cation that is stabilised by an anion to form a salt. An overview of pharmaceutical salts is provided by P. H. Stahl and C. G. Wermuth in Handbook of Pharmaceutical Salts: Properties, Selection and Use, Weinheim/Zurich:Wiley-VCH/VHCA, 2002. When the compound is a cation, it may be stabilised by one or more of the anions described in this review. The compounds may be isolated from reaction mixtures as pharmaceutically acceptable salts. The pharmaceutically acceptable salts may alternatively be prepared in situ during the isolation and purification of compounds or by treatment of the compound with a suitable acid, for example, trifluoroacetic acid, benzene sulfonic acid, hydrogen chloride, hydrogen bromide, hydrogen iodide, sulfuric acid, phosphoric acid, acetic acid, propionic acid, glycolic acid, maleic acid, malonic acid, methanesulfonic acid, fumaric acid, succinic acid, tartaric acid, citric acid, benzoic acid and ascorbic acid. When the compound is a cation, it may be stabilised by one or more of the conjugate bases of the acids listed above.

When R ^3b is oxide, the positive charge of the nitrogen atom to which R ^3b is bonded is stabilised by the negative charge of the oxide. When d is 1 , R ^3b is typically methyl or oxide.

Z is selected from the group consisting of O, C(R ^3c )2 and NR ^3d , wherein each R ^3c is independently selected from the group consisting of H, Ci-4alkoxy (such as methoxy or ethoxy), Ci-4alkoxyCi-4alkoxy (such as methoxyethoxy, ethoxyethoxy or ethoxymethoxy), Ci-4haloalkoxy (such as trifluoromethoxy) and C1.4haloalkoxyC1.4- haloalkoxy (such as trifluoromethoxyethoxy); and R ^3d is Ci-4alkyl (such as methyl or ethyl) or Ci-4haloalkyl (such as trofluoromethyl).

Sometimes, each R ^3c is independently selected from the group consisting of H, methoxy, ethoxy, methoxyethoxy, ethoxyethoxy, ethoxymethoxy, trifluoromethoxy and trifluoromethoxyethoxy. Typically, each R ^3c is independently selected from the group consisting of H, methoxy, methoxyethoxy, trifluoromethoxy and trifluoromethoxyethoxy (such as H, methoxy and methoxyethoxy).

Often, one R ^3c is H. Often, one R ^3c is H and the other R ^3c is selected from the group consisting of H, methoxy and methoxyethoxy.

Often, R ^3d is Ci-4alkyl (such as methyl). Typically, R ^3d is methyl.

In some embodiments, Z is selected from the group consisting of O, CH2, CH(OCH ₃ ), CH(OCH ₂ CH ₂ OCH ₃ ) and N(CH ₃ ).

As described above, b is 0 or 1 . In some embodiments, b is 1 when D is any one of formulae Ila, lib and lid. In these embodiments, b is 0 or 1 when D is of formula He. Typically, b is 1 .

In some embodiments, D is any one of formulae Ila, lib and He, such as Ha or Hb. In particular embodiments, D is of formula Ha.

As described above, L of formula I is any one of formulae laa, Ibb and Icc: laa Ibb Icc wherein the dashed lines indicate optional cis- or trans-stereochemistry and the wavy line indicated with an asterisk crosses the bond to the right and the other wavy line crosses the bond to the left. Typically, the dashed lines indicate trans-stereochemistry., i.e. in compounds in which L is of formula laa, Q ^a and Q ^b are typically positioned trans to one another, as in formula I2:

A of formula I is Ci-ealkylene or C-i-ehaloalkylene. A is typically linear.

Often, the Ci-ealkylene is a Ci-3alkylene such as ethylene, methylene or propylene, typically ethylene.

Often, the C-i-ehaloalkylene is a Ci-shaloalkylene. Sometimes, the Ci-ehaloalkylene is a tetrahaloethylene, difluoromethylene or a hexahalopropylene, typically tetrafluoroethylene.

In some embodiments, A is ethylene when D is any one of formulae Ila, He and lid. Typically, A is methylene or ethylene when D is of formula lib.

In some embodiments, A is ethylene as in formula I3:

As described above, a (i.e. the number of repeat units of -C(O)NHQ ^C -) is 1 , 2 or

3, such as 2 or 1 . In some embodiments, a is 2.

Each Q ^c is independently of formula la or Id: wherein the wavy line indicated with an asterisk indicates the bond to C(O), the other wavy line crosses the bond to NH, R ⁵ is C-i-ealkyl or C-i-ehaloalkyl and R ⁸ is H, Cisalkyl, C3-7cycloalkyl or C-i-shaloalkyL It is often the case (such as when D is of formula lib or He) that when a is 2, one Q ^c is of formula la and one Q ^c is of formula Id. According to particular embodiments, Q ^b - [C(O)NHQ ^C ] ₂ -C(O)- is Q ^b -[C(O)NH[formula la]] [C(O)NH[formula ld]]-C(O)-.

Often, R ⁵ , where part of Q ^c , is Ci^alkyl or Ci^haloalkyl, such as Ci-4alkyl. Sometimes, R ⁵ is methyl, isopropyl or trifluoromethyl, such as methyl or isopropyl. Typically, R ⁵ is methyl.

Sometimes (such as when D is of formula He), when a is 2 and each Q ^c is of formula la, one R ⁵ is methyl and one R ⁵ is isopropyl. Often, R ⁸ of Q ^c is H, Ci-4alkyl or Ci. 4haloalkyl, such as H or Ci-4alkyl. Sometimes, R ⁸ is H, methyl, isopentyl or trifluoromethyl. Typically, R ⁸ is H, methyl or isopentyl. When D is of formula Hb or He, it is sometimes the case that one Q ^c is of formula Id and R ⁸ is isopentyl (- CH ₂ CH ₂ CH(CH3)2).

In some embodiments, each Q ^c is of formula la, i.e. the compound is of formula I4:

As described above, Q ^b is selected from the group consisting of: Het ³ ; any one of formulae la, Id and If: wherein the wavy line indicated with an asterisk crosses the bond to C(O) and the other wavy line crosses the bond to L; and naphthylene, optionally substituted with one or more substituents selected from the group consisting of halo, nitro, N(R ^2a )R ^2b , Ci .3a Iky I, Ci-3haloalkyl, Ci-3alkoxy and Ci. shaloalkoxy; wherein

Het ³ is a 9- or 10-membered, bivalent, bicyclic heterocyclic group containing one or more heteroatoms selected from N, O and S, and is optionally substituted with one or more substituents selected from the group consisting of =O, halo, cyano, nitro, N(R ^2a )R ^2b , Het ^a , Ci-4alkyl, Ci-4haloalkyl and OR ^a ;

R ^a is selected from the group consisting of H, Ci-4alkyl, Ci-4haloalkyl and aryl, wherein the aryl is optionally substituted with one or more substituents selected from the group consisting of OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy, Ci-4haloalkoxy and Het ^b ;

Het ^a and Het ^b are each independently 4- to 12-membered heterocyclic groups containing one or more heteroatoms selected from N, O and S, and are each optionally substituted with one or more substituents selected from =O, OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy and Ci-4haloalkoxy;

G ² is CH, N or N(Ci. ₈ alkyl);

R ¹⁰ is selected from the group consisting of OH, halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl, Ci-3haloalkyl, Ci-3alkoxy and Ci-shaloalkoxy;

R ⁵ is Ci-ealkyl or C-i-ehaloalkyl;

R ⁸ is H, Ci-salkyl or C-i-shaloalkyl;

R ^2a and R ^2b are independently selected from H, methyl, ethyl, halomethyl and haloethyl; and c is 0, 1 , 2 or 3.

Typically, Q ^b is of formula la or If. Often, when L is of formula laa, Q ^b is of formula If. Often, when L is of formula Ibb, Q ^b is of formula la. Often, when L is of formula Icc, Q ^b is of formula la or If. Sometimes, when a is 2, Q ^b is of formula If. Other times, when a is 1 , Q ^b is of formula la or If.

Often, R ⁵ , when a part of Q ^b , is Ci^alkyl (such as methyl) or Ci-4haloalkyl (such as trifluoromethyl). Typically, R ⁵ of Q ^b is methyl.

In some embodiments, Q ^b is of formula If. In the structure of Q ^b represented by formula If, there are 5 available positions of attachment of L or C(O)N to Q ^b and R ¹⁰ to the ring of formula If. Often, the positions of attachment of L and C(O)N are 3 bonds away from one another (e.g. where G ² of Q ^b is CH, the positions of attachment lie para to one another). Sometimes, Q ^b is attached to L at the carbon atom adjacent to G ² (e.g. where G ² is CH, the bond to L is ortho to G ² ). Sometimes, Q ^b is attached to C(O)N at the carbon atom positioned two bonds away from G ² (e.g. where G ² is CH, the bond to C(O)N is meta to G ² ).

Often, R ^2a and R ^2b , when a part of Q ^b , are independently selected from H, methyl and halomethyl (such as trifluoromethyl). Typically, R ^2a and R ^2b are independently selected from H and methyl, such as methyl. Often, c of Q ^b is 0, 1 or 2, such as 0 or 1 . In some embodiments, c of Q ^b is 0.

In some embodiments, G ² of Q ^b is CH or N, typically CH.

In some embodiments, Q ^b is attached to L at the carbon atom adjacent to G ² and Q ^b is attached to C(O)N at the carbon atom positioned two bonds away from G ² ,so as to provide a compound of formula II:

Sometimes, Q ^b is of formula If (e.g. in which G ² represents CH or N and c represents 0, such as pyridinylene (e.g. 2,5-pyridinylene, for example wherein the 2- position of the pyridinylene ring is bound to L) or phenylene (e.g. 1 ,4-phenylene)). Other times (e.g. when Q ^a is Het ³ or of formula If), Q ^b is of formula la (e.g. in which R ⁵ is methyl). Sometimes (e.g. when Q ^a is of formula If or, particularly, Het ³ ), Q ^b is of formula Id (e.g. in which R ⁸ is C-i-salkyl or, particularly, H). Sometimes, (e.g. when Q ^a is of formula If) Q ^b is Het ³ (e.g. quinolinylene, such as 2,6-quinolinylene).

In some embodiments, the compound is any one of formulae II, 112, 113 and 114:

As described above, Q ^a is selected from the group consisting of: Het ³ ; any one of the group consisting of formulae la, Id and If: wherein the wavy line indicated with an asterisk crosses the bond to L and the other wavy line crosses the bond to R ¹ ;and naphthylene, optionally substituted with one or more substituents selected from the group consisting of halo, nitro, N(R ^2a )R ^2b , Ci .3a Iky I, Ci-3haloalkyl, Ci-3alkoxy and Ci. shaloalkoxy; wherein

Het ³ is a 9- or 10-membered, bivalent, bicyclic heterocyclic group containing one or more heteroatoms selected from N, O and S, and is optionally substituted with one or more substituents selected from the group consisting of =O, halo, cyano, nitro, N(R ^2a )R ^2b , Het ^a , Ci-4alkyl, Ci-4haloalkyl and OR ^a ;

R ^a is selected from the group consisting of H, Ci-4alkyl, Ci-4haloalkyl and aryl, wherein the aryl is optionally substituted with one or more substituents selected from the group consisting of OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy, Ci-4haloalkoxy and Het ^b ;

Het ^a and Het ^b are each independently 4- to 12-membered heterocyclic groups containing one or more heteroatoms selected from N, O and S, and are each optionally substituted with one or more substituents selected from =O, OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy and Ci-4haloalkoxy;

G ² is CH or N;

R ¹⁰ is selected from the group consisting of OH, halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl, Ci-shaloalkyl, Ci-3alkoxy and Ci-shaloalkoxy;

R ⁵ is Ci-ealkyl or C-i-ehaloalkyl;

R ⁸ is H, Ci-salkyl, Cs-zcycloalkyl or C-i-shaloalkyl;

R ^2a and R ^2b are independently selected from H, methyl, ethyl, halomethyl and haloethyl; and c is 0, 1 , 2 or 3.

Often, Q ^a is selected from the group consisting of Het ³ , formula If, optionally substituted naphthylene (such as naphthylene), formula la and formula Id. In some embodiments, Q ^a is selected from the group consisting of Het ³ , formula If and naphthylene. Often, Q ^a is selected from the group consisting of Het ³ and formula If.

Het ³ , where an option for Q ^a , is often optionally substituted with one or more substituents selected from the group consisting of halo, N(Ci-4alkyl)2 (such as dimethylamino), Ci-4alkyl (such as methyl or ethyl), Ci-4haloalkyl (such as trifluromethyl), hydroxy, Ci-4alkoxy (such as methoxy or ethoxy) and Ci-4haloalkoxy (such as trifluoromethoxy). Typically, Het ³ is unsubstituted.

