Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
ANEURINIBACILLUS MIGULANUS STRAIN AND USE THEREOF
Document Type and Number:
WIPO Patent Application WO/2017/209651
Kind Code:
A1
Abstract:
The invention relates to biotechnology and may be used for producing a gramicidin S active substance by using a producing strain ofAneurinibacillus migulanus, VKPMV-10212. The obtained mutant strain enables high-yield production of a gramicidin substance.

Inventors:
NESTERUK, Vladimir Viktorovich (4-yi Voikovskiy pr, 3 kv. 1, Moscow 1, 125171, RU)
SYROV, Kirill Konstantinovich (ul. Krylatskaya, 45 k. 1, kv. 13, Moscow 9, 121609, RU)
Application Number:
RU2017/000326
Publication Date:
December 07, 2017
Filing Date:
May 19, 2017
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
JOINT STOCK COMPANY "VALENTA PHARMACEUTICALS" (ul. Fabrichnaya, 2Shchyolkov, Moskovskaya obl. 1, 141101, RU)
International Classes:
C12N1/20; A61K35/74; A61P31/04; C07K7/66; C12R1/08
Foreign References:
RU2447143C22012-04-10
Other References:
BERDITSCH M. ET AL.: "The ability of Aneurinibacillus migulanus (Bacillus brevis) to produce the antibiotic gramicidin S is correlated with phenotype variation", APPLIED AND ENVIROMENTAL MICROBIOLOGY, vol. 73, no. 20, 2007, pages 6620 - 6628, XP055446118
Attorney, Agent or Firm:
PATENT & LAW FIRM "YUS", LIMITED LIABILITY COMPANY (Prospekt Mira, 6Moscow, 129090, RU)
Download PDF:
Claims:
ФОРМУЛА ИЗОБРЕТЕНИЯ

Штамм бактерий Aneurinibacillus migulanus ВКПМВ-10212, продуцент грамицидина.

Применение штамма бактерий Aneurinibacillus migulanus ВКПМВ-10212 для получения грамицидина.

Description:
Штамм Aneurinibacillus migulanus и его применение

ОБЛАСТЬ ТЕХНИКИ

Изобретение относится к биотехнологии и может быть использовано для получения действующего вещества грамицидина С с помощью штамма продуцента Aneurinibacillus migulanus ВКПМВ-10212. Полученный мутантный штамм позволяет продуцировать грамицидин с высоким выходом.

УРОВЕНЬ ТЕХНИКИ

Известны способы получения грамицидина С при глубинном выращивании продуцента Bacillus brevis на синтетических средах [Коршунов В. В. Физиология обмена веществ Bacillus brevis subsp. G.-B. в связи с биосинтезом грамицидина С. - Канд. лиса, 1962, М., МГУ, Коршунов В. В., Егоров Н.С. Синтетическая среда для развития Bacillus brevis и образование граммидина. Микробиология, 1962; 31 :3, 515- 519, . Шапошников В.Н., Работнова И.Л., Силаев А.Б. и др. Способ получения кристаллического грамицидина С. - Авторское свидетельство на изобретение No 187243, 1963, Куплетская М.Б. Влияние аэрации на развитие и образование граммидина культурой Bacillus brevis var. G.-B. Микробиология, 1965; 34:5, 905-909, Жарикова Г.Г. Естественная изменчивость споровых бактерий и биосинтез полипептидных антибиотиков. - Докт. дисс, 1972, М., МГУ, Березовская А. И., Выпияч А.Н., Егоров Н.С. и др. Штамм Bacillus brevis 101 - продуцент грамицидина С. - Авторское свидетельство на изобретение N°686463, 1978, Способ глубинного культивирования Bacillus brevis штамм 101 для получения грамицидина С, - РФ2447143, 24.11.2008].

Известен периодический процесс получения грамицидина С при выращивании наиболее продуктивных штаммов Bacillus brevis. [Удалова Т.П. Особенности роста и развития Bacillus brevis var. G.-B в связи с биосинтезом грамицидина S. - Канд. дисс, 1979, М., МГУ], который использовали для синтеза продукта при выращивании Bacillus brevis штамма 101 [Юдина Т.П. Физиолого-биохимические особенности продуцентов граммидина Bacillus brevis subsp. G.-B. и их вариантов. - Канд. дисс, 2002, М., МГУ.], характеризуется тем, что производится одноразовая загрузка питательной среды в ферментер, инокуляция посевным материалом, культивирование при аэрации и перемешивании в течение 27 часов до достижения величины рН 6,0 и ниже.

