Specification The present invention relates to Amorfrutin analogues and stereoisomeric forms, solvates, hydrates, conjugates and/or pharmaceutically acceptable salts of these compounds as well as pharmaceutical compositions containing at least one of these Amorfrutin analogues together with pharmaceutically acceptable carrier, excipient and/or diluents. Said Amorfrutin analogues have been identified as modulators of the peroxisome proliferator-activated receptors (PPARs), especially PPARy and are useful for the prevention and treatment of metabolic diseases, inflammatory diseases, cancer and preparation of phytomedicals and/or functional food products for prevention of metabolic diseases. Background of the invention

The peroxisome proliferator-activated receptor gamma (PPARy) is a nuclear receptor that regulates transcription with two effector binding sites called activation function 1 (AF1 ) and activation function 2 (AF2). AF1 is localized within the N- terminal regulatory domain. The receptor's central DNA binding domain is followed by the C-terminal ligand binding domain (LBD), which comprises AF2. PPARy is regulated by a phosphorylation site in the LBD at Ser273. The ligand-activated transcription factor PPARy acts in the nucleus as a heterodimer with the retinoid X receptor RXR. PPARy interacts with prostaglandins and fatty acids and their metabolites. It acts as a sensor and regulator with a dominant role in glucose and lipid metabolism and adipose cell differentiation. Activation of the receptor improves insulin sensitivity through different metabolic actions, including regulation of adipokines. PPARy is a well-established drug target for type II diabetes. To reduce blood glucose levels recent pharmaceutical developments aimed to activate PPARy in peripheral metabolic target tissues such as adipose tissue, muscle, liver and macrophages. Recent publications indicate potential roles of PPARy - expressed in the central nervous system - in the regulation of weight balance {Nature Med. 2011 , 5, 618; Nature Med. 2011 , 5, 623.). This nuclear receptor further plays also a key role in inflammatory diseases and cancer (Nature Rev. Cancer 2012, 12, 181 ).

The two other PPAR family members, PPARa and PPAR /δ, also bind fatty acids and are involved in fatty acid metabolism. In general, PPARa and PPAR /δ promote fatty acid catabolism in several tissues, whereas PPAR y regulates fatty acid storage in adipose tissues. Dual PPARa and PPAR /δ agonists correcting glucose and lipid abnormalities in patients with type II diabetes have been already reported [Biochim. Biophys. Acta 2011 , 1812, 1007; Structure 2001 , 9, 699]. The LBD of PPARy has several regulatory functions. It determines the receptor's subcellular localization, initiates heterodimerization with RXR, and activates or represses transcription of target genes in a ligand-dependent manner. The ligand binding stabilizes the LBD and leads to a more compact and rigid conformation, which in turn causes recruitment of cell-specific coactivators like SRC1 to the LBD's AF2 effector binding site. PPARy bound to the promoter of a target gene activates transcription of that target gene upon coactivator recruitment. The synthetic agonist rosiglitazone induces coactivator recruitment and inhibits NCoR co-repressor-mediated CDK5-dependent phosphorylation of Ser273, which alters the expression of a subset of genes with regulatory functions in metabolism.

Rosiglitazone and other glitazones (thiazolidinediones, TZDs) strongly activate transcription of a large number of genes in various tissues. This unspecific action of glitazones is associated with severe side effects including weight gain, osteoporosis, cardiovascular complications, and edema and determined the withdrawn of these products from the market or the restriction of their prescription. Partial PPARy agonists, which activate PPARy only weakly, are more selective PPARy modulators (SPPARyMs) and avoid side effects. [Structure 2007, 15, 1258] Dependent on the cellular context and transcriptional PPARy co-factors, partial PPARy agonists may activate or potentially repress transcription of target genes. The partial agonists BVT.13, MRL-24, nTZDpa and amorfrutin 1 block NCoR recruitment and Ser273 phosphorylation as effectively as rosiglitazone, but activate transcription of target genes only to a moderate level. [Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 7257; Nature 2010, 466, 451 .] Amorfrutins are a group of natural products that have recently been identified as PPARy modulators with the characteristics of SPPARyMs. They are binding the PPARy, having dissociation constants of around 300 nM.

It is the object of the present invention to provide amorfrutin analogues of general formula I, conjugates and pharmaceutically acceptable salts thereof suitable to selectively modulate the PPARy with greatly increased specific activity with regard to the prior art and with less side effects. A further aspect of the invention is to provide amorfrutin analogues of general fornnula I, conjugates and pharnnaceutically acceptable salts thereof, which can be used as pharnnaceutically active agents, especially for the treatment of metabolic diseases, as well as compositions comprising at least one of those compounds and/or pharmaceutically acceptable salts thereof as pharmaceutically active ingredients. The compounds of the present invention can be used also as prophylactic dietary supplements. The objective of the present invention is solved by the teaching of the independent claims. Further advantageous features, aspects and details of the invention are evident from the dependent claims, the description, the figures, and the examples of the present application.

Description of the invention

Thus, the present invention relates to a compound of general formula (I)

(I)

wherein

R ¹ represents the following: -H, -CO ₂ R ¹⁵ , -CHO, -C(O)-CH=CH-Ph;

R ² represents the following: -H, -OH, -OC _q H( _2q+ i );

R ⁴ represents the following: -H, -OH, -OCH ₃ , -CH ₃ or

R ² together with R ³ or R ³ together with R ⁴ form with the two carbons of the benzene ring to which R ² and R ³ or R ³ and R ⁴ are attached one of the following moieties: R ³ , R ⁵ , R ⁶ and R ⁷ represent independently of each other: -R ⁸ , -R ⁹ , -R ¹⁰ , -R ¹⁶ -H, -OH, _(CH ₂ )n-R ⁸ , -(CH ₂ ) _m -R ⁹ , -(CH ₂ ) _P -R ¹⁰ , -(CH ₂ ) ₀ -R ¹⁶ -CH=CH-R ⁸ , -CH=CH-R ⁹ , -CH=CH-R ¹⁰ , -CH=CH-R ¹⁶ , -(CH ₂ ) _n -CHR ⁸ R ⁹ -(CH ₂ ) _m -CHR ¹⁷ R ¹⁸ , -(CH ₂ )p-CHR ¹⁹ R ²⁰ , -(CH ₂ ) ₀ -CHR ²¹ R ²² , -OCH ₃ , -OC ₂ H ₅ -CH=CH-CH(CH ₃ ) ₂ , -CH ₂ -CH=CR ⁸ R ⁹ , -CH ₂ -CH=CR ¹⁷ R ¹⁸ _:

-CH ₂ -CH=CR ¹⁹ R ²⁰ , -CH ₂ -CH=CR ²¹ R ²² -CH ₂ -CH(R ^{1 1} )-C(CH ₃ )=CH _2;

-CH ₂ -CH(R ²³ )-C(CH ₃ )=CH _2j -CH ₂ -CH(R ²⁴ )-C(CH ₃ )=CH _2; -CH ₂ -CH(R ²⁵ )-C(CH ₃ )=CH _2j -CH ₂ -CH(OH)-R ⁸ , -CH ₂ -CH(OH)-R ⁹

-CH ₂ -CH(OH)-R ¹⁰ , -CH ₂ -CH(OH)-R ¹⁶ _: -CH ₂ -CH=C(R ⁸ )-CH ₂ -CH ₂ -CH=CR ⁹ R ¹⁰ , -CR ⁸ =CH ₂₎ -CR ⁹ =CH _2:

-CR ¹⁰ =CH ₂₎ -CR ¹⁶ =CH _2j -CH ₂ -CH=C(R ²⁶ )-CH ₂ -CH ₂ -CH=CR ²⁷ R ²⁸ _:

-CH ₂ -CH=C(R ²⁹ )-CH ₂ -CH ₂ -CH=CR ³⁰ R ³¹ , -CH ₂ -CH ₂ -CHR ⁵⁰ R ⁵¹ , -CH ₂ -CH=C(R ³² )-CH ₂ -CH ₂ -CH=CR ³³ R ³⁴ ,

17 _D 18 _D 19 _D 20 _D 21 _D 22 _D 26 _D 27 _D 28 _D 29 _D 30 _D 31 _D 32 _D 33 _D 34 , , , , , , , , , , , K , K , K , K ,

R ⁵⁰ and R ⁵¹ represent independently of each other: -H, -CH ₃ , -C ₂ H ₅ , -C ₃ H ₇ , -C4H9, -C ₅ Hi i, -C ₆ H ₁₃ , -CH ₂ OH, -CH(OH)(CH ₃ ) _, -C(OH)(CH ₃ ) ₂ , -CH(CH ₃ )-O-CO-CH _3j -C(CH ₃ )=CH ₂ , -CH(OH)-CH ₂ -CH=C(CH ₃ ) ₂ ,

-CH ₂ -CH ₂ -CH=C(CH ₃ ) _2j -CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ¹¹ , -CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ⁴² ,

-CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ⁴³ ,

-CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ⁴⁴ , -CH=CH-CH ₂ -CH=CHR ¹¹ , -CH=CH-CH2-CH=CHR ⁴² , -CH=CH-CH2-CH=CHR ⁴³ , -CH=CH-CH ₂ -CH=CHR ⁴⁴ , -CH(OH)-CH ₃ , -C(CH ₃ )=CH-CH ₂ -CH=C(CH ₃ ) ₂ ,

-CH=CH-CH=CHR ^{1 1} , -CH=CH-CH=CHR ,42

-CH=CH-CH=CHR ,43 -CH=CH-CH=CHR ⁴⁴ ,

R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , R ²³ , R ²⁴ , R ²⁵ , R ³⁵ , R ³⁶ , R ³⁷ , R ³⁸ , R ³⁹ , R ⁴⁰ , R ⁴¹ , R ⁴² , R ⁴³ and R ⁴⁴ represent independently of each other: -H, -CH ₃ , -C2H ₅ , -C3H ₇ , -C ₄ H ₉ , -C5H11 , -OH, -OCH3, -CO2H, -CH2-CH=CH ₂ , -C(CH ₃ )=CH ₂ ;

R ¹⁵ represents one of the following -H, -CH ₃ , -C2H ₅ , -C3H ₇ , -C ₄ H ₉ ;

R ⁴⁵ , R ⁴⁶ , R ⁴⁷ , R ⁴⁸ , R ⁴⁹ , R ⁵² and R ⁵³ represent independently of each other -H, — CH3, — C2H ₅ , — C3H ₇ , — C ₄ Hg _i — OCH3, — OC2H ₅ , — OC3H ₇ , — F, —CI, — CF3, -CHF2, -CH ₂ F. m, n, p, o and q are integer numbers independently of each other selected from 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 and 14; and conjugates, enantiomers, stereoisomeric forms, mixtures of enantiomers, diastereomers, mixtures of diastereomers, hydrates, solvates, tautomers, racemates and pharmaceutically acceptable salts of the above mentioned compounds for use as modulator of PPARs. As used herein the term "conjugate" refers to a compound of general formula I covalently linked to a peptide or a peptide analogue that is recognized by a certain receptor expressed on the surface of the cell and involved in beneficial physiological responses, such as increased satiety. Hence, such conjugates are able to specifically direct the compounds of general formula I to cells expressing the receptors that interact with the peptides or peptides analogues to which the compounds of general formula I are conjugated. Example of peptides suitable to be covalently linked to a compound of general formula I include, but are not restricted to metabolically active peptide hormones, such as incretin-derivatives.

Glucagon-like peptide-1 (GLP-1 ) receptor or the glucose-dependent insulinotropic polypeptide (GIP) receptor constitutes examples of receptors expressed on the surface of the cell and involved in beneficial physiological responses.

GLP-1 is one of the most potent incretins and it stimulates insulin secretion. GLP-1 is released by the gut into the circulation in response to carbohydrate or protein ingestion. The GLP-1 receptor is a 463 amino acid 7 transmembrane-spanning protein exhibiting 27% to 40% sequence homology to the receptors for secretin, calcitonin, and parathyroid hormone. As these receptors shared higher identity with each other than with other members of the G protein-coupled receptor superfamily, they were classified together into a new family of receptors now known as the type II receptor family. However, despite the strong sequence homology between GLP-1 and the other members of the glucagon related family of peptides, the GLP-1 receptor recognizes GLP-1 specifically, with no demonstrable binding by a number of related peptides, including secretin and vasoactive intestinal peptide. The mammalian GLP-1 receptor is mainly expressed in pancreatic cells, stomach and brain.

Glucose-dependent insulinotropic polypeptide or gastric inhibitory polypeptide (GIP) is a 42 amino acid peptide hormone secreted by K cells in the intestinal epithelium. The majority of intestinal K cells are located in the proximal duodenum. GIP secretion is primarily regulated by nutrients, especially fats. The GIP receptor is also a member of the glucagon receptor family. The GIP receptor is involved in glucose homeostasis via potentiation of glucose-dependent insulin secretion from the pancreatic islet β-cells. It also inhibits gastric acid secretion. The GIP receptor is expressed in the pancreas, stomach, small intestine, adipose tissue, adrenal cortex, pituitary, heart, testis, endothelial cells, bone, trachea, spleen, thymus, lung, kidney, thyroid, and several regions in the CNS.

However, the receptors expressed on the surface of the cell and targeted by the conjugates of the current invention are not restricted to the above mentioned receptors, to the receptors of this family or to the receptors expressed only in brain; they further include receptors specifically expressed in any other tissues that are targeted by amorfrutin analogues, such as fibroblast growth factor 21 (FGF21 ) that is involved in the stimulation of glucose uptake in adipocytes, but not in other cell types.

A preferred embodiment of the present invention relates to the so far unknown compounds of general formula (I)

wherein

R ¹ represents the following: -H;

R ² represents the following: -H, -OH, -OC _q H(2q+1 );

R ⁴ represents the following: -H, -OH, -OCH3, -CH ₃ or

R ² together with R ³ or R ³ together with R ⁴ form with the two carbons of the benzene ring to which R ² and R ³ or R ³ and R ⁴ are attached one of the following moieties:

R ³ , R ⁵ , R ⁶ and R ⁷ represent independently of each other: -R ⁸ , -R ⁹ , -R ¹⁰ , -R ¹⁶ , -H, -OH, -(CH ₂ ) _n -R ⁸ , -(CH ₂ ) _m -R ⁹ , -(CH ₂ ) _P -R ¹⁰ , -(CH ₂ ) ₀ -R ¹⁶ , -C ₂ H ₄ -Ph, -CH ₂ -Ph, -CH=CH-Ph, -OCH3, -OC ₂ H ₅ , -CH=CH-CH(CH ₃ ) ₂ , -CH ₂ - CH=C(CH ₃ ) ₂ , -CH ₂ -CH=CR ⁸ R ⁹ , -CH ₂ -CH=CR ¹⁰ R ¹⁶ ,

-CH ₂ -CH(R ¹¹ )-C(CH ₃ )=CH ₂ , -CH ₂ -CH(OH)-R ⁸ , -CH ₂ -CH(OH)-R ⁹ ,

-CH ₂ -CH(OH)-R ¹⁰ , -CH ₂ -CH(OH)-R 16 -CH ₂ -CH=C(R°)-CH ₂ -CH ₂ -

CH=CR ⁹ R ^{10 8} =CH ₂ , -CR ⁹ =CH ₂ , CR ¹⁰ =CH ₂ , CR ¹⁶ =CH ₂ ,

R ⁸ , R ⁹ , R ¹⁰ and R ¹⁶ represent independently of each other: -H, -CH ₃ , -C ₂ H ₅ , -C ₃ H ₇ , -C ₄ H ₉ , -C5H 1 1 , -C ₆ H i 3, -CH ₂ OH, -CH(OH)(CH ₃ ), -C(OH)(CH ₃ ) ₂ , -CH(CH ₃ )-O-CO-CH ₃ , -C(CH ₃ )=CH ₂ , -CH(OH)-CH ₂ -CH=C(CH ₃ ) ₂ , — CH2— CH2— CH=C(CH3)2, -CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ^{1 1} , -CH=CH-CH ₂ -CH=CHR ^{1 1} , ^■ CH(OH)-CH ₃ , -C(CH ₃ )=CH-CH ₂ -CH=C(CH ₃ ) ₂ , -CH=CH-CH=CHR ^{1 1} ;

R ^{1 1} , R ¹² , R ¹³ and R ¹⁴ represent independently of each other: -H, -CH ₃ , -C ₂ H ₅ , — C ₃ H ₇ , — C ₄ Hg, — C5H11 , —OH, — CO ₂ H, — CH;?— CH=CH ₂ ; m, n, p, o and q are integer numbers independently of each other selected from 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 and 14; and conjugates, enantiomers, stereoisomeric forms, mixtures of enantiomers, diastereomers, mixtures of diastereomers, hydrates, solvates, tautomers, racemates and pharmaceutically acceptable salts of the above mentioned compounds.

The expression tautomer is defined as an organic compound that is interconvertible by a chemical reaction called tautomerization. Tautomerization can be catalyzed preferably by bases or acids or other suitable compounds. Another aspect of the present invention is directed to novel compounds selected from the following group:

Compound Name

NP-01221 1 2-[(1 R,6R)-3-methyl-6-prop-1 -en-2-yl-1 -cyclohex-2-enyl]-5- pentylbenzene-1 ,3-diol

NP-016018 2-[(1 R,6R)-3-methyl-6-prop-1 -en-2-yl-1 -cyclohex-2-enyl]-5- propylbenzene-1 ,3-diol

NP-015933 2,6-di-(3-methyl-2-butenyl)-5-pentylbenzene-1 ,3-diol

NP-015939 2-(2-hydroxy-3-methylbut-3-en-1 -yl)-6-(3-methyl-2-butenyl)-5- pentylbenzene-1 ,3-diol

NP-015137 3-methoxy-2-(3-methyl-2-butenyl)-5-(2-phenylethyl)-benzene-

1 -ol

NP-015938 4-(2-hydroxy-3-methylbut-3-en-1 -yl)-2-(3-methyl-2-butenyl)-5- pentylbenzene-1 ,3-diol

NP-015937 2-(2-hydroxy-3-methylbut-3-en-1 -yl)-6-(3-methyl-2-butenyl)-5-

(2-phenylethyl)-benzene-1 ,3-diol The present invention is also directed to a method of treatment comprising the step of administering to a patient a pharmaceutically effective amount of a compound of general formula (I)

wherein

R ¹ represents the following: -H, -CO ₂ R ¹⁵ , -CHO, -C(O)-CH

R ² represents the following: -H, -OH, -OC _q H( _2q+ i);

R ⁴ represents the following: -H, -OH, -OCH ₃ , -CH ₃ or

R ² together with R ³ or R ³ together with R ⁴ form with the two carbons of the benzene r R ³ , R ⁵ , R ⁶ and R ⁷ represent independently of each other: -R ⁸ , -R ⁹ , -R ¹⁰ , -R ¹⁶ , -H, -OH, -(CH ₂ ) _n -R ⁸ , -(CH ₂ ) _m -R ⁹ , -(CH ₂ ) _P -R ¹⁰ , -(CH ₂ ) ₀ -R ¹⁶ , -CH=CH-R ⁸ , -CH=CH-R ⁹ , -CH=CH-R ¹⁰ , -CH=CH-R ¹⁶ , -(CH ₂ ) _n -CHR ⁸ R ⁹ , -(CH ₂ ) _m -CHR ¹⁷ R ¹⁸ , -(CH ₂ )p-CHR ¹⁹ R ²⁰ , -(CH ₂ ) ₀ -CHR ²¹ R ²² , -OCH ₃ , -OC ₂ H ₅ , -CH=CH-CH(CH ₃ ) ₂ , -CH ₂ -CH=CR ⁸ R ⁹ , -CH ₂ -CH=CR ¹⁷ R ¹⁸ , -CH ₂ -CH=CR ¹⁹ R ²⁰ , -CH ₂ -CH=CR ²¹ R ²² , -CH ₂ -CH(R ^{1 1} )-C(CH ₃ )=CH ₂ ,