Often, Het ³ , where an option for Q ^a , is optionally substituted benzoxadiazolylene (such as 2,1 ,3-benzoxadiazolylene), benzothiazolylene, quinolinylene or benzothiadiazolylene (such as 2,1 ,3-benzothiadiazolylene). . Often, Het ³ is optionally substituted 2,1 ,3-benzoxadiazolylene, benzothiazolylene, quinolinylene or 2,1 ,3- benzothiadiazolylene. In particular embodiments, when Het ³ is optionally substituted benzoxadiazolylene (such as 2,1 ,3-benzoxadiazolylene), it is bonded to L at the 4- position. In certain embodiments, when Het ³ is optionally substituted benzothiazolylene, it is bonded to L at the 2-position. Often, when Het ³ is optionally substituted quinolinylene, it is bonded to L at the 3-position. In certain embodiments, when Het ³ is optionally substituted benzothiadiazolylene (such as 2,1 ,3-benzothiadiazolylene), it is bonded to L at the 5-position.

R ¹⁰ of formula If, where an option for Q ^a , is selected from the group consisting of OH, halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl, Ci-shaloalkyl, Ci-3alkoxy and Ci-shaloalkoxy, wherein R ^2a and R ^2b are independently selected from H, Ci-2alkyl and C-iJ aloalkyl.

Often, R ^2a and R ^2b , when a part of Q ^a , are independently selected from H, methyl and halomethyl (such as trifluoromethyl). Typically, R ^2a and R ^2b are independently selected from H and methyl, such as methyl.

Often, c, when a part of Q ^a , is 0, 1 or 2, such as 0 or 1 .

In cases where G ² , when a part of Q ^a , is N, the N is typically positioned meta or para to L. In some embodiments, G ² , when a part of Q ^a , is CH.

In the structure of Q ^a represented by formula If, there are 5 available positions of attachment of R ¹ or L to Q ^a and R ¹⁰ to the ring of formula If.

In some embodiments, R ¹⁰ of Q ^a is independently selected from the group consisting of OH, halo (such as fluoro), di(C-i-2alkyl)amino (such as dimethylamino), Cisalkoxy (such as methoxy), Ci-shaloalkoxy (such as trifluoromethoxy), Ci-salkyl (such as methyl or ethyl) and Ci-shaloalkyl (such as trifluoromethyl). Often, R ¹⁰ of Q ^a is independently selected from the group consisting of OH, fluoro, dimethylamino, methoxy, trifluoromethoxy, methyl and trifluoromethyl, such as OH, fluoro, dimethylamino, methoxy and trifluoromethyl.

Often, R ⁵ , when a part of Q ^a , is Ci-4alkyl (such as methyl) or Ci-4haloalkyl (such as trifluoromethyl). Typically, R ⁵ of Q ^a is methyl.

Often, R ⁸ of Q ^a is Cs-ycycloalkyl or Ci-4alkyl. Sometimes, R ⁸ is cyclohexyl or isopentyl.

Typically, when Q ^a is of formula la or Id, R ¹ is NHC(O)(Ci-4alkyl) such as NHC(O)CH ₃ .

Sometimes, when L is of formula laa or Ibb, Q ^a is of formula If or Het ³ . Other times, when L is of formula Icc, Q ^a is of formula If, is Het ³ , or is of formula la or Id.

Sometimes, Q ^a is selected from the group consisting of Het ³ (e.g. quinolinyl, such as quinolin-2-yl or quinolin-3-yl); naphthylene (optionally substituted by one or more substituents selected from halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl and Ci-3alkoxy) (e.g. unsubstituted naphthylene, such as unsubstituted naphth-2-ylene); formula If (such as formula If in which G ² represents CH (e.g. phenyl optionally substituted at the 3- or 4- position by R ¹⁰ , wherein R ¹⁰ is as hereinbefore defined (e.g. nitro or, particularly, methoxy)) or formula If in which G ² is N (e.g. 3- or 4-pyridyl)); and formula la in which R ⁵ is as hereinbefore defined (e.g. R ⁵ represents methyl).

Sometimes, the compound of formula I contains at least one Q ^a or Q ^b group that represents naphthylene (optionally substituted by one or more substituents selected from halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl and Ci-3alkoxy), Het ³ , or formula Id or formula If.

Sometimes, Qa is of formula la or of formula If (e.g. formula If), Het ³ or naphthylene (which latter group is optionally substituted by one or more substituents selected from OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl and Ci-4alkoxy, but particularly unsubstituted naphthylene); and Q ^b is Het ³ or, particularly, formula la, Id or If.

Sometimes, when Q ^a is of formula la, Q ^b is Het ³ or, particularly, formula Id or If (e.g. If); one of Q ^a and Q ^b is of formula If, and the other is naphthylene (optionally substituted with one or more substituents selected from OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl and Ci-4alkoxy), Het ³ , or a structural fragment of formula la, Id, or If; or Q ^a is Het ³ and Q ^b is naphthylene (optionally substituted by one or more substituents selected from OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl and Ci-4alkoxy), Het ³ orformula la, Id, or If; or Q ^b is Het ³ , formula Id or, particularly, formula If.

As described above, R ¹ is H, NHC(O)(Ci-4alkyl), NO2 or N(R ^2a )R ^2b , wherein R ^2a and R ^2b are independently selected from H, C-i-salkyl and Ci-2haloalkyl. Often, when part of R ¹ , R ^2a and R ^2b are independently selected from methyl and ethyl (typically methyl). Often, R ¹ is H or NHC(O)(Ci-4alkyl), such as NHC(O)CH3. In some embodiments, R ¹ is H, i.e. the compound is of formula I5:

Sometimes, the compound is of formula I6: wherein the wavy lines indicate optional cis- or trans-stereochemistry; R ¹ is NO2, N(R ^2a )R ^2b or, particularly, H; a is 1 or, particularly, 2; Q ^a is naphthylene (optionally substituted with one or more substituents selected from halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl and Ci-3alkoxy) or, particularly, Het ³ (e.g. quinolinylene, such as quinolin-2-ylene or quinolin-3-ylene) or formula If; G ² is CH or N; and R ^2a , R ^2b , Het ³ , Q ^c , A and D are as hereinbefore defined.

Sometimes, the compound is of formula I6, wherein R ¹ is H; a is 2; Q ^a and the 6- membered ring containing G ² are positioned trans- to one another; Q ^a represents Het ³ (e.g. quinolinylene, such as quinolin-2-ylene or quinolin-3-ylene) or formula If (e.g. phenyl optionally substituted at the 3-or 4-position by R ¹⁰ , wherein R ¹⁰ is as hereinbefore defined (e.g. nitro or, particularly, methoxy)); G ² is CH (e.g. when Q ^a is Het ³ ) or N; each Q ^c is of formula la; R ⁵ is C-i-ealkyl (e.g. methyl); A is Csn-alkylene or, particularly, C2n-alkylene; and D is of formula lib wherein each R ^3a is Ci-4alkyl (e.g. methyl).

In some embodiments, the compound is of formula III or 1111 :





Often, the compound is represented by any one of structures Illa to lllk. Alternatively, the compound may be represented by any one of structures Illi to Ills, lilt to lllap, or lllaq. In some embodiments, the compound of formula I is in the form of a pharmaceutically acceptable salt, i.e. the compound may be isolated or prepared in the form of a pharmaceutically acceptable salt. The term “pharmaceutically acceptable salt” is intended to define salts that may be administered to a patient or used in pharmacy. The pharmaceutically acceptable salt may be prepared by reacting the compound with a suitable acid, such as hydrogen chloride, hydrogen bromide, hydrogen iodide, sulfuric acid, phosphoric acid, acetic acid, trifluoroacetic acid, benzene sulfonic acid, propionic acid, glycolic acid, maleic acid, malonic acid, methanesulfonic acid, fumaric acid, succinic acid, tartaric acid, citric acid, benzoic acid and ascorbic acid.

The compounds of formula I may exhibit tautomerism. All tautomeric forms and mixtures thereof are included within the scope of the invention. The compounds may exist in different stereoisomeric forms. All stereoisomeric forms and mixtures thereof, including enantiomers and racemic mixtures, are included within the scope of the invention. Individual stereoisomers of compounds of formula I, i.e. compounds comprising less than 5% 2% or 1 % (e.g. less than 1 %) of the other stereoisomer, are included. Mixtures of stereoisomers in any proportion, for example a racemic mixture comprising substantially equal amounts of two enantiomers are also included within the invention.

Diastereoisomers may be separated using conventional techniques, e.g. chromatography or fractional crystallisation. The various stereoisomers may be isolated by separation of a racemic or other mixture of the compounds using conventional, e.g. fractional crystallisation or HPLC, techniques. Alternatively the desired optical isomers may be made by reaction of the appropriate optically active starting materials under conditions which do not cause racemisation or epimerisation, or by derivatisation, for example with a homochiral acid followed by separation of the diastereomeric esters by conventional means (e.g. HPLC, chromatography over silica).

Also included are solvates and isotopically-enriched compounds of formula I. Isotopically-enriched compounds are identical to those described herein, with the exception that a quantity of the compound has a greater preponderance of an isotope of an element than that found naturally. Examples of such isotopes with which compounds of formula I may be enriched include particular isotopes of hydrogen, carbon, nitrogen, oxygen, sulfur, fluorine and chlorine, such as ² H, ³ H, ¹³ C, ¹⁴ C, ¹⁵ N, ¹⁸ 0, ¹⁷ 0, ³⁵ S, ¹⁸ F, and ³⁶ CL

According to its second aspect, the invention provides a composition for use in the treatment of viruses comprising RNA, said composition comprising one or more compounds of formula I and a pharmaceutically acceptable excipient. An extensive overview of pharmaceutically acceptable excipients is described in the Handbook of Pharmaceutical Excipients, 6 ^th Edition; Editors R. C. Rowe, P. J. Sheskey and M. E. Quinn, The Pharmaceutical Press, London, American Pharmacists Association, Washington, 2009. Any suitable pharmaceutically acceptable excipient described within this document is within the scope of the invention.

The pharmaceutically acceptable excipient may be included within the composition for the purpose of long-term stabilization of the compound, bulking up solid formulations (often referred to as "bulking agents", "fillers", or "diluents"), or to enhance activity of the compound, such as by facilitating its absorption within the body, reducing its viscosity, or enhancing its solubility. The excipient may also enhance in vitro stability of the compound, such as prevention of denaturation or aggregation. Alternatively, the excipient may be used for identification purposes, or to make the compound more appealing to the patient, for example by improving its taste, smell and/or appearance. Typically, the excipient makes up the bulk of the composition.

Excipients include diluents or fillers, binders, disintegrants, lubricants, colouring agents and preservatives. Diluents or fillers are inert ingredients that may affect the chemical and physical properties of the final composition. If the dosage of the compound of the invention is small then more diluents will be required to produce a composition suitable for practical use. If the dosage of the compound of the invention is high then fewer diluents will be required.

Binders add cohesiveness to powders in order to form granules, which may form a tablet. The binder must also allow the tablet to disintegrate upon ingestion so that the compound of the invention dissolves. Disintegration of the composition after administration may be facilitated through the use of a disintegrant.

For the avoidance of doubt, the embodiments described herein in relation to the compound defined in the first aspect of the invention apply mutatis mutandis to the second aspect. For example, the one or more compounds of the second aspect may be any one of formulae 11 to I5, II, III and Illa to Hip.

The compounds used in any of the various aspects of the invention may have a particularly high affinity for at least one RNA sequence. When bound to at least one RNA oligomer or polymer, the compounds may have a dissociation constant of less than 10- 5 M, preferably less than 10-6 M (such as 10-7 M) and particularly less than 10-8 M. In this respect, dissociation constants may be measured under conditions known to those skilled in the art, for example in water at room temperature (e.g. at or around 20°C) in the presence of a buffer (e.g. a buffer that stabilises the pH at 7.5, such as a borate (e.g. at 0.02 M) or Tris/HCI (e.g. at 0.01 M) buffer) and at an RNA concentration of between 10 and 30 mM (e.g. 20 mM). Alternatively, dissociation constants may be estimated by a comparison of the binding affinity of a compound to a set RNA sequence with the binding affinity of a well-known compound to that same sequence.