В основу изобретения поставлена задача, создать более эффективный способ продукции грамицидина с высоким, с промышленной точки зрения, выходом и предложить микроорганизмы, которые могут быть использованы в этом способе. Поставленная задача решается путем получения нового штамма Aneurinibacillus migulanus ВКПМВ-10212.

ОПИСАНИЕ ИЗОБРЕТЕНИЯ

В одном варианте изобретение относится к штамму бактерий Aneurinibacillus migulanus ВКПМВ-10212.

В предпочтительном варианте изобретение относится к штамму бактерий Aneurinibacillus migulanus ВКПМВ-10212, продуценту грамицидина.

В другом варианте изобретение относится к применению штамма бактерий Aneurinibacillus migulanus ВКПМВ-10212 для получения грамицидина.

Родовое и видовое название культуры - Aneurinibacillus migulanus.

Номер, полученный при регистрации - ВКПМВ-10212.

Способ получения штамма - получен как мутант.

Идентифицирована культура ВКПМ ФГУП «ГосНИИГенетика» (г.Москва), отчет об идентификации штамма N°101 методом анализа 16S РНК от 16 марта 2009 г. Справка о депонировании прилагается. Дата депонирования - 03.03.2009 г.

Культурально-морфологические особенности штамма - палочки длиной 4-8 мкм, шириной 0,6-0,7 мкм, образует споры с овальными краями размером 0,8-1,0 мкм. Аэроб. Не разжижает желатину. Не гидролизует крахмал. Потребляет азот в аминной и аммонийной форме. На агаризованной питательной среде Гаузе-Бражниковой при культивировании в течение 40-48 часов при температуре 40±1°С образует колонии округлой формы, приподнятые над поверхностью агара, с отчетливо выраженным кратерообразным или точечным центром. Цвет колоний - бежевый, колонии непрозрачные, пастообразной консистенции. Легко снимаются с поверхности агара петлей. Форма и размер колоний сильно варьируют в зависимости от состава среды, густоты посева и других факторов. В процессе культивирования может расщепляться на варианты с отличающейся морфологией и сниженной продукцией антибиотика.

Область применения штамма: промышленное производство антибиотиков. Продукт, синтезируемый штаммом: грамицидина С гидрохлорид (кристаллический) .

Активность (продуктивность) штамма, другие производственные показатели - при культивировании в качалочных колбах на «лабораторной регламентной» жидкой питательной среде в течение 72 часов продуцирует 2±0,3 г/л грамицидина С, что соответствует 0,2±0,02 грамицидина с/гбиомассы- При выращивании в ферментерах при оптимальных условиях удельная продукция грамицидина С может составлять до 0,4 Гграмицидина с/гбиомассы- Средняя продуктивность линий, поддерживаемых в активном состоянии на агаризованных средах на 27.01.2009 г., составляет 2,073 г/л грамицидина С; содержание близкородственных примесей - 15,3%.

Способ определения активности штамма с указанием метода - экстракция грамицидина С из культуральной жидкости этиловым спиртом с последующим определение концентрации грамицидина С методом высокоэффективной жидкостной хроматографии.

Способ, условия и состав сред для длительного хранения штамма - хранение спор на пшене, хранение вегетативных клеток и спор в лиофильно высушенном состоянии (на молоке 10-20%).

Способ, условия и состав сред для размножения штамма - выращивание на агаризованной среде Гаузе-Бражниковой (дрожжевая вода 50% по объему или 28 мг% по аминному азоту; пептон 1%; NaCl 0,5%; агар-агар 3%; рН 7,0) в течение 48-72 часов при 40°С. Выращивание на жидкой полусинтетической среде «лабораторная регламентная» (на 1 л среды: глицерин дистиллированный - 20 мл, молочная кислота пищевая 40% - 8 мл; К 2 НР0 4 - 9,9 г, NaCl - 5 г; MgS04-7H 2 0 - 0,2 г; аммоний щавелевокислый - 8,12 г; дрожжевой автолизат - до 5 мг%) в качалочных колбах вместимостью 0,75 л (0,1 л среды) на круговой качалке (частота вращения 220 об/мин, амплитуда 1 м) при 40 °С в течение 48-72 часов.

