ANTHRAX THERAPIES, COMPOSITIONS, AND METHODS RELATED THERETO

TECHNICALFIELD

The present invention relates to molecules that complex with Bacillus anthracis protective antigen. In some embodiments, the invention relates to a composition for neutralizing anthrax toxin comprising an antibody and the use of said antibody as a medicament. In further embodiments, the invention relates to detecting Bacillus anthracis in a subject. The present invention is also concerned with a composition having a synergistic effect on anthrax toxin neutralization, comprising a protective antigen-specific antibody and a lethal factor- specific antibody.

BACKGROUND

At present, several antibiotics, such as penicillin, ciprofloxacib, and doxycycline, are used for the treatment of anthrax infections. However, antibiotic treatment cannot be successfully applied to antibiotic-resistant anthrax strains. In particular, this antibiotic treatment is not suitable for use in biochemical terrorism or biochemical warfare, which uses antibiotic-resistant strains. Also, since antibiotics cannot inhibit the action of anthrax toxin, anthrax is highly fatal if antibiotics are not administered at early stages of infection. Unfortunately, anthrax is difficult to diagnose and treat at early stages because it initially presents with cold-like symptoms. Thus, there is a need to identify superior methods of treating anthrax infections.

Vaccines have been developed and are currently used for preventing anthrax in the USA and Great Britain. However, since the vaccines have not been proven completely safe, their application is allowed only to army personnel and some persons who are highly liable to be exposed to B. anthracis. In addition, since a period of at least several months is required to acquire sufficient immunity, vaccines are actually unprotective when applied in emergency situations such as in the event of biochemical terrorism. Thus, there is an urgent need for the

development of therapeutic and preventive approaches which can be applied to such situations.

SUMMARY

The present invention relates to an antibody specific to the protective antigen component of anthrax toxin. In some embodiments, the invention relates to a composition for neutralizing anthrax toxin comprising an antibody and the use of said antibody as a medicament. In further embodiments, the invention relates to a kit for detecting anthrax toxin comprising such an antibody. The present invention is also concerned with a composition having a synergistic effect on anthrax toxin neutralization, comprising a protective antigen-specific antibody and a lethal factor-specific antibody.

In some embodiments, Ihe invention relates to a method for the prevention or treatment of anthrax toxin in a subject comprising: a) providing; i) a subject at risk for, diagnosed with, or presenting a symptom of anthrax toxin exposure, and ii) a composition comprising an antibody with reactivity to anthrax protective antigen; and b) administering said composition to said subject M additional embodiments, said composition further comprises a lethal factor antibody. In further embodiments, said composition comprising lethal factor antibody and protective antigen antibody are in a ratio between 10:1 and 1:10 respectively. In further embodiments, said composition comprising lethal factor antibody and protective antigen antibody are in a ratio greater than 1:1 and less than 10:1 respectively. In further embodiments, said composition comprising lethal factor antibody and protective antigen antibody are in a ratio 2:1 respectively. In further embodiments, said protective antigen antibody is specific for the C-terminal domain. In further embodiments, said lethal factor antibody is specific for domain 3. In further embodiments, said composition is administered under conditions such that at least one symptom is reduced.

In some embodiments, Ihe invention relates to a method for the treatment of anthrax toxin exposure in a subject comprising: a) providing; i) a subject presenting a symptom of anthrax toxin exposure, and ii) a therapeutic composition comprising an antibody specific for the C-

terminal domain of Bacillus anthracis protective antigen; and b) administering said therapeutic composition to said subject under conditions such that at least one symptom is reduced. In additional embodiments, said therapeutic composition further comprises said antibody specific for lethal factor. In some embodiment, the invention relates to a method for the prevention, treatment, or management of anthrax toxin in a subject diagnosed with or at risk for exposure to anthrax toxin comprising: a) providing; i) a subject presenting a symptom of anthrax toxin exposure or at risk for anthrax toxin exposure, and ii) a therapeutic composition comprising antibody specific for the receptor binding domain of Bacillus anthracis protective antigen; and b) administering said therapeutic composition to said subject under conditions such that at least one symptom is reduced. Ih further embodiments, said therapeutic composition comprises lethal factor antibody and antibody specific for C-terminal domain of Bacillus anthracis protective antigen in a ratio between 10:1 and 1:10 respectively. In further embodiments, said therapeutic composition comprises lethal factor antibody and antibody specific for C- terminal domain of Bacillus anthracis protective antigen in a ratio greater than 1:1 and less than 10:1 respectively. In further embodiments, said therapeutic composition comprises lethal factor antibody and antibody specific for C-terminal domain of Bacillus anthracis protective antigen in a ratio 2: 1 respectively. In further embodiments, said subject is a human. In further embodiments, said antibody is polyclonal. In further embodiments, said antibody is monoclonal. In additional embodiments, said therapeutic composition further comprises said antibody specific for lethal factor.

In some embodiments, the invention relates to an isolated nucleic acid sequence that encodes an amino acid sequence that complexes with the C-terminal of domain of Bacillus anthracis protective antigen. In some embodiments, the invention relates to an isolated antibody that binds to C- terminal domain of Bacillus anthracis protective antigen. In further embodiments, the present invention contemplates an isolated antibody comprising an amino acid sequence

selected from the group consisting of SEQ E) NO,:2-17.