As described above, compounds of formula I bind to RNA (specifically viral RNA), thereby displacing, or inhibiting the binding to that RNA of enzymes or regulatory proteins. Enzymes that may be mentioned in this respect include those necessary for replication (thus providing the effect of inhibiting RNA replication) as well as those involved in transcription (thus providing the effect of inhibiting the expression of certain peptides (proteins, enzymes, etc.)). Affinity to RNA may be measured by techniques known to those skilled in the art, such as capillary electrophoresis. Furthermore, affinity to certain sections of RNA may be determined by techniques known to those skilled in the art, such as RNA footprinting.

Due to their ability to inhibit RNA replication, compounds of formula I have utility in the treatment of diseases that rely upon RNA replication for their propagation. Such diseases include viral infections by RNA viruses.

The first and second aspects of the invention provide a compound of formula I or a composition comprising one or more compounds of formula I for use in the treatment of a virus comprising RNA. The virus may comprise RNA that is single-stranded (ssRNA) or double-stranded (dsRNA). Examples of double-stranded RNA viruses include reoviruses and rotaviruses. Typically, the RNA within the RNA virus is single-stranded.

Single-stranded RNA viruses may be positive-sense, negative-sense or ambisense. Positive-sense RNA viruses contain RNA that acts in a similar manner to messenger RNA (mRNA) and can be immediately translated by a host cell. Examples of a positive-sense single-stranded RNA virus include coronavirus, rhinovirus, poliovirus, hepatitis C and E virus and Zika virus.

Negative-sense RNA viruses contain RNA that must first be converted to positivesense RNA by RNA-dependent RNA polymerase before they are translated by a host cell. Examples of a negative-sense single-stranded RNA virus include influenzavirus, measles virus, mumps virus, rabies virus and ebola virus. Ambisense RNA viruses resemble negative-sense viruses but contain at least one ambisense RNA segment that carries both positive-sense and negative-sense RNA.The RNA virus may be segmented or non-segmented. The genome of RNA viruses is often divided up into separate parts, i.e. separate RNA molecules, in which case it is called segmented. Each segment often codes for only one protein.

The RNA virus may be enveloped by a protein, i.e. a viral envelope. This protects the genetic material within the virus and is typically derived from portions of host cell membranes. Examples of enveloped RNA viruses include coronaviruses, hepatitis C viruses, zika viruses, influenza viruses, measles viruses, and rabies viruses.

In some embodiments, the virus comprising RNA is a Respiratory Syncytial virus, Human Rhino virus, Human Influenza virus, Influenza virus such as Influenza viruses A and B, Norovirus, Dengue virus, Yellow fever virus, West Nile virus, Zika Virus, Rift Valley fever virus, African swine fever virus, Japanese encephalitis virus, Nipah virus and coronavirus such as SARS-CoV-2.

According to its third aspect, the invention provides a method of treatment of a virus comprising RNA, said method comprising administering an effective amount of a compound of formula I or a composition as defined in the second aspect of the invention. According to another aspect of the invention, there is provided use of a compound of formula I or a composition, as defined in the second aspect, in the manufacture of a medicament for use in a method of treating a virus comprising RNA. For the avoidance of doubt, the embodiments described herein in relation to the first and second aspects of the invention apply mutatis mutandis to these aspects. For example, the compound may be any one of formulae 11 to I5, II, III and Illa to Hip and/or the composition may comprise one or more of the pharmaceutically acceptable excipients described in the Handbook of Pharmaceutical Excipients (supra). Furthermore, the RNA may be single stranded and/or positive-sense, and the virus may be enveloped and/or non-segmented, such as coronavirus.

The compounds defined in the first aspect are useful in the treatment of diseases that rely upon RNA replication for propagation, and a therapeutically effective amount of a compound of formula I may be administered to a person suffering from that disease. Such treatment may be particularly useful where the person suffering from that disease is immunocompromised.

The compounds defined in the first aspect may be particularly useful in the treatment of viral infections where the infective agent is resistant to one or more anti-viral agents having a different mode of action. In this respect, according to a further aspect of the invention there is provided a compound defined in the first aspect or a composition defined in the second aspect for use in a method of treating a viral infection where the infective agent is resistant to one or more anti-viral agents that do not act by inhibiting RNA replication. Also provided is a method of treatment of a viral infection where the infective agent is resistant to one or more anti-viral agents that do not act by inhibiting RNA replication, the method comprising administering an effective amount of a compound of formula I.

As well as having utility on their own in the treatment of diseases that rely upon RNA replication for their propagation, the compounds of the invention may be used in combination with one or more other compounds or treatment regimes that are used to treat such a disease. When used herein, the term "in combination with" includes administration of the other agents that are known to be effective in treating the disease, before, during and/or following administration of a compound of the invention. When more than one other agent is administered, the term also includes administration of the other agents at different times relative to the time of administration of a compound of the invention.

Agents that are known to be effective in treating diseases that rely upon RNA replication for their propagation include anti-viral agents.

Anti-viral agents include remdesivir, baricitinib, favipiravir, merimepodib, acyclovir, gancyclovir, AZT, ddl, amantadine hydrochloride, inosine pranobex, and vidarabine.

Where a compound of the invention is administered to a patient in combination with one or more other agents that are known to be effective in treating diseases that rely upon RNA replication for their propagation, the compound and the other agent may be administered separately or, conveniently, as a single composition. Thus, according to a further aspect of the invention, there is provided a combination product comprising a formulation comprising a compound of the invention, and a formulation comprising one or more other chemical agents that are known to be effective in treating diseases that rely upon RNA replication for their propagation.

The combination product according to this aspect of the invention may comprise separate formulations, or may comprise a single formulation including a compound of the invention and one or more other chemical agents that are known to be effective in treating diseases that rely upon RNA replication for their propagation. When the combination product comprises separate formulations, the combination product may alternatively be termed "a kit-of-parts". Often, the formulations of the combination product are formulated in admixture with a pharmaceutically-acceptable excipient, such as an adjuvant, diluent or carrier. For the avoidance of doubt, the other agents that are known to be effective in treating diseases that rely upon RNA replication for their propagation include (and typically are one or more of) the anti-viral agents described above.

The compounds and compositions of the invention may be administered orally, subcutaneously, intravenously, intraarterially, transdermally, intranasally, by inhalation, or by any other enteral or parenteral route. The compounds and compositions are typically administered in the form of pharmaceutical preparations comprising the compound of the invention either as a free base or a non-toxic organic or inorganic acid addition salt, in a pharmaceutically acceptable dosage form. Depending upon the disease and patient to be treated, as well as the route of administration, the compounds and compositions of the invention may be administered at varying doses. Suitable daily doses of the compounds of the invention in therapeutic treatment of humans are about 1 to 2000 mg/m ² .

The most effective mode of administration and dosage regimen for the compounds and compositions of the invention depends on several factors, including the particular condition being treated, the extent and localisation of that condition in the patient being treated, as well as the patient's state of health and their reaction to the compound being administered. Accordingly, the dosages of the compounds of the invention should be adjusted to suit the individual patient. Methods for determining the appropriate dose for an individual patient will be known to those skilled in the art

According to its fourth aspect, the invention provides use of a compound of formula I, as defined in the first aspect, or a composition comprising one or more compounds of formula I and a pharmaceutically acceptable excipient, as defined in the second aspect, for binding RNA, wherein said binding is ex vivo. For example, the compound or composition may be used as part of an RNA assay in which the compound or composition is used to detect the presence of RNA. The embodiments described herein in relation to the first and second aspects of the invention apply mutatis mutandis to this aspect. For example, the compound may be any one of formulae 11 to I5, II, III and Illa to Hip, the composition may comprise one or more of the pharmaceutically acceptable excipients described in the Handbook of Pharmaceutical Excipients (supra), and/or the RNA may be single stranded and/or positive-sense.

As well as having utility in the treatment of diseases, compounds of the invention are also useful in various assay methods based upon RNA binding. For example, compounds that bind to the minor groove of DNA have the ability to stabilise DNA duplexes, as well as to stabilise a fully matched (in terms of base pairs) DNA duplex to a greater extent than a mismatched DNA duplex, thereby enabling easier discrimination between the fully matched and mismatched duplexes (e.g. in terms of the melting temperatures of the duplexes).

Thus, we disclose a method of stabilising an RNA duplex formed between first and second single strands of RNA, which method comprises contacting that RNA duplex with a compound of the invention.

Further, there is also provided a method of enhancing the difference in melting temperatures between first and second RNA duplexes, wherein each RNA duplex is formed from a first single strand of RNA that is the same in each duplex and a second single strand of RNA that is different in each duplex, which method comprises contacting each RNA duplex with a compound of the invention. Often, the first RNA duplex has a greater degree of base-pair matching (e.g. it is fully matched) than the second RNA duplex, which has at least one base-pair mismatch.

Compounds that stabilise fully matched RNA duplexes to a greater extent than mismatched RNA duplexes may be used to reduce levels of "false positive" results in RNA hybridisation assay techniques, for example as described in US 6,221 ,589. The reduction in "false positive" results may be achieved through the use of more stringent conditions (e.g. higher wash temperatures) following a hybridisation reaction in the presence of a duplex-stabilising compound than is possible following a reaction in the absence of such a compound. Thus, there is further provided a method of increasing the maximum temperature of a wash following an RNA hybridisation reaction, the method comprising the provision of a compound of the invention to the hybridisation reaction mixture. When used herein, the term "maximum temperature of a wash following a RNA hybridisation reaction" refers to the highest possible wash temperature that does not result in a substantial loss of the "true positive" results (i.e. the fully or most highly matched RNA duplexes).

When used herein in relation to the above-mentioned methods involving RNA duplexes, the term "contacting" includes admixing of a compound of the invention with an RNA duplex. However, the term also includes attaching (e.g. covalently bounding) a compound of the invention (e.g. a compound of the invention bearing a haloalkyl group), or a derivative thereof (e.g. a compound of formula I) that bears a functional group (e.g. a hydroxy, amino or carboxylic acid group) that may be used to form a suitable attachment, to one or both of the single strands of RNA that form the duplex. Such "labelled" single strands of RNA may be used as primers, capture probes, or in a number of different assays (e.g. capture-detection assays, 5'-nuclease assays and Beacon assays).

Compounds of the invention may also possess fluorescence properties. Fluorescent compounds of the invention may be useful in various assay methods based upon RNA binding which involve or require fluorescence. Thus, according to a further aspect of the invention, there is provided a method of detecting dsRNA in a sample, said method comprising contacting a compound of the invention with the sample and comparing the fluorescence of said compound in contact with said sample with the fluorescence of said compound in isolation, a change in fluorescence indicating the presence of RNA in the sample.

In this embodiment of the invention, a change in fluorescence may be, for example, a change in the wavelength of light emitted by the compound of the invention, a change in the wavelength of light absorbed by said compound or a change in the intensity of light emitted by said compound. Further, the dsRNA may also be labelled with a fluorophore. When labelled in this way (and even when not so labelled), the dsRNA can act as a donor or acceptor in a "FRET"'-type assay for detecting the presence of dsRNA.

In an alternative aspect of the invention, there is provided a method of detecting and visualising dsRNA in a sample containing dsRNA, said method comprising contacting the sample with a compound of the invention and then visualising dsRNA by irradiating the sample with ultraviolet light. In this embodiment of the invention, the sample might derive from agarose gel electrophoresis experiments or from RNA microarrays.

Any discussion herein of documents, acts, materials, devices, articles or the like is not to be taken as an admission that any or all of these matters form part of the prior art base or were common general knowledge in the field relevant to the present disclosure as it existed before the priority date of each claim of this application.

It will be appreciated by those skilled in the art that numerous variations and/or modifications may be made to the invention as described herein without departing from the scope of the invention as described. The present embodiments are therefore to be considered for descriptive purposes and are not restrictive, and are not limited to the extent of that described in the embodiment. The person skilled in the art is to understand that the present embodiments may be read alone, or in combination, and may be combined with any one or a combination of the features described herein. The subject-matter of each patent and non-patent literature reference cited herein is hereby incorporated by reference in its entirety.