-CH ₂ -CH(R ²³ )-C(CH ₃ )=CH ₂ , -CH ₂ -CH(R ²⁴ )-C(CH ₃ )=CH ₂ , -CH ₂ -CH(R ²⁵ )-C(CH ₃ )=CH ₂ , -CH ₂ -CH(OH)-R ⁸ , -CH ₂ -CH(OH)-R ⁹ ,

-CH ₂ -CH(OH)-R ¹⁰ , -CH ₂ -CH(OH)-R ¹⁶ , -CH ₂ -CH=C(R ⁸ )-CH ₂ -CH ₂ -

CH=CR ⁹ R ¹⁰ , -CR ⁸ =CH ₂ , -CR ⁹ =CH ₂ , -CR ¹⁰ =CH ₂ , -CR ¹⁶ =CH ₂ , -CH ₂ - CH=C(R ²⁶ )-CH ₂ -CH ₂ -CH=CR ²⁷ R ²⁸ , -CH ₂ -CH=C(R ²⁹ )-CH ₂ -CH ₂ -CH=CR ³⁰ R ³¹ , -CH -CH=C(R ³² )-CH ₂ -CH ₂ -CH=CR ³³ R ³⁴ , - -CH ₂ -CHR ⁵⁰ R ⁵¹

_D 8 _D 9 _D 10 _D 16 _D 17 _D 18 _D 19 _D 20 _D 21 _D 22 _D 26 _D 27 _D 28 _D 29 _D 30 _D 31 _D 32 _D 33 _D 34 r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ , r\ ,

R ⁵⁰ and R ⁵¹ represent independently of each other: -H, -CH ₃ , -C2H ₅ , -C ₃ H _7j -C ₄ H _9j -C ₅ Hi i, -C ₆ H i 3, -CH ₂ OH, -CH(OH)(CH ₃ ), -C(OH)(CH ₃ )2, -CH(CH ₃ )-O-CO-CH _3j -C(CH ₃ )=CH ₂ , -CH(OH)-CH ₂ -CH=C(CH ₃ ) _2j

-CH ₂ -CH ₂ -CH=C(CH ₃ ) _2j -CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ¹¹ , -CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ⁴² ,

-CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ⁴³ ,

-CH(OH)-CH(OH)-CO-CH=CH-CH=CHR ⁴⁴ ,

-CH=CH-CH ₂ -CH=CHR ¹¹ , -CH=CH-CH ₂ -CH=CHR ⁴² , -CH=CH-CH ₂ -CH=CHR ⁴³ , -CH=CH-CH ₂ -CH=CHR ⁴⁴ , -CH(OH)-CH ₃ , -C(CH ₃ )=CH-CH ₂ -CH=C(CH ₃ ) _2j -CH=CH-CH=CHR ^{1 1} , -CH=CH-CH=CHR ⁴² , -CH=CH-CH=CHR ⁴³ , -CH=CH-CH=CHR ⁴⁴ ,

R ¹¹ , R ¹² , R ¹³ , R ¹⁴ , R ²³ , R ²⁴ , R ²⁵ , R ³⁵ , R ³⁶ , R ³⁷ , R ³⁸ , R ³⁹ , R ⁴⁰ , R ⁴¹ , R ⁴² , R ⁴³ and R ⁴⁴ represent independently of each other: -H, -CH ₃ , -C ₂ H ₅ , -C ₃ H ₇ , -C ₄ H ₉ , -C ₅ Hii, -OH, -OCH _3j -CO ₂ H, -CH2-CH=CH ₂ , -C(CH ₃ )=CH ₂ ;

R ¹⁵ represents one of the following -H, -CH ₃ , -C ₂ H ₅ , -C ₃ H ₇ , -C ₄ H ₉ ;

R ⁴⁵ , R ⁴⁶ , R ⁴⁷ , R ⁴⁸ , R ⁴⁹ , R ⁵² and R ⁵³ represent independently of each other -H, — CH ₃ , — Ο ₂ Η _δ , — C ₃ H ₇ , ,— C ₄ Hg _, — OCH ₃ , — OC ₂ Hs, — OC ₃ H ₇ , — F, —CI, — CF ₃ , -CHF ₂ , -CH ₂ F _; m, n, p, o and q are integer numbers independently of each other selected from 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13 and 14; or conjugates, enantiomers, stereoisomeric forms, mixtures of enantiomers, diastereoisomers, mixtures of diastereoisomers, hydrates, solvates, tautomers, racemates and pharmaceutically acceptable salts of the above mentioned compounds for the modulation of PPARs and/or for the treatment of PPAR associated diseases. The PPAR associated diseases are discussed further below in detail.

In a preferred embodiment of the present application the substituents R ³ and R ⁵ are the same substituent selected from: -R ⁸ , -(CH ₂ ) _n -R ⁸ , -(CH ₂ ) _n -CHR ⁸ R ⁹ , -CH=CH-CH(CH ₃ ) ₂ , -CH ₂ -CH=CR ⁸ R ⁹ , -C ₂ H ₄ -Ph, -CH=CH-Ph,

-CH ₂ -CH(OH)-R ⁸ , -CR ⁸ =CH ₂ , -CH ₂ -CH=C(R ⁸ )-CH ₂ -CH ₂ -CH=CR ⁹ R ¹⁰ , -CH ₂ -CH(R ¹¹ )-C(CH ₃ )=CH ₂ ;

wherein

R ⁸ , R ⁹ and R ¹⁰ represent independently of each other: -H, -CH ₃ , -C ₂ H ₅ , -C ₃ H ₇ , — C ₄ Hg, — C5H 11 , — CeHi ₃ , — C(CH ₃ )=CH ₂ , — C(CH ₃ )=CH— CH ₂ — CH=C(CH ₃ ) ₂ , -CH ₂ -CH ₂ -CH=C(CH ₃ ) ₂ , -CH=CH-CH=CHR ¹¹ , -CH=CH-CH ₂ -CH=CHR ¹¹ ; and

R ¹¹ represents: -H, -CH ₃ , -C ₂ H ₅ , -C ₃ H ₇ , -C ₄ H ₉ , -C ₅ Hn, -CH2-CH=CH ₂ . The wording "the same substituent" simply means R ³ = R ⁵ .

In another preferred embodiment R ² together with R ³ , or R ³ together with R ⁴ form with the two carbons of the benzene ring to which R ² and R ³ or R ³ and R ⁴ are attached one of the following moieties: wherein R ⁷ has the meaning above defined.

Further preferred compounds of general formula (I) are these compounds, wherein R ¹ substituent represents -H. Moreover compounds are preferred wherein R ³ , R ⁵ and R ⁶ are different from hydrogen. R represents preferably the following substituents: -OH or -OCH ₃ and most preferably -OH.

R ⁶ preferably contains a phenyl group, and more preferably a substituted phenyl group. R ³ and R ⁵ do preferably not contain a phenyl group, but preferably contain a substituent with one or two double bonds.

R ³ and R ⁵ are preferably independently of each other selected from the following substituents: -CH=CH-CH(CH ₃ ) ₂ , -CH ₂ -CH=CR ⁸ R ⁹ , -CH ₂ -CH=CR > 1"R _D 1f

23

-CH ₂ -CH(R ¹¹ )-C(CH ₃ )=CH ₂ , -CH ₂ -CH(R^)-C(CH ₃ )=CH ₂ , -CH ₂ -CH(OH)-R°,

₅ 9D 10

-CH ₂ -CH(OH)-R ¹⁶ , -CH ₂ -CH=C(R°)-CH ₂ -CH ₂ -CH=CR ^a R ^lu ,

-CH ₂ -CH=C(R ²⁶ )-CH ₂ -CH ₂ -CH=CR ²⁷ R ²⁸ , -CR ¹⁶ =CH ₂ , -CR ⁸ =CH ₂ ,

-(CH ₂ )p-CHR ¹⁹ R ²⁰ or -(CH ₂ )o-CHR ²¹ R ²² . Compounds of the following general formula (II) - (VII) are also preferred:

Another preferred embodiment according to the current invention is directed to compounds of general formula VIII

wherein R ¹⁶ is selected from

and R ⁴ , R ⁵ , R ¹⁵ , R ⁴⁵ , R ⁴⁶ , R ⁴⁷ , R ⁴⁸ , R ⁴⁹ , R ⁵² and R ⁵³ have the meanings disclosed above and at least one of the substituents R ⁴⁵ , R ⁴⁶ , R ⁴⁷ , R ⁴⁸ and R ⁴⁹ is different of hydrogen.

Compounds of general formula IX

wherein R ¹⁶ is selected from

and R ⁴ , R ⁵ , R ¹⁵ , R ⁴⁵ , R ⁴⁶ , R ⁴⁷ , R ⁴⁸ , R ⁴⁹ , R ⁵² and R ⁵³ have the meanings disclosed above and at least one of the substituents R ⁴⁵ , R ⁴⁶ , R ⁴⁷ , R ⁴⁸ and R ⁴⁹ is different of hydrogen are also preferred.

Even more preferred compounds are compounds of general formula VIII or IX wherein R ¹⁶ represents one of the followin :

and FT ⁵ , R ^4b , FT , R , R ^4y , R^ and R ^M represent independently of each other: — CH3, — C2H ₅ , — C3H ₇ , — C ₄ Hg, — OCH3, — OC2H ₅ , — OC3H ₇ , — F, —CI, — CF3, -CHF ₂ , -CH ₂ F. Connpounds of general fornnula X and XI

X

wherein R ¹⁶ represents one of the following:

5

R ^4b , FT, R , R ^4y , R^ and R ^M represent independently of each other: — C2H5, — C3H ₇ , ,— C ₄ H9, — OCH3, — OC2H ₅ ,— OC3H ₇ , — F, —CI, — CF3, -CH ₂ F are also preferred. In yet another preferred embodiment of the present invention, the compound according to the general formula (I) is selected from the group of compounds depicted in the following Table 1 .

Table 1. Compounds according to the present invention.

Compound Structure

_ηΛ

In another preferred embodiment the compounds of formula (I) are isolated from the roots of Glycyrrhiza foetida and from the fruits of Amorpha fructicosa. Indications

In a further aspect of the present invention, the novel compounds according to the general formula (I) are used as pharmaceutically active agent applicable in medicine. Surprisingly it was found that the above-mentioned compounds of general formula (I) as well as the pharmaceutical compositions comprising said compounds of general formula (I) are acting as modulators of PPARs, with great specificity for PPARy and and are useful for the prevention and/or treatment of metabolic diseases.

The term modulator refers to a compound that modulates the transcriptional activity of PPAR involving specific activation or repression of a subgroup of genes regulated by PPAR, thus leading to a differential expression of PPAR target genes.

As PPARy is involved in inflammatory and cancer processes, a further aspect according to the present invention is directed to compounds of general formula (I) useful for prevention and/or treatment of inflammatory diseases and cancer.

Further aspects of the present invention relate to the use of the compounds of general formula (I) for the preparation of a pharmaceutical composition useful for prevention and/or treatment of metabolic diseases, inflammatory diseases and cancer.

In yet another aspect of the present invention, the compounds according to the general formula (I) are for the preparation of phytomedicals or functional food products for prevention of metabolic diseases.

The term "functional food product" refers to a food purported or proven to have a beneficial health effect. The term "phytomedical" is defined as a pharmaceutical composition containing compounds isolated from plants for prevention and/or treatment of various health concerns.

Furthermore, the compounds of general formula (I) have hepatoprotective properties.

Preferably, the compounds of general formula (I) and/or pharmaceutical acceptable salts thereof are useful for or can be used for the prevention and/or treatment of metabolic diseases.

Metabolic diseases refer to diseases and conditions characterized by pathological disorders of the metabolism. They are mainly characterized by enzyme defects and abnormalities in the regulating system leading to a pathological enrichment of substrates, lack of metabolic products, failure of producing energy, of regeneration of cellular constituents, of elimination of metabolic products and of maintenance of homeostasis. They can be acquired or be a genetic disease. Metabolic disorders include, but are not limited to: obesity, type I diabetes, type II diabetes, maturity- onset diabetes of youth, gestational diabetes, hypoglycemia, amyloidosis, branched chain disease, hyperaminoacidemia, hyperaminoaciduria, disturbances of the metabolism of urea, hyperammonemia, mucopolysaccharidoses e. g. Maroteaux-Lamy syndrom, glycogen storage diseases and lipid storage diseases, Cori's disease, intestinal carbohydrate malabsorption, maltase-, lactase-, sucrase- insufficiency, disorders of the metabolism of fructose, disorders of the metabolism of galactose, galactosaemia, disturbances of pyruvate metabolism, hypolipidemia, hypolipoproteinemia, hyperlipidemia, hyperlipoproteinemia, carnitine or carnitine acyltransferase deficiency, porphyrias, disturbances of the purine metabolism, lysosomal diseases, metabolic diseases of nerves and nervous systems like gangliosidoses, sphingolipidoses, sulfatidoses, leucodystrophies, Lesch-Nyhan syndrome, dysfunction of the parathyroid glands, pancreatic islet cell dysfunction, carbohydrate and lipid storage myopathies, glycogenoses, myoglobinuria, alkaptonuria, adrenogenital syndrome, ketosis, ketoacidosis, methylmalonaciduria, Morbus Addison, Morbus Conn, Morbus Cushing, Morbus Fabry, Morbus Gaucher, Morbus Hunter, cystic fibrosis, phenylketonuria, thesaurismosis, uricopathia, insulin resistance.

In another preferred embodiment, the compounds of general formula (I) and/or pharmaceutical acceptable salts thereof are useful for or can be used for the prevention and/or treatment of inflammatory diseases.

Inflammatory diseases refer to diseases involving an inflammation process. Inflammation is the final common pathway of various insults, such as infection, trauma, and allergies to the human body. It is characterized by activation of the immune system with recruitment of inflammatory cells, production of proinflammatory cells and production of pro-inflammatory cytokines. Most inflammatory diseases and disorders are characterized by abnormal accumulation of inflammatory cells including monocytes/macrophages, granulocytes, plasma cells, lymphocytes and platelets. Along with tissue endothelial cells and fibroblasts, these inflammatory cells release a complex array of lipids, growth factors, cytokines and destructive enzymes that cause local tissue damage. 5

The term "inflammatory disease" encompasses a variety of conditions, including autoimmune diseases, proliferative skin diseases, and inflammatory dermatoses. Inflammatory disorders result in the destruction of healthy tissue by an inflammatory process, dysregulation of the immune system, and unwanted proliferation of cells. Examples of inflammatory diseases are acne vulgaris, acute respiratory distress syndrome, Addison's disease, allergic rhinitis, allergic intraocular inflammatory diseases, antineutrophil cytoplasmic antibody (ANCA)- associated small-vessel vasculitis, ankylosing spondylitis, arthritis, asthma, atherosclerosis, atopic dermatitis, autoimmune hepatitis, autoimmune hemolytic anemia, autoimmune hepatitis, Behcet's disease, Bell's palsy, bullous pemphigoid, cerebral ischemia, chronic obstructive pulmonary disease cirrhosis, Cogan's syndrome, contact dermatitis, Crohn's disease, Cushing's syndrome, dermatomyositis, diabetes mellitus, discoid lupus erythematosus, eosinophilic fasciitis, erythema nodosum, exfoliative dermatitis, fibromyalgia, focal glomerulosclerosis, focal segmental glomerulosclerosis, giant cell arteritis, gout, gouty arthritis, graft versus host disease, hand eczema, Henoch-Schonlein purpura, herpes gestationis, hirsutism, idiopathic cerato-scleritis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura, immune thrombocytopenic purpura inflammatory bowel or gastrointestinal disorders, inflammatory dermatoses, lichen planus, lupus nephritis, lymphomatous tracheobronchitis, macular edema, multiple sclerosis, myasthenia gravis, myositis, nonspecific fibrosing lung disease, osteoarthritis, pancreatitis, pemphigoid gestationis, pemphigus vulgaris, periodontitis, polyarteritis nodosa, polymyalgia rheumatica, pruritus scroti, pruritis/inflammation, psoriasis, psoriatic arthritis, pulmonary histoplasmosis, rheumatoid arthritis, relapsing polychondritis, rosacea caused by sarcoidosis, rosacea caused by scleroderma, rosacea caused by Sweet's syndrome, rosacea caused by systemic lupus erythematosus, rosacea caused by urticaria, rosacea caused by zoster-associated pain, sarcoidosis, scleroderma, segmental glomerulosclerosis, septic shock syndrome, shoulder tendinitis or bursitis, Sjogren's syndrome, Still's disease, stroke-induced brain cell death, Sweet's disease, systemic lupus erythematosus, systemic sclerosis, Takayasu's arteritis, temporal arteritis, toxic epidermal necrolysis, transplant- rejection and transplant-rejection-related syndromes, tuberculosis, type-1 diabetes, ulcerative colitis, uveitis, vasculitis, and Wegener's granulomatosis.

Another aspect of the present invention is directed to the use of compound of general formula (I) and/or pharmaceutically acceptable salts thereof for prevention and/or treatment of cancer. The cancer type is preferably selected from the group comprising or consisting of: adenocarcinoma, choroidal melanoma, acute leukemia, acoustic neurinoma, ampullary carcinoma, anal carcinoma, astrocytoma, basal cell carcinoma, pancreatic cancer, desmoid tumor, bladder cancer, bronchial carcinoma, non-small cell lung cancer (NSCLC), breast cancer, Burkitt's lymphoma, corpus cancer, CUP- syndrome (carcinoma of unknown primary), colorectal cancer, small intestine cancer, small intestinal tumors, ovarian cancer, endometrial carcinoma, ependymoma, epithelial cancer types, Ewing's tumors, gastrointestinal tumors, gastric cancer, gallbladder cancer, gall bladder carcinomas, uterine cancer, cervical cancer, cervix, glioblastomas, gynecologic tumors, ear, nose and throat tumors, hematologic neoplasias, hairy cell leukemia, urethral cancer, skin cancer, skin testis cancer, brain tumors (gliomas), brain metastases, testicle cancer, hypophysis tumor, carcinoids, Kaposi's sarcoma, laryngeal cancer, germ cell tumor, bone cancer, colorectal carcinoma, head and neck tumors (tumors of the ear, nose and throat area), colon carcinoma, craniopharyngiomas, oral cancer (cancer in the mouth area and on lips), cancer of the central nervous system, liver cancer, liver metastases, leukemia, eyelid tumor, lung cancer, lymph node cancer (Hodgkin's/Non-Hodgkin's), lymphomas, stomach cancer, malignant melanoma, malignant neoplasia, malignant tumors gastrointestinal tract, breast carcinoma, rectal cancer, medulloblastomas, melanoma, meningiomas, Hodgkin's disease, mycosis fungoides, nasal cancer, neurinoma, neuroblastoma, kidney cancer, renal cell carcinomas, non-Hodgkin's lymphomas, oligodendroglioma, esophageal carcinoma, osteolytic carcinomas and osteoplastic carcinomas, osteosarcomas, ovarial carcinoma, pancreatic carcinoma, penile cancer, plasmocytoma, squamous cell carcinoma of the head and neck (SCCHN), prostate cancer, pharyngeal cancer, rectal carcinoma, retinoblastoma, vaginal cancer, thyroid carcinoma, Schneeberger disease, esophageal cancer, spinalioms, T-cell lymphoma (mycosis fungoides), thymoma, tube carcinoma, eye tumors, urethral cancer, urologic tumors, urothelial carcinoma, vulva cancer, wart appearance, soft tissue tumors, soft tissue sarcoma, Wilm's tumor, cervical carcinoma and tongue cancer.