Оптимальные условия и состав среды для ферментации - среда «ферментационная регламентная» (глицерин - 30 мл, молочная кислота 40% - 24,6 мл, К 2 НР0 4 - 2 г, NaCl - 5 г; MgS0 4 -7H 2 0 - 0,2 г; аммоний щавелевокислый - 12 г; дрожжевой автолизат - до 10 мг%; гидролизат казеина - до 20 мг%; лапрол - 2 мл; рН

3 3

после стерилизации 7,02-7,2). Аэрация 1,25 м 0 2 / м среды час, давление - 0,5 ати, интенсивность перемешивания должна обеспечивать массобмен по кислороду на уровне от 0,2-0,3 ммоль 0 2 /л мин в начале ферментации до 0,4-1,0 ммоль 0 2 /л мин в конце ферментации в зависимости от достигнутой биомассы (0,035-0,045 ммоль 0 2 /гбиомассы 'МИн). Хемостатирование на уровне рН 6,4-7,2. Культивирование в течение 16-48 часов в зависимости от способа ведения ферментации.

ДНК штамма содержит рестракционный сайт Hindlll.

Штамм не является зоопатогенным, фитопатогенным.

Фиг. 1. Рестрикционный анализ фрагмента ДНК, кодирующего ген 16S РНК исследуемого штамма 101.

1. Фрагмент ДНК, кодирующий ген 16S РНК исследуемого штамма 101, обработанный рестриктазой Hindlll

2. Маркер 1 kb DNA Ladder (10000, 8000, 6000, 5000, 4000, 3500, 3000, 2500, 2000, 1500, 1000, 750, 500, 250 п.н., снизу вверх)

3. Фрагмент ДНК, кодирующий ген 16S РНК исследуемого штамма 101, не обработанный рестриктазой Hindlll.

Пример 1. Идентификация штамма 101 до вида с помощью анализа 16S РНК Этапы работ

I. Рассев культуры до отдельной колонии и получение биомассы для анализа 16S РНК

II. Выделение ДНК

III. Выбор праймеров и режимы ПЦР

Консервативные праймеры для наработки 16S rDNA - 8f - aga gtt tga tec tgg etc ag

926r - ccg tea att cct ttr agt tt

1492r - ggt tac cct tgt tac gac tt

с режимами реакции:

1. 95°С - Змин.

2. 35 циклов

95°С - 30 сек.

57°С - 30 сек.

72°С - 1 мин. 30 сек.

3. 72°С - 5 мин. IV. Секвенирование 16S rDNA, сравнение секвенсов и построение деревьев родства

Секвенирование проводится на автоматическом секвенаторе АЕ3000.

Для анализа секвенсов используются специализированные филогенетические компьютерные программы.

Стабильность воспроизведения результатов. Проводится не менее трех повторов ПЦР-реакций.

Условия электрофореза ПЦР исследуемых образцов.

1,0% агарозный гель, электрофорез при напряженности электрического поля 5 В/см.

V. Рестрикционный анализ фрагмента ДНК, кодирующего ген 16S РНК а) Секвенирование вариабельных участков 16S rDNA.

При секвенировании вариабельных участков 16S rDNA получена следующая собранная нуклеотидная последовательность для штамма 101: atgaaggttttcgatcgtaaagttctgttgttagggaagaaccgccggggatgacctccc

cggtctgacggttncctaaacgagaaagcccccggctaatctacggtgcccagcagc cgc

ggtaatacgtagggggcaagcgttgtccggaattattgggcgtaaagcgcgcgcagg cgg

cttcttaagtcaggtgtgaaagcccacggctcaaccgtggagggccacttgaaactg gga

agcttgagtgcaggagaggagagcggaattccacgtgtagcggtgaaatgcgtagag atg

tggaggaacacccgtggcgaaggcggctctctggcctgtaactgacgctgaggcgcg aaa

gcgtggggagcgaacaggattagatacccctggtagtccacgccgtaaacgttgagt gct

aggtgttggggactccaatcctcagtgctcgcagctaacgcaat

aagcactccgcctggg б) Анализ результатов секвенирования и построение дерева родства