The invention may be further understood with reference to the following nonlimiting clauses:

1 . A compound of formula I: wherein

R ¹ is H, NHC(O)(Ci. ₄ alkyl), NO ₂ or N(R ^2a )R ^2b ,;

Q ^a and Q ^b are independently selected from the group consisting of: Het ³ ; any one of formulae la, Id and If: wherein the wavy line indicated with an asterisk crosses the bond to the right and the other wavy line crosses the bond to the left; and naphthylene, optionally substituted with one or more substituents selected from the group consisting of halo, nitro, N(R ^2a )R ^2b , Ci .3a Iky I, Ci-3haloalkyl, Ci-3alkoxy and Ci. shaloalkoxy;

L is any one of formulae laa, Ibb and Icc: laa Ibb Icc

J wherein the dashed lines indicate optional cis- or trans-stereochemistry and the wavy line indicated with an asterisk crosses the bond to the right and the other wavy line crosses the bond to the left; each Q ^c is independently selected from formulae la and Id; a is 1 , 2 or 3; A is C-i-ealkylene or C-i-ehaloalkylene; b is 0 or 1 ; and

D is any one selected from the group consisting of formulae Ila to lid:

Ila lib lie lid wherein the wavy line crosses the bond that connects D to A;

Het ³ is a 9- or 10-membered, bivalent, bicyclic heterocyclic group containing one or more heteroatoms selected from N, O and S, and is optionally substituted with one or more substituents selected from the group consisting of =O, halo, cyano, nitro, N(R ^2a )R ^2b , Het ^a , Ci-4alkyl, Ci-4haloalkyl and OR ^a ;

R ^a is selected from the group consisting of H, Ci-4alkyl, Ci-4haloalkyl and aryl, wherein the aryl is optionally substituted with one or more substituents selected from the group consisting of OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy, Ci-4haloalkoxy and Het ^b ;

Het ^a and Het ^b are each independently 4- to 12-membered heterocyclic groups containing one or more heteroatoms selected from N, O and S, and are each optionally substituted with one or more substituents selected from =O, OH, halo, cyano, nitro, N(R ^2a )R ^2b , Ci-4alkyl, Ci-4haloalkyl, Ci-4alkoxy and Ci-4haloalkoxy;

G ² is CH or N;

R ¹⁰ is selected from the group consisting of OH, halo, nitro, N(R ^2a )R ^2b , Ci-3alkyl, Ci-3haloalkyl, Ci-3alkoxy and Ci-shaloalkoxy; c is 0, 1 , 2 or 3;

R ⁵ is Ci-ealkyl or C-i-ehaloalkyl;

R ⁸ is H, Ci-salkyl, Cs-zcycloalkyl or C-i-shaloalkyl;

R ^2a and R ^2b are independently selected from H, methyl, ethyl, halomethyl and haloethyl; each R ^3a is independently selected from the group consisting of H, Ci-4alkyl and Ci-4haloalkyl;

R ^3b is selected from the group consisting of H, Ci-4alkyl, oxide and Ci-4haloalkyl; d is 0 or 1 ;

Z is selected from the group consisting of O, C(R ^3c )2 and NR ^3d ; each R ^3c is independently selected from the group consisting of H, Ci-4alkoxy, Ci. 4alkoxyCi-4alkoxy, Ci-4haloalkoxy and C- haloalkoxyC- haloalkoxy; and R ^3d is Ci-4alkyl or Ci-4haloalkyl; for use in the treatment of a virus comprising RNA.

2. The compound for the use of clause 1 , wherein b is 1 when D is any one of formulae Ila, lib and lid.

3. The compound for the use of clause 1 or clause 2, wherein A is ethylene when D is any one of formulae Ila, He and lid.

4. The compound for the use of any one of clauses 1 to 3, wherein A is methylene or ethylene when D is of formula lib.

5. The compound for the use of any one of clauses 1 to 4, wherein each R ^3a is methyl or H.

6. The compound for the use of any one of clauses 1 to 4, wherein each R ^3a is methyl.

7. The compound for the use of any one of clauses 1 to 6, wherein D is any one of formulae Ila, lib and He.

8. The compound for the use of any one of clauses 1 to 7, wherein R ^3b is selected from the group consisting of H, methyl and oxide.

9. The compound for the use of any one of clauses 1 to 8, wherein Z is selected from the group consisting of O, CH2, CH(Ci-4alkoxy), CH(Ci-4alkoxyalkoxy) and N(Ci-4alkyl).

10. The compound for the use of any of clauses 1 to 8, wherein Z is selected from the group consisting of O, CH ₂ , CH(OCH ₃ ), CH(OCH ₂ CH ₂ OCH ₃ ) and N(CH ₃ ).

11. The compound for the use of any one of clauses 1 to 3, wherein D is of formula Ha. 12. The compound for the use of any one of clauses 1 to 11 , wherein the dashed lines of formula laa indicate trans-stereochemistry.

13. The compound for the use of any one of clauses 1 to 11 , wherein A is ethylene.

14. The compound for the use of any one of clauses 1 to 13, wherein a is 2 or 1 .

15. The compound for the use of any one of clauses 1 to 13, wherein a is 2.

16. The compound for the use of clause 15, wherein one Q ^c is the structure represented by formula la and one Q ^c is the structure represented by formula Id.

17. The compound for the use of any one of clauses 1 to 16, wherein R ⁸ is Cisalkyl or C3-7cycloalkyl.

18. The compound for the use of clause 17, wherein R ⁸ is isopentyl or cyclohexyl.

19. The compound for the use of any one of clauses 1 to 15, wherein each Q ^c is of formula la.

20. The compound for the use of any one of clauses 1 to 19, wherein R ⁵ is Ci- ea Iky I.

21 . The compound for the use of clause 20, wherein R ⁵ is methyl.

22. The compound for the use of any one of clauses 1 to 21 , wherein Q ^b is of formula la or If.

23. The compound for the use of any one of clauses 1 to 22, wherein Q ^b is of formula If.

24. The compound for the use of clause 23, wherein G ² of Q ^b is CH or N. 25. The compound for the use of clause 23 or clause 24, wherein c of Q ^b is 0.

26. The compound for the use of clause 1 , wherein the compound is any one of formulae II, II2, II3 and II4: wherein R ¹ , R ⁵ , Q ^a , G ² , Q ^c , a, A, b and D are as defined in any one of clauses 1

27. The compound for the use of any one of clauses 1 to 26, wherein Q ^a is any one of Het ³ , formula If and naphthylene.

28. The compound for the use of any one of clauses 1 to 27, wherein Q ^a is a 9- membered, bivalent, bicyclic heterocyclic group containing one or more heteroatoms selected from N, O and S, and is optionally substituted with one or more substituents selected from the group consisting of halo, N(Ci-4alkyl)2, Ci-4alkyl, Ci-4haloalkyl, hydroxy, Ci-4alkoxy and Ci-4haloalkoxy; of formula If; or naphthylene. 29. The compound for the use of clause 28, wherein the 9-membered, bivalent, bicyclic heterocyclic group is quinolinylene, benzoxadiazolylene, benzothiazolylene or benzothiadiazolylene.

30. The compound for the use of any one of clauses 1 to 29, wherein when Q ^a is the structure represented by formula If, R ¹⁰ of Q ^a is OH, halo, di(Ci. 2alkyl)amino, Ci-3alkoxy, Ci-3haloalkoxy, Ci-3alkyl and Ci-shaloalkyL

31 . The compound for the use of any one of clauses 1 to 30, wherein when Q ^a is the structure represented by formula If, c of Q ^a is 0 or 1 .

32. The compound or composition for the use of any one of clauses 1 to 31 , wherein R ¹ is H.

33. The compound for the use of clause 1 , wherein the compound is of formula

III or 1111 : wherein Q ^a , G ² , R ⁵ , Q ^c and D are as defined in any one of clauses 1 to 31 .

34. The compound for the use of clause 1 , wherein the compound is of any one of formulae Illa to Illas:











A composition comprising one or more compounds as defined in any one of clauses 1 to 34 and a pharmaceutically acceptable excipient for use in the treatment of a virus comprising RNA. The compound or composition for the use of any one of clauses 1 to 35, wherein the virus is any one of the group consisting of Respiratory Syncytial Virus, Human Rhino Virus, Human Influenza Virus, Influenza virus such as Influenza viruses A and B, Norovirus, Dengue virus, Yellow fever virus, West Nile virus, Zika Virus, Rift Valley fever virus, African swine fever virus, Japanese encephalitis virus, Nipah virus and coronavirus such as SARS- CoV-2. The compound or composition for the use of any one of clauses 1 to 36, wherein the RNA is single-stranded. A method of treatment of a virus comprising RNA, said method comprising administering an effective amount of a compound as defined in any one of clauses 1 to 34 or of a composition as defined in clause 35. The method of clause 38, wherein the RNA is single-stranded and/or the virus is as defined in clause 36. 40. Use of the compound or composition defined in any one of clauses 1 to 35 in the manufacture of a medicament for use in a method of treating viruses comprising RNA.

41 . The use of clause 40, wherein the RNA is single-stranded and/or the virus is as defined in clause 36.

42. Use of a compound as defined in any one of clauses 1 to 34 or a composition as defined in clause 35 in binding RNA.

43. The use of clause 42, wherein the RNA is viral RNA.

44. The use of clause 42 or clause 43, wherein the RNA is single-stranded.

EXPERIMENTAL

The invention may be further understood with reference to the examples that follow.

General experimental methods

¹ H NMR spectra were measured on either a Bruker AV 400 at 400 MHz and 125 MHz or Bruker DRX 500 at 500 MHz and 126 MHz, with chemical shifts given in ppm (d values), relative to proton traces in solvent. The data were presented as follows: chemical shift, integration, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet, br = broad, app = apparent), coupling constant (s) in Hertz (Hz). Chemical shifts (5) were recorded relative to residual DMSO-d6 (5 = 2.50 in 1 H NMR). IR spectra were recorded on a Perkin Elmer, 1 FT-IR spectrometer. Mass spectra were obtained on a Jeol JMS AX505. Anhydrous solvents were obtained from a Puresolv purification system, from Innovative Technologies, or purchased as such from Aldrich. Purification was carried out using reverse-phase HPLC on a waters system using a C18 Luna column and gradient as follows:

HPLC Procedure: Flow rate: 6 mL/min.

The purity of all new S-MGBs was greater than 96%, as confirmed by HPLC.

General Synthesis for New S-MGBs

The appropriate pyrrole dimer (0.25 mmol) was dissolved in methanol (25 mL) and cooled with ice-water and then Pd/C-10% (50 mg) was added portionwise with stirring under nitrogen. The reaction mixture was hydrogenated for 2h at room temperature and atmospheric pressure. The catalyst was removed over celite and the solvent removed under reduced pressure. The amine so formed was dissolved in DMF (1 mL, dry). To this solution was added either (i) a pre-mixed solution (DMF, 1 mL dry, 30 mins) of the appropriate carboxylic acid (0.23 mmol), HBTU (0.46 mmol) and triethylamine (0.23 mmol) dropwise at room temperature; or (ii) a solution of methyl benzimidothioate hydrogen iodide salt (0.23 mmol) in DMF (1 mL, dry) dropwise at room temperature. The reaction mixed was stirred overnight and purified by HPLC, identifying the fraction containing the desired product by LCMS, and obtaining it as a mono or di trifluoroacetate salt (as appropriate) after freeze drying. S-MGB Characterisation Data

Compound synthesis and characterisation

All compounds were prepared as mono- or di-trifluoroacetate salts.

S-MGB-1 (lilt) (E)-1 -methyl-4-(1 -methyl-4-(4-(2-(quinolin-3-yl)vinyl)benzamido)-1 H- pyrrole-2-carboxamido)-A/-(2-morpholinoethyl)-1/-/-pyrrole-2 -carboxamide

For synthesis and characterisation see C.J. Suckling et al., J. Med. Chem. 2007, 50, 6116-6125.

S-MGB-2 (111 u) (E)-6-(4-methoxystyryl)-A/-(1 -methyl-5-((1 -methyl-5-((2- morpholinoethyl)carbamoyl)-1H-pyrrol-3-yl)carbamoyl)-1/-/-py rrol-3-yl)nicotinamide

For synthesis and characterisation see C.J. Suckling et al. (2007, supra).

S-MGB-3 (I II v) (E)-1 -methyl-4-(1 -methyl-4-(4-(2-(quinolin-3-yl)vinyl)benzamido)-1 H- pyrrole-2-carboxamido)-A/-(2-morpholinoethyl)-1/-/-pyrrole-2 -carboxamide

For synthesis and characterisation see C.J. Suckling et al. (2007, supra).

S-MGB-5 (I Haq) 1 -methyl-4-(1 -methyl-4-(4-((E)-2-(quinolin-3-yl)vinyl)benzamido)-

1 H-pyrrole-2-carboxamido)-N-(2-(((E)-1-(methylamino)-2-nitrov inyl)amino)ethyl)-1 H- pyrrole-2-carboxamide

For synthesis and characterisation see A.LKhalaf etal., Eur. J. Med. Chem. 2012, 56, 39-47.

S-MGB-131 (Illi) (E)-N-(3-(dimethylamino)propyl)-4-(4-(4-(3-methoxystyryl)ben zamido)- 1 -methyl-1 H-pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamide

For synthesis and characterisation see C.J. Suckling et al. (2007, supra).