Therefore, another aspect of the present invention is directed to pharmaceutical compositions comprising at least one compound of the present invention as active ingredient, together with at least one pharmaceutically acceptable carrier, excipient and/or diluents. Preferably, the pharmaceutical composition comprises at least one compound according to claim 1 or 6. The pharmaceutical compositions of the present invention can be prepared in a conventional solid or liquid carrier or 7 diluent and a conventional pharmaceutically-nnade adjuvant at suitable dosage level in a known way. The preferred preparations are adapted for oral application. These administration forms include, for example, pills, tablets, film tablets, coated tablets, capsules, powders and deposits.

Furthermore, the present invention also includes pharmaceutical preparations for parenteral application, including dermal, intradermal, intragastral, intracutan, intravasal, intravenous, intramuscular, intraperitoneal, intranasal, intravaginal, intrabuccal, percutan, rectal, subcutaneous, sublingual, topical, or transdermal application, which preparations in addition to typical vehicles and/or diluents contain at least one compound according to the present invention and/or a pharmaceutical acceptable salt thereof as active ingredient.

The pharmaceutical compositions according to the present invention containing at least one compound according to the present invention, and/or a pharmaceutical acceptable salt thereof as active ingredient will typically be administered together with suitable carrier materials selected with respect to the intended form of administration, i.e. for oral administration in the form of tablets, capsules (either solid filled, semi-solid filled or liquid filled), powders for constitution, extrudates, deposits, gels, elixirs, dispersable granules, syrups, suspensions, and the like, and consistent with conventional pharmaceutical practices. For example, for oral administration in the form of tablets or capsules, the active drug component may be combined with any oral non-toxic pharmaceutically acceptable carrier, preferably with an inert carrier like lactose, starch, sucrose, cellulose, magnesium stearate, dicalcium phosphate, calcium sulfate, talc, mannitol, ethyl alcohol (liquid filled capsules) and the like. Moreover, suitable binders, lubricants, disintegrating agents and coloring agents may also be incorporated into the tablet or capsule. Powders and tablets may contain about 5 to about 95 weight % of the benzothiophene-1 ,1 -dioxide derived compound and/or the respective pharmaceutically active salt as active ingredient.

Suitable binders include starch, gelatin, natural sugars, corn sweeteners, natural and synthetic gums such as acacia, sodium alginate, carboxymethylcellulose, polyethylene glycol and waxes. Among suitable lubricants there may be mentioned boric acid, sodium benzoate, sodium acetate, sodium chloride, and the like. Suitable disintegrants include starch, methylcellulose, guar gum, and the like. Sweetening and flavoring agents as well as preservatives may also be included, where appropriate. The disintegrants, diluents, lubricants, binders etc. are discussed in more detail below.

Moreover, the pharmaceutical compositions of the present invention may be formulated in sustained release form to provide the rate controlled release of any one or more of the components or active ingredients to optimise the therapeutic effect(s), e.g. antihistaminic activity and the like. Suitable dosage forms for sustained release include tablets having layers of varying disintegration rates or controlled release polymeric matrices impregnated with the active components and shaped in tablet form or capsules containing such impregnated or encapsulated porous polymeric matrices.

Liquid form preparations include solutions, suspensions, and emulsions. As an example, there may be mentioned water or water/propylene glycol solutions for parenteral injections or addition of sweeteners and opacifiers for oral solutions, suspensions, and emulsions. Liquid form preparations may also include solutions for intranasal administration. Aerosol preparations suitable for inhalation may include solutions and solids in powder form, which may be present in combination with a pharmaceutically acceptable carrier such as an inert, compressed gas, e.g. nitrogen. For preparing suppositories, a low melting fat or wax, such as a mixture of fatty acid glycerides like cocoa butter is melted first, and the active ingredient is then dispersed homogeneously therein e.g. by stirring. The molten, homogeneous mixture is then poured into conveniently sized moulds, allowed to cool, and thereby solidified.

Also included are solid form preparations which are intended to be converted, shortly before use, to liquid form preparations for either oral or parenteral administration. Such liquid forms include solutions, suspensions, and emulsions. The compounds according to the present invention may also be delivered transdermally. The transdermal compositions may have the form of a cream, a lotion, an aerosol and/or an emulsion and may be included in a transdermal patch of the matrix or reservoir type as is known in the art for this purpose.

The term capsule as recited herein refers to a specific container or enclosure made e.g. of methyl cellulose, polyvinyl alcohols, or denatured gelatins or starch for holding or containing compositions comprising the active ingredient(s). Capsules with hard shells are typically made of blended of relatively high gel strength gelatins from bones or pork skin. The capsule itself may contain small amounts of dyes, opaquing agents, plasticisers and/or preservatives. Under tablet a compressed or moulded solid dosage form is understood which comprises the active ingredients with suitable diluents. The tablet may be prepared by compression of mixtures or granulations obtained by wet granulation, dry granulation, or by compaction well known to a person of ordinary skill in the art.

Oral gels refer to the active ingredients dispersed or solubilised in a hydrophilic semi-solid matrix. Powders for constitution refers to powder blends containing the active ingredients and suitable diluents which can be suspended e.g. in water or in juice.

Suitable diluents are substances that usually make up the major portion of the composition or dosage form. Suitable diluents include sugars such as lactose, sucrose, mannitol, and sorbitol, starches derived from wheat, corn rice, and potato, and celluloses such as microcrystalline cellulose. The amount of diluent in the composition can range from about 5 to about 95 % by weight of the total composition, preferably from about 25 to about 75 weight %, and more preferably from about 30 to about 60 weight %.

The term disintegrants refers to materials added to the composition to support break apart (disintegrate) and release the pharmaceutically active ingredients of a medicament. Suitable disintegrants include starches, "cold water soluble" modified starches such as sodium carboxymethyl starch, natural and synthetic gums such as locust bean, karaya, guar, tragacanth and agar, cellulose derivatives such as methylcellulose and sodium carboxymethylcellulose, microcrystalline celluloses, and cross-linked microcrystalline celluloses such as sodium croscaramellose, alginates such as alginic acid and sodium alginate, clays such as bentonites, and effervescent mixtures. The amount of disintegrant in the composition may range from about 2 to about 20 weight % of the composition, more preferably from about 5 to about 10 weight %.

Binders are substances which bind or "glue" together powder particles and make them cohesive by forming granules, thus serving as the "adhesive" in the formulation. Binders add cohesive strength already available in the diluent or bulking agent. Suitable binders include sugars such as sucrose, starches derived from wheat corn rice and potato, natural gums such as acacia, gelatin and tragacanth, derivatives of seaweed such as alginic acid, sodium alginate and ammonium calcium alginate, cellulose materials such as methylcellulose, sodium carboxymethylcellulose and hydroxypropylmethylcellulose, polyvinylpyrrolidone, and inorganic compounds such as magnesium aluminum silicate. The amount of binder in the composition may range from about 2 to about 20 weight % of the composition, preferably from about 3 to about 10 weight %, and more preferably from about 3 to about 6 weight %.

Lubricants refer to a class of substances which are added to the dosage form to enable the tablet granules etc. after being compressed to release from the mould or die by reducing friction or wear. Suitable lubricants include metallic stearates such as magnesium stearate, calcium stearate, or potassium stearate, stearic acid, high melting point waxes, and other water soluble lubricants such as sodium chloride, sodium benzoate, sodium acetate, sodium oleate, polyethylene glycols and D,L-leucine. Lubricants are usually added at the very last step before compression, since they must be present at the surface of the granules. The amount of lubricant in the composition may range from about 0.2 to about 5 weight % of the composition, preferably from about 0.5 to about 2 weight %, and more preferably from about 0.3 to about 1 .5 weight % of the composition.

Glidents are materials that prevent caking of the components of the pharmaceutical composition and improve the flow characteristics of granulate so that flow is smooth and uniform. Suitable glidents include silicon dioxide and talc. The amount of glident in the composition may range from about 0.1 to about 5 weight % of the final composition, preferably from about 0.5 to about 2 weight %.

Coloring agents are excipients that provide coloration to the composition or the dosage form. Such excipients can include food grade dyes adsorbed onto a suitable adsorbent such as clay or aluminum oxide. The amount of the coloring agent may vary from about 0.1 to about 5 weight % of the composition, preferably from about 0.1 to about 1 weight %.

Chemical synthesis

The compounds of general formula I according to the present invention can be obtained through isolation from natural sources and/or chemical synthesis. For example, compounds of general formula I, wherein R ¹ is selected from -H, -CO ₂ R ¹⁵ and -CHO, R ² is selected from -OH and -OC _q H( ₂ q ₊ i), R ⁴ is selected from -OH and -OCH ₃ , and R ³ , R ⁵ and R ⁶ have the meanings defined above can be obtained starting from ketone 3 and a malonate derivative such as 4 (see Scheme 1 ). Ketones of general fornnula 3 are commercially available or can be accessed by reacting hydrazone 5 obtained from the corresponding methyl ketone with commercially available brominated derivative 6. Malonate derivative 4 can be synthesized starting from diethylmalonate 8 and acyl chloride 7. Conveniently, acid chlorides of general formula 7 are commercially available or can be easily prepared from the corresponding carboxylic acids by methods well known to the person skilled in the art.

Scheme 1. Retrosynthetic analysis.

For example, compounds of general formula 10, 11 and 12 can be synthesized according to the synthetic pathway described in Scheme 2. To access ketone 3, hydrazone 5 is reacted with brominated derivative 6 in presence of a strong base such as lithium diisopropylamide in anhydrous tetrahydrofurane. Example of suitable brominated derivative 6 are 1 -bromo-3-methylbut-2-ene and (2Z)-1 - bromo-3,7-dimethylocta-2,6-diene.

After treatment of diethyl malonate 8 with Mg turnings in absolute ethanol and a catalytic amount of carbon tetrachloride, the intermediate magnesium salt is reacted with acyl chloride 7 to provide enol 9. Suitable acyl chlorides 7 are hydrocinamoyl chloride, pentanoyl chloride, butanoyl chloride, propanoyl chloride, ethanoyl chloride, formyl chloride. Enol 9 is converted to corresponding chloride 4 by treatment with phosphoryl chloride and triethylamine. Subsequent treatment of chloride 4 with ketone 3 provides amorfrutine analogue 10 that can be further methylated to provide the methylated analogue 11. Cleavage of the methyl ester on methylated analogue 11 furnishes amorfrutine 12. It is obvious for the person skilled in the art that amorfrutine 12 can be decarboxylated to afford amorfrutine analogues with R ¹ being -H or submitted to esterification to provide amorfrutine analogues with R ¹ being -CO ₂ R ¹⁵ and R ¹⁵ being different of -H, or submitted to reduction with diisobutylaluminium hydride to provide amorfrutine analogues with R ¹ being -CHO.

10 11 12

Scheme 2. Synthesis of amorfrutine derivatives of general formula 10, 11 and 12: a. LDA, THF; b. Mg turnings, EtOH, CCI ₄ ; c. POCI ₃ , Et ₃ N; d. LDA, THF;

e. Mel, NaHCO ₃ ; f. KOH, DMSO. The conjugates of the present invention can be constructed by covalently linking a compound of general compound I (amorfrutin) with a peptide or a peptide analogue using conjugation chemistries known to the skilled person. The inventive compounds can be covalently linked to the peptide via the carboxylic acid, the hydroxyl group or a suitable functionality introduced on the hydrophobic side chains by derivatisation.

For example, a stable conjugate, which is resistant to proteolytic cleavage (by cellular proteases) can be generated via ether conjugation, by using a suitable functionality introduced on the hydrophobic side chains of the compounds of general formula I, or the carboxylic acid or the hydroxyl group.

More labile, proteolytically cleavable conjugates can be generated via ester conjugation, by using a functionality present on the hydrophobic side chains of the compounds of general formula I, or the carboxylic acid or the hydroxyl group. Using this approach, the compounds of general formula I can be targeted to specific cell types, taken up and released intracellularly.

Peptide conjugation shall take place using standard conjugation chemistry through carboxyl groups, free amines or thiol group on cysteine, or any other suitable methods, preferable C- or N-terminally. Peptide conjugation can benefit from introducing a (bio-) chemically inert (bifunctional) linker molecule. To improve the stability of the peptide, said peptide can be modified using appropriate derivatisation to avoid degradation in a cellular or physiological context. For example, the peptide hormones GLP-1 are rapidly inactivated by the enzyme dipeptidyl peptidase-4 (DPP-4). To prevent this physiologically common enzymatic degradation, the regular amino acid alanine at the second position of GLP-1 can be replaced with 2-aminoisobutyric acid. Thus, amorfrutin NP-003520 can be linked via an ester bond achieved by reacting its carboxylic acid group to a FGF21 peptide derivative to produce a conjugate NP- 003520 / FGF21 peptide derivative that induces synergistic glucose-lowering effects in adipocytes via FGF21 pathways and PPARy-regulated pathways.

Description of the Figures

Figure 1 shows the binding of PPARy by the compounds of general formula (I):

Binding of different compounds was determined in a competitive time- resolved fluorescence resonance energy transfer-based binding assay. Data are expressed as mean (n=2-3).

Figure 2 shows the partial activation of PPARs by Amorfrutin B (NP-015142): (a) Chemical structure of amorfrutin B;

(b) Transcriptional activation of PPARy by amorfrutin B (black triangles) or rosiglitazone (grey squares) in a reporter gene assay;

(c) Transcriptional activation of PPARa by amorfrutin B (black triangles) or

GW7647 (grey circles) in a reporter gene assay;

(d) Transcriptional activation of PPAR /δ by amorfrutin B (black triangles) or

GW0742 (grey diamonds) in a reporter gene assay;

(e-i) Recruitment of transcriptional cofactor peptides to PPARy-LBD titrated with amorfrutin B (black triangles) or rosiglitazone (grey squares). Binding of cofactor peptides was measured by time-resolved fluorescence resonance energy transfer. Recruitment is represented relative to rosiglitazone. Peptides are derived from coactivators CBP; (e), PGC1 a (f), TRAP220/DRIP (g), PRIP/RAP250 (h) or corepressor NCoR (i). Data are expressed as mean ± SD (n=3).

Figure 3 shows the binding of PPARa by the compounds of general formula (I):

Binding of different compounds was determined in a competitive time- resolved fluorescence resonance energy transfer-based binding assay. Data are expressed as mean (n=2-3).

Figure 4 shows the binding of PPAR /δ by the compounds of general formula (I):

Binding of different compounds was determined in a competitive time- resolved fluorescence resonance energy transfer-based binding assay. Data are expressed as mean (n=2-3).

Figure 5 shows the transcriptional activation of PPARy: PPARy activation of different compound concentrations was determined in a reporter gene assay and is normalized to rosiglitazone-induced activation. Axes of ordinates were differentially scaled according to individual activation efficacies. Data are expressed as mean (n=2-3).

Figure 6 shows the transcriptional activation of PPARa: PPARa activation of different compound concentrations was determined in a reporter gene assay and is normalized to GW7647-induced activation. Axes of ordinates were differentially scaled according to individual activation efficacies. Data are expressed as mean (n=2-3).

Figure 7 shows:

(a) The recruitment of transcriptional cofactor peptides to PPARy-LBD titrated with amorfrutin B (black) or rosiglitazone (grey). Data are expressed as mean ± SD (n=3). ^*** p<0.001 amorfrutin B vs. Rosiglitazone;

(b, c, d) The recruitment of the transcriptional corepressor NCoR to PPARy titrated with the indicated compounds. Data are expressed as mean (n=2-3). Binding of cofactor peptides was measured by time-resolved fluorescence resonance energy transfer. Recruitment is represented relative to rosiglitazone. Figure 8 shows the gene expression profile in primary human adipocytes after treatment with amorfrutin B (AB) and rosiglitazone (RGZ). Cells were treated for 24 h with 10 μηηοΙ/L RGZ (grey bars) or 10 μηηοΙ/L AB (black bars) and expression of (a) known PPARy target genes and (b) adipokines was analyzed by qPCR. (c) Primary human adipocytes were transfected with PPARy siRNA (hatched bars) or control siRNA (unhatched bars) and were treated with either 10 μηηοΙ/L RGZ (grey bars), 10 μηηοΙ/L AB (black bars) or vehicle only (white bar) for 24 h. RNA expression was analyzed by quantitative PCR. Data are expressed as mean ± SEM (n=3-4/group). n.s. not significant, ^* p<0.05, ^** p<0.01 , * ^** p<0.001 vs. vehicle. AB, amorfrutin B; RGZ, rosiglitazone.

Figure 9 shows NCOR1 RNA expression after treatment of primary human adipocytes with amorfrutin B (AB) or rosiglitazone (RGZ). Cells were treated for 24 h with 10 μηηοΙ/L RGZ (grey bars) or 10 μηηοΙ/L AB (black bars) and RNA expression was analyzed by quantitative PCR. Data are expressed as mean ± SEM (n=3-4/group). n.s. not significant vs. vehicle. AB, amorfrutin B; RGZ, rosiglitazone.

Figure 10 shows the effect of the compounds on proliferation of HT-29 colon carcinoma cells, PC3 prostate cancer cells and MCF-7 breast cancer cells, treated for 3 days with 20 μηηοΙ/Ι of the indicated compounds. Cells were quantified by fluorometric detection of the cellular DNA content. Data are normalised to DMSO-treated cells. Data are expressed as mean (n=2-3/group).

Figure 11 shows the concentration-dependent effects of the compounds on proliferation of (a) HT-29 colon carcinoma cells, (b) T84 colon carcinoma cells and (c) PC3 prostate cancer cells. Cells were treated for 3 days (HT-29, PC3) and 4 days (T84) with various concentrations of the indicated compounds, and cells were quantified by fluorometric detection of the cellular DNA content. Data are expressed as mean (n=3-4/group).

Figure 12 shows the effects of the compound on activation of caspases 2, 3, 6, 7,

8, 9 and 10 in HT-29 and PC3 cancer cells, treated for 24 h with 20 μηηοΙ/Ι of the indicated amorfrutin analogue or 100 nmol/l paclitaxel. Data are normalised to DMSO-treated cells and are expressed as mean ± SEM (n=2-3/group). Figure 13 shows the effects of compound NP-015934 (20 μηηοΙ/Ι) on caspase activation in different cancer cells relative to DMSO treatment, (a) Activation of caspases 2, 3, 6, 7, 8, 9 and 10 after 24 h treatment of HT- 29 cells, (b) Activation of caspases 3 and 7 after 24 h treatment of HT- 29 cells, (c) Activation of caspases 3 and 7 after 3 h treatment of MCF-7 cells, (d) Activation of caspases 2, 3, 6, 7, 8, 9 and 10 after 3 h treatment of PC3 cells. Data are expressed as mean ± SEM (n=1 - 2/group). ^* p<0.05, ^** p<0.01 vs. DMSO control.

Figure 14 shows the effects of compound NP-015934 on DNA fragmentation in

HT-29 colon cancer cells relative to DMSO treatment. Cells were treated with 30 or 100 μηηοΙ/Ι NP-015934 for 2 or 4 h. Data are expressed as mean ± SEM (n=4/group). ^** p<0.01 , ^*** p<0.001 vs. DMSO control.