Jh some embodiments, the invention relates to an isolated antibody that binds SEQ IDNo.:l. In one embodiment, the antibody is humanized.

In some embodiments the invention relates an amino acid sequence comprising a sequence selected from the group consisting of SEQ ID No.: 2, SEQ E) No.: 6, SEQ E> No.: 10, and SEQ E) No.: 14.

In farther embodiments, the invention relates to a therapeutic composition comprising a molecule containing a substituted or unsubstituted amino acid sequence selected from the group consisting of SEQ E) No.: 3, SEQ E) No.: 4, SEQ E) No.: 5, SEQ E ⁾ No.: 7 SEQ E ⁾ No.: 8, SEQ TD No.: 9, SEQ E ⁾ No.: 11, SEQ E ⁾ No.: 12, SEQ E) No.: 13, SEQ E ⁾ No.: 15, SEQ E) No.: 16, and SEQ E) No.: 17 functioning to inhibit the binding of protective antigen to cells.

In some embodiments, the invention relates to an isolated monoclonal antibody or fragment (e.g. FAB, Fv, etc.) which binds to C-terminai domain of Bacillus cmthracis protective antigen and inhibits the binding of protective antigen to cells. In further embodiments, the monoclonal antibody recognizes a portion of the receptor binding domain of Bacillus cmthracis protective antigen, i.e., (residues 596 to 735) responsible for the attachment of the toxin to the cellular receptors, and preferably recognizes a portion of the amino acid sequence from 679 to 693, i.e., SEQ E) No. 1: GLKEVINDRYDMLN. In further embodiments, monoclonal antibody neutralizes Bacillus cmthracis lethal toxin.

In some embodiments, Hie invention relates to a method of prevention or treatment of anthrax intoxication whereby antibodies to protective antigen and lethal factor are administered.

Bi further embodiment, the invention relates to humanized antibodies comprising of sequences disclosed herein preferably all or any part of SEQ E) No. 3,4, 5, 11, 12, and/or l3, and/or the CDRregions of SEQ E) No.: 34 and 35.

In some embodiments, the invention relates to an antibody comprising an amino

acid sequence disclosed herein preferably SEQ ID No.2, 6, 10, or 14

In additional embodiments, the invention relates to a complementarity determining region (CDR) of a heavy chain variable region specific to anthrax toxin protective antigen, the CDR having an amino acid sequence of SEQ ID No.3, 4, 5, 11, 12, or 13. In additional embodiments, the invention relates to a complementarity determining region (CDR) of a light chain variable region specific to anthrax toxin protective antigen, the CDR having an amino acid sequence of SEQ ID No.7,8,9, 15, 16 or 17.

In some embodiments, the invention relates to an antibody specific to anthrax toxin protective antigen, comprising: (i) a heavy chain variable region including complementarity detennining regions (CDRs) having amino acid sequences of SEQ ID Nos.3, 4 and 5, and a light chain variable region including CDRs having amino acid sequences of SEQ ID Nos. 7,

8 and 9; or (ii) a heavy chain variable region including CDRs having amino acid sequences of SEQ ID Nos. 11, 12, and 13, and a light chain variable region including CDRs having amino acid sequences of SEQ ID Nos. 15, 16 and 17. In further embodiments, the antibody specific to anthrax toxin protective antigen is an antibody fragment or a whole antibody.

Ih some embodiments the invention relate to an antibody specific to anthrax toxin protective antigen, which is produced by a hybridoma having accession number KCTC10899BP or by a hybridoma having accession number KCTC10900BP.

In some embodiments, the invention relates to a hybridoma having accession number KCTC10899BP or KCTC10900BP.

In some embodiments, the invention relates to a nucleotide sequence encoding a heavy chain variable region having an amino acid sequence of SEQ ID No.2 or 10.

In some embodiments, the invention relates to a nucleotide sequence encoding a light chain variable region having an amino acid sequence of SEQ ID No. 6 or 14. In further embodiments, the invention relates to a composition for neutralizing anthrax toxin, comprising one or more selected from the antibodies disclosed herein.

In some embodiments, the invention relates to a nucleotide sequence encoding SEQ

ID No.: 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or 17.

In some embodiments, the invention relates to a kit for detecting anthrax toxin, comprising one or more antibodies selected from the antibodies disclosed herein.

In some embodiments, the invention relates to a composition for neutralizing anthrax toxin, comprising one or more antibodies specific to anihrax toxin protective antigen, selected from the antibodies disclosed herein, and an antibody specific to anthrax toxin lethal factor.

In some embodiments, the invention relates to a composition for neutralizing anthrax toxin, wherein the antibody specific to anthrax toxin lethal factor is 5B 13B 1. In additional embodiments the invention relates to a medicament comprised of one or more antibodies selected from the antibodies disclosed herein used for the prevention or treatment of anthrax intoxication.

In some embodiments, the invention relates to a medicament comprised of one or more antibodies selected from the antibodies disclosed herein used for the prevention or treatment of anthrax intoxication.

It is not intended that the therapeutic method of the present invention be limited to particular subjects. A variety of subjects are contemplated. In one embodiment the subject is selected from a pig, a rat, a cow, a horse, and a human.