S-MGB-170 (lllw) (E)-1 -methyl-4-(1 -methyl-4-(4-(2-(pyridin-3-yl)vinyl)benzamido)-1 H- pyrrole-2-carboxamido)-N-(2-morpholinoethyl)-1 H-pyrrole-2-carboxamide

For synthesis and characterisation see C.J. Suckling et al. (2007, supra).

S-MGB-171 (lllx) (E)-1-methyl-4-(1-methyl-4-(4-(2-(pyridin-4-yl)vinyl)benzami do)-1 H- pyrrole-2-carboxamido)-N-(2-morpholinoethyl)-1 H-pyrrole-2-carboxamide

For synthesis and characterisation see C.J. Suckling et al. (2007, supra). S-MGB-176 (Illy) (E)-1 -methyl-4-(1 -methyl-4-(4-(4-(trifluoromethyl)styryl)benzamido)- 1 H-pyrrole-2-carboxamido)-N-(2-morpholinoethyl)-1 H-pyrrole-2-carboxamide

For synthesis and characterisation see F.J. Scott et al., Bioorg. Med. Chem. Lett. 2016, 26, 3478-3486.

S-MGB-187 (II lz) (E)-4-(4-(2-(benzo[c][1 ,2,5]oxadiazol-5-yl)vinyl)benzamido)-1 -methyl- A/-(1 -methyl-5-((2-morpholinoethyl)carbamoyl)-1 /-/-py rrol-3-y I )- 1 H-pyrrole-2- carboxamide

For synthesis and characterisation see F.J. Scott et al. (2016, supra).

S-MGB-188 (lllaa) (E)-4-(4-(2-(benzo[c][1 ,2,5]thiadiazol-5-yl)vinyl)benzamido)-1 - methyl-N-(1 -methyl-5-((2-morpholinoethyl)carbamoyl)-1 H-py rrol-3-y I )- 1 H-pyrrole-2- carboxamide

For synthesis and characterisation see F.J. Scott et al. (2016, supra).

S-MGB-196 (lllab) (E)-N-(5-((1-isopropyl-5-((2-morpholinoethyl)carbamoyl)-1 H-pyrrol- 3-yl)carbamoyl)-1-methyl-1 H-pyrrol-3-yl)-6-(4-methoxystyryl)nicotinamide

For synthesis and characterisation see A.L Khalaf et al. (2012, supra).

S-MGB-206 (lilac) (E)-4-(2-(4-(4-(4-(3-methoxystyryl)benzamido)-1-methyl-1 H-pyrrole- 2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamido)ethyl)morpholine 4-oxide

For synthesis and characterisation see Scott, Fraser. “An Investigation into Nucleic Acid Binding Compounds.” University of Strathclyde Thesis, 2013 (https://suprimo.lib. strath. ac.uk/primo-explore/fulldisplay?docid=SUSTAX _Tsf268508b&context=L&vid=SUNU01&lang=en_US& search_scope=Search%20the% 20full%20Library&adaptor=Local%20Search%20Engine&isF rbr=true&tab=fulllibrary&q uery=any, contains, fraser%20scott&sortby=date&facet=frbrgroupid, include, 2906846&of fset=0)

S-MGB-207 (Iliad) (E)-4-(2-(4-(4-(6-(4-methoxystyryl)nicotinamido)-1 -methyl-1 H- pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamido)ethyl)morpholine 4-oxide

For synthesis and characterisation see Scott, Fraser (Thesis, 2013, supra).

S-MGB-208 (Him) (E)-N-(2-aminoethyl)-1 -methyl-4-(1 -methyl-4-(4-(2-(quinolin-3- yl)vinyl)benzamido)-1 H-pyrrole-2-carboxamido)-1 H-pyrrole-2-carboxamide

For synthesis and characterisation see A.L Khalaf et al. (2012, supra). S-MGB-216 (lllae) (E)-1-(2-(4-(4-(4-(3-methoxystyryl)benzamido)-1-methyl-1 H-pyrrole-

2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamido)ethyl)piperidine 1 -oxide

For synthesis and characterisation see Scott, Fraser (Thesis, 2013, supra).

S-MGB-219 (lllaf) (E)-1-(2-(1-methyl-4-(1-methyl-4-(4-(2-(quinolin-3- yl)vinyl)benzamido)-1 H-pyrrole-2-carboxamido)-1 H-pyrrole-2- carboxamido)ethyl)piperidine 1 -oxide

For synthesis and characterisation see Scott, Fraser (Thesis, 2013, supra).

S-MGB-234 (Illa) (E)-6-(4-methoxystyryl)-/V-(1 -methyl-5-((1 -methyl-5-((2- morpholinoethyl)carbamoyl)-1H-pyrrol-3-yl)carbamoyl)-1/-/-py rrol-3-yl)nicotinamide

For synthesis and characterisation see F. Giordani et al., J. Med. Chem., 2019, 62, 3021-3035.

S-MGB-235 (II lb) (E)-4-(4-(3-methoxystyryl)benzamido)-1 -methyl-A/-(1 -methyl-5-((2- morpholinoethyl)carbamoyl)-1/-/-pyrrol-3-yl)-1/-/-pyrrole-2- carboxamide

For synthesis and characterisation see F. Giordani et al., (2019, supra).

S-MGB-245 (II lag) (E)-6-(4-(dimethylamino)styryl)-A/-(1 -methyl-5-((1 -methyl-5-((2- morpholinoethyl)carbamoyl)-1H-pyrrol-3-yl)carbamoyl)-1/-/-py rrol-3-yl)nicotinamide

For synthesis and characterisation see F.J. Scott et al. (2016, supra).

S-MGB-246 (Ilin) (E)-N-(5-((5-((2-(dimethylamino)ethyl)carbamoyl)-1 -methyl-1 H-pyrrol-

3-yl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)-6-(4-(dimethylamino)styryl)nicotinamide

For synthesis and characterisation see F. Giordani et al., (2019, supra).

S-MGB-247 (lllo) (E)-N-(2-(dimethylamino)ethyl)-4-(4-(4-(3-methoxystyryl)benz amido)- 1 -methyl-1 H-pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamide

For synthesis and characterisation see F. Giordani et al., (2019, supra).

S-MGB-252 (lllah) (E)-6-(4-(dimethylamino)styryl)-N-(5-((5-((2-(4-methoxypiper idin-1 - yl)ethyl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)carbamoyl)-1 -methyl-1 H-pyrrol-3- yl)nicotinamide

Yield: 34%

IR 1665, 1576, 1528, 1435, 1406, 1366, 1288, 1171 , 1126, 800, 719 cm’ ¹ 1 H NMR (d6-DMSO): 10.45 (1 H, s), 9.97 (1 H, s), 9.02-9.08 (2H, m), 8.20-8.26 (2H, m), 7.71 (1 H, d, J = 15.9 Hz), 7.63 (1 H, d, J = 8.3 Hz), 7.53 (2H, d, J = 8.9 Hz), 7.33 (1 H, d, J = 1 .7 Hz), 7.20 (1 H, d, J = 1 .7 Hz), 7.11 (2H, t, J = 7 Hz), 6.99 (1 H, d, J = 1 .7 Hz), 6.75 (2H, d, J = 8.9 Hz), 3.88 (3H, s), 3.83 (3H, s), 3.5-3.6 (6H, m), 3.2-3.25 (4H, m), 3.0-3.1 (2H, m), 2.97 (6H, s), 2.15-2.2 (1 H, m), 1.98-2.02 (1 H. m), 1.78-1.84 (1 H, m), 1.48-1.56 (1 H, m).

LRMS: M+1 Found: 653.3 Calculated for C36H44O4N8653.36

S-MGB-253 (lllai) (E)-N-(2-(4-methoxypiperidin-1 -yl)ethyl)-4-(4-(4-(3- methoxystyryl)benzamido)-1 -methyl-1 H-pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2- carboxamide

Yield: 46%

IR 1695, 1603, 1532, 1449, 1402, 1213, 1076, 1049, 910, 874, 760, 731 , 694 cm’ ¹ 1 H NMR (d6-DMSO): 10.32 (1 H, s), 9.97 (1 H, s), 9.0-9.2 (1 H, bs), 8.21 (1 H, q, J = 4.95 Hz), 7.96 (1 H, d, J = 8.5 Hz), 7.73 (1 H, d, J = 8.5 Hz), 7.3-7.4 (4H, m), 7.17-7.24 (3H, m), 7.11 (2H, t, J = 1 .7 Hz), 6.99 (1 H, d, J = 1 .7 Hz), 6.88 (1 H, dd, J = 1 .9, 8.0 Hz), 3.87 (3H, s), 3.83 (3H, s), 3.81 (3H, s), 3.5-3.6 (6H, m), 3.26 (3H, s), 3.2-3.25 (1 H, m). 2.95-

3.1 (2H, m), 2.15-2.2 (1 H, m), 1.98-2.03 (1 H. m), 1.77-1.84 (1 H, m), 1.47-1.56 (1 H, m). LRMS: M+1 Found: 639.3 Calculated for C36H42O5N6 639.33

S-MGB-255 (lllaj ) (E)-N-(5-((5-((2-(4-methoxypiperidin-1 -yl)ethyl)carbamoyl)-1 -methyl- 1 H-pyrrol-3-yl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)-6-(4-methoxystyryl)nicotinamide Yield: 27%

IR: 1667, 1591 , 1514, 1462, 1433, 1404, 1258, 1198, 1173, 1126, 1026, 828, 799, 718 cm ^-1

1 H NMR (d6-DMSO): 10.46 (1 H, s), 9.98 (1 H, s), 8.9-9.07 (2H, m), 8.25 (1 H, dd, J = 2.3,

8.2 Hz), 8.21 (1 H, m), 7.75 (1 H, d, J = 16.1 Hz), 7.63-7.67 (3H, m), 7.33 (1 H, d, J = 1.72 Hz), 7.25 (1 H, d, J = 16.1 Hz), 7.20 (1 H, d, J = 1.72 Hz), 7.11 (1 H, d, J = 1.8 Hz), 6.98- 7.01 (3H, m), 3.88 (3H, s), 3.83 (3H, s), 3.80 (1 H, s) 3.4-3.7 (5H, m), 3.26 (3H, s), 3.2- 3.25 (1 H, m), 2.9-3.1 (2H, m), 2.15-2.2 (1 H, m), 1.98-2.02 (1 H. m), 1.78-1.84 (1 H, m), 1.48-1.56 (1 H, m).

LRMS: Found: 640.3 Calculated for C35H41O5N7 640.32 S-MGB-260 (I Ila k) (E)-N-(5-((5-((2-(4-(2-methoxyethoxy)piperidin-1 - yl)ethyl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)-6-(4- methoxystyryl)nicotinamide

Yield: 58%

IR 3292, 1647, 1593, 1512, 1462, 1432, 1404, 1258, 1198, 1173, 1126, 1026, 828, 799, 720 cm’ ¹

1 H NMR (d6-DMSO): 10.47 (1 H, s), 9.98 (1 H, s), 9.02-9.07 (2H, m), 8.19-8.27 (2H, m), 7.74 (1 H, d, J = 16.1 Hz), 7.63-7.67 (3H, m), 7.33 (1 H, d, J = 1.72 Hz), 7.25 (1 H, d, J = 16.1 Hz), 7.20 (1 H, d, J = 1.72 Hz), 7.11 (1 H, d, J = 1.8 Hz), 6.98-7.01 (3H, m), 3.88 (3H, s), 3.83 (3H, s), 3.80 (3H, s), 3.41 -3.71 (10H, m), 3.18-3.30 (4H, m), 3.05 (2H, m), 2.16 (1 H, m), 1 .98 (1 H. m), 1 .82 (1 H, m), 1 .54 (1 H, m).

HRMS: M+1 Found: 684.3505 Calculated for C37H46O6N7684.3504

S-MGB-261 (lllal) (E)-4-(4-(2-(benzo[c][1 ,2,5]oxadiazol-5-yl)vinyl)benzamido)-N-(5-((2- (4-(2-methoxyethoxy)piperidin-1 -yl)ethyl)carbamoyl)-1 -methyl-1 H-py rrol-3-y I )- 1 -methyl-

1 H-pyrrole-2-carboxamide

Yield: 31 %

IR: 3300, 1647, 1578, 1535, 1466, 1435, 1404, 1263, 1200, 1177, 1123, 1007, 878, 321 , 801 , 720 cm’ ¹

1 H NMR (d6-DMSO): 10.37 (1 H, s), 9.98 (1 H, s), 9.07 (1 H, bs), 8.22 (1 H, m), 8.11 (3H, s), 8.02 (2H, d, J = 8.4 Hz), 7.82 (2H, J = 8.4 Hz), 7.70 (1 H, d, J = 16.4 Hz), 7.62 (1 H, d, J = 16.4 Hz), 7.35 (1 H, d, J = 1.72 Hz), 7.22 (1 H, d, J = 1.72 Hz), 7.13 (1 H, d, J = 1.8 Hz), 7.01 (1 H, d, J = 1.8 Hz), 3.89 (3H, s), 3.84 (3H, s), 3.42-3.71 (10H, m), 3.2-3.3 (4H, m), 3.05 (2H, m), 2.17 (1 H, m), 1.99 (1 H. m), 1.88 (1 H, m), 1.56 (1 H, m).