Figure 15 shows the effect of amorfrutin B treatment in insulin-resistent DIO mice:

(a) Pharmacokinetic profile of amorfrutin B after oral administration in

C57BL/6 mice. Data are expressed as mean ± SEM (n=3);

(b) Fasting blood glucose of DIO mice after 15 days of treatment with vehicle (BW= 41 .7 g ± 1 .1 g), rosiglitazone (BW= 41 .2 g ± 1 .5 g) or amorfrutin B (BW= 35.7 g ± 1 .4 g);

(c) Fasting plasma insulin of DIO mice after 15 days of treatment; (d) Effect of treatment for 15 days on insulin resistance determined by homeostatic model assessment of insulin resistance (HOMA-IR);

(e, f) Glucose and insulin concentrations during oral glucose tolerance test

(OGTT) after 22 days of treatment with vehicle (white circles, BW= 39.9 g ± 1 .0 g), rosiglitazone (grey squares, BW= 39.9 g ± 1 .5 g) or amorfrutin B (black triangles, BW= 34.4 g ± 1 .3 g). AUC, area under the curve. AUC, area under the curve;

(g) Glucose levels during intraperitoneal insulin sensitivity test (IPIST) after

15 days of treatment. AUCi, inverse area under the curve. Data are expressed as mean ± SEM. ^* p<0.05, ^** p<0.01 , ^*** p<0.001 vs. vehicle. VEH, vehicle (white circles, n=13); RGZ, rosiglitazone (grey squares, n=8-10); AB, amorfrutin B (black triangles, n=13); BW, body weight (mean ± SEM). 7

Figure 16 shows the effect of amorfrutin B treatment of plasma lipid parameters in insulin-resistant DIO mice:

(a) Fasting plasma triacylglycerols after 27 days of treatment;

(b) Fasting plasma NEFA after 27 days of treatment. Data are expressed as mean + SEM. ^* p<0.05, ^** p<0.01 , vs. vehicle. VEH, vehicle (n=13); RGZ, rosiglitazone (n=10) ; AB, amorfrutin B (n=12-13).

Figure 17 shows the RNA expression of Ppargda, Ppargdb, Ucp1, Ucp2,

Adipocq and Lep in the visceral white adipose tissues of DIO mice treated for 4 weeks with rosiglitazone (grey) or amorfrutin B (black) analysed by qPCR (n=6-9 per group). Data are expressed as mean ± SEM. n.s. not significant, ^* p<0.05, ^** p<0.01 , ^*** p<0.001 vs. vehicle.

Figure 18 shows the RNA expression of different genes in tissues of DIO mice treated for 4 weeks with rosiglitazone (grey) or amorfrutin B (black)

(n=6-9 per group):

(a-c) Liver tissues were analysed by qPCR for expression of genes associated with (a) glycolysis and gluconeogenesis, (b) fatty acid metabolism, or (c) ketogenesis;

(d) Plasma levels of β-hydroxybutyrate determined by colorimetry;

(e) Skeletal muscle tissues were analysed by qPCR (n=6-9 per group).

Data are expressed as mean ± SEM. n.s. not significant, ^* p<0.05, * ^* p<0.01 , ^*** p<0.001 vs. vehicle. VEH, vehicle; RGZ, rosiglitazone; AB, amorfrutin B.

Figure 19 shows the FGF21 levels in DIO mice treated for 4 weeks with vehicle

(white), rosiglitazone (grey) or amorfrutin B (black) (n=6-9 per group):

(a) Fgf21 gene expression in white adipose tissue (WAT) and liver;

(b) Plasma levels of FGF21 determined by ELISA. Data are expressed as mean ± SEM. n.s. not significant, ^* p<0.05, ^** p<0.01 , ^*** p<0.001 vs. vehicle. VEH, vehicle; RGZ, rosiglitazone; AB, amorfrutin B.

Figure 20 shows the phosphorylation of PPARy-Ser273 in WAT of DIO mice treated for 4 weeks with vehicle control (VEH, white), rosiglitazone (RGZ, grey) or amorfrutin B (AB, black):

(a) Western Blot of representative samples (n=4 per group); Densitometric analysis (n=10-13 per group). Data are expressed as mean ± SEM. re 21 shows the effect of amorfrutin B on viability (white triangles) and cytotoxicity (black triangles) in human HepG2 cells after treatment for 24 h (n=3, mean ± SD). re 22 shows:

the analysis of genetic toxicity in the in vitro micronucleus assay in Chinese hamster ovary (CHO) cells in absence (-S9) or presence (+S9) of rat liver homogenate extract: CHO cells were treated with different concentrations of amorfrutin B (AB, n=2), the clastogens mitomycin C (MMC, n=4) or cyclophosphamide (CP, n=4), or vehicle (VEH), and micronuclei were stained with Hoechst dye and counted by fluorescence microscopy;

the expression of genes related with macrophage invasion and inflammation in murine livers of DIO mice treated 4 weeks with rosiglitazone or amorfrutin B: Murine livers of DIO mice treated for 4 weeks with rosiglitazone (grey) or amorfrutin B (black) were analysed by qPCR for expression of genes associated with macrophage invasion and inflammation (n=6-9 per group);

RNA expression of liver Fabp4: RNA expression of liver Fabp4 was analyzed by qPCR;

the effect of amorfrutin B (n=13) and rosiglitazone (n=10) or vehicle (n=1 1 ) on liver damage-indicating plasma levels of alanine transaminase (ALT) after treatment for 4 weeks in DIO mice;

the expression of genes involved in osteoblagenesis: MC3T3-E1 preosteoblasts (pointed bars) were differentiated to osteoblasts in presence of vehicle only (white, set to 1 ), rosiglitazone (grey) or amorfrutin B (black). Expression of genes involved in osteoblastogenesis was determined by qPCR.

the calcification of differentiated MC3T3-E1 osteoblasts: the calcification of differentiated MC3T3-E1 osteoblasts treated with amorfrutin B (AB, n=6), rosiglitazone (RGZ, n=4) or vehicle (VEH, n=4) was measured by Alizarin Red S staining;

the effect of amorfrutin B on plasma osteocalcin concentration after treatment for 4 weeks in DIO mice. Osteocalcin was measured by ELISA; the body weight gain of obese mice after treatment with amorfrutin B (black triangles, n=13), rosiglitazone (grey squares, n=10) or vehicle only (white circles, n=13). Data are expressed as mean ± SEM. n.s. not significant, ^* p<0.05, ^** p<0.01 , ^*** p<0.001 vs. vehicle. VEH, vehicle; RGZ, rosiglitazone; AB, amorfrutin B; PRE, preosteoblasts. re 23 shows the effect of the compounds A1 , A2, A3, A4 and thiazolidinediones on osteoblast differentiation:

Expression of genes involved in osteoblastogenesis was determined by qPCR;

Calcification of differentiated MC3T3-E1 osteoblasts and preosteoblasts was measured by Alizarin Red S staining. Data are expressed as mean ± SEM. n.s. not significant, ^* p<0.05, ^** p<0.01 vs. vehicle. PRE, preosteoblasts; VEH, vehicle; RGZ, rosiglitazone; PGZ, pioglitazone; TGZ, troglitazone; AB, amorfrutin B (NP-015142); A1 , amorfrutin 1 (NP-003520); A2, amorfrutin 2 (NP-003521 ); A3, amorfrutin 3 (NP-006430); A4, amorfrutin 4 (NP-009525). re 24 shows:

the effect of amorfrutin B (NP-015142) treatment on daily food intake in DIO mice. Data are expressed as mean ± SEM. ^*** p<0.001 vs. vehicle; variation of body weight with cumulative energy intake: Analysis of co- variance (ANCOVA) was performed on cumulative energy intake and body weight after 14 days of treatment. In both treatment groups body weight moderately correlates with energy intake (VEH, p=0.07; AB, p=0.09), but AB-treated mice show a shift towards lower body weight additional to the decrease in energy intake (p=0.02 for elevation of regression curve), indicating that anti-obesity effects of AB are not exclusively attributed to less energy intake during the first 3 days;

the effect of amorfrutin B and rosiglitazone on plasma triiodothyronine (T3) and thyroxine (T4) concentration after 27 days of treatment (n=5- 13). Data are expressed as mean + SEM. n.s. not significant vs. vehicle; variation of HOMA-IR index with body weight: ANCOVA was performed on HOMA-IR index and body weight data after 14 days of treatment. As expected, in both treatment groups insulin resistance correlates with total body weight (VEH, p=0.01 ; AB, p=0.002), but AB-treated mice clearly show an additional shift towards lower insulin resistance irrespective of decrease in body weight (p=0.01 for elevation of regression curve), indicating that anti-diabetic effects of AB are not exclusively attributed to body weight reduction. VEH, vehicle; AB, amorfrutin B. Figure 25 shows the effect of amorfrutin B (NP-015142) and rosiglitazone on blood parameters after treatment for 4 weeks in DIO mice (n=9-13):

(a) Plasma HDL and LDLA/LDL cholesterol levels;

(b) Hematocrit after treatment for 4 weeks in DIO mice;

(c) Colorimetric analysis of whole blood hemoglobin. Data are expressed as mean + SEM. n.s. not significant, ^** p<0.01 , vs. vehicle. VEH, vehicle;

RGZ, rosiglitazone; AB, amorfrutin B.

Figure 26 shows additive effects of compound NP-015934 and anticancer reference drugs on proliferation of HT-29 colon carcinoma cells. Cells were treated for 3 days with different mixtures of the indicated compounds, and proliferation was quantified by fluorometric detection of the cellular DNA content. IC'70 data were plotted as isobologram:

(a) NP-015934 and cisplatin;

(b) NP-015934 and irinotecan;

Data are expressed as mean ± SD (n=4/group). CI, combination index.

Figure 27 shows staining of HT-29 colon carcinoma cells with annexin-V-FLUOS and propidium iodide after detection by flow cytometry. Cells were treated with 20 μΜ of NP-015934 for 2 days before staining:

(a) Microscopical image and annexin-V/propidium iodide scatter plot of treated HT- 29 cells.

(b) Percentages of apoptotic cells (annexin-V-positive) after treatment. Data are expressed as mean ± SEM (n=3/group). ^*** p<0.001 vs. control. Figure 28 shows the formation of reactive oxygen species (ROS) in HT-29 cells treated with NP-015934 and its role in apoptosis:

(a) Fluorescence intensity of the ROS-sensitive dye H ₂ -DCFDA during treatment of HT-29 cells with 30 μΜ of NP-015934 in the absence or presence of antioxidants.

(b) Area under the curve (AUC) of H ₂ -DCFDA fluorescence (a). Data are expressed as mean ± SEM (n=7/group). ^*** p<0.001 vs. control, ###p<0.001 vs. NP-015934. (c) Percentages of apoptotic cells (annexin-V-positive) after treatment. Data are expressed as mean ± SEM (n=3/group). ***p≤0.001 vs. control only, n.s. not significant vs. NP-015934 only. Ctrl, Control; NAC, N-acetylcysteine (1 mM); GSH, glutathione (5 mM); D3T, 3H-1 ,2-Dithiole-3-thione (50 μΜ); ATOC, o Tocopherol (50 μΜ), AA, ascorbic acid (1 mM).

(d) Annexin-V/propidium iodide scatter plot of HT-29 cells. Cells were pre-treated for 1 h with indicated antioxidants, and 30 μΜ NP-015934 was added for additional 24 h of co-treatment. Figure 29 shows the effect of NP-015934 on the essential mitochondrial transmembrane potential (ΔΨητι) and the role of the 2-hydroxyl residue:

(a) Chemical structure of NP-015934 and NP-015934met.

(b) Concentration-dependent effect of NP-015934 and NP-015934met on the mitochondrial transmembrane potential, determined in the fluorometric JC-1 assay. HT-29 cells were treated with indicated compound concentrations for

15 min. Data are expressed as mean ± SD (n=4/group).

Figure 30 shows opening of the mitochondrial permeability transition pore (MPTP) in HT-29 cells treated with NP-015934 or NP-015934met for 30 min. Cells were stained with calcein and CoCI ₂ and were quantified by flow cytometry:

(a) Fluorescence intensity histogram of treated HT-29 cells.

(b) Mean fluorescence intensities of indicated treatments. Data are expressed as mean ± SEM (n=3/group). ^*** p<0.001 vs. control, ###p<0.001 vs. NP-015934, n.s. not significant

Figure 31 shows the effects of NP-015934 and NP-015934met on oxygen consumption and extracellular acidification of HT-29 cells by use of phosphorescent oxygen- and pH-sensitive probes:

(a) Fluorescence lifetime of an oxygen-sensitive probe in HT-29 cells during treatment with indicated compounds. Fluorescence lifetime increases with reduction in extracellular oxygen concentration.

(b) The rate of probe fluorescence lifetime was determined between 20 and 60 min of treatment (a) and plotted relative to untreated cells.

(c) Extracellular acidification in HT-29 cells during treatment with indicated compounds, measured by fluorescence of a pH-sensitive probe.

(d) The rate of extracellular acidification was determined between 20 and 150 min of treatment (c) and plotted as hydrogen ions per minute. Data are expressed as mean ± SEM (n=8/group). ^* p<0.05, ^** p<0.01 , ^*** p<0.001 vs. control, ###p<0.001 vs. NP-015934, n.s. not significant. CCCP, carbonyl cyanide m- chlorophenyl hydrazone (2 μΜ); AMA, antimycin A (2 μΜ). Figure 32 shows staining of HT-29 colon carcinoma cells with annexin-V-FLUOS and propidium iodide after detection by flow cytometry. Cells were treated for 1 day with indicated concentrations of NP-015934 or NP-015934met or both:

(a) Annexin-V/propidium iodide scatter plot of treated HT-29 cells.

(b) Percentages of apoptotic cells (annexin-V-positive) after treatment. Data are expressed as mean ± SEM (n=3/group). ^*** p<0.001 vs. control, n.s. not significant.

The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention.

Further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description. Accordingly, this description is to be construed as illustrative only and is for the purpose of teaching those skilled in the art the general manner of carrying out the invention. It is to be understood that the forms of the invention shown and described herein are to be taken as examples of embodiments. Elements and materials may be substituted for those illustrated and described herein, parts and processes may be reversed, and certain features of the invention may be utilized independently, all as would be apparent to one skilled in the art after having the benefit of this description of the invention. Changes may be made in the elements described herein without departing from the spirit and scope of the invention as described in the following claims. EXAMPLES

Abbreviations used in the Examples that follow are: AB (Amorfrutin B, NP- 015142), ALT (Alanine transaminase), DIO (Diet-induced obesity), HFD (High-fat diet), PPAR (Peroxisome proliferator-activated receptor), RGZ (Rosiglitazone), siRNA (Small interfering RNA), SPPARyM (selective Peroxisome proliferator- activated receptor γ modulator), TZDs (thiazolidinediones), VEH (Vehicle), vWAT (Viscerale white adipose tissue).

A. Materials

Compounds were purchased from the following: rosiglitazone (Cayman, Biozol, Eching, Germany), pioglitazone, troglitazone, GW7647, GW0742, N- acetylcysteine, glutathione, 3H-1 ,2-dithiole-3-thione, a-tocopherol, ascorbic acid, carbonyl cyanide m-chlorophenyl hydrazone (Sigma Aldrich, Taufkirchen, Germany), Antimycin A (Biomol GmbH). All natural products (NPs) described in this study were provided by AnalytiCon Discovery (Potsdam, Germany) and isolated by standard procedures from natural sources. The compounds were isolated using standard chromatography procedures from natural sources (isolated microbial strains (terrestrial or marine origin) or plants (several partitions with different chemical profiles)). Identity of each isolated natural product was confirmed using LC/MS and NMR.

Example A.1. Isolation of NP-003520, NP-015136, NP-009525, NP-015142, NP- 015135, NP-015137

530g of dried seeds of Amorpha fruticosa (provided by Friedrich Nature Discovery Gmbh; Euskirchen, Germany) were extracted twice with MeOH-MTB-ether and yielded 73g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate) natural products NP-003520, NP-015136, NP-009525, NP- 015142, NP-015135, NP-015137 were isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data. Example A.2. Isolation of NP-003521 , NP-006431 , NP-015934, NP-015935, NP- 015936, NP-006430, NP-006427, NP-015933, NP-015953, NP-015954, NP- 015937, NP-015938, NP-015939 327g of roots of Giycyrrhiza foetida (provided by Friedrich Nature Discovery Gmbh; Euskirchen, Germany) were extracted twice with MeOH-MTB-ether and yielded 33g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural products NP-003521 , NP-006431 , NP- 015934, NP-015935, NP-015936, NP-006430, NP-006427, NP-015933, NP- 015953, NP-015954, NP-015937, NP-015938, NP-015939 were isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.3. Isolation of NP-01221 1 , NP-016018, NP-016020, NP-016021 570g of aerial parts of Cannabis sp. (collected in Michendorf, Germany, by AnalytiCon Discovery) were extracted twice with MeOH-MTB-ether and yielded 66g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate /formic acid) natural products NP-01221 1 , NP-016018, NP-016020, NP- 016021 were isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.4. Isolation of NP-01241 1 , NP-012412, NP-012626

552g of aerial parts of Eriodictyon sp. (Syn. Yerba santa, provided by Alfred Galke Gmbh, Gittelde, Germany) were extracted twice with MeOH-MTB-ether and yielded 154g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural products NP-01241 1 , NP-012412, NP- 012626 were isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.5. Isolation of NP-009326, NP-004976, NP-004977, NP-004978 560g of aerial parts of Rapanaea melanophloeos (provided by Kenya National Academy of Science, Nairobi, Kenya) were extracted twice with MeOH-MTB-ether and yielded 50g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural products NP-009326, NP-004976, NP- 004977, and NP-004978 were isolated in a purity (HPLC, ELSD-detection, and H- 5

NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.6. Isolation of NP-002329 and NP-01 1855

525g of seeds of Anacardium occidentale (provided by Friedrich Nature discovery, Euskirchen, Gernnany) were extracted twice with MeOH-MTB-ether and yielded 50g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formiate/formic acid) natural products NP-002329 and NP-01 1855 were isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.7. Isolation of NP-001727 and NP-001728

331 g of aerial parts of Picris altissima (provided by the Botanical Garden of Berlin, Germany) were extracted twice with MeOH-MTB-ether and yielded 50g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural products NP-001727 and NP-001728 were isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structures were elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.8. Isolation of NP-014467

331 g of aerial parts of Syzygium jambos (provided by Friedrich Nature Discovery, Euskirchen, Germany) were extracted twice with MeOH-MTB-ether and yielded 50g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural product NP-014467 was isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structure was elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.9. Isolation of NP-006243

An undetermined fungal strain (isolated at AnalytiCon, strain No. 01458fxxx000010) was fermented in a nutrient medium containing mainly sucrose, glutamic acid, salts and Amberlite XAD 1 180 for 5 days at 30°C in a stirred vessel with 10 litres working volume. The lyophilized biomass was extracted twice with MeOH-Acetone and yielded 40g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural product NP-006243 was isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structure was elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.10. Isolation of NP-000420

A fungal strain (Hyalodendron sp., isolated for AnalytiCon, strain No. 05048febs006260) was fermented in a nutrient medium containing mainly corn meal and malt extract for 7 days at 21 °C in a stirred vessel with 10 litres working volume.

The lyophilized biomass was extracted twice with MeOH-Acetone and yielded 40g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural product NP-000420 was isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structure was elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data. Example A.11. Isolation of NP-012584

An undetermined fungal strain (isolated at AnalytiCon, strain No. 02465fxxx000012) was cultivated on 1 .5 kg of a solid substrate containing mainly rice, millet and a solution of salts for 19 days at 25°C.

The culture was extracted twice with MeOH-Acetone and yielded 70g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural product NP-012584 was isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structure was elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.12. Isolation of NP-001782 and NP-001787

An fungal strain allocated to the genus Penicillium (isolated at AnalytiCon, strain No. 01672fxxx000012) was cultivated on 1 .1 kg of a solid substrate containing mainly rice, millet and a solution of salts for 19 days at 25°C.

The culture was extracted twice with MeOH-Acetone and yielded 50g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural product NP-001782 and NP-001787 were isolated in a purity (HPLC, 7

ELSD-detection, and H-NMR) of >70%. Structure was elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data.

Example A.13. Isolation of NP-001269

An undetermined fungal strain (isolated at AnalytiCon, strain No. 00410fxxx000005) was cultivated on 0.5 kg of a solid substrate containing mainly rice, millet and a solution of salts for 19 days at 25°C.