In one embodiment, the therapeutic composition is administered to a subject suffering from symptoms of anthrax intoxication. In another embodiment, Hie therapeutic composition is administered prophylactically to a subject at risk for anthrax intoxication.

It is not intended that the therapeutic method of the present invention be limited to certain modes of administration. A variety of modes of administering the therapeutic composition are contemplated. In one embodiment, the therapeutic composition is administered by a mode selected from intravenously, intramuscularly, subcutaneously, intradermally, intraperitoneally, intrapleurally, intrathecally, and topically.

In additional embodiments, the invention relates to an aerosolized composition

comprising molecules described herein.

It is not intended that the present invention be limited to a particular therapeutic composition. A variety of compositions are contemplated. In one embodiment the therapeutic composition comprises a soluble mixture of anti-CBaPA antibodies. In another embodiment, the anti-CBaPA antibodies are provided together with physiologically tolerable liquid, gels, solid carriers, diluents, adjuvants or excipients, and combinations thereof. In other embodiments, the therapeutic composition comprises anti-C5a antibodies and other therapeutic agents (e.g. other immunoglobulins or antibiotics).

The present invention also provides a method for screening C-terminal truncated CBaPA peptides to identify immunogens for the production of anti-CBaPA antibodies. In one embodiment, the method comprises, providing a C-terminal truncated CBaPA peptide, modifying the amino acid sequence of said C-terminal truncated CBaPA peptide, and screening said C-terminal truncated CBaPA peptide to identify immunogens for the production of anti-CBaPA antibodies. In other embodiments, the screening step involves a chemotaxis assay. In a different embodiment, the screening step involves a competitive binding assay. In an additional embodiment, the screening step involves administering the C- terminal truncated peptides to anthrax intoxicated animals.

In another embodiment, the present invention provides a method for anthrax toxin rescue, comprising: a) providing; i) a patient presenting symptoms of anthrax toxin exposure, ii) a therapeutic composition comprising an antibody specific for the complement component of a CBaPA peptide region, wherein said CBaPA peptide region is some fraction of the complete CBaPA peptide; and b) administering said therapeutic composition to said patient.

In a preferred embodiment, the CBaPA peptide region (recited in the anthrax toxin rescue method above) is defined by SEQ ID NO: 1. In another embodiment, the patient (recited in the anthrax toxin rescue method above) presents the symptoms of anthrax toxin exposure for a period in the range of approximately six to twelve hours prior to the administration of said therapeutic composition.

In another embodiment the patient (recited in the anthrax rescue method above) is selected from the group consisting of human, rat, cow, and pig.

In another embodiment, the antibody (recited in the anthrax toxin rescue method above) is polyclonal or monoclonal and are not reactive with Lethal Factor or Edema Factor. Ih some embodiments, the invention relates to a method of prevention or treatment of a subject at risk for or showing signs of anthrax intoxication comprising: i) providing, a) a composition comprising an molecule that complexes with anthrax protective antigen and b) a subject; and ii) administering said composition to said subject under conditions such that anthrax intoxication is reduced. In further embodiments, said composition is a pharmaceutical composition. In further embodiments, said molecule complexes with the receptor binding domain of Bacillus cmthracis protective antigen, preferably the amino acids from 679 to 693. In further embodiments, the molecule is an amino acid sequence. In further embodiments the molecule is a substituted amino acid sequence of sequences disclosed herein. In further embodiments, the molecule is an antibody disclosed herein. In some embodiments, tiie invention relates to diagnosis of the presence of Bacillus antkracis in a subject comprising, providing a subject and an antibody to anthrax protective antigen ("PA"), obtaining a sample from said subject suspected of containing Bacillus cmthracis, mixing said sample and said antibody under conditions such that anthrax protective antigen complexes with said antibody, and correlating the formation of a antibody and anthrax protective antigen complex with the existence of Bacillus anihracis in said subject

It is therefore an object of the present invention to provide antibodies neutralizing anthrax toxin by direct inhibition of the PA binding to cells. It is another object of the present invention to provide a composition for neutralizing anthrax toxin, comprising one or more antibodies specific to anthrax toxin protective antigen and an antibody specific to anthrax toxin lethal factor to provide a synergistic augmentation in neutralization efficacy.

It is still another object of the present invention to provide nucleotide sequences encoding heavy chain variable regions of the antibodies. >

It is still another object of the present invention to provide nucleotide sequences encoding light chain variable regions of the antibodies. It is still another object of the present invention to provide a composition for neutralizing anthrax toxin, comprising one or more selected from the antibodies.

It is still another object of the present invention to provide a kit for detecting anthrax toxin, comprising one or more selected from the antibodies.

Thus, in one aspect, the present invention relates to an antibody specific to anthrax toxin protective antigen, which is produced by a hybridoma having accession number KCTC10899BP or KCTC10900BP.

BRIEF DESCRIPTION OF THE DRAWINGS

The above and other objects, features and other advantages of the present invention will be more clearly understood from the following detailed description taken in conjunction with the accompanying drawings, in which:

Fig. 1 shows the results of a neutralization assay for sera obtained from mice immunized with lethal factor (LF) or protective antigen (PA), using a mouse macrophage cell line,

(J774A.1). Four x 10 ⁴ J774A.1 cells were seeded onto a 96-well cell culture plate, and cultured for 18 hrs. The protective antigen and lethal factor were added to each well in final concentrations of 400 ng/ml and 200 ng/ml, respectively. Polyclonal antisera against the PA and the LF obtained from blood of immunized mice were applied to cells after being serially diluted and reacted with the toxin antigen. The viability of the cells was assessed by MTT assay. Results are expressed as the percentages of cells still viable after the treatment. Both polyclonal-anisera showed protective effect on macrophage cell line against PA and LA toxin.