HRMS: M+1 Found: 695.3297 Calculated for C37H43O6N8695.3300

S-MGB-300 (lllc) (E)-N-(3-amino-3-iminopropyl)-1-methyl-4-(1-methyl-4-(4-(2-( quinolin- 3-yl)vinyl)benzamido)-1 H-pyrrole-2-carboxamido)-1 H-pyrrole-2-carboxamide

Yield: 5%

IR: 3304, 3078, 1670, 1629, 1570, 1525, 1508, 1465, 1436, 1406, 1386, 1273, 1197, 1126, 1062, 1006, 968, 956, 894, 837, 798, 771 , 750, 721 , 680 cm’ ¹

¹ H NMR (DMSO-d ₆ ): 10.36 (1 H, s), 9.96 (1 H, s), 9.27 (1 H, d, J = 2.47), 8.90 (2H, s), 8.56 (1 H, d, J = 1.98), 8.46 (2H, s), 8.20 (1 H, t, J = 5.64 Hz), 8.03 (2H, t, J = 8.55 Hz), 8.03- 8.01 (2H, d, J = 8.55 Hz), 7.83-7.82 (2H, d, J = 8.54 Hz), 7.77 (1 H, td, J = 8.40 Hz), 7.70- 7.67 (1 H, d, J = 16 Hz), 7.65 (1 H, m), 7.64-7.61 (1 H, d, J = 16.3 Hz), 7.35 (1 H, d, J = 1.83 Hz), 7.19 (1 H, d, J = 1.85 Hz), 7.13 (1 H, d, J = 1.77 Hz), 6.98 (1 H, d, J = 2.28 Hz), 3.89 (3H, s), 3.83 (3H, s), 3.51 (2H, q, J = 7.47 Hz), 2.61 (2H, t, J = 5.95 Hz) LRMS: M+1 Found: 589.3Calculated for C33H32O3N8589.27

S-MGB-306 (lllj) N-(3-amino-3-iminopropyl)-4-(4-benzimidamido-1-methyl-1 H-pyrrole- 2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamide

Yield: 24%

IR: 3294, 3275, 3256, 3183, 3088, 1665, 1632, 1611 , 1578, 1518, 1487, 1468, 1433, 1404, 1371 , 1360, 1271 , 1184, 1128, 1070, 1001 , 891 , 839, 799, 779, 721 , 694, 660, 631 , 606 cm’ ¹

1 H NMR (d6-DMSO): 11.15 (1 H, s), 9.99 (1 H, s), 9.80 (1 H, s), 8.91 (2H, s), 8.83 (1 H, s), 8.56 (2H, s), 8.24 (1 H, t, J = 5.6 Hz), 7.87 (2H, d, 7.4 Hz), 7.80 (1 H, t, J = 7.4 Hz), 7.69 (2H, t, J = 7.7 Hz), 7.29 (1 H, d, J = 1.7 Hz), 7.20 (1 H, d, J = 1.7 Hz), 7.05 (1 H, d, J = 1.9 Hz), 6.95 (1 H, d, J = 1.8 Hz), 3.95 (3H, s), 3.84 (3H, s), 3.51 (2H, q, J = 6.4 Hz), 2.62 (2H, t, 6.4 Hz).

HRMS: M+1 Found: 435.3 Calculated for C22H26O2N8435.23

S-MGB-323 (lllk) N-(3-amino-3-iminopropyl)-4-(4-benzamido-1 -methyl-1 H-pyrrole-2- carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamide

Yield: 12%

IR: 3274, 3100, 1675, 1645, 16336, 1576, 1539, 1470, 1437, 14070, 1271 , 1203, 1164, 1126, 1065, 1032, 1004, 894, 799, 777, 723, 702, 669 cm’ ¹

1 H NMR (d6-DMSO): 10.50 (1 H, s), 10.12 (1 H, s), 9.08 (2H, s), 8.62 (2H, s), 8.37 (1 H, t, J = 5.5 Hz), 8.11 (2H, d, 1.5 Hz), 7.65-7.8 (3H, m), 7.50 (1 H, d, J = 1.8 Hz), 7.35 (1 H, d, J = 1.8 Hz), 7.28 (1 H, d, J = 1.8 Hz), 7.14 (1 H, d, J = 1.8 Hz), 4.05 (3H, s), 4.00 (3H, s), 3.68 (2H, q, J = 6.2 Hz), 2.78 (2H, t, 6.2 Hz).

HRMS: M+1 Found: 436.3 Calculated for C22H25O3N7436.21

S-MGB-351 (Hip) 2-(4-(4-(4-chlorobenzimidamido)-1 -methyl-1 H-pyrrole-2- carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamido)-N-(3-(dimethylamino)propyl)-5- isopentylthiazole-4-carboxamide

For synthesis and characterisation see R.J.O. Nichol et al., Med. Chem. Commun., 2019, 10, 1620-1634. S-MGB-352 (lllq) 2-(4-(4-(3-chlorobenzimidamido)-1-methyl-1 H-pyrrole-2- carboxamido)-1-methyl-1 H-pyrrole-2-carboxamido)-N-(3-(dimethylamino)propyl)-5- isopentylthiazole-4-carboxamide

For synthesis and characterisation see R.J.O. Nichol et al. (2019, supra).

S-MGB-354 (II lr) N-(3-(dimethylamino)propyl)-2-(4-(4-(3-fluorobenzimidamido)- 1 - methyl-1 H-pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2-carboxamido)-5- isopentylthiazole-4-carboxamide

For synthesis and characterisation see R.J.O. Nichol et al. (2019, supra)..

S-MGB-356 (lllam) 2-acetamido-5-cyclohexyl-N-(1 -methyl-5-((1 -methyl-5-((2- morpholinoethyl)carbamoyl)-1 H-pyrrol-3-yl)carbamoyl)-1 H-pyrrol-3-yl)thiazole-4- carboxamide

Yield: 16%

IR: 2960, 2890, 1659, 1651 , 1543, 1464, 1433, 1404, 1262, 1198, 1130, 1103, 833, 799, 777, 721 cm’ ¹

1 H NMR (d6-DMSO): 12.08 (1 H, s), 9.92 (1 H, s), 9.57 (2H, m), 8.23 (1 H, t, J = 5.3 Hz), 7.26 (1 H, d, J = 1.6 Hz), 7.20 (1 H, d, J = 1.6 Hz), 7.17 (1 H, d, J = 1.6 Hz), 7.01 (1 H, d, J = 1.6 Hz), 4.0-4.1 (2H, m) 3.87 (3H, s), 3.84 (3H, s), 3.5-3.7 (8H, m), 3.25-3.35 (2H, m), 3.1-3.2 (2H, m), 2.17 (3H, s), 1.95-2.05 (2H. m), 1.75-1.85 (2H, m), 1.65-1.75 (1 H, m), 1.3-1 .4 (4H, m).

HRMS: M+1 Found: 625.2913 Calculated for C30H41O5N8625.2915

S-MGB-360 (Hid) (E)-A/-(3-amino-3-iminopropyl)-4-(4-(4-(2-(benzo[c][1 ,2,5]oxadiazol-5- yl)vinyl)benzamido)-1 -methyl-1 /-/-pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2- carboxamide

Yield: 7.9%

IR: 720, 752, 801 , 833, 878, 955, 1007, 1125, 1180, 1200, 1267, 1404, 1435, 1464, 1528, 1564, 1580, 1638, 1657, 1674 cm’ ¹

¹ H NMR (DMSO-d ₆ ): 10.38(1 H, s), 9.96(1 H, s), 8.91 (2H, s), 8.47(2H, s), 8.22(1 H, t, J = 5.7Hz), 8.13(3H, m), 8.03-7.99(2H, m), 7.83-7.79(2H, m), 7.72(1 H, d, J = 16.2Hz), 7.64(1 H, d, J = 16.2Hz), 7.35(1 H, d, J = 1.4Hz), 7.20(1 H, d, J = 1.4Hz), 7.13(1 H, d, J = 1.4Hz), 6.98(1 H, d, J = 1.4Hz), 3.89(3H, s), 3.83(3H, s), 3.54(2H, q, J = 6.3Hz), 2.63(2H, t, J = 6.3Hz).

HRMS: M+1 Found: 580.3 Calculated for C30H29O4N9 580.24 S-MGB-362 (Hie) (E)-/V-(3-amino-3-iminopropyl)-4-(4-(4-(2-(benzo[d]thiazol-2 - yl)vinyl)benzamido)-1 -methyl-1 H-pyrrole-2-carboxamido)-1 -methyl-1 H-pyrrole-2- carboxamide

Yield: 20%

IR: 721 , 756, 799, 831 , 949, 1013, 1063, 1123, 1180, 1200, 1267, 1404, 1433, 1468, 1516, 1533, 1578, 1632, 1663 cm’ ¹

¹ H NMR (DMSO-d ₆ ): 10.41 (1 H, s), 9.97(1 H, s), 8.91 (2H, s), 8.47(2H, s), 8.22(1 H, t, J = 5.8Hz), 8.15(1 H, d, J = 7.8Hz), 8.03-8.01 (3H, m), 7.96(2H, d, J = 8.4Hz), 7.77(2H, d, J = 3.7Hz), 7.57(1 H, dt, J = 1 .1 Hz & J = 7.1 Hz), 7.49(1 H, dt, J = 1 .1 Hz & J = 7.1 Hz), 7.36(1 H, d, J = 1.4Hz), 7.20(1 H, d, J = 1.4Hz), 7.14(1 H, d, J = 1.4Hz), 6.98(1 H, d, J = 1.4Hz), 3.89(3H, s), 3.83(3H, s), 3.54(2H, q, J = 6.7Hz), 2.63(2H, t, J = 6.7Hz).

HRMAS: Found: 595.2233 Calculated for C31H31O3N8S 595.2234

S-MGB-363 (II If) (E)-A/-(5-((5-((3-amino-3-iminopropyl)carbamoyl)-1 -methyl-1 H-pyrrol- 3-yl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)-6-(4-(dimethylamino)styryl)nicotinamide Yield: 29%

IR: 720, 774, 799, 833, 1126, 1167, 1182, 1289, 1314, 1364, 1406, 1433, 1462, 1528, 1572, 1665 cm’ ¹

¹ H NMR (DMSO-d ₆ ): 10.45(1 H, s), 9.96(1 H, s), 9.05(1 H, d, J = 1.7Hz), 8.48(2H, s), 8.26(1 H, dd, J = 8.3Hz & J = 7.8Hz), 8.22(1 H, t, J = 5.5Hz), 7.74(1 H, d, J = 16.0Hz), 7.64(1 H, d, J = 8.2Hz), 7.55(2H, d, J = 8.8Hz), 7.35(1 H, d, J = 1.5Hz), 7.20(1 H, d, J = 1.5Hz), 7.14(1 H, d, J = 16.0Hz), 7.12(1 H, d, J = 1.5Hz), 6.98(1 H, d, J = 1 ,5Hz),6.78(2H, d, J = 8.8Hz), 3.89(3H, s), 3.83(3H, s), 3.53(2H, q, J = 6.3Hz), 2.99(6H, s), 2.63(2H, t, J = 6.3Hz).

HRMS: M+2/2 Found: 291 .6502 Calculated for C31H37O3N9 291 .6504

S-MGB-364 (Illg) (E)-N-(3-amino-3-iminopropyl)-1 -methyl-4-(1 -methyl-4-(4-(4-

(trifluoromethyl)styryl)benzamido)-1 H-pyrrole-2-carboxamido)-1 H-pyrrole-2- carboxamide

Yield: 27%

IR: 720, 758, 799, 841 , 951 , 966, 1013, 1065, 1109, 1165, 1200, 1263, 1323, 1402, 1433, 1464, 1524, 1580, 1634 cm’ ¹

1 H NMR (DMSO-d6): 3.36(1 H, s), 9.96(1 H, s), 8.91 (2H, s), 8.50(2H, s), 8.22(1 H, t, J = 5.4Hz), 8.01 (2H, d, J = 8.2Hz), 7.88(2H, d, J = 8.2Hz), 7.81 (4H, m), 7.52(2H, s), 7.35(1 H, s), 7.19(1 H, s), 7.13(1 H, s), 6.98(1 H, s), 3.89(3H, s), 3.83(3H, s), 3.54(2H, q, J = 6.4Hz), 2.63(2H, t, J = 6.4Hz).