Первичный скрининг по базе данных GenBank и RDP-II показал, что исследуемый штамм принадлежит к следующим систематическим группам Bacteria; Firmicutes; Bacillales; Paenibacillaceae; Aneurinibacillus group; Aneurinibacillus, причем гомология с видами Aneurinibacillus migulanus и Aneurinibacillus aneurinilyticus составляет 98%.

Последовательности были выровнены с соответствующими последовательностями ближайших видов бактерий, доступными из базы данных GenBank. Результаты обработки секвенсов при помощи компьютерной программы находящейся на сайте RDB II (Ribosomal Database Project II), предназначенной для определения родства микроорганизмов и построения филогенетических деревьев, представляются в графическом виде.

Таблица 1. Матрица расстояний

1 2 3 4 5 6 7 8 9 10

101.txt 1 — 0,980 0,987 0,958 0,991 0,892 0,907 0,989 0,958 0,989

Ab.anurly3 2 0,020 — 0,985 0,955 0,989 0,895 0,909 0,991 0,955 0,991

Ab.migulan 3 0,013 0,015 — 0,962 0,996 0,902 0,912 0,994 0,962 0,994

Ab.thaerph 4 0,042 0,045 0,038 — 0,967 0,903 0,912 0,965 1 0,965

Ab.migula2 5 0,009 0,01 1 0,004 0,033 — 0,902 0,917 0,998 0,967 0,998

B.badius2 6 0,108 0,105 0,098 0,097 0,098 — 0,889 0,905 0,903 0,905

Oxl.oxali2 7 0,093 0,091 0,088 0,088 0,083 0,11 1 — 0,919 0,912 0,919

Ab.anurly2 8 0,011 0,009 0,006 0,035 0,002 0,095 0,081 — 0,965 1

Ab.thaerp2 9 0,042 0,045 0,038 0,000 0,033 0,097 0,088 0,035 — 0,965

Ab.anurlyt 10 0,011 0,009 0,006 0,035 0,002 0,095 0,081 0,000 0,035 —

Таблица 2. Описание последовательностей

Ab.migula2 Aneurinibacillus migulanus DSM 2895 (T)

Ab.anurly2 Aneurinibacillus aneurinilyticus DSM 5562 (T)

Ab.migulan Aneurinibacillus migulanus ATCC 9999 (T)

Ab.anurlyt Aneurinibacillus aneurinilyticus NCIMB 10056

Ab.anurly3 Aneurinibacillus aneurinilyticus ATCC 12856 (T)

Aneurinibacillus thermoaerophilus str. L420-91

Ab.thaerph

DSM 10154 (T)

Ab.thaerp2 Aneurinibacillus thermoaerophilus DSM 10155

Oxl.oxali2 Oxalophagus oxalicus str. Alt Oxl DSM 5503 (T)

B.badius2 Bacillus badius ATCC 14574 (T)

101.txt Исследуемый штамм 101 Дальнейший анализ по RDP II 16S рРН базе данных показал гомологию с теми же видами бактерий, и наиболее близкими видами являются Aneurinibacillus migulanus и Aneurinibacillus aneurinilyticus .

По данным анализа было построено филогенетическое дерево с гомологичными штаммами (Фиг. 2).

Критерием отнесения микроорганизма к тому или иному виду считается гомология не менее 97%. По этому критерию исследуемый штамм можно отнести к видам Aneurinibacillus migulanus и Aneurinibacillus aneurinilyticus.

Для более точной идентификации воспользовались методы рестрикционного анализа фрагмента ДНК, кодирующего ген 16S РНК.

По литературным данным известно, что данный фрагмент ДНК Aneurinibacillus migulanus содержит рестрикционный сайт Hindlll, тогда как у Aneurinibacillus aneurinilyticus данный рестрикционный сайт отсутствует.