Fig.2 shows the results of binding assay by Western blotting (A) for detecting the binding

of anti-PA 4F3E1 and 4F9A5 antibodies obtained from each hybridoma cells to protective antigen (PA) and C-terminal domain of PA (PAc) and ELISA (B) for detecting the binding of 4F3E1 antibody to PA and PAc Two hundreds nanogram of antigens were subjected to SDS-PAGE and Western blotting. For ELISA, antigens (200 ng/well) were coated on the immunoplate. Then the antibodies

(0.4 μg/ml) were added to each well. After washing, bound antibodies were detected using horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG (Fc-specific) antibody (Pierce).

The antibodies displayed specific binding to PA and PAc in a dose-dependent manner.

Fig. 3 shows the results of the evaluation of antigen binding activity of selected antibodies using surface plasmon resonance. Recombinant PA (List Biological Laboratories) was conjugated to a CM5 chip. Five concentrations of 4F3E1 or 4F9A5 were used for analysis.

Curves were fitted to a 1:2 stoichiometty of binding, and the binding kinetics was analyzed using the BIAevaluation software. The antibodies showed high affinity to recombinant PA.

Fig. 4 shows the results of a neutralization assay using a mouse macrophage cell line for detecting the anthrax toxin-neutralizing activity of purified 4F3E1 and 4F9A5 antibodies. The antibodies were preincubated with LeTx (0.2 μg/ml PA plus 0.1 μg/ml LF), and the complex was incubated with J774A.1 cells. The viability of the cells was assessed by an MTT assay. The results are expressed as percentages of viable cells. The antibodies displayed toxin- neutralizing activities in a dose-dependent manner. The deduced IC50 values of the antibodies were 1.24 μg/ml and 1.39 μg/ml, respectivel.

Fig. 5 shows the results of a neutralization assay using a mouse macrophage cell line according to antibody administration time for evaluating the preventive and therapeutic effects of the antibodies. 4F3E1 (2.48 μg/ml), 4F9A5 (2.78 μg/ml), or anti-GST control antibody (5 μg/ml) was administered before or after challenge with LeTx (0.2 μg/ml PA plus 0.1 μg/ml LF) at different times. After 3 h of LeTx challenge, the survival of J774A.1 cells was determined by an MTT assay. The results are expressed as percentages of viable cells. The antibodies displayed about 80% neutralization activity when administered at -60, -30, 0 and 5

min and about 60% neutralization activity when administered at 15 min, based on Ihe time of toxin administration.

Fig. 6 shows the results of the evaluation of in vivo toxin-neutralizing activity of the antibodies in Fisher 344 rats. LeTx (20 μg PA plus 10 μg LF) preincubated with 40 μg of 4F3E1 or control antibody (anti-GST mAb) was intravenously administered to each of five Fisher 344 rats. The results are expressed as percentages of viable rats from five rats after the treatment. All 5 rats received the antibody were protected from the death caused by toxin, whereas rats received the control antibody were not

Fig. 7 shows the results of the evaluation of inhibitory activity of the antibodies on the binding of protective antigen to cells using Western blot and ELISA. For Ihe Western blotting,

PA (1.5 μg) was preincubated with 4F3E1, 4F9A5, or anti-GST control mAb and the mixtures were added to CHO-Kl cells, and incubated for 3 h. After extensive washing, cells were lysed with lysis buffer containing protease inhibitor cocktail, and subjected to SDS-PAGE and western blot analysis. PA bands were detected using streptavidin-HRP and West Femto chemiluminescence substrate. For the ELISA Biotin-PA (1.5 μg) was preincubated with

4F3E1, 4F9A5 (another anti-PA neutralizing mAb), or anti-GST control mAb and the mixtures were added to CHO-Kl cells grown in a 96-well plate, and incubated for 3 h. After extensive washing, cells were fixed with 3.7% paraformaldehyde-PBS, followed by blocking with 5% BSA-PBS. Cell-bound PA was detected using streptavidin-HRP. The results clearly have shown that the antibodies specifically inhibit the binding of PA to cell surface receptors, in a dose-dependent manner.

Fig. 8 shows the results of the determination of epitope recognized by 4F3E1 by MALDI- MS and slot-blot analysis, (a) Determination of the epitope recognized by 4F3E1 using MALDI-MS. Epitope extraction and epitope excision was done. Upper panel shows the results from the epitope extraction, and lower panel shows the results from the epitope excision (Lys- C, GIu C, and trypsin from the left). Numbers are amino acid of peptides of matched sequence within PAc. (b) Stereo ribbon representation of PA-ATR complex (RCSB Protein Data Base;

1T6B). ATR-binding loop was marked on the structure in red. GST-tagged PAc and deletion mutant lacks ATR-binding loop (PAcδ676-694) were generated, (c) Slot-blot analysis of GST- PAc and GST-PAcδ676-694 using anti-GST mAb, anti-PA mouse polyserum, or 4F3E1. The epitope recognized by 4F3E1 might be located at the region near 670-704 of PA which include small loop within Pac previously suggested as a receptor binding motif.