HRESIMS: Found: 606.2434 Calculated for C31H31O3N7F3 606.2435

S-MGB-373 (Ilian) 2-(4-(4-(3-chlorobenzimidamido)-1-methyl-1 H-pyrrole-2- carboxamido)-1-methyl-1 H-pyrrole-2-carboxamido)-5-isopentyl-N-(2- morpholinoethyl)thiazole-4-carboxamide

For synthesis and characterisation see R.J.O. Nichol et al. (2019, supra).

S-MGB-377 (Ills) (E)-N-(3-(dimethylamino)propyl)-5-isopentyl-2-(1 -methyl-4-(4-(4- (trifluoromethyl)styryl)benzamido)-1 H-pyrrole-2-carboxamido)thiazole-4-carboxamide

For synthesis and characterisation see R.J.O. Nichol et al. (2019, supra).

S-MGB-394 (I Hao) (E)-4-methyl-4-(2-(1 -methyl-4-(1 -methyl-4-(4-(2-(quinolin-3- yl)vinyl)benzamido)-1 H-pyrrole-2-carboxamido)-1 H-pyrrole-2- carboxamido)ethyl)morpholin-4-ium

For synthesis and characterisation see Scott, Fraser (Thesis, 2013, supra).

S-MGB-407 (lllh) 4-(4-(2-naphthamido)benzamido)-N-(5-((3-amino-3- iminopropyl)carbamoyl)-1-methyl-1 H-pyrrol-3-yl)-1-methyl-1 H-pyrrole-2-carboxamide Yield: 10%

IR: 3223, 1627, 1570, 1500, 1436, 1406, 1386, 1363, 1323, 1271 , 1249, 1199, 1184, 1130, 1062, 839, 800, 773, 758, 742, 721 , 682 cm’ ¹

¹ H NMR (DMSO-d ₆ ): 10.68 (1 H, s), 10.26 (1 H, s), 9.96(1 H, s), 8.91 (2H, bs), 8.63 (1 H, s), 8.48(2H, bs), 8.21 (1 H, t, J = 6.0 Hz), 8.13-8.02 (4H, m), 7.99 (4H, s), 7.67 (2H, m), 7.34 (1 H, d, J = 1 .5 Hz), 7.20 (1 H, d, J = 1 .5 Hz), 7.12 (1 H, d, J = 1 .5 Hz), 6.98 (1 H, d, J = 1.5 Hz), 3.89 (3H, s), 3.83 (3H, s), 3.52 (2H, q, J = 6.5Hz), 2.63(2H, t, J = 6.5Hz).

HRMS: M+1 Found: 605.2603 Calculated for C33H33O4N8 605.2606

S-MGB-408 (Illi) N-(4-((5-((5-((3-amino-3-iminopropyl)carbamoyl)-1-methyl-1 H-pyrrol-3- yl)carbamoyl)-1 -methyl-1 H-pyrrol-3-yl)carbamoyl)phenyl)benzo[c][1 ,2,5]oxadiazole-5- carboxamide

Yield: 12%

IR: 721 , 770, 800, 837, 887, 1011 , 1126, 1186, 1200, 1260, 1337, 1404, 1435, 1466, 1524, 1582, 1632, 1670 cm’ ^{1 1} H NMR (DMSO-d ₆ ): 10.88 (1 H, s), 10.28 (1 H, s), 9.95 (1 H, s), 8.91 (2H, bs), 8.75 (1 H, s), 8.47 (2H, bs), 8.24-8.20 (2H, m), 8.04-8.00 (3H, m), 7.94 (2H, d, J = 8.5 Hz), 7.33 (1 H, d, J = 1.5 Hz), 7.19 (1 H, d, J = 1.5 Hz), 7.11 (1 H, d, J = 1.5 Hz), 6.97 (1 H, d, J = 1.5 Hz), 3.89 (3H, s), 3.83 (3H, s), 3.52 (2H, q, J = 6.5 Hz), 2.63 (2H, t, J = 6.5Hz).

LRMS: M+1 Found: 597.3 Calculated for C29H29O5N10579.23

S-MGB-568 (lllap) (E)-1-methyl-N-(1-methyl-5-(4-methylpiperazine-1-carbonyl)-1 H- pyrrol-3-yl)-4-(4-(2-(quinolin-3-yl)vinyl)benzamido)-1 H-pyrrole-2-carboxamide

Yield: 12%

IR 3286, 1670, 1637, 1527, 1506, 1463, 1433, 1404, 1381 , 1352, 1263, 1180, 1120, 1062, 1014, 964, 893, 866, 833, 796, 771 , 750, 719, 680 cm’ ¹

1 H NMR (d6-DMSO) 10.36 (1 H, s), 9.94 (1 H, s), 9.28 (1 H, d, J = 2.6 Hz), 8.57 (1 H, d, J = 1.98 Hz), 8.05-8.03 (2H, t, J = 8.5 Hz), 8.02-8.01 (1 H, d, J = 8.3 Hz), 7.84 - 7.82 (2H, d, J = 8.4 Hz), 7.77 (1 H, td, J = 1.2 Hz), 7.70-7.67 (1 H, d, J = 16.7 Hz), 7.65 (1 H, m), 7.64-7.61 (1 H, d, J = 16.4 Hz), 7.32 (1 H, d, J = 1.67 Hz), 7.30 (1 H, d, J = 1.91 Hz), 7.16 (1 H, d, J = 1.67 Hz), 6.55 (1 H, d, J = 1.52 Hz), 4.46 (2H, d, J = 14.22 Hz), 3.89 (3H, s), 3.69 (3H, s), 3.49 (2H, d, J = 11 .28 Hz), 3.30 (2H, t, J = 11 .74 Hz), 3.09 (2H, m, J = 9.95 Hz), 2.86 (3H, s)

LRMS: M+1 Found: 602.00 Calculated for C35H35O3N7602.29

RNA binding

Fluorescence intercalator displacement (FID) method

RNA (Polyadenylic acid - Polyuridylic acid sodium salt, double-stranded homopolymer, P1537, Sigma) was dissolved in 1 mM pH 7.4 phosphate buffer (containing 0.27 mM potassium chloride, 13.7 mM sodium chloride) to a concentration of 1 mg/mL in, SybrSafe (SYBR® Safe DNA Gel Stain, x10,000 in DMSO, S33102 Invitrogen) was used as supplied by the manufacturer in DMSO, and S-MGBs were prepared as 10 mM stocks in DMSO. These stock solutions were diluted appropriately with each other and 1 mM phosphate buffer to give test solutions comprised of 20 pM S-MGB, 12500-fold dilution of SybrSafe and 3.76 ng/mL RNA. Control solutions of RNA and SybrSafe, RNA, and SybrSafe at these concentrations were also prepared. Test and control solutions heated to 30 °C and the fluorescence measured using the SYBER filter setting of a StepOnePlus using melt analysis mode (StepOne Software v2.3). The reduction of fluorescence due to the S-MGBs was calculated as a normalised percentage based on the fluorescence measured due to the control with SybrSafe and RNA as maximum and the control with only SybrSafe as minimum. Low normalised percentage indicates a greater ability to displace SybrSafe from the RNA, and suggests strong binding to RNA.

In vitro activity against SARS-CoV-2

For further information on the plaque inhibition assay and the data analysis, see Bewley K. R. et al. Nat. Protoc. 2021 , 16(6):3114-3140.

Cell and Virus

SARS-CoV-2 (hCoV-19/Australia/VIC01/2020) was provided by The Doherty Institute, Melbourne, Australia at P1 and passaged twice in Vero/hSLAM cells [ECACC 04091501], Whole genome sequencing was performed on the working stock at Passage 3, using both Nanopore and Illumina technologies and no significant changes in the viral sequence were observed. Virus titre was determined by a plaque assay on Vero E6 cells [ECACC 85020206], Cell lines were obtained from the European Collection of Authenticated Cell Cultures (ECACC) PHE, Porton Down, UK. Cell cultures were maintained at 37 °C in minimal essential media (MEM) (Life Technologies, California, USA) supplemented with 10% foetal bovine serum (FBS) (Sigma, Dorset, UK) and 25 mM HEPES (Life Technologies).

Plaque inhibition assay

A microplaque inhibition assay was used to assess the inhibitory effect of various compounds. Compounds were diluted 2-fold over a 12-step dilution range, in duplicate. A fixed concentration of wildtype SARS-CoV-2 was added to the diluted compounds. Additional assay wells included virus-free and untreated virus-only controls. The plates (diluted compound & virus) were then incubated for 1 hr at 37°C to allow the compounds to neutralise the virus. The contents of the neutralisation plates were then transferred into 96-well plates containing Vero-E6 cells and the virus was allowed to adsorb to the cells for 1 hr at 37°C. The inocula were removed from the cell plates and a viscous overlay (1 % CMC) added (test compound was added to the overlay media). The plates were then incubated for 24 hours. The cells were then fixed using 8% formalin for >8 hrs and an immunostaining protocol performed on the fixed cells, as described previously by Bewley etal. (2021 , supra). Stained foci were counted using an ELISpot counter (Cellular Technology Limited (CTL)). The counted foci data were then imported into R- Bioconductor. A positive control, chloroquine diphosphate (50 - 0.02 pM), was run alongside test compounds, on each assay plate. Data analysis

A mid-point probit analysis (written in R programming language for statistical computing and graphics) was used to determine the amount of compound (pM) required to inhibit SARS-CoV-2 infectious viral foci by 50% (IC ₅ o) compared with the virus only control. All outliers were included in the mid-point probit analysis.

The positive control, chloroquine diphosphate (50 - 0.02 pM), is consistent across assays where an IC ₅ o of 0.641 pM was recorded with a 95% confidence interval range of 0.448 - 0.912. The dashed lines are the 95% confidence intervals.

In vitro activity against Hepatitis C Virus (HCV)

Cell Culture

Human hepatoma Huh7 cells (Nakabayashi et aL, 1982) cells were grown in Dulbecco’s modified Eagle medium (Life Technologies) supplemented with 10% fetal calf serum, 2 mM L-glutamine, 100 U/ml penicillin, 100 p g/ml streptomycin and 0.1 M nonessential amino acids as described (see Witteveldt, J., Martin-Gans, M. & Simmonds, P. Antimicrob Agents Chemother 60, 2981-2992 (2016) and Witteveldt, J. et al. J Gen Virol 90, 48-58 (2009). Huh7-J20 cells were propagated as above, but in the presence of 2 p g/ml puromycin (Sigma) (see Iro, M. et al. Antiviral Res 83, 148-155 (2009))

Generation of cell culture infectious HCV (HCVcc)

The HCVcc used in this study was strain JFH-1 (kindly provided by T. Wakita as plasmid containing cDNA sequence (Wakita, T. et al. Nature Med 11, 791-796 (2005))) and its cell-culture adaptive mutant JFH-1 DSGCSL (Zhou, X. et al. Stem Cell Rep 3, 204-214 (2014)). Infectious virus was generated and titrated as previously described (Angus, A. G. et al. J Virol 86, 679-690 (2012); Wakita, T. et al., Nature Med 11, 791- 796 (2005); and Zhou, X. et al. Stem Cell Rep 3, 204-214 (2014)).

Anti-HCV Assays

The Huh7-J20 reporter cell line, seeded into 96-well tissue culture dish, were infected with HCVcc in the presence or absence (i.e. DMSO control) of compounds and the levels of virus infectivity was determined by measuring the secreted alkaline phosphatase (SEAP) medium at indicated time post-infection as described previously (Iro, M. et al., 2009, supra). Antiviral screenings were performed using two different infection models. For the Viral Entry model: Huh7-J2023 cells were pre-treated for 1 h and exposed to the cell culture infectious HCV (HCVcc) gt 2a strain JFH-1 in the presence of 0.63 pg/mL compound or equivalent DMSO (as a vehicle control) for 3 h. The cells were then washed and re-fed with fresh medium (without drug) for 72 h. For the Viral Life Cycle model: Huh7-J20 cells were pre-treated, infected with JFH-1 HCVcc for 3 h in the presence of drugs or DMSO, as the Viral Entry model, and then exposed to the compounds for a further 72 h. In both models, the antiviral activity was determined by measuring SEAP levels in the infected cell medium. In parallel, cell viability was also determined under the same conditions. Infectivity is expressed as '% activity relative to DMSO (i.e. no drug) control'. For dose-response scales, Huh7-J20 were infected with HCVcc according to the Virus Life Cycle model. All the compounds were tested using appropriate starting concentrations with 3-fold dilutions. The antiviral activity was determined normalizing results to DMSO-treated cells and IC ₅ o values were calculated using a non-linear regression function with GraphPad Prism 6 software.