The culture was extracted twice with MeOH-Acetone and yielded 10g raw extract. By repeated chromatography (stationary phase RP-8 and RP-18, mobile phase methanol-water and acetonitrile-water (buffered with ammonium formate/formic acid) natural product NP-001269 was isolated in a purity (HPLC, ELSD-detection, and H-NMR) of >70%. Structure was elucidated by interpretation of LCMS, 1 D and 2D NMR (HSQC, HMBC, HH-COSY) data. Purity assessment of isolated compounds

All isolated natural products were analysed by HPLC/MS/ELSD to get the molecular weights and the purity. HPLC-conditions are listed in Table 2. The results of the purity assessment together with the retention time Rt are listed in Table 3.

Table 2: Conditions of the HPLC/MS/ELSD analysis

HPLC System PE Series 200

MS System Applied Biosystems API 150, 165 or 365

Data System Analyst 1 .3 or Masschrom 1 .2.1 .

Stationary Phase Merck Select B 250x4 mm, 5 μιτι

Flow Rate 1 ml/min

Detection (+/(-)-ESI, Fast-Switching-Mode

ELSD (Sedex 75)

UV (Merck, 254 nm)

Sample Concentration 10 mg/ml in DMSO

Injection Volumen 30 μΙ

Mobile Phase: A: 5 mM ammonium formate and 0.1 % formic acid

B: acetonitrile/methanol = 1 :1 , 5 mM ammonium formate and 0.1 % formic acid (pH 3)

Gradient Time [min] % A % B

00.0 85 15

30.0 0 100

35.0 0 100 Table 3: Purity [%] and retention times (Rt [min]) of the isolated natural products

Compound Rt [min] Purity [%]

NP-000420 19.19 99.1

NP-001269 16.49 81 .0

NP-001727 22.55 70.3

NP-001728 25.35 80.6

NP-001782 16.7 99.9

NP-001787 .6 86.3

NP-002329 29.77 88.3

NP-003520 27.79 99.9

NP-003521 28.69 99.6

NP-004976 25.52 86.2

NP-004977 25.8 91 .8

NP-004978 26.39 90.5

NP-006243 24.33 97.7

NP-006427 21 .78 93.3

NP-006430 24.36 99.6

NP-006431 25.33 94.0

NP-009326 26.45 83.8

NP-009525 27.98 88.4

NP-01 1855 30.32 98.6

NP-01221 1 27.6 100.0

NP-01241 1 20.19 95.7

NP-012412 20.91 87.1

NP-012584 30.27 99.4

NP-012626 22.72 93.4

NP-014467 26.25 99.2

NP-015135 25.96 85.9

NP-015136 27.56 97.8

NP-015137 27.1 98.7

NP-015142 30.19 100.0

NP-015933 28.52 98.9

NP-015934 29.82 99.9

NP-015935 30.51 95.5

NP-015936 28.94 96.0

NP-015937 26.58 96.5

NP-015938 27.01 96.2

NP-015939 27.44 97.9

NP-015953 23.24 93.5

NP-015954 23.45 85.8

NP-015955 25.06 97.5

NP-016018 25.79 85.9

NP-016020 28.51 94.7

NP-016021 27.87 96.8 B. Chemical synthesis

General procedures. Starting materials were synthesized as described by Tu (Synthesis, 2000, 13, 1956) or purchased from Sigma-Aldrich and used without further purification. Dry THF was distilled from CaH ₂ and all other anhydrous solvents were prepared using 3 A molecular sieves. All reactions were performed under argon atmosphere with a continuous argon flow. Silica gel flash column chromatography was performed on Combiflash RF (Teledyne ISCO) chromatography systems using normal-phase silica gel and ethyl acetate/hexanes mixtures as solvents. ¹ H and ¹³ C NMR spectra were obtained on 500 and 600 MHz Varian INOVA NMR spectrometers using CDCI3 and acetone-d6 (Cambridge Isotope Laboratories) as solvents. Spectra were calibrated to the solvent, 7.26 ppm for ¹ H NMR spectra in CDCI3, 2.05 ppm for ¹ H NMR spectra in acetone-d6, 77.16 ppm for ¹³ C NMR spectra in CDCI3, and 29.8 ppm for ¹³ C NMR spectra in acetone-d6.

Example B.1. Synthesis of 2,10-dimethyl-2,9-undecadien-6-one (1*)

2* 1*

To a solution of lithium diisopropyi amide (LDA) (19.4 mmol, 1 .3 equiv) in anhydrous THF (40 mL) contained within a 500 mL Schlenk flask cooled to -78 °C using a dry ice-acetone bath was added drop wise hydrazone 2* (3.1 g, 14.9 mmol, 1 equiv) (prepared according to Synthesis, 2000, 13, 1956). The mixture was allowed to warm to -30 °C while stirring over a period of 60 minutes and then subsequently recooled to -78 °C. To the deprotonated hydrazone was added a solution under argon of 3,3-dimethylallylbromide in THF (5 mL) very slowly as to maintain a uniform temperature. The reaction mixture was allowed to warm to room temperature while stirring overnight. The reaction was first diluted with THF (100 mL) and was proceeded by the addition of 1 M HCI (150 mL, 10 equiv) to quench excess base and hydrolyze the hydrazone. The hydrolysis was monitored using thin layer chromatography (hexanes: ethyl acetate = 10:1 ). After 30 minutes of stirring, the product was extracted with a 1 :1 mixture of hexanes and ethyl acetate (3 x 50 mL) and the combined organic extracts were dried over Na ₂ S0 ₄ , decanted into a 1 L round bottom flask and concentrated under reduced pressure. Purification of the crude product using flash column chromatography (silica gel, 100% hexanes progressing to 2:1 hexanes, ethyl acetate) afforded the ketone 1* 5

(1 .4 g, 48% yield) as a clear liquid. ¹ H NMR (600 MHz, CDCI ₃ ): δ 5.06 (m, 2H, CH=C(CH3)2), 2.41 (t, 4H, CH2C=O), 2.24 (dt, 4H, CH2CH2C=O), 1 .67 (s, 6H), 1 .61 (s, 6H) ppm. Example B.2. Synthesis of diethyl 2-(1 -hydroxy-3-phenylpropylidene) malonate

(3*)

To a flame-dried 500 ml_ Schlenk flask was added magnesium turnings (1 .59 g, 65.3 mmol, 1 .10 equiv) and absolute ethanol (5 ml_). A portion (1 ml.) of a 1 :1 solution by volume of diethyl malonate (9.5 g, 59.3 mmol, 1 equiv) and absolute ethanol (9 mi_) was added to the turnings suspension and stirred vigorously, followed by the addition of a catalytic amount of CCI ₄ (91 .2 mg, 0.593 mmol, 0.01 equiv). Once the reaction was initiated (usually requiring 5 min stirring), the remainder of the diethyl malonate solution was added slowly with continuous stirring. The reaction was heated under reflux at 80 °C overnight to achieve complete dissolution of the magnesium turnings and subsequently cooled to room temperature. The resulting magnesium salt was concentrated under reduced pressure and then resuspended in anhydrous diethyl ether (50 ml_). The resulting suspension was heated under reflux at 50°C for 30 minutes and then recooied to room temperature. Hydrocinnamoyl chloride (10 g, 59.3 mmol, 1 equiv) was added cautiously over a period of 15 minutes at room temperature, and the reaction was stirred overnight. The mixture was cooled to 0 °C and added to an ice-cold aqueous solution (100 mL) of H ₂ SO ₄ (30 mmol, 0.5 equiv), and the resulting mixture was extracted with diethyl ether (3 x 100 mL) in a 1 L separatory funnel. The combined organic layers were dried over Na ₂ SO ₄ , decanted into a 1000 mL round bottom flask and concentrated under reduced pressure. Purification using flash column chromatography (silica gel, 20:1 hexanes : ethyl acetate progressing to 1 :1 hexanes : ethyl acetate) afforded compound 3* (14.4 g, 83% yield) as a viscous, clear liquid. 1 H NMR (600 MHz, CDCI ₃ ): (enol form) δ 13.49 (s, 1 H, enol- OH), 4.27 (q, 2H), 4.22 (q, 2H), 2.96 (m, 2H), 2.77 (m, 2H), 1 .31 (t, 3H), 1 .27 (t, 3H) ppm.

^* Note: The title compound exists as an keto:enol ratio of ca 1 :3. 5

Example B.3. S nthesis of diethyl 2-(1 -chloro-3-phenylpropylidene)malonate (4*)

A 250 mL Schlenk flask was charged with compound 3* (12.0 g, 41 mmol, 1 .0 equiv). POCI3 (37.8 g, 246 mmol, 6.0 equiv) was subsequently added and the mixture was stirred for 5 min at room temperature. Following the 5 minute period, the reaction was cooled to -10 °C using an ice-salt bath. At -10 °C was added drop wise triethylamine (4.16 g, 41 mmol, 1 .0 equiv) to the vigorously stirred solution over the course of 10 min, yielding an off-white suspension. The ice bath was removed and the mixture was allowed to stir at room temperature for 22 h. The reaction was then heated to 80 °C under reflux and stirred at this temperature for an additional 4 h. The reaction was then cooled to 0 °C using an ice-water bath and diluted with 200 mL anhydrous dichloromethane (DCM). The diluted solution was then added drop wise cautiously over a period of 15 min to an ice- cooled suspension of NaHCO3 (124 mmol) in H ₂ O (600 mL). Once the gas evolution ceased, the pH of the aqueous mixture was adjusted to 7 using 1 M aqueous HCI. The organic phase was then isolated, and the aqueous layer was washed with DCM (2 x 100 mL). The organic collections were combined, dried over Na ₂ SO ₄ and concentrated under reduced pressure. The residue was purified using flash column chromatography (silica gel, 10:1 hexanes : ethyl acetate progressing to 1 :1 hexanes : ethyl acetate) yielding chloride 4* as a faintly yellow oil. H NMR (600 MHz, CDCI3): δ 7.32-7.28 (m, 2H), 7.26-7.15 (m, 3H), 4.32 (q, 2H), 4.20 (q, 2H), 3.21 (m, 2H), 2.96 (m, 2H), 1 .34 (t, 3H), 1 .26 (t, 3H) ppm.

Example B.4. Synthesis of ethyl 2,4-dihydroxy-3,5-bis(3-methyl-2-butenyl)-6- phenethylbenzoate (5*)

4* 1 * 5*

To a solution of LDA (17.0 mmol, 2.2 equiv) in anhydrous THF (34 mL) cooled to -78 °C using a dry ice-acetone bath was added ketone 1* (3.0 g, 15.5 mmol, 2 equiv). The reaction mixture was allowed to warm to -30 °C while stirring over a 5 period of 30 min. Subsequently, the reaction was recooled to -78 °C, followed by the addition of a solution of chloride 4* (2.24 g, 7.73 mmol,1 equiv) in THF (4 mL) (Note: chloride 4* was dried via azeotropic evaporation of toluene (50 mL) in vacuo, prior to use in this reaction). The reaction was allowed to slowly warm to room temperature and was monitored by thin layer chromatography (hexanes : ethyl acetate = 10:1 ). After 16 h of stirring at room temperature, the reaction was cooled to 0°C using an ice-water bath, diluted with hexanes (80 mL) and acidified using 1 M aqueous HCI (15 mL). The mixture was extracted using diethyl ether (3 x 100 mL) and the organic phases were combined. The organic collection was washed with brine solution (1 x 100 mL) an H ₂ O (1 x 100 mL), dried over Na ₂ SO ₄ and concentrated under reduced pressure. The crude product was purified using flash column chromatography (silica gel, 100% hexanes progressing to hexanes : ethyl acetate = 2:1 ) yielding compound 5* (1 .82g, 56% yield ) as a clear, viscous liquid. ¹ H NMR (600 MHz, CDCI ₃ ): δ 1 1 .67 (s, 1 H, OH), 7.26-7.22 (m, 2H, phenyl), 7.17-7.12 (m, 3H, phenyl), 6.01 (s, 1 H, OH), 5.26 (m, 1 H), 5.06 (m, 1 H), 4.44 (q, 2H, COOCH2CH3), 3.45 (d, 2H), 3.36 (d, 2H), 3.23 (m, 2H), 2.84 (m, 2H), 1 .83 (s, 3H), 1 .75 (broad s, 6H), 1 .71 (s, 3H), 1 .36 (t, 3H, COOCH2CHs) ppm; ¹³ C NMR (126 MHz, CDCI ₃ ): δ 172.14, 160.17, 158.46, 142.31 , 141 .27, 135.07, 133.40, 128.55, 128.19, 126.08, 123.04, 121 .83, 1 19.45, 1 12.50, 105.98, 61 .61 , 37.31 , 32.74, 26.01 , 25.89, 25.28, 22.48, 18.18, 18.08 14.52 ppm.

Example B.5. Synthesis of ethyl 2-hydroxy-4-methoxy-3,5-bis(3-methyl-2- butenyl)-6-phenethylbenzoate (6*)

A solution of compound 5* (1 .68 g, 3.98 mmol, 1 .0 equiv) in anhydrous acetone (75 mL) was cooled to 0 °C using an ice-water bath and K ₂ CO ₃ (3.30 g, 23.9 mmol, 6.0 equiv) was added. After 5 min of stirring at 0 °C, methyl iodide (0.58 g, 4.09 mmol, 1 .03 equiv) was slowly added to the vigorously stirring solution. The ice bath was then removed and the reaction was allowed to stir at room temperature for 6 h. The mixture was then concentrated under reduced pressure 5 and the concentrate was dissolved in a 1 :1 :1 mixture (v/v/v) of ice water, hexanes and diethyl ether. The solution was neutralized with 1 M aqueous HCI. The organic phase was isolated and the aqueous phase was washed with a 1 :1 mixture of hexanes and diethyl ether (2 x 50 mL). The collected organic phases were combined, dried over a ₂ S0 and concentrated under reduced pressure. The residue was purified using flash column chromatography (silica gel, 100% hexanes progressing to 2:1 hexanes : ethyl acetate) yielding amorf rutin 6 ^* (1 .3 g, 75% yield) as soft clear crystals. ¹ H NMR (600 MHz, CDCI ₃ ): δ 1 1 .16 (s, 1 H, OH), 7.32-7.28 (m, 2H, phenyl), 7.23-7.17 (m, 3H, phenyl), 5.25 (m, 1 H), 5.03 (m, 1 H), 4.45 (q, 2H, COOCH2CH3 ), 3.71 (s, 3H, OCH3), 3.39 (d, 2H), 3.34 (d, 2H,), 3.23 (m, 2H), 2.82 (m, 2H), 1 .79 (s, 3H), 1 .71 (s, 3H), 1 .70 (s, 3H), 1 .66 (s, 3H) ppm; ¹³ C NMR (125 MHz, CDCI ₃ ): δ 171 .80, 161 .61 , 160.27, 142.34, 141 .63, 131 .93, 131 .64, 128.55, 128.25, 126.32, 126.1 1 , 124.38, 123.02, 121 .37, 109.96, 61 .87, 61 .67, 37.57, 32.59, 25.93, 25.83, 25.52, 23.72, 18.26, 18.14, 14.49 ppm.

Example B.6. Synthesis of 2-Hydroxy-4-methoxy-3,5-bis(3-methyl-2-butenyl)-6- phenethylbenzoic acid (7*) corresponding to isolated product NP_015934

A 500 mL Schlenk flask was charged with KOH (13.1 g, 234 mmol, 20 equiv) pellets, which were subsequently dissolved using H ₂ O (10 mL) at room temperature. Once the KOH was completely dissolved and all excess heat dissipated, dimethylsulfoxide (DMSO) (100 mL) was added. Amorfrutin 6* (5.1 g, 1 1 .7 mmol, 1 .0 equiv) was transferred to the basic solution with a minimal amount of DMSO (5 mL). The reaction mixture was heated to 120 °C under reflux for 6 h, while monitoring with thin layer chromatography (hexanes : ethyl acetate = 2:1 ) the disappearance of the spot representing starting material, and then cooled to 0°C using an ice-water bath. The chilled solution was transferred to a 1 L Erlenmeyer flask containing 1 M aqueous HCI (265 mL), hexanes (200 mL), and diethyl ether (200 mL), being vigorously stirred at 0°C. After 5 min stirring, the organic phase was isolated using a 1 L separatory funnel, and the aqueous layer was washed with 1 :1 hexanes : diethyl ether (2 x 100 mL). The organic extracts were 5 combined, washed with H ₂ O (2 x 100 ml_), dried over Na2SO and concentrated under reduced pressure. Purification using flash column chromatography (silica gel, 6:1 hexanes : ethyl acetate progressing to 1 :1 hexanes : ethyl acetate) afforded amorfrutin 7* (4.0 g, 84% yield) as a crystalline white solid. ¹ H NMR (600 MHz, acetone-de): δ 7.32-7.25 (m, 4H), 7.18-7.14 (m, 1 H), 5.28 (m, 1 H), 5.07 (m,1 H), 3.71 (s, 3H, OCH3), 3.41 -3.33 (m, 6H), 2.85 (m, 2H), 1 .78 (s, 3H), 1 .73 (s, 3H), 1 .66 (bs, 3H) ppm; ¹³ C NMR (125 MHz, acetone-d ₆ ): δ 174.27, 162.22, 161 .74, 143.45, 143.19, 131 .58, 131 .38, 129.14, 129.07, 126.64, 126.41 , 125.51 , 124.07, 121 .46, 1 10.41 , 61 .75, 38.30, 34.02, 25.93, 25.85, 25.76, 24.03, 18.20, 17.99 ppm.

C. Biological evaluation Methods used in the following examples:

PPAR binding, cofactor recruitment and transcriptional activation assays

Binding of natural products to PPARs was quantified by use of a competitive time- resolved fluorescence resonance energy transfer (TR-FRET) assay according to the manufacturer's protocol (Lanthascreen PPAR competitive binding assay, Life Technologies, CA, USA) as described recently (Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 7257). Briefly, terbium-tagged PPAR ligand binding domain was titrated with varying ligand concentrations in the presence of constant concentrations of the fluorescein-labelled PPAR ligand fluormone. Increasing the concentration of unknown PPAR ligands results in a displacement of the labelled PPAR ligand and hence in a decrease of the TR-FRET signal. Fluorescence intensity was measured with the POLARstar Omega (BMG LABTECH, Offenburg, Germany). Data were fitted using GraphPad Prism 5.0 according equation: Y=Bottom + (Top- Bottom)/(1 +10 ^A ((LoglC50-X) ^* HillSlope)) with variable Hill slope, and affinity constants (K,) were calculated according to the manufacturer's protocol.

Binding of transcriptional cofactors was measured by a peptide-based TR-FRET assay according to the manufacturer's instruction (Lanthascreen PPARy coactivator assay, Life Technologies). Efficacy is the maximal association (for coactivators) or dissociation (for corepressors) normalized to the full PPARy agonist rosiglitazone (set to 100%). Transcriptional activation of PPARs was assessed in cellular reporter gene assays according to the manufacturer's protocols (GeneBLAzer PPAR Assay, Life Technologies). Briefly, HEK 293 cells were stably expressing a GAL4-PPAR-LBD fusion protein and an UAS-beta- lactamase reporter gene. Cells were incubated with different concentrations of compounds resulting in differential expression of the reporter gene. In reporter gene assays efficacy is the maximal transcriptional activation normalized to the full PPAR agonists RGZ, GW7647 or GW0742 (set to 100%). Fluorescence of all assays was measured with the POLARstar Omega (BMG LABTECH, Offenburg, Germany). Data were fitted using GraphPad Prism 5.0 according equation: Y=Bottom + (Top-Bottom)/(1 +10 ^A ((LogEC50-X) ^* HillSlope)) with variable Hill slope.