Fig.9 shows the amino acid sequences of heavy chain and light chain variable regions of the 4F3E1 antibody, wherein CDR regions are underlined.

Fig. 10 shows the amino acid sequences of heavy chain and light chain variable regions of the 4F9A5 antibody, wherein CDR regions are underlined.

Fig. HA show the amino acid sequence (SEQ ID No.34) of heavy chain variable region of 5B13B1 Lethal Factor antibody.

Fig.1 IB shows the amino acid sequence (SEQ ID No.35) of light chain variable region of 5B13B1 Lethal Factor antibody. Fig.12 shows the amino acid sequence of (SEQ ID No.36) of domain 3 of lethal factor.

DETAILED DISCUSSION

The term "antibody", as used herein, refers to a molecule specifically binding to an antigen, and includes dimeric, trimeric and multimeric antibodies, and recombinant, processed and camelized antibodies. Also, an antibody may be a whole antibody or a functional fragment of an antibody molecule. The term "functional fragment of an antibody molecule" indicates a fragment retaining at least its antigen binding function, and include Fab, F(ab'), F(ab') ₂ , scFv, dsFv, and diabody. Techniques for the preparation and use of the various antibodies are well known in the art. For example, antibody fragments may be obtained using proteolytic enzymes (e.g., a whole antibody is digested with papain to produce Fab fragments, and pepsin treatment results in the production of F(ab') ₂ fragments), and may be preferably prepared by recombinant DNA techniques. An isolated antibody any collected composition containing

the antibody. Preferably die concentration of said antibody is greater than that found in blood serum.

As used herein, "humanized" forms of non-human (e.g., murine) antibodies are chimeric antibodies that contain minimal sequence, or no sequence, derived from non-human immunoglobulin. For the most part, humanized antibodies are human immunoglobulins (recipient antibody) in which residues from a hypervariable region of the recipient are replaced by residues from a hypervariable region of a non-human species (donor antibody) such as mouse, rat, rabbit or nonhuman primate having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are generally made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a nonhuman immunoglobulin and all or substantially all of the FR residues are Ihose of a human immunoglobulin sequence. The humanized antibody may also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat No. 5,225,539 to Winter et al. (herein incorporated by reference). Importantly, early methods for humanizing antibodies often resulted in antibodies with lower affinity than the non-human antibody starting material. More recent approaches to humanizing antibodies address this problem by making changes to the CDRs. See U.S. Patent Application Publication No.20040162413, hereby incorporated by reference. In some

embodiments, the present invention provides an optimized heteromeric variable region (e.g. that may or may not be part of a full antibody other molecule) having equal or higher antigen binding affinity than a donor heteromeric variable region, wherein the donor heteromeric variable region comprises three light chain donor CDRs, and wherein the optimized heteromeric variable region comprises: a) a light chain altered variable region comprising; i) four unvaried human germline light chain framework regions, and ii) three light chain altered variable region CDRs, wherein at least one of the three light chain altered variable region CDRs is a light chain donor CDR variant, and wherein the light chain donor CDR variant comprises a different amino acid at only one, two, three or four positions compared to one of the three light chain donor CDRs (e.g. the at least one light chain donor CDR variant is identical to one of the light chain donor CDRs except for one, two, three or four amino acid differences).

"Anti-CbaPA" means an antibody specific for any portion of the C-terminal domain of Bacillus anthracis protective antigen, i.e., (residues 596 to 735) responsible for the attachment of the toxin to the cellular receptors preferably the amino acids from 679 to 693, i.e., SEQ ID No. 1: GLKEVINDRYDMLN.

As used herein, an antibody "specific" or for "binding" means that the antibody has some affinity to complex with a specified epitope, Le., localized region on the surface of an molecule that is capable of combining with the antibody, usually through, but not limited to, hydrogen bonding of the antibody's variable amino acid sequence region. It is not intended to require a high degree of complexation, and is intended to include those with low affinity.

Diagnosis of anthrax can be accomplished by a variety of methods such as detecting serum antibodies to the protective antigen (PA) and lethal factor components of anthrax toxin, the

presence of antibodies to poly-D-glutamic acid capsule, and culturing and sequencing some portion of nucleic acids or arrays of genomic expression from a sample collected from a subject.

A symptom of anthrax toxin includes, but is not limited to, shortness of breath, vomiting, fever, malaise, and adenopathy. In the most common cutaneous form of anthrax, spores inoculate a host through skin lacerations, abrasions, or biting flies. The disease begins as a nondescript papule that becomes a 1-cm vesicle within 2 days. Occasionally, surrounding edema is severe and can lead to airway compromise if present in Hie neck. The skin in infected areas may become edematous and necrotic. Spore germination occurs within macrophages at the site of inoculation. Anthrax bacilli are isolated easily from the vesicular lesions and can be observed on Gram stain. If prior treatment with antibiotics has occurred, the best way to determine infection is to perform serologic testing and punch biopsy at the edge of the lesion and examine by silver staining and immunohistochemical testing. The initial lesion ruptures after a week and progresses to a characteristic black eschar. The stages of skin infection occur despite treatment with antibiotics. Differential diagnoses of the skin lesion include tularemia, plague, cutaneous diphtheria, Staphylococcus infections, Rickettsia infections, and orf (a viral disease of livestock).