Cell viability assay

Huh7-J20 cells were tested for viability in the same conditions described for antiviral assays. Cells grown in a 96-well tissue culture plate in the presence of the drugs or DMSO control were incubated with the WST-1 reagent (Roche) for 3 h as per the manufacturer’s protocol. Cell viability was obtained reading absorbance at 450 nm with PHERAstar (BMG Labtech). Cell viability is expressed as '% activity relative to DMSO (i.e. no drug) control'.

In vitro activity against influenza

Cells were seeded in 3 x 96 well plates for cell line A549at appropriate cell density (8x10 ⁵ cells/mL) in assay media and incubated overnight (37 °C). Test articles were diluted to 10x test concentration and 10pL of each dilution was transferred to the assay plates for a final test concentration of 20pM. Inhibitor control compounds were also prepared at 10x test concentration and added to plates. 20pL trypsin treated TPCK was added to all wells on the plates to facilitate viral infection. Finally, 20pL diluted virus stock (2.81 x10 ⁶ TCID ₅ o/mL) was added to achieve previously optimised test MOI (0.5). Plates were incubated for 72h at 37°C/5% CO2. Viral infection was determined by Accelerated Viral Inhibition Neuraminidase Assay (AVINA). Percentage viral inhibition was calculated relative to uninfected cells and virus control to determine the antiviral activity of the test compounds. In vivo activity against SARS-CoV-2

Study design

Twelve 7-9-week-old, Golden Syrian hamsters (Mesocricetus auratus) were divided into two groups of six, each comprising three males and three females. Animals were housed in pairs prior to challenge. After challenge, animals were caged individually within a containment level 3 facility. Both groups were challenged intranasally with a target dose of 5E+04 plaque forming units (PFU) of SARS-CoV-2 (see below). The experimental group received 4 doses of MGB-363 (5mg/kg) with two separate intraperitoneal injections on both day 1 and day 2 post challenge (see below). The control group received no treatment.

Table 1: Study procedures and samples

Health monitoring

Hamsters were weighed upon arrival at the facility then hamsters were weighed, and temperatures recorded daily, and clinical observations were made twice daily. After each IP injection of MGB-363 hamsters were also monitored for behavioural changes or signs of discomfort.

Preparation and Challenge of SARS-CoV-2

The challenge agent used in this study was SARS-CoV-2 virus, VERO/hSLAM cell passage 3 (Victoria/1/2020) stock ID ASL401 , titre 2.4E+07 PFU/ml. The challenge item was stored at <-60°C prior to inoculum preparation. For this study a dose of 5.0x10 ⁴ pfu in 200 pL PBS. The total volume of 200 pL of inoculum material was administered and distributed evenly between both nares. This procedure is performed slowly, ensuring each droplet has gone into the nasal cavity before releasing another droplet.

Confirmation of Challenge Dose

The challenge dose was confirmed by plaque assay infected on the day of challenge. Dilutions of the challenge material were plated in triplicate on each assay plate for determination of challenge titre.

The challenge dose was diluted in serum-free MEM containing antibiotic/antimycotic (Life Technologies) and incubated in 24-well plates (Nunc, ThermoFisher Scientific, Loughborough, UK) with Vero E6 cell monolayers. Virus was allowed to adsorb at 37 °C for 1 hour, then overlaid with MEM containing 1.5% carboxymethylcellulose (Sigma), 4% (v/v) foetal bovine serum (Sigma) and 25 mM HEPES buffer (Life Technologies). After incubation at 37 °C for 5 days, the plates were fixed overnight with 20% (w/v) formalin/PBS, washed with tap water and stained with methanol crystal violet solution (0.2% v/v) (Sigma).

Treatment Preparation and Administration

MGB-363 was made up to a final concentration of 2.5 mg/ml in saline containing 10% DMSO. These doses were prepared and transferred to the containment level 3 facility the day before use. Doses were stored at room temperature prior to use. All animals in the treatment group were injected on 4 occasions with 200 uL IP of 5 mg/kg MGB-363. These were administered twice on day 1 post-challenge and twice on day 2 post-challenge. Injections on the same day were administered first between 07:00 and 10:00 and the second between 14:00 and 16:00.

In-life Sampling

Hamsters were put under sedation via inhalation using isoflurane within a chamber. Throat swabs were taken into 1 mL viral transport medium pre-challenge and at days -2, 2, 4, 6 and 7.

Polymerase Chain Reaction

RNA was isolated throat swabs. Samples were inactivated in AVL (Qiagen) and ethanol. Downstream extraction was performed using the BioSprint™ 96 One-for-AII vet kit (Indical) and Kingfisher Flex platform as per manufacturer’s instructions. Tissue samples were performed using the BioSprint™ 96 One-for-AII vet kit (Indical) and Kingfisher Flex platform as per manufacturer’s instructions.

Reverse transcription quantitative polymerase chain reaction (RT-qPCR) targeting a region of the SARS-COV-2 nucleocapsid (N) gene was used to determine viral loads using TaqPath™ 1-Step RT-qPCR Master Mix, CG (Applied Biosystems™), 2019-nCoV CDC TUO Kit (Integrated DNA Technologies) and QuantStudio™ 7 Flex Real-Time PCR System. Sequences of the N1 primers and probe were:

2019-nCoV_N1 -Forward 5’ GACCCCAAAATCAGCGAAAT 3’ (SEQ ID NO 1 )

2019-nCoV_N1 -Reverse 5’ TCTGGTTACTGCCAGTTGAATCTG 3’ (SEQ ID NO 2)

2019-nCoV_N1 -Probe 5’ FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1 3’ (SEQ ID NO 3).

The cycling conditions were: 25 °C for 2 minutes, 50 °C for 15 minutes, 95 °C for 2 minutes followed by 45 cycles of 95 °C for 3 seconds, 55 °C for 30 seconds. The quantification standard was in vitro transcribed RNA of the SARS-CoV-2 N ORF (accession number NC 045512.2) with quantification between 1 x 10 ¹ and 1 x 10 ⁶ copies/pL Positive samples detected below the limit of quantification (LOQ) were assigned the value of 5 copies /pL, whilst undetected samples were assigned the value of < 2.3 copies/pL, equivalent to the assay’s lower limit of detection (LLOD).

Sub-genomic RT-qPCR was performed on the QuantStudio™ 7 Flex Real-Time PCR System using TaqMan™ Fast Virus 1 -Step Master Mix (Thermo Fisher Scientific) with forward primer, probe and reverse primer at a final concentration of 250 nM, 125 nM and 500 nM respectively. Sequences of the sgE primers and probe were: 2019-nCoV_sgE-forward, 5’ CGATCTCTTGTAGATCTGTTCTC 3’ (SEQ ID NO 4);

2019-nCoV_sgE-reverse, 5’ ATATTGCAGCAGTACGCACACA 3’ (SEQ ID NO 5);

2019-nCoV_sgE-probe, 5’ FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1 3’ (SEQ ID NO 6).

Cycling conditions were 50°C for 10 minutes, 95°C for 2 minutes, followed by 45 cycles of 95°C for 10 seconds and 60°C for 30 seconds. RT-qPCR amplicons were quantified against an in vitro transcribed RNA standard of the full-length SARS-CoV-2 E ORF (accession number NC_045512.2) preceded by the UTR leader sequence and putative E gene transcription regulatory sequence. Positive samples detected below the lower limit of quantification (LLOQ) were assigned the value of 5 copies/pl, whilst undetected samples were assigned the value of <= 0.9 copies/pL, equivalent to the assay’s lower limit of detections (LLOD). Histopathology

The following samples from each animal were fixed in 10% neutral-buffered formalin, processed to paraffin wax and 4 pm thick sections cut and stained with haematoxylin and eosin (H&E): lung, nasal cavity including olfactory and respiratory mucosa, heart, liver, spleen, pancreas, trachea/larynx brain and small intestine (duodenum). The tissue sections specified above were digitally scanned and reviewed by a qualified veterinary pathologist blinded to treatment and group details and the slides were randomised prior to examination in order to prevent bias (blind evaluation). Lesions consistent with infection with SARS-CoV-2 were observed only in the lungs and nasal cavity. A scoring system was used to evaluate objectively the histopathological lesions observed in the tissue sections: 0=within normal limits; 1 =minimal; 2=mild; 3=moderate and 4=marked/severe. Moreover, the area of the lung with pneumonia was calculated using digital image analysis (Nikon-NIS-Ar software package).

Statistical Analysis

Area under the curve (AUC) was calculated for all sampling taken over a timecourse. These AUC were compared via one-sided unpaired t-tests, apart from the sgPCR which was compared with the Mann-Whitney U test as this assay had many values below the lower limit of quantification (LLOQ) thereby indicating a non-parametric comparison would be more suitable. Histopathology was compared with a one-sided Mann-Whitney U test.

Results

RNA binding

The ability of S-MGBs to bind to RNA was assessed using a fluorescence intercalator displacement assay. PolyAU double stranded RNA is treated with probe molecule (Sybr-Safe) that increases its fluorescence upon binding to RNA. When this system is treated with another compound, any reduction in fluorescence indicates that the compound has displaced the probe and bound to RNA. Table 2: Data obtained from a fluorescence intercalator displacement assay using polyAU RNA and SYBR-safe as fluorescent probe.

The compound references used herein are included in parentheses.

The % normalised fluorescence obtained with S-MGBs of the invention is shown in Table 2. A reduction in normalised % is indicative of RNA binding and two known RNA binding compounds have been included as positive controls (polymyxin B and kanamycin). All S-MGBs of the invention are able to bind to RNA, to varying degrees. Several are stronger RNA binders than the control.

In vitro activity against SARS-CoV-2

A microplaque inhibition assay was used to assess the inhibitory effect of several S-MGBs of the invention against the virus SARS-CoV-2.

Table 3: Data obtained from a SARS-CoV-2 microplaque inhibition assay.

Inhibitory activity against SARS-CoV-2 was observed for all S-MGBs tested as shown in Table 3. The most active compound, S-MGB-363, was selected for further testing in vivo. These data confirm that S-MGBs of the invention are active against SARS-CoV-2.

In vitro activity against influenza

The inhibitory effect of several S-MGBs of the invention was assessed against the influenza. This was done by measuring the cytopathic effect caused by viral infection. Table 4: Data obtained from influenza inhibition assays.

Inhibitory activity against influenza was observed for the S-MGBs tested, as shown in Table 4. These data confirm that S-MGBs of the invention are active against influenza.

In vitro activity against HCV

The inhibitory effect of several S-MGBs of the invention was assessed against the virus HCV. This was carried out in several ways. Firstly, an assay was used to measure the inhibitory effect of S-MGBs on the entry of HCV to cells, and secondly the inhibitory effect of the whole virus life cycle was measured. In both of these experiments, the viability of the host cells was also measured. Finally, several S-MGBs also progressed to IC ₅ o determination, measuring the inhibitory effect against the HCV life cycle. Table 5: Data obtained from various HCV inhibition assays.

Inhibitory activity against HCV was observed for all S-MGBs tested as shown in Table 5. Many S-MGBs are particularly selective at inhibiting the virus life cycle without affecting cell viability. These data confirm that S-MGBs of the invention are active against HCV.

In vivo activity against SARS-CoV-2

A hamster model of SAR-CoV-2 was used to confirm that activity observed in vitro could be translated into in vivo activity, namely a reduction in severe lung pathology and reduction in viral levels in the respiratory tract. S-MGB-363 was selected to be used in this in vivo model based on its superior activity in vitro. Hamsters were challenged with the virus on day 0 and treated with 5 mg/kg of S-MGB-363 on day 1 and day 2. Viral shedding, via throat swabs, was monitored throughout the experiment and histopathology was carried out at the end point.

Both viral RNA and viral sub-genomic RNA measurements of the throat swabs confirm a statistically significant reduction in viral shedding at the end of the experiment in the treatment group (see Figures 1 and 2). This is in line with a statistically significant reduction in histopathology score in the nasal cavity in the treatment group (see Figure 3). Additionally, the histopathology score and lung histopathology image analysis confirm a statistically significant reduction in pathology and lesions for the treatment group (see Figures 3 and 4). Together, these data confirm that S-MGB-363 has a therapeutic effect in the in vivo SARS-CoV-2 model.