Cell culture

Primary subcutaneous preadipocytes isolated from human patients were provided by Zen-Bio (BioCat, Heidelberg, Germany) and treated as described previously. [Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 7257] Briefly, preadipocytes were maintained in preadipocyte medium (PM-1 , Zen-Bio) and then differentiated using PPARy agonist-free adipocyte medium (AM-1 , Zen-Bio) supplemented with 500 μηηοΙ/L 3-isobutyl-1 -methylxanthine (Sigma Aldrich, Taufkirchen, Germany) for 7 days. Subsequently, medium was changed to pure AM-1 for additional 7 days. Mature adipocytes were treated with 10 μηηοΙ/L amorfrutin B or 10 μηηοΙ/L rosiglitazone diluted in AM-1 for 24 hours, whereas 0.1 % DMSO was used as vehicle control.

Mouse MC3T3-E1 preosteoblast cells (subclone 4, CRL-2593, ATCC, LGC Promochem, Wesel, Germany) were cultured in Minimum Essential Medium a medium (MEMa, A1049001 , Gibco, Life Technologies) with 10% fetal bovine serum (FBS, Biochrom, Berlin, Germany) and 1 % penicillin/streptomycin (Biochrom) at 37 °C and 5% CO2. One-day post-confluent cells were differentiated to osteoblasts in MEMa additionally supplemented with 200 μηηοΙ/L ascorbic acid and 10 mmol/L β-glycerophosphate (all Sigma-Aldrich). The preosteoblasts were treated with amorfrutin B (10 μΜ), amorfrutins 1 -4 (each 10 μΜ), rosiglitazone (10 μΜ), pioglitazone (10 μΜ), troglitazone (10 μΜ) or vehicle (0.1 % DMSO) during the whole differentiation. The cells were collected after 7 days for gene expression analyses and after 24 days for staining. Calcification was determined by staining of osteoblasts with Alizarin red S (Sigma) according to [Anal. Biochem. 2004, 329, 77].

Primary subcutaneous preadipocytes (Zen-Bio, BioCat, Heidelberg, Germany) were differentiated and treated as described in Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 7257. 5

Viability and cytotoxicity were assessed in human HepG2 cells (ATCC) cultured in DMEM (Gibco, Life Technologies) supplemented with 10% FBS treated with amorfrutin B for 24 h using the CellTiter-Glo Luminescent Cell Viability Assay and the CytoTox-Glo Cytotoxicity Assay (both Promega, Mannheim, Germany) respectively, according to the manufacturer's protocols. In vitro micronucleus assays were performed in CHO-K1 cells at Cerep, Inc. (Redmond, WA, USA) according to Mutat. Res. 2007 630, 1 .

Antiproliferative effects were investigated in human HT-29 (DSZM, Braunschweig, Germany) and T84 (ATCC) colon carcinoma cells, in PC3 (ATCC) prostate cancer cells and MCF-7 (ATCC) breast cancer cells. HT-29 and T84 cells were cultured in DMEM/F-12 (ATCC) supplemented with 5% FBS (Biochrom) and 1 % penicillin/streptomycin (Biochrom), PC3 cells were cultivated in RPMI 1640 (Biochrom) supplemented with 10% FBS (Biochrom) and 1 % penicillin/streptomycin (Biochrom), MCF-7 cells were cultured in DMEM GlutaMAX (Gibco, Life Technologies) supplemented with 10% FBS (Biochrom), 10 g/ml human insulin (Sigma Aldrich) and 1 % penicillin/streptomycin (Biochrom), all at 37 °C and 5% CO2. For one-concentration screening studies, one day before treatment cells were seeded in 96 well plates (TPP) with a density of 4000 cells/well (HT-29), 5000 cells/well (MCF-7) and 1500 cells/well (PC3), respectively, in a final volume of 200 L/well. Cells were then treated with the indicated compound concentrations by adding 50 μί of a 5 times stock concentration. For concentration series, cells were seeded in black 384 well plates (Corning #3712) with a density of 750 cells/well (HT-29), 900 cells/well (T84), 250 cells/well (PC3), respectively, in a final volume of 50 L/well. Cells were then treated with the indicated compound concentrations by adding 10 μί of a 6 times stock concentration. After 3 days (HT-29, PC-3, MCF-7) and 4 days (T84) of treatment, cells were quantified using the CyQUANT NF Cell Proliferation Assay Kit (Life Technologies) according to the manufacturer's instructions. Fluorescence intensity was measured with the POLARstar Omega (BMG LABTECH). For dilution series, data were fitted using GraphPad Prism 5.0 according equation: Y=Bottom + (Top- Bottom)/(1 +10 ^A ((LoglC50-X) ^* HillSlope)) with variable Hill slope. Efficiency is the maximal observed induction of cell death after treatment relative to nontreated cells. Additive effects were determined by treatment with compound mixtures with following ratios: 7:0, 6:1 , 5:2, 4:3, 3:4, 2:5, 1 :6, 0:7. HT-29 cells were treated with different concentration series of these compound mixtures. For each mixture, compound IC'70 values, which gives the concentration needed to inhibit cancer cell growth by 70%, were calculated and plotted as isobologram according the Loewe additivity model (Klin Wochenschr. 1927, 6, 1077). The combination index (CI) for compounds 1 and 2 in each mixture (M) was calculated as follows: CI = IC _∞ (M1 )/IC ₅₀ (1 ) + IC ₅ o(M2)/IC ₅ o(2).

Phosphatidylserine external ization of HT-29 cells treated with NP-015934 was determined by staining with annexin-V-FLUOS and propidium iodide (Roche Life Science) and subsequent flow cytometry (Accuri C6, BD Biosciences) according to manufacturer's instructions. Analysis was performed using FlowJo 7.6 (Tree Star).

Formation of reactive oxygen species (ROS) was measured by use of the ROS- sensitive dye H ₂ -DCFDA (Life Technologies) according to the manufacturer's instruction. Briefly, one day before treatment HT-29 cells were seeded in 96 well plates (TPP) with a density of 15000 cells/well. Before treatment, adherent cells were washed once with pre-warmed PBS and loaded with 50 μΜ dye diluted in PBS. Cells were then incubated for 30 min at 37°C to allow incorporation and activation of H ₂ -DCFDA, followed by removal of free dye and washing with pre- warmed PBS. Phenol-Red-free medium was added and cells were again incubated at 37 °C for 60 min. Compounds were added as indicated, and fluorescence (485/530 nm) was measured with the POLARstar Omega (BMG Labtech) at 37 °C for 22 h of treatment using orbital averaging and bottom optics.

For investigating the mitochondrial transmembrane potential (ΔΨιτι) the JC-1 assay (Cayman Chemicals) was performed according to the manual. This assay makes use of a lipophilic cationic dye (5,5',6,6'-Tetrachloro-1 ,1 ',3,3'- tetraethylbenzimidazolylcarbocyanine iodide), which selectively enters into mitochondria and changes reversibly its color from red to green as the membrane potential decreases. For this assay, one day before treatment HT-29 cells were seeded in 96 well plates (TPP) with a density of 40000 cells/well. One day later, cells were treated with indicated compounds for 5 min at 37 °C, followed by addition of JC-1 dye for additional 10 min. Cells were then washed twice with pre- warmed JC-1 assay buffer to remove free JC-1 dye. Fluorescence measurement was performed in JC-1 assay buffer in the POLARstar Omega (BMG Labtech) with following filter settings: JC-1 -aggregates (excitation 560/10 nm, emission 590/30 nm), JC-1 monomers (excitation 485/30 nm, emission 520/10 nm). The ratio of JC- 1 aggregates to monomers fluorescence was used as indicator of mitochondrial transmembrane potential. Data were fitted using GraphPad Prism 5.0 according 5 equation: Y=Bottom + (Top- Bottom)/(1 +10 ^A ((LoglC50-X) ^* HillSlope)) with variable Hill slope.

To explore the effects on the mitochondrial permeability transition pore (MPTP) the MitoProbe Transition Pore Assay Kit (Life Technologies) was used according to the manufacturer's instructions. Cells were loaded with a calcein dye that accumulates in cytosolic compartments, including the mitochondria. The fluorescence of cytosolic calcein was quenched by addition of C0CI2, while mitochondrial fluorescence is maintained. Opening of the MPTP leads to loss of mitochondrial calcein fluorescence. For that purpose, HT-29 cells were suspended in HBSS/Ca buffer with a density of 10 ⁶ cells/ml, and labeled with 10 nM calcein and 400 μΜ CoCI ₂ . Subsequently, NP-015934 or NP-015934met was added as indicated. Cells were incubated at 37 °C for 30 min and subsequently washed with HBSS/Ca buffer before counting by flow cytometry (Accuri C6, BD Biosciences) according to manufacturer's instructions. Analysis was performed using FlowJo 7.6 (Tree Star) and Prism 5.0 (GraphPad).

Oxygen consumption was determined by time-resolved fluorescence of an oxygen-sensitive probe (MitoXpress-Xtra HS, Luxcel Biosciences). Probe fluorescence is quenched by molecular oxygen, so that fluorescence lifetime increases with reduction in extracellular oxygen concentration. One day before treatment, HT-29 cells were seeded in 96 well plates (TPP) with a density of 80000 cells/well in DMEM/F-12 supplemented with 5% FBS and 1 % penicillin/streptomycin and incubated at 37 °C and 5% CO2. For subsequent oxygen consumption measurements, the medium was removed and cells were incubated with 140 μΙ of pre-warmed probe diluted in phenol red-free DMEM/F- 12/FBS/penicillin/streptomycin. After incubation for 10 min at 37 °C, cells were then treated with the indicated compound concentrations by adding 20 μΙ_ of a 8 times stock concentration. Finally, cells were sealed with 100 μΙ of pre-warmed HS mineral oil (MitoXpress-Xtra HS) to prevent back diffusion of ambient oxygen. Time-resolved fluorescence was measured in the POLARstar Omega (BMG Labtech) with following settings: temperature = 37 °C; TRF optic Z height = 6 mm; excitation = 380/20 nm; emission = 655/50 nm; window 1 (w1 ): 30 με delay and 30 με integration time; window 2 (w2): 70 με delay and 30 με integration time; interval time = 90 s; measurement time = 150 min. Background fluorescence was measured in wells with medium and oil, but without cells and probe. For data analysis, background fluorescence was subtracted individually for both measurement windows. Fluorescence lifetime (τ) for each sample was then 5 calculated by τ = 40/(ln(w1/w2)), and plotted over treatment time. For comparing oxygen consumption between treatments, the rate of probe fluorescence lifetime was determined between 20 and 60 min and expressed relative to untreated cells. Data were analyzed using Prism 5.0 (GraphPad).

Extracellular acidification was determined by time-resolved fluorescence of a pH- sensitive probe (pH Xtra, Luxcel Biosciences). Fluorescence lifetime of this probe increases with decrease in pH, so that it allows measurement of extracellular acidification. One day before treatment, HT-29 cells were seeded in 96 well plates (TPP) with a density of 80000 cells/well in DMEM/F-12 supplemented with 5% FBS and 1 % penicillin/streptomycin and incubated at 37 °C in a CO ₂ -free incubator. For subsequent measurements the following low-buffering aspiration medium was used according to the manufacturer's instructions: 1 mM PBS (pH 7.4), 20 mM glucose, 75 mM NaCI, 54 mM KCI, 2.4 mM CaCI ₂ and 0.8 mM MgSO ₄ . Before treatment, cells were washed twice with 200 μΙ aspiration buffer, and incubated with 140 μΙ of pre-warmed probe diluted in aspiration medium. After incubation for 10 min at 37 °C, cells were then treated with the indicated compound concentrations by adding 20 μΙ_ of a 8 times stock concentration. Time- resolved fluorescence was measured in the POLARstar Omega (BMG Labtech) with following settings: temperature = 37°C; TRF optic Z height = 6 mm; excitation = 380/20 nm; emission = 615/50 nm; window 1 (w1 ): 100 s delay and 30 s integration time; window 2 (w2): 300 s delay and 30 s integration time; interval time = 100 s; measurement time = 200 min. Background fluorescence was measured in wells with medium and oil, but without cells. For data analysis, background fluorescence was subtracted individually for both measurement windows. Fluorescence lifetime (τ) for each sample was then calculated by T = 200/(ln(w1/w2)), transformed to absolute pH values according pH = (1687.2- lifetime)/199.12 (Anal. Biochem. 2009, 390, 21 ), and plotted over treatment time. For comparing extracellular acidification between treatments, the acidification rate was determined between 20 and 150 min. Data were analyzed using Prism 5.0 (GraphPad).

PPARy knockdown

Specificity of PPARy modulation was investigated in siRNA-mediated PPARy- knockdown in adipocytes with subsequent real-time PCR detection as described in Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 7257. Briefly, differentiated human adipocytes were seeded in 24-well-plates (Nunc) at a confluence of 30 to 60%. Cells were transfected with 10 nmol/L PPARy Silencer Select Validated siRNA (ID S10888) or 10 nmol/L Silencer Select Negative Control #1 siRNA (all Life Technologies) using DeliverX Plus siRNA Transfection Kit (Panomics, BioCat). Transfection was carried out in serum- and antibiotic-free AM-1 medium (AM-1 - PRF-SF, Zen-Bio) for 4 h and continued for 3 days in standard AM-1 medium. Afterwards, cells were additionally treated with 10 μηηοΙ/L amorfrutin B, 10 μηηοΙ/L RGZ or vehicle control for 24 hours prior to RNA collection.

RNA purification, cDNA synthesis and quantitative real-time PCR (qPCR)

Animal tissues were first lysed and homogenized in TRIzol (Invitrogen) with 5 mm steel beads at 20 Hz for 8 min (TissueLyser, QIAGEN), and isolation of total RNA was done according to the manufacturer's instruction. Subsequent RNA purification was performed using the RNeasy Mini Kit (QIAGEN) and genomic DNA digestion (DNase-Set, QIAGEN) according to the manual. The concentration of extracted RNA was measured using the Nanodrop ND-1000 Spectrophotometer (Fisher Scientific). RNA was reversely transcribed into cDNA applying the High Capacity cDNA Reverse Transcription Kit (Life Technologies) with random primers. Quantitative PCR was carried out on the ABI Prism 7900HT Sequence Detection System using the SYBR Green PCR Master Mix (all Life Technologies). After an initial denaturation at 95 °C for 10 min, the cDNA was amplified by 40 cycles of PCR (95 °C, 15 s; 60 °C, 60 s). The relative gene expression levels were normalized using β-actin gene and quantified by the 2 AACt method [Method. Methods San Diego, Calif, 2001 , 25, 402]. Primer sequences are summarized in Table 4.

Caspase activation

Activation of caspases 3 and 7 were investigated using the luminometric Caspase- Glo 3/7 Assay (Promega) according to the manufacturer's instructions. Briefly, one day before treatment HT-29 and MCF-7 cells were seeded in black 384 well plates (Corning, #3712) with a density of 2000 cells/well in a final volume of 20 L/well. Cells were treated for the indicated time with the given compound concentrations by adding 5 μί of a 5 times stock concentration. Luminescence was measured with the POLARstar Omega (BMG LABTECH). Activation of caspases 2, 3, 6, 7, 8, 9 and 10 were investigated using the fluorimetric Homogeneous Caspases Assay, (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's instructions. Briefly, one day before treatment HT-29 and PC-3 cells were seeded in black 384 well plates (Corning, #3712) with a density of 1300 and 1000 cells/well, respectively, in a final volume of 20 L/well. Cells were treated for the indicated time with the given compound concentrations by adding 5 μί of a 5 times stock concentration. Fluorescence was measured with the POLARstar Omega (BMG LABTECH).

DNA fragmentation assay

BrdU-labeled DNA fragments in the cytoplasm of treated HT-29 cells were quantified with the Cellular DNA Fragmentation ELISA (Roche Diagnostics) according to the instructions for use. Briefly, HT-29 cells were seeded in 96 well plates (TPP) with a density of 13000 cells/well in a final volume of 200 L/well with 10 μηηοΙ/L BrdU and incubated for 2 days at 37 °C. Supernatant was removed and cells were incubated in 100 μΙ_ medium containing the compound at given concentrations. After the indicated treatment time, the cytosolic fractions were harvested and analysed on a 96 well half-area clear high-binding microplate (Corning, #3690) according to the manual. Absorbance was measured at 450 and 690 nm. Cell-free samples were used as background control for subtraction.

Pharmacokinetics Pharmacokinetic experiments were performed at Charles River (Edinburgh, UK). Briefly, 18 male C57BL/6 mice were orally administered with 100 mg/kg body weight amorfrutin B in 1 % carboxymethylcellulose. Terminal blood samples were collected after 0.5, 1 , 2, 4, 8, and 24 h after dosing and analyzed using LC- MS/MS. Animal studies

Animal studies have been approved by the State Office of Health and Social Affairs Berlin and were carried out according to internationally approved guidelines. All animals were singly housed under temperature-, humidity- and light- controlled conditions (22 °C, 50% humidity, 12 hours light/12 hours dark-cycle). Mice had ad libitum access to food and water. Mice and food were weighed in a regularly manner to determine changes in body weight and food intake. Male C57BL/6 mice at age of 6 weeks were fed for 12 weeks with high-fat diet (HFD, D12492, kJ composition: 60% fat, 19% protein, 21 % carbohydrate, 25.3 MJ/kg, ssniff, Soest, Germany) to induce obesity and insulin resistance. Prior to treatment, mice were weighed and distributed uniformly to 3 groups (n = 10-13 each). Mice were fed over 4 weeks with HFD without compound (vehicle), with 4 mg/kg/d rosiglitazone (RGZ) or with 100 mg/kg/d amorfrutin B (AB) incorporated in the food.

After 15 days of treatment an intraperitoneal insulin sensitivity test (IPIST) was performed. Mice were fasted overnight and then had ad libitum access to food for 1 h before the test. 1 .5 U/kg body weight of insulin (Sigma-Aldrich) was injected intraperitoneally. Blood was taken from tail vein at the indicated time points and blood glucose was analysed in a Hemocue B-Glucose analyser (Hemocue, Grc^ostheim, Germany). Whole blood was further collected using Microvette lithium-heparin coated capillary tubes (CB300, Sarstedt, Nurnbrecht, Germany). After centrifugation for 5 min at 2000 g and 4 °C, plasma was collected and stored at -80 °C for subsequent measurements.

After 22 days of feeding an oral glucose tolerance test (OGTT) was carried out. Mice were fasted overnight before being subjected to an oral dose of 2 g/kg body weight of glucose (Sigma-Aldrich). Blood was taken from tail vein at the indicated time points and examined as described above.

After 27 days of dosing, fasted mice were sacrificed by cervical dislocation. Hematocrit was measured by weighting of blood samples before and after plasma separation. Plasma and tissues were collected and stored at -80 °C before use. Metabolic parameters measurements

Blood glucose was analysed in a Hemocue B-Glucose analyzer. Plasma glucose was measured using the Amplex Red Glucose Assay Kit (Life Technologies). Plasma triacylglycerols, NEFA, HDL and LDL cholesterol and plasma alanine transaminase (ALT) were determined with colorimetric quantification kits (Biovision, BioCat). Plasma β-hydroxybutyrate was analyzed colorimetrically (Cayman, Biomol, Hamburg, Germany). Insulin (Insulin Ultrasensitive EIA, ALPCO, Immundiagnostik, Bensheim, Germany), triiodothyronine (T3), thyroxin (T4) (Calbiotech, San Diego, CA, USA), osteocalcin (BGLAP bone gamma- carboxyglutamate (gla) protein, ABIN415574, antibodies-online, Aachen, Germany) and FGF21 (BioVendor, Heidelberg, Germany) were determined in plasma samples using ELISA. Whole blood haemoglobin (Hemoglobin Colorimetric Assay Kit, Cayman, Biomol) was analysed for investigation of hemodilution. All assays were performed according to the manufacturer's instructions. HOMA-IR was determined according to HOMA-IR = fasting blood glucose (mg/dL) χ fasting insulin ( U/mL)/405.