Mialational anthrax usually occurs in textile and tanning industries among workers handling contaminated animal wool, hair, and hides. Inhaled spores are ingested by pulmonary macrophages and then carried to hilar and mediastinal lymph nodes. The spores undergo germination and multiplication and begin to elaborate toxins. After the lymph nodes become overwhelmed, bacteremia and death quicldy ensue. The initial stage begins with the onset of myalgia, malaise, fatigue, nonproductive cough, occasional sensation of retrosternal

pressure, and fever. There may be a transient improvement in symptomatology after the first few days. The second stage, lasting 24 h and often culminating in death, develops suddenly with the onset of acute respiratory distress, hypoxemia, and cyanosis. The patient may have mild fever; alternatively, the patient may have hypothermia and develop shock. Diaphoresis often is present; enlarged mediastinal lymph nodes may lead to partial tracheal compression and alarming stridor. Auscultation of the lungs is remarkable for crackles and signs of pleural effusions. Meningeal involvement may be present in up to 50% of cases; it usually is bloody and may be associated with subarachnoid hemorrhage. Decreased level of consciousness, meningismus, and coma may be present. A chest radiograph typically shows widening of the mediastinum and pleural efiusions, whereas the parenchyma may appear normal.

Gastrointestinal anthrax usually occurs fiυm eating infected, undercooked meat Symptoms usually begin a few days after ingestion of the contaminated meat. Abdominal pain and fever occur first, followed by nausea, vomiting, and diarrhea. "A substituted amino acid sequence" means that the amino acid sequence may contain one or more changed amino acids compared to an unsubstituted sequence or the amino acid sequence may entirely remove one or more amino acids provided that the amino acid sequence has the same function contemplated as having as in the unsubstituted or original sequence. It is intended that the contemplated function includes substitutions with reduced function, e.g., antibodies with reduced affinity. The changed amino acids may be natural, unusual, or non-naturally occurring, Le., synthetically produced. Preferably the number of changed amino acids is less than 10 % and even more preferably less than 5 % of the entire sequence. However, to the extent that the substitutions are residues with comparable hydrophobicities, e.g., isoleucine and valine, asparagine and aspartic acid, the number of

changed amino acids could be more than 10%. The amino acid sequence may be chemically modified at the amino terminal or carboxyl terminal ends to contain any molecular arrangement. One or more or all of the amide carbonyl bonds may be chemically altered to form the corresponding alkyl amine. A "molecule"is intended to include biomolecules such as, but not limited to, antibodies, amino acid sequences, and nucleic acid sequences of large molecular weights.

A molecule "functioning to inhibit the binding of protective antigen to cells" means that the molecule decreases to some degree the ability of cells to bind protective antigen. It is not intended that it must entirely prevent cell binding to protective antigen. It is enough that the binding be inhibited 10% or more, more preferably 20% or more, still more preferably 50% or more, and most preferably 90% or more. Although the applicants do not desire to be limited by any particular mechanism, a molecule is generally thought to inhibit binding by associating to protective antigen, thus interfering with protective antigens C-terminal domain from interacting with cellular components that facilitate membrane insertion. The term "Kd", as used herein, refers to a dissociation constant of specific antibody-antigen interaction, and has been used to measure the affinity of an antibody to an antigen.

Bacillus anthracis is Gram-positive, 4-8 um in length and 1-1.5 μm in width, making it the largest among pathogens, is square-ended, and sometimes forms long chains. B. anthracis is non-motile without flagella, and forms spores in unfavorable environments. The spores can survive for 24 hours in air and even for 100 years in the soil, and have properties of high resistance to heat, sunlight disinfecting agents, and the like.

Anthrax is a disease caused by a spore-forming bacterium belonging to the genus Bacillus,

Bacillus anthracis. Since anthrax is actually rare in humans, studies involving anthrax have been not actively performed. Anthrax most commonly occurs in domestic animals (cattle, sheep, goats, camels, antelopes, and other herbivores), and often occurs in livestock workers who are exposed to infected livestock, or in people when they ingest products made from

infected livestock. However, due to its high potential use for purposes of biological terrorism, B. anthracis has recently been classified by the American CDC (Centers for Disease Control and Prevention) as a pathogenic microorganism of Category A, which has high potential for use in terrorism. Anthrax infection may occur mainly in three forms: cutaneous (skin), inhalation

(pulmonary), and intestinal. Among them, inhalation infection is most lethal. Initial symptoms of inhalation anthrax may resemble a common cold and include fever, difficulty in breathing, coughing, headaches, vomiting, chilling, abdominal pain, and chest discomfort. After several days, the symptoms may progress to severe breathing problems and shock. Inhalation anthrax is usually fatal. About 20% of all cutaneous infection cases are fetal and intestinal infection results in a 25-60% death rate. Inhalation infection is more frequently fatal.

In the case of inhalation anthrax, B. anthracis is drawn in its dormant spore state into the lungs through the respiratory tract, and is ingested by macrophages in the alveoli. The spores germinate within the macrophages, and are carried to lymph nodes, where they multiply. The bacterial cells then get into the bloodstream, and begin reproducing continuously and producing toxins, causing lethal symptoms.