Проведен рестрикционный анализ фрагмента ДНК, кодирующего ген 16S РНК исследуемого штамма 101. Результаты работы показаны на фиг. 1.

Наличие фрагментов 620 п.н. и 870 п.н. при обработке фрагмента ДНК рестриктазой Hindlll говорит о том, что сайт Hindlll присутствует в составе франмента ДНК исследуемого штамма 101. Этот критерий позволяет отнести исследуемый штамм 101 к виду Aneurinibacillus migulanus.

Пример 2. Способ получения грамицидина С

Грамицидин С получают методом ферментации. Процесс состоит из четырех этапов: обработка продуктивного штамма Aneurinibacillus migulanus ВКПМВ-10212 в лаборатории, подготовка прививочного материала, культивирование прививочного материала в лабораторном ферментере, биосинтез грамицидина С в основном ферментере.

Основные параметры ферментации подобраны с учетом морфологии и стабильности продуктивного штамма Aneurinibacillus migulanus ВКПМВ-10212. Время выращивания продуктивного штамма на среде агара в термостате варьирует в диапазоне от 48 до 120 часов и позволяет семенной объем в большем объеме, чем при культивировании на чашках Петри. Бактериальную суспензию хранят в 15% защитном растворе глицерина при температуре от -20°С до -80°С. Предварительную подготовку посевного материала проводят в лабораторном ферментере в среде агаре и отсутствии других микроорганизмов.

Затем инокулят перемещают в следующий ферментер в количестве 1-2,5% от объема среды ферментации, состоящей из цитрата натрия, хлорида аммония, калия дигидрофосфата, D- и L-молочной кислоты в соотношении 1 :1, порошка экстракта дрожжей, порошка казеина, пеногасителя Struktol J 647. Оптимальные параметры процесса ферментации: оптическая плотность от 10 до 20, рН от 5,5 до 7,5, отсутствие других микроорганизмов. Процесс ферментации продолжается от 48 до 120 часов.

Следующий этап производства заключается в брожении посевного материала в основном ферментере. Объем посевного материала составляет 8-17% от среды ферментации, состоящей из цитрата натрия, хлорида аммония, калия дигидрофосфата, D- и L-молочной кислоты в соотношении 1 : 1 , порошка экстракта дрожжей, порошка казеина, пеногасителя Struktol J 647. Оптимальное значение рН в диапазоне от 6,5 до 7,0 контролируется добавлением раствора аммиака. Оптимальную концентрацию питательных веществ поддерживают добавлением растворов глицерина, сульфата аммония и кукурузного крахмала. Процесс ферментации продолжается от 48 до 120 часов.

Полученную биомассу фильтруют на керамическом фильтрующем модуле способом ультрафильтрации, промывая биомассу деионизированной водой для удаления примесей из биомассы. Концентрированную биомассу сушат в распылительной сушилке при температуре 180°С. Высушенную биомассу промывают ацетоном при температуре 40°С для удаления окрашенных примесей. Ацетон удаляют при помощи продувки азотом, затем повторно промывают ацетоном и сушат в вакууме при температуре 45 °С

Далее грамицидин С экстрагируют этанолом, корректируя рН до 3,0-4,0 разбавленной хлористоводородной кислотой (НС1 : этанол = 1 : 2). Экстракцию проводят несколько раз, удаляя экстракты с помощью сжатого азота. После отделения этанола биомассу сушат в вакууме при температуре около 47°С.

Высушенную биомассу растворяют в воде и обесцвечивают активированным углем, затем фильтруют на фильтр-прессе, промывая этанолом для уменьшения потерь продукта из-за сорбции на угле.

Полученный экстракт перемещают в кристаллизатор, разбавляют деионизированной водой, добавляют концентрированный раствор хлорида натрия и нагревают до температуры 55-65°С. После осветления раствор охлаждают до температуры не выше 5 °С. Полученные кристаллы отделяют на центрифуге и сушат в вакууме при температуре не более 65 °С, затем измельчают на штырьковой мельнице, просеивают через сита с диаметром ячеек 400 и 200 мкм и упаковывают в полиэтиленовые мешки, помещенные в алюминиевые контейнеры.