Immunoblottinq

Visceral white adipose tissue of treated mice was lysed in UEES lysis buffer (9 M Urea, 100 mM EDTA EGTA, 4% SDS with protease and phosphatase inhibitors) using 5 mm steel beads at 20 Hz for 8 min (TissueLyser). After centrifugation for 10 min at 10000 g, the supernatants were stored at -80 °C until use. Samples were denatured and separated using a NuPAGE Novex 4-12% Bis-Tris gel (Invitrogen) and blotted onto nitrocellulose membranes. Membrane was blocked with a solution containing 1 .5% milk powder, 1 .5% BSA in PBS-T (0.1 %) and 0.5x phosphatase inhibitor overnight at 4 °C. Membranes were washed in PBS-T (0.1 %). A rabbit polyclonal phospho-specific antibody against PPARy Ser 273 was produced by Eurogentech (Seraing, Belgium) with the phosphopeptide Ac- KTTDKpSPFVIYDC-amide [Nature 2010, 466, 451]. For detection, 0.8 pg/mL PPARy-pSer273 and 0.5 pg/mL PPARy (E-8, Santa Cruz, Heidelberg, Germany) antibody, respectively, were diluted in PBS-T (0.1 %) with 1 .5% milk powder and 1 .5% BSA. Membranes were shaken overnight at 4 °C and subsequently incubated with anti-rabbit IgG-HRP (Santa Cruz, #sc-2004) and anti-mouse IgG- HRP (Santa Cruz, #sc-2005), respectively, prior to detection with Western Lightning ECL solution (Perkin Elmer). Membranes were stripped with Restore Plus Western Blot Stripping Buffer (Thermo Scientific) for 10 min. Densitometry was performed with GelAnalyzer 2010. The rate of PPARy phosphorylation was normalized to total PPARy protein and plotted on logarithmic scale.

Statistical analyses

Data are presented as mean ± standard error of mean (SEM) if not otherwise denoted. Statistical tests were performed in GraphPad Prism 5.0. For comparison of two groups statistical significance was examined by unpaired two-tailed Student's t-test if not otherwise stated. For multiple comparisons data were analysed by one-way ANOVA with subsequent Dunnett's post test. A p value < 0.05 was defined as statistically significant. To exclude that observed reduction in adiposity is not exclusively attributed to a change in caloric intake (see Figure 24b), and to determine that the anti-diabetic effects are not exclusively attributed to body weight reduction (see Figure 24d), we performed analysis of covariance (ANCOVA) tests as explained in [Nat. Methods 2012, 9, 57]. Briefly, ANCOVA works by plotting individual data for two phenotypes (e.g. HOMA-IR index vs. body weight) and fitting them with a linear regression curve. Comparison in that regression line of two different treatments (e.g. treated vs. untreated) allow for effectively testing if both phenotypes are strongly dependent on each other (same slope and interception of regression lines) or if both phenotypes are fully or partly independent from each other (different slope and/or interception of regression lines). Table 4: Primer sequences used for quantitative real-time PCR.

Gene

Symbol Forward primer Reverse primer

ID

ACTB 60 CAGCCATGTACGTTGCTATCCAGG AGGTCCAGACGCAGGATGGCATG

ADIPOQ 9370 GGTGAGAAGGGTGAGAAAGG TCCTTTCCTGCCTTGGATT

ANGPTL2 23452 GGGAGACGTACAAGCAAGGG CGGAAACTGGCGTATTCTGC

ANGPTL4 51 129 GATCCCCACGGCGAGTTC CCGTGATGCTATGCACCTTCT

CD36 948 GTTGATTTGTGAATAAGAACCAGAGC TGTTAAGCACCTGTTTCTTGCAA

CEBPA 1050 CTAACTCCCCCATGGAGTCGG GTCGATGGACGTCTCGTGC

CEBPB 1051 ACTTTAG CG AGTCAG AG CCG GATTTAAAGGCAGGCGGCG

CFD 1675 TGAAGGTCAGGGTCACCCAA GACCAACCAGATGCAGGAGT

FABP4 2167 GGTGGTGGAATGCGTCATG CAACGTCCCTTGGCTTATGC

FGF21 26291 TGGATCGCTCCACTTTGACC GGGCTTCGGACTGGTAAACA

HSD1 1 B1 3290 GGCCTCATAGACACAGAAACAGC TGATCTCCAGGGCACATTCC

LEP 3952 TGTGCGGATTCTTGTGGCTT GGAGACTGACTGCGTGTGT

LPL 4023 ACAGAATTACTGGCCTCGATCC CTGCATCATCAGGAGAAAGACG

NR1 H3 10062 CACCTACATGCGTCGCAAGT G ACAG G ACACACTCCTCCCG

PCK2 5106 CTGAGGAGGAGAATGGGCG AG AG CCAACC AG CAGTTGTCA

PDE3B 5140 TCGAGACATTCCTTATCACAATCG GGAACTGGCCGTGTTGTCA

PDK4 5166 CTGGACTTTGGTTCAGAAAATGC CCTTCAGAATGTTGGCGAGTCT

PLTP 5360 G ACACCGTG CCTGTG CG GGTGGAAGCCACAGGATCCT

PPARG 5468 CATGGCAATTGAATGTCGTGTC CCGGAAGAAACCCTTGCAT

RARRES2 5919 CAGGCCCAATGGGAGGAAAC GGCCCAGAACTTTGTCCTCA

Acadl 1 1363 AGCCTGGGGCTGGAAGTGACTTA CACGGTTGGTGACGGCCACG

Acadm 1 1364 ACGGGGGAAAGGCCAACTGGTAT AGGATCTGGGTTAGAACGTGCCA

Acoxl 1 1430 CAGCACTGGTCTCCGTCATG CTCCGGACTACCATCCAAGATG

Actb 1 1461 TGTCCACCTTCCAGCAGATGT AGCTCAGTAACAGTCCGCCTAGA

Adipoq 1 1450 AGGAAAGGAGAGCCTGGAGA CGAATGGGTACATTGGGAAC

Bdh1 7191 1 GTGTGTGTAAGGCACATCCG CTTCTGGCTTGGAGTTGGCT 5

Bdh2 69772 GTCTTTGGATTGTGCCGCAG GCAAAAGCTAATGCGGATGC

Bglap 12096 GTCCCACACAGCAGCTTGGCCC ACAGAGCGCAGCCAGGGTCAG

Ccl3 20302 GCTCCCAGCCAGGTGTCATTTTCC GGGGTTCCTCGCTGCCTCCA

Ccl5 20304 CTCACTGCAGCCGCCCTCTG CCG AG CCATATG GTG AGG CAGG

Ccr2 12772 TC AG CTG CCTG CAAAG ACCAG A CGGTGTGGTGGCCCCTTCAT

Ccr5 12774 AGACTCTGGCTCTTGCAGGATGGA GGCAGGAGCTGAGCCGCAAT

Cptla 12894 TCTGCAGACTCGGTCACCACTCAAG GGCTCAGGCGGAGATCGATGC

Cptl b 12895 GAGATCAAGCCGGTCATGGCAC AGGCGCGAGCCCTCATAGAGC

Cpt2 12896 AAGCAGCGATGGGCCAG GAGCTCAGGCAGGGTGACC

CxcM 14825 GGCCCCACTGCACCCAAACC CAAGGCAAGCCTCGCGACCA

Emr1 13733 ACCCTCCAGCACATCCAGCCAA TC AC AG CCCG AGG GTGTCCA

Fabp4 1 1770 CATGGCCAAGCCCAACAT CG CCCAGTTTG AAG G AAATC

Fbp1 14121 GCATCGCACAGCTCTATGGT ACAGGTAGCGTAGGACGACT

Fgf21 56636 AGACAGCCTTAGTGTCTTCTCA CCAAGGCAGCTGGAATTGTG

G6pc 14377 GCTGGAGTCTTGTCAGGCAT ATCCAAGCGCGAAACCAAAC

G6pc3 68401 TATGGGTTGACTGCTCTGGC CCAGGTTGATGGACCAGGAAA

Hmgcl 15356 TGTACCCACCCCAGTGAAGA GAGTGGTCAGCCATCTGTGG

Hmgcsl 208715 GTCCTGGCACAGTACTCACC TGTGGCGTCTTGTGTGACTT

Hmgcs2 15360 AGAGGCCTTCAGGGGTCTAA TTGAACATGTCCAGGGAGGC

Ibsp 15891 CG GTTTCCAGTCCAGG G AGG CA TGGGGTGTGGTCTCTGCTCCG

116 16193 TCTGCAAGAGACTTCCATCCAGTTGC AGGCCGTGGTTGTCACCAGC

Lep 16846 CCCTGTGTCGGTTCCTGTGGC TGGCGGATACCGACTGCGTG

Pck1 18534 CCTAGTGCCTGTGGGAAGAC AGCCCTTAAGTTGCCTTGGG

Pck2 74551 GTACCACTG GTGTACG AG GC GTCTTTCCTTTGTGCTCCGC

Pcx 18563 GGGCGGAGCTAACATCTACC TATACTCCAGACGCCGGACA

Pdk4 27273 ATATTCAGTGACTCAAAGACGGGAA ACACTCAAAGGCATCTTGGACTACT

Phex 18675 GTGGCACCCTGGTGTTGGGC ATGGCAGCAGCGGCTTCTATGC

Pklr 18770 AGTCTGTG GTTCTTG CAG CC CTGG AG CCCCACTTAAAG CA

Ppargda 19017 TCCCATACACAACCGCAGTCGC GGGGTCATTTGGTGACTCTGGGGT

Ppargd b 170826 GGGAAAAGGCCATCGGTGAA CAGCACCTGGCACTCTACAA Ptgs2 19225 CCCTGCTGCCCGACACCTTC CCAGCAACCCGGCCAGCAAT

Slc2a2 20526 CCAGGTCCAATCCCTTGGTT CCCAAGGAAGTCCGCAATGT

Taldol 21351 CAACGAAGACCAAATGGCCG CATTCGTTCCGTGAGCATCC

Tnf 21926 AGCCCACGTCGTAGCAAACCA CATGCCGTTGGCCAGGAGGG

Ucp1 22227 CACGGGGACCTACAATGCTT TAGGGGTCGTCCCTTTCCAA

Ucp2 22228 CGCCTTCTACAAGGGGTTCA CGAGATTGGTAGGCAGCCAT

Ucp3 22229 ACAAAGGATTTGTGCCCTCC TCAAAACGGAGATTCCCGCA

Example C.1 : Binding affinity assays.

The binding affinity of the compounds displayed in Table 1 for PPARs was analyzed using in vitro binding assays.

The binding affinities for PPARy ranging from 19 nmol/L to 6 μηηοΙ/L are summarized in Figure 1 and Table 5.

Table 5: Compound data and PPAR binding/activation constants

Source PPARa PPARv

Compound Additional name CAS Ki EC50 Efficacy Ki Ki EC50 Efficacy EC50 Efficacy

Genus and Species

(μιηοΙ/Ι) (μιηοΙ/Ι) (%) (μιηοΙ/Ι) (pmol/l) (μιηοΙ/Ι) (%) (μιηοΙ/Ι) (%)

NP-000420 1083197-79-8 # F n.d. 48 n.d. n.d. 4.4 0.708 n.d. n.d. 8.5 74

NP-001269 913690-90-1 F n.d. n.d. n.d. n.d. n.d. > 100 n.d. n.d. n.d. n.d.

NP-001727 none P Picris altissima 38 n.d. n.d. 38 1.3 n.d. n.d. 9.6 81

NP-001728 none P Picris altissima 9.6 4.3 49 n.d. 0.860 n.d. n.d. 2.9 94

NP-001782 Altenusin 31 186-12-6 F n.d. 60 n.d. n.d. 15 3.2 n.d. n.d. n.d. n.d.

NP-001787 Alternarian acid 91868-93-8 F n.d. > 100 n.d. n.d. > 100 > 100 n.d. n.d. n.d. n.d.

NP-002329 103904-73-0 P 2.8 0.173 60 2.2 0.264 5.4 54 0.928 124

NP-003520 Amorfrutin 1 80489-90-3 P G.foetida, A. fruticosa 27 ^* 0.699 23 27 ^* 0.236 ^* n.d. n.d. 0.051 ^* 75

NP-003521 Amorfrutin 2 80489-91-4 P G.foetida, A. fruticosa 25* 0.390 18 17* 0.287* n.d. n.d. 0.318* 85

NP-004976 none P Myrsine capitellata 24 n.d. n.d. 12 1.7 n.d. n.d. n.d. n.d.

NP-004977 none P Myrsine capitellata n.d. n.d. n.d. n.d. 2.9 n.d. n.d. n.d. n.d.

NP-004978 none P Myrsine capitellata 11 n.d. n.d. 6.7 3.2 n.d. n.d. n.d. n.d.

NP-006243 none F n.d. 12 4.7 15 3.8 0.305 0.066 12 1.1 73

NP-006427 1083192-64-6 P Glycyrrhiza foetida n.d. n.d. n.d. n.d. 3.2 n.d. n.d. n.d. n.d.

NP-006430 Amorfrutin 3 946570-99-6 P G.foetida, A. fruticosa 115 ^* 0.807 13 68 ^* 0.352 ^* n.d. n.d. 2.8 ^* 92

NP-006431 70610-12-7 P Glycyrrhiza foetida 7.8 0.903 28 2.3 0.093 1.3 24 0.413 97

NP-009326 none P n.d. n.d. n.d. n.d. > 100 n.d. n.d. n.d. n.d.

NP-009525 Amorfrutin 4 none P G.foetida, A. fruticosa 8.0* 0.660 14 6.0* 0.278* n.d. n.d. 0.335* 78

NP-01 1855 103904-74-1 P 1.6 0.224 68 3.8 0.167 5.8 70 0.770 125

NP-01221 1 Cannabidiol 13956-29-1 P Cannabis sativa n.d. n.d. n.d. n.d. 4.7 n.d. n.d. n.d. n.d.

GAR-P03598WO07 Application (without Figures).doc

MP-01241 1 1083200-69-4 # P 128 n.d. n.d. 40 1.6 n.d. n.d. 9.4

MP-012412 none P 32 n.d. n.d. 5.4 1.0 n.d. n.d. 4.9 81

MP-012584 llicicolin B 22581-07-3 F n.d. 3.2 n.d. n.d. 8.9 1.1 n.d. n.d. n.d. n.d.

MP-012626 Eriolic acid A 1207435-63-9 P 86 n.d. n.d. 39 0.871 n.d. n.d. 2.2 74

MP-014467 143522-31-0 P Syzygium jambos 25 n.d. n.d. 30 2.3 n.d. n.d. n.d. n.d.

MP-015135 1 174387-93-9 P Amorpha fruticosa 7.2 n.d. n.d. 3.6 1.2 n.d. n.d. 0.660 108

MP-015136 73436-07-4 P Amorpha fruticosa 5.0 1.7 22 1.4 0.134 1.0 36 n.d. n.d.

MP-015137 70610-10-5 P Amorpha fruticosa 6.8 1.5 20 8.9 0.969 0.215 6.0 6.1 1 18

MP-015142 Amorfrutin B 78916-42-4 P G.foetida, A. fruticosa 2.6" 0.906 61 1.8 0.019* 0.073 25 0.060 61

MP-015933 1 189096-44-3 P Glycyrrhiza foetida 1.6 0.157 16 3.0 0.41 1 0.298 27 0.349 73

MP-015934 1 189096-45-4 P Glycyrrhiza foetida 9.1 n.d. n.d. 5.2 0.723 1.2 7.0 n.d. n.d. iMP-015935 1189096-22-7 P Glycyrrhiza foetida 8.2 n.d. n.d. 5.8 0.524 0.439 5.0 0.581 69

NP-015936 1 189096-23-8 P Glycyrrhiza foetida 4.4 0.480 14 7.0 0.613 0.423 16 0.169 60

NP-015937 1 189096-25-0 P Glycyrrhiza foetida 6.0 4.4 22 5.0 0.413 0.379 7.0 0.023 60

NP-015938 1189096-26-1 P Glycyrrhiza foetida 6.6 n.d. n.d. 5.6 1.3 n.d. n.d. n.d. n.d.

NP-015939 1 189096-29-4 P Glycyrrhiza foetida 6.2 n.d. n.d. 6.8 0.626 0.796 12 1.7 67

NP-015953 1234832-83-7 P Glycyrrhiza foetida 7.8 2.8 29 4.8 0.492 0.025 5.0 0.135 58

NP-015954 1235317-27-7 P Glycyrrhiza foetida 1 1 1.9 48 4.5 0.508 6.0 1 1 2.2 74

NP-015955 1235159-42-8 P Glycyrrhiza foetida 18 n.d. n.d. 24 0.454 6.9 79 0.150 104

NP-016018 Cannabidivarin 24274-48-4 P Cannabis sativa n.d. n.d. n.d. n.d. 6.0 n.d. n.d. n.d. n.d.

NP-016020 25555-57-1 P Cannabis sativa 7.0 1.4 24 2.7 0.280 0.093 12 n.d. n.d.

NP-016021 Cannabidiolic acid 1244-58-2 P Cannabis sativa n.d. n.d. n.d. n.d. > 100 n.d. n.d. n.d. n.d.

Amorfrutin B (NP-015142) (Figure 2a) showed the lowest, nanomolar binding affinity constant to PPARy (Ki = 19 nM, Table 6) similar to the standard PPARy- targeting drug rosiglitazone (Avandia, Ki = 7 nM, Table 6), and 12-times lower than the initially described amorfrutin A1 .

Table 6. Binding and activation of PPARs by amorfrutin B (NP-015142): Binding affinity (Ki) values were obtained by using competitive TR-FRET assays, effective concentrations (EC50) and efficacy values were determined from reporter gene assays. Efficacy is the maximum activation relative to the reference agonist, n.d., not determined.

Receptor Amorfrutin B Rosiglitazone GW7647 GW0742

PPARa

Ki(mmol/L) 2624 n.d. 1 n.d.

EC50(mmol/L) 906 n.d. 0.3 n.d.

Efficacy(%) 61 n.d. 100 n.d.

PPARp/y

Ki(mmol/L) 1782 n.d. n.d. 0.4

EC50(mmol/L) 740 n.d. n.d. 0.2

Efficacy(%) 3 n.d. n.d. 100

PPARy

Ki(mmol/L) 19 7 n.d. n.d.

EC50(mmol/L) 73 4 n.d. n.d.

Efficacy(%) 25 100 n.d. n.d.

Additionally, the compounds bound to the isotypes PPARa and PPAR /δ. The results are summarized in Figure 3, Figure 4 and Table 5. Amorfrutin B (NP- 015142) revealed potent binding to PPARa (Ki = 2624 nM, Table 6) and PPAR /δ (Ki = 1782 nM, Table 6) with low-micromolar affinity, suggesting that this compound may also modulate the activity of these PPARs. Such partial pan-PPAR modulation may enable to concomitantly treat diabetes-associated disorders, but is difficult to trace mechanistically due to the involvement and potential cross-talk of various tissues.

Example C.2: Transcriptional activation assays.

The transcriptional activation potential of the compounds displayed in Table 1 using reporter gene assays was evaluated. PPARy activation with EC50 values ranging from 25 nmol/L to 6.9 μηηοΙ/L and transactivation efficacies from 5% to 7

79% relative to RGZ (see Figure 5 and Table 5) was observed. Amorfrutin B (NP-015142) showed nanomolar effective concentrations (EC50 = 73 nM) and reduced maximal PPARy activation (efficacy = 25%, see Figure 2b and Table 5). In contrast to the full PPARy agonist RGZ, amorfrutins only partially induced transcriptional activation of PPARy, suggesting that the compounds of this invention represent a new chemical class of selective PPAR modulators (SPPARMs).