B. anthracis produces anthrax toxin through a pXOl plasmid. Anthrax toxin is composed of three distinct proteins: protective antigen (PA, 83 kDa), lethal factor (LF, 90 kDa), and edema factor (EF, 89 kDa). The protective antigen, consisting of four folding domains, binds to the anlhrax toxin receptor (ATR) on the cell surface through its domain 4 (Carboxyl-terminal domain; PAc). PA is then cleaved at the site of domain 1 by furin-like protease on the cell surface to produce PA63, releasing an N-terminal 20-kDa fragment The activated fbmi of PA,

PA63, oligomerizes into a heptamer, [PA63] ₇ , to generate regions capable of binding to LF or

EF. The PA63 heptamer combines with either LF or EF to form either lethal toxin (LeTx) or edema toxin (EdTx).

The PA63 heptamer-LF/EF complex is endocytosed into the cytoplasm, and fused with lysosome. The PA63 heptamer undergoes conformational changes at low pH, resulting in the

release of LF and EF into the cytoplasm. In the cytoplasm, LF acts as a zinc-dependent metalloprotease which cleaves mitogen-activated protein kinase kinases. This cleavage disrupts Hie intracellular signal transduction pathway, resulting in Hie lysis of macrophages. EF is a calcium/calmodulin-dependent adenylate cyclase, which causes increased levels of intracellular cAMP levels, leading to swelling and local inflammation.

Passive immunization using antibodies is an effective strategy for toxin neutralization. The development of antibodies capable of neutralizing botulinum toxin and ricin in addition to anthrax toxin is in progress (Rainey et al., 2004 Nature reviews of Microbiology 2: 721-726). Several research groups revealed through studies using cells and small animals, such as guinea pigs, rats, mice, and hamsters, that antisera are effective in neutralizing anthrax toxin (Beedham et al., 2001 Vaccine 19:4409-4416; Little et al., 1997 Infection and Immunity 65:5171-5175; Kobiler et al., 2002 Infection and Immunity 70:544-550).

A couple of studies showed that antibodies recognizing LF also neutralized LeTx in vitro and in vivo (Little et al., 1990 Infection and Immunity 58:1606-1613; Zhao et al., 2003 Human Antibodies 12:129-135; Lim et al., 2005 Infection and Immunity 73:6547-6551). A monoclonal antibody, LF8, capable of neutralizing anthrax toxin, inhibits lethal toxin formation by binding to the PA binding domain of LF (Zhao et al., 2003 Human Antibodies 12: 129-135).

Antibodies capable of neutralizing anthrax toxin effectively prevent and treat anthrax due to their properties of having high specificity and affinity to antigens and long half-lives in vivo. Many attempts have recently been made to neutralize anthrax toxin using monoclonal antibodies against protective antigen (PA), and such attempts were reported (Brossier et al.,

2004 Infection and Immunity 72:6313-6317; Sawada-Hirai et al., 2004 Journal of Immune

Based Therapies and Vaccines 2:5; Wang et al., 2004 Human antibodies 13:105-110; Wild et al., 2003 Nature Biotechnology 21:1305-1306; Cirino et al., 1999 Infection and Immunity 67:2957-2963).

The underlying mechanism involved in anti-PA antibody-based neutralization of anthrax toxin is not clear. Although the inventor does not desire to be limited by any particular

mechanism, it is believed Ifaat anti-PA antibody-based neutralization of anthrax toxin occur binding inhibition between PA and its cellular receptor, inhibition of cleavage of PA, or inhibition of heptamer assembly. Here, me present inventors selected hybridoma cells that secrete monoclonal antibodies capable of neutralizing anthrax toxin directly by binding to the protective antigen, and found that the antibodies produced by the hybridomas, which have high toxin-neutralizing activity, have preventive and therapeutic activity against anthrax through a mechanism of binding to the cellular receptor-binding region of protective antigen and inhibiting the binding between protective antigen and cells. Thus, mis is the first evidence how anti-PA antibody neutralize anthrax toxin at molecular level. Moreover, the present inventors found through in vitro cell and in vivo animal studies that the use of an antibody specific to protective antigen in combination with an antibody specific to lethal factor has a synergistic effect on anthrax toxin neutralization.

In some embodiments, the antibodies of the present embodiments are neutralization antibodies. A "neutralization antibody" means an antibody mat induces a neutralizing immune response by eliminating or significantly reducing (i.e. reducing by 30% or more, and more preferably by 50% or more) the biological activity of a bound target antigen. The 4F3E1 and 4F9A5 antibodies act as antibodies having preventive or therapeutic activity against anthrax. Although the inventors do not desire embodiments to be limited by any particular mechanism, it is believed that 4F3E1 and 4F9A5 inhibit the binding of the protective antigen to cells by binding to PAc, which is the cellular receptor-binding region of protective antigen. In some embodiments, both antibodies were found to inhibit the action of anthrax toxin in a dose- dependent manner.

The present inventors prepared antibodies specific to the protective antigen component of anthrax toxin according to the following procedure. Bacillus anthracis protective antigen was purified, and Balb/c mice were immunized with this protein. Blood samples were collected from orbital venous plexus of the immunized mice, and the sera obtained were assessed for anthrax toxin-neutralizing activity. The immunized mice were sacrificed, and the spleen was

excised from the mice. Splenocytes were extracted and fused with mouse myeloma FO cells. Then, hybridoma cells having neutralization activity were selected using a neutralization assay for anthrax toxin. Cells having anthrax toxin-neutralizing activity by specifically binding to protective antigen were subjected to limiting dilution, and two monoclonal antibodies, 4F3E1 and 4F9A5, were selected. Western blot analysis revealed that the isolated antibodies bind to PAc.

Antibodies produced by the selected hybridomas protect cells against anthrax toxin by inhibiting the action of anthrax toxin in a dose-dependent manner, and effectively act when administered after as well as before exposure to anthrax toxin. Also, the evaluation of the in vivo toxin-neutralizing activity of the antibodies in Fisher 344 rats resulted in the finding that the antibodies could effectively neutralize anthrax toxin in vivo.

Two antibodies specifically binding to anthrax toxin protective antigen are 4F3E1, having a dissociation constant (Ka) of 1.94XlO ^-9 M, and 4F9A5, having a Kd of 0.99* 10* M, exhibit high affinity to the antigen. The 4F3E1 antibody recognizes the loop located at the C- terminal domain of PA, SEQ ID No. 1, which as arole in bindingto cell surface receptors.

The present inventors identified amino acid sequences and nucleotide sequences of heavy chain and light chain variable regions of the monoclonal antibodies, and determined CDRs.

The term "complementarity determining regions (CDRs)" refers to amino acid sequences that determine the binding affinity and specificity of a variable region to an antigen. Three complementarity determining regions, CDRl, CDR2 and CDR3, are present in a variable region.

The 4F3E1 antibody has a heavy chain variable region comprising the amino acid sequence of SEQ ID No. 2 and a light chain variable region comprising the amino acid sequence of SEQ ID No. 6. The heavy chain variable region comprises CDRl, comprising the amino acid sequence of SEQ ID No. 3, CDR2, comprising the amino acid sequence of SEQ ID No. 4, and CDR3, comprising the amino acid sequence of SEQ ID No. 5. The light chain variable region comprises CDRl, comprising the amino acid sequence of SEQ ID No. 7,

CDR2, comprising the amino acid sequence of SEQ K) No. 8, and CDR3, comprising the amino acid sequence of SEQ K) No.9.

Thus, the present invention provides a CDR of a heavy chain variable region specific to anthrax toxin protective antigen, the CDR comprising the amino acid sequence of SEQ K) No. 3, 4 or 5; and a CDR of a light chain variable region specific to anthrax toxin protective antigen, the CDR comprising the amino acid sequence of SEQ JD No.7, 8, or 9. In addition, the present invention provides a heavy chain variable region specific to anthrax toxin protective antigen, comprising one or more selected from among CDRs comprising the amino acid sequences of SEQ ID Nos.3, 4 and 5; and a light chain variable region specific to anthrax toxin protective antigen, comprising one or more selected from among CDRs comprising the amino acid sequences of SEQ K) Nos.7, 8, or 9.

The 4F9A5 antibody has a heavy chain variable region having the amino acid sequence of SEQ K) No. 10 and a light chain variable region comprising the amino acid sequence of SEQ K) No. 14. The heavy chain variable region comprises CDRl, comprising the amino acid sequence of SEQ K) No. 11, CDR2, comprising the amino acid sequence of SEQ K) No. 12, and CDR3, comprising Hie amino acid sequence of SEQ K) No. 13. The light chain variable region comprises CDRl, comprising the amino acid sequence of SEQ K) No. 15, CDR2, comprising the amino acid sequence of SEQ K) No. 16, and CDR3, comprising the amino acid sequence of SEQ K)No. 17. Thus, the present invention provides a CDR of a light chain variable region specific to anthrax toxin protective antigen, the CDR comprising the amino acid sequence of SEQ K) No. 11, 12, and 13. In addition, the present invention provides a light chain variable region specific to anthrax toxin protective antigen, comprising one or more selected from among CDRs comprisingthe amino acid sequences of SEQ K) Nos. 15, 16 and 17. In another aspect, the present invention relates to an antibody specific to anthrax toxin protective antigen, comprising a heavy chain variable region including CDRs comprising the

amino acid sequences of SEQ ID Nos. 3, 4 and 5; and a light chain variable region including CDRs comprisingthe amino acid sequences of SEQ E) Nos.7, 8, or 9.

In a further aspect, the present invention relates to an antibody specific to anthrax toxin protective antigen, comprising a heavy chain variable region including CDRs comprising the amino acid sequences of SEQ ID Nos. 11, 12, and 13; and a light chain variable region including CDRs comprising the amino acid sequences of SEQ ID Nos. 15, 16 and 17.

Immunoglobulins are divided into variable regions and constant regions. The variable regions direct the formation of antigen-antibody complexes by specifically recognizing epitopes on antigens. The constant regions, having mostly the same sequence between all the immunoblobulin classes, have effector functions, including activating the complement system, conferring an ability to pass across the placenta and acting as ligands for receptors on various immune cells. The specificity of an antibody to an antigen is determined by structural specificity according to the amino acid sequences of variable regions. Thus, based on the amino acid sequences of heavy chain and light