Transcriptional activation of the PPARa isotype was additionally tested in reporter gene assays, with amorfrutin B (NP-015142) revealing EC50 and efficacy values of 906 nmol/L and 61 %, respectively (see Figure 2c and Table 6) and a range from 157 nmol/L to 4.7 μηηοΙ/L and 13% to 68%, respectively, for the rest of tested compounds (see Figure 6 and Table 6). In spite of activation of the PPARp/δ isotype by amorfrutin B (NP-015142) at nanomolar concentrations (EC50 = 740 nM), efficacy of PPARp/δ activation was low (3%, see Figure 2d and Table 7).

Furthermore, amorfrutin B (NP-015142) only partially induced recruitment of important transcriptional cofactors including CBP, PGC1 a, TRAP220/DRIP and PRIP/RAP250 to PPARy (see Figure 2e-i, Table 7 and Figure 7). In contrast, amorfrutin B (NP-015142) reduced binding of the corepressor NCoR with IC50 value similar to rosiglitazone (AB, 60 nmol/L vs. RGZ, 23 nM/L), but with lower maximal dissociation efficacy (61 % vs. RGZ, see Figure 2h, Table 7). This was similar for other compounds of this invention (see Figure 7 and Table 5). These results indicate that amorfrutin B (NP-015142) is a high-affinity SPPARM with potential to exhibit strong antidiabetic properties without provoking side effects associated with full PPARy activation.

Table 7: Cofactor recruitment profile of amorfrutin B (NP-015142) bound to PPARy.

Compound Rosiglitazone Amorfrutin B

EC50 EC50

Cofactor (nmol/l) Efficacy (%) (nmol/l) Efficacy (%)

CBP 12 100 1 1 1 26

PGC1 a 57 100 126 30

TRAP220/DRIP 36 100 273 8

PRIP/RAP250 41 100 14 27

NCoR 23 100 60 61 7

Example C.3: PPARy activation assay in primary human adipocytes.

Amorfrutin B (NP-015142) induced expression of adipogenesis-related genes such as CCAAT/enhancer binding protein a and β (CEBPA and CEBPB) and the fatty acid binding protein 4 (FABP4) much less strongly than RGZ (see Figure 8a) in human primary adipocytes. These results indicate alleviated adipocyte differentiation. In contrast to RGZ, AB further showed reduced RNA expression of the Cortisol generating hydroxysteroid (1 1 -beta) dehydrogenase 1 (HSD11B1), which is linked to central obesity [Science 2001 , 294, 2166]. Additionally, AB treatment led to decreased transcription of the pyruvate dehydrogenase kinase 4 (PDK4), a glycerogenesis-activating enzyme that is linked to excess lipid storage in adipocyte [Diabetes 2008, 57, 2272]. However, AB treatment also resulted in increased phosphodiesterase 3B (PDE3B) expression that is responsible for beneficial NEFA release of TZD-treated mice [Diabetes 1999, 48, 1830]. No treatment had an effect of NCOR1 gene expression (see Figure 9).

Since secretion of endocrine factors by adipose tissue play a pivotal role in systemic metabolism, the expression of important adipokines in treated human adipocytes was investigated. Amorfrutin B (NP-015142) treatment led to increasing transcription of the beneficial adipokines adiponectin (ADIPOQ), fibroblast growth factor 21 (FGF21) and angiopoietin-like 4 (ANGPTL4) similar to RGZ, but we observed no regulation of leptin {LEP) transcription (see Figure 8b). Furthermore, AB resulted in reduced expression of pro-inflammaotory angiopoietin-like 2 (ANGPTL2), retinoic acid receptor responder 2 (RARRES2) and adipsin (complement factor 2, CFD) (see Figure 8b). In summary, these data indicate potential antidiabetic effects with presumably concomitant less susceptibility to adipose-derived body weight gain in vivo upon amorfrutin B (NP- 015142) treatment.

Knockdown of PPARy in these cells led to a significant reduction of amorfrutin B- induced gene expression (see Figure 8c), indicating specific modulation of PPARy-derived transcription in human adipocytes.

Example C.4: Antiproliferative and apoptotic effects in cancer cells

Treatment of HT-29 colon carcinoma cells, PC3 prostate cancer cells and MCF-7 breast cancer cells with 20 μηηοΙ/L of amorfrutins for 3 days clearly showed antiproliferative effects, especially for NP-01221 1 , NP-016018, NP-015135, NP- 015142, NP-015933, NP-015934, NP-015935, NP-015936, NP-015937 and NP- 015939 (see Figure 10). Additional studies revealed concentration-dependent 7 antiproliferative effects with inhibitory concentrations (IC ₅ o) ranging from 8.1 pmol/L (NP-015934, HT-29 cells) to 57.3 pmol/L (NP-015135, PC3 cells) and with efficacies of up to 100% cancer cell death induction (see Figure 11 and Table 8). HT-29 colon carcinoma cells were further treated with different mixtures of compound NP-015934 and cisplatin or irinotecan, which are commonly used in treatment of various cancer diseases. Combinative treatment showed additive effects on proliferation inhibition, with a combination index (CI) of approx. 1 (see Figure 26).

To further investigate the mechanism of cell death, the activation of various caspases in the treated cells was determined. Noteworthy, at 20 μηηοΙ/L most of the tested compounds significantly induced caspase activation in at least one tested cell line (see Figure 12), and NP-015142 treatment particularly resulted in considerable caspase activation in all tested cancer cells during 24 h of treatment (see Figure 13). These results suggest the involvement of apoptosis as mechanism of compound-induced cancer cell death. Consistently, treatment of HT-29 cells with 30 and 100 μηηοΙ/L of NP-015934 led to striking DNA fragmentation during the first hours, which is a hallmark of apoptosis (see Figure 14).

Table 8: Antiproliferative profile of amorfrutins in HT-29, T84 and PC3 cancer cells

HT-29 Τ84 PC3

Compound

IC50 Efficacy IC50 Efficacy IC50 Efficacy

NP-015135 40.0 μΜ 100% 41 .8 μΜ 99% 57.3 μΜ 89%

NP-015142 20.3 μΜ 98% 12.6 μΜ 99% 32.2 μΜ 95%

NP-015933 21 .8 μΜ 98% 20.3 μΜ 99% 21 .8 μΜ 99%

NP-015934 8.1 μΜ 95% 1 1 .2 μΜ 99% 15.9 μΜ 95%

NP-015935 18.1 μΜ 96% 12.8 μΜ 100% 37.5 μΜ 97%

NP-015936 48.5 μΜ 100% 29.7 μΜ 100% 50.6 μΜ 96%

NP-015937 21 .1 μΜ 100% 40.5 μΜ 99% 31 .4 μΜ 95%

NP-015939 26.7 μΜ 100% 24.1 μΜ 99% 45.1 μΜ 93%

In line with apoptosis induction, treatment of HT-29 colon carcinoma cells with 20 μΜ of compound NP-015934 further led to substantial phosphatidylserine external ization (see Figure 27). To explore the underlying mechanism of apoptosis, NP-015934- induced generation of reactive oxygen species (ROS) was measured. Treatment with NP-015934 resulted in significant formation of ROS that could completely be quenched by antioxidants (see Figure 28 a,b). However, antioxidants did not reduce the NP-015934- induced phosphatidylserine external ization, proving that the ROS formation is not causal for apoptosis (see Figure 28 c,d).

7

Degradation of the essential mitochondrial transmembrane potential (ΔΨιτι) is a common mechanism of mitochondria-targeting anticancer drugs (Nat. Rev. Drug Discov. 2010, 9, 447). Indeed, NP-015934 abolished the mitochondrial transmembrane potential already after 15 min of treatment (see Figure 29), indicating an early uncoupling effect on the mitochondrial electrochemical gradient (IC ₅ o = 625 nM). Strikingly, this depolarizing effect was completely abolished by methylation of the 2-hydroxyl residue (NP-015934met), showing an essential role of the 2-hydroxyl residue during apoptosis induction (see Figure 29). Degradation of the mitochondrial transmembrane potential can lead to irreversible opening of the mitochondrial permeability transition pore (MPTP), resulting in loss of mitochondrial integrity and subsequent induction of cytosolic apoptosis pathways (Front. Oncol. 2013, 3, 41 ). Consistently, HT-29 cells treated with NP- 015934 for 30 min showed opening of the MPTP as assessed by flow cytometry. However, treatment with NP-015934met only slightly led to MPTP opening (see Figure 30).

The mitochondrial transmembrane potential is required for oxidative phosphorylation, and hence, mitochondrial uncoupler can affect cellular respiration (Anal. Biochem. 2009, 390, 21 ). For that purpose, cellular respiration of HT-29 cells that were treated with NP-015934 or NP-015934met was assessed using phosphorescent oxygen- and pH-sensitive probes. NP-015934-treated cells showed striking increase in oxygen consumption, similar to the known mitochondrial uncoupler CCCP (see Figure 31 a,b), probably as consequence of disturbed ATP production without inhibiting the electron transport chain. However, treatment with NP-015934met did not show any effects (see Figure 31 a,b). Cells with affected mitochondrial ATP synthesis might activate their glycolysis and lactate production, which accounts for the majority of intracellular pH changes (Anal. Biochem. 2009, 390, 21 ). Consistently, NP-015934-treated cells considerably showed extracellular acidification, whereas NP-015934met only had minor effects (see Figure 31 c,d).

In agreement with these mitochondrial studies, treatment with 30 μΜ NP-015934met for 24 h did not induce apoptotic phosphatidylserine external ization (see Figure 32). Noteworthy, co-treated NP-015934met could not reduce the NP- 015934- induced apoptosis, even when added in excess (see Figure 32). This indicates a passive rather than a receptor-driven mechanism of apoptosis. Example B.5: Pharmacokinetic profile of amorfrutin B (NP-015142) in C57BL/6 mice.

To initially explore the pharmacokinetic profile of amorfrutin B, C57BL/6 mice were orally challenged once with a loading dose of 100 mg/kg amorfrutin B (see Figure 15a, Table 9). Administration of amorfrutin B led to a fast plasma concentration peak, indicating a high bioavailability of that natural product. Amorfrutin B was almost completely eliminated after 24 h of dosage with an elimination half-life of about 2 h (see Table 9). Amorfrutin B and amorfrutin A1 showed similar pharmacokinetic properties (see Table 9).

Table 9: Pharmacokinetics of amorfrutin B (NP-015142) and amorfrutin 1 (NP- 003520) after single oral administration in male C57BL/6 mice.

Amorfrutin B Amorfrutin A1

Parameter

(100 mg/kg) (100 mg/kg)

Cmax (mg/l) 30.4 42.4

Cmin (mg/l) 0.015 0.015

AUC (mg/l x h) 85.4 1 1 1 .1

t1/2 (h) 2.3 2.2

ke (h-1 ) 0.307 0.318

CL (ml/h) 30.0 26.0 Cmax, maximal concentration; Cmin, minimal concentration; AUC, area under the curve; t1/2, half-life; ke, elimination rate constant; CL, clearance.

Amorfrutin B has strong antidiabetic effects and considerably improves dyslipidemia in diet-induced obesity mice. To characterize amorfrutin B in a diabetic obese animal model, HFD-fed C57BL/6 mice were treated for 4 weeks with 100 mg/kg/d amorfrutin B, 4 mg/kg/d rosiglitazone or vehicle only. After 2 weeks amorfrutin B-treated mice had strikingly reduced concentrations of fasting blood glucose (see Figure 15b) and fasting plasma insulin (see Figure 15c) equally to or even better than RGZ-treated mice. Amorfrutin B and RGZ-treated mice both showed equal reduction of insulin resistance as determined by homeostatic modelling (see Figure 15d). In oral glucose tolerance tests (OGTT, see Figure 15e and 15f) and intraperitoneal insulin sensitivity tests (IPIST) amorfrutin B reduced insulin resistance and glucose intolerance similar to RGZ (see Figure 15g). 7

Amorfrutin B strongly decreased concentrations of triacylglycerols and NEFA in plasma of HFD-fed mice comparable to RGZ (see Figure 16). After 4 weeks of treatment, amorfrutin B and RGZ both reduced fasting plasma levels of triacylglycerols by 25% (see Figure 16a). Fasting concentrations of deleterious plasma NEFA were decreased by 29% with amorfrutin B and 40% with RGZ treatment (see Figure 16b).

Based on the above described results, the physiological effects of amorfrutin B treatment seemed to be largely controlled via nanomolar activation of PPARy and differential expression of its target genes in the adipocytes. In vWAT, AB significantly increased expression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha and beta (Ppargda and b) (2-fold each, see Figure 17), indicating improved mitochondrial biogenesis and fatty acid breakdown. AB and RGZ equally increased expression of adiponectin (Adipoq) and uncoupling protein 3 (Ucp3, approx. 2-fold each), but only RGZ clearly boosted Ucp1 expression (20-fold vs. 1 .6-fold, see Figure 17).

Additionally, the in vivo gene expression was investigated in order to explore the potential additional physiological effects derived from regulation via the liver and skeletal muscle. In liver, in contrast to RGZ, AB only partly regulated gluconeogenic genes (see Figure 18).

Both RGZ and AB showed a 25% increase in transcription of Ppargda, but in general minor expression changes of fatty acid oxidation genes (see Figure 18b). The most prominent difference between RGZ and AB-treated livers was pyruvate dehydrogenase 4 (Pdk4), which was highly activated only in RGZ-treated mice (+96% vs. vehicle, see Figure 18b). These data confirm the effects observed in human primary adipocytes (Figure 2a), suggesting a switch between carbohydrate and lipid metabolism that may play a role in the different mechanisms between rosiglitazone and amorfrutin.

Since ketone body metabolism is involved in diabetes and obesity, the expression of ketogenic genes in liver of the C57BL/6 mice was further analyzed. Both RGZ and AB activated genes of ketone metabolism with striking increase in expression of 3-hydroxy-3-methylglutaryl-CoA synthase 1 (Hmgcsl) in AB-treated mice (+123%, see Figure 18c). However, plasma levels of β-hydroxybutyrate (β-ΗΒ) were not significantly changed after treatment (see Figure 18d). To further explore potential PPAR /5-induced insulin-sensitizing effects in skeletal muscle, the gene expression of various target genes was analysed, but no amorfrutin-induced differential regulation could be detected (see Figure 18e). These data suggest a minor role of the skeletal muscle in the observed antidiabetic profile of amorfrutins, confirming the low PPAR /δ activation observed in reporter gene assays (see Figure 2d).

To investigate the role of the peptide hormone fibroblast growth factor 21 (FGF21 ) in the observed metabolic improvement, the Fgf21 expression in WAT and liver and circulating FGF21 plasma levels was analyzed. As described for TZDs [Mol. Pharmacol. 2008, 74, 403], RGZ induced Fgf21 gene expression in liver and adipose tissue (see Figure 19) and strikingly increased FGF21 plasma levels (see Figure 19). However, AB completely failed to induce expression and secretion of FGF21 , suggesting alternative PPARy activation to the described TZD-FGF21 autocrine loop.

Furthermore, it was investigated if the phosphorylation of PPARy on Ser273 in WAT [Nature 2010, 466, 451 ] mediate the antidiabetic effects of AB, but no significant change at this phosphorylation site after RSG or AB treatment was observed (see Figure 20).

Example B.6: Investigation of the side-effects associated with TZDs treatment on the compounds of the present invention.

As discussed above, PPARy-targeting drugs such as RGZ provoked undesirable side effects. Therefore, the potential side-effects of the compounds of the present invention was tested.

Viability and cytotoxicity assays in HepG2 cells did not reveal any adverse effects up to 32 μηηοΙ/L amorfrutin B (see Figure 21 ).

Potential cancerogenity of amorfrutin B was evaluated using a cellular micronudeus assay. In this assay, formation of micronudei during cell division of Chinese hamster ovary (CHO) cells is observed microscopically after treatment with potential mutagens. Amorfrutin B was tested up to a concentration of 32 μηηοΙ/L and showed no genetic toxicity either in the presence (+S9) or absence (-S9) of metabolic activation by rat liver homogenate extracts (Figure 22a). Noteworthy, amorfrutin B significantly reduced the basal formation of micronudei in the presence of S9 extract in a concentration-dependent manner, thus -,

10 improving genetic integrity. After 4 weeks of treatment, livers of RGZ-treated HFD- fed obese mice showed strongly increased expression of inflammation markers indicating macrophage infiltration and potential local inflammation. In contrast, AB treatment led to reduced gene expression of these markers (see Figure 22b), suggesting anti-inflammatory effects of AB-treatment in the liver of HFD-fed mice. In addition, RGZ treatment increased Fabp4 expression by a factor of 31 , indicating increased lipid storage in the mouse liver, whereas AB did not show any increase in Fabp4 expression (see Figure 22c). Consistently, RGZ elevated plasma alanine transaminase (ALT) levels compared to untreated HFD-fed mice, indicating liver toxicity. In contrast, amorfrutin B treatment led to reduction of plasma ALT levels (see Figure 22d), proving liver- protective effects of the compounds of the present invention.

Another well-known side-effect of thiazolidinediones is the impairment of osteoblastogenesis leading to osteoporosis and increased fracture risk. Treatment of murine MC3T3-E1 preosteoblasts with rosiglitazone or related TZDs resulted in reduced expression of genes involved in osteoblastogenesis such as phosphate regulating gene with homologies to endopeptidases on the X chromosome (Phex), integrin binding sialoprotein {Ibsp) and osteocalcin {Bglap) (see Figure 22e). RGZ- treatment led to impaired calcification of bone cells in vitro as assessed by Alizarin red S staining (see Figure 22f). In contrast, treatment with compounds of the present invention did not show any reductions in expression of this osteoblast gene set (see Figure 22e and Figure 23a) or on mineralization of bone cells (see Figure 22f and Figure 23b) in vitro. In HFD-fed mice, rosiglitazone substantially increased plasma bone osteocalcin levels by 50% (see Figure 22g), indicating elevated bone cell turnover. However, amorfrutin B-treated DIO mice did not show any effect of plasma bone osteocalcin levels (see Figure 22g). Taken together, these results indicate that the compounds of the present invention do not provoke osteoporosis in mice.

Adverse body weight gain is a frequent side effect of PPARy activation due to increased fat storage in white adipose tissue. However, in HFD-fed mice amorfrutin B treatment did not lead to increased adiposity, but instead to a beneficial reduction of body weight gain by approximately 15% compared to HFD- fed mice treated with vehicle control (see Figure 22h). Given the inconspicuous results from the various described assays, this observation cannot be explained by potential compound toxicity. Feeding of amorfrutin B only had a slight impact on 7 food intake during the first three days (see Figure 24a), and correction for food intake using analysis of covariance (ANCOVA, see Figure 24b) revealed that anoretic effects cannot exclusively explain the observed reduction in weight gain after amorfrutin B treatment. To investigate the potential contribution of the hypothalamic-pituitary-thyroid axis, the plasma levels of triiodothyronine (T3) and thyroxine (T4) were measured. Amorfrutin B-treated mice did not show significant changes on these endocrine hormones (see Figure 24c). In general, weight reduction may result in improved insulin sensitivity. Although amorfrutin B induced effects on body weight correlated (in part) with improved insulin sensitivity, analysis of covariance (ANCOVA) clearly showed antidiabetic effects, which were independent from weight regulation (see Figure 24d).

RGZ has recently been reported to decrease HDL cholesterol [Diabet. Med. 2007, 24, 94]. After 4 weeks of treatment, RGZ-treated DIO mice showed a reduction in plasma HDL cholesterol by 24%, whereas amorfrutin B neither changed plasma HDL nor LDLA/LDL levels (see Figure 25a).

RGZ administration is further associated with the development of hemodilution and edema as a result of fluid retention. Amorfrutin B treatment did not impair hematocrit (see Figure 25b) or levels of whole blood haemoglobin (see Figure 25c) in DIO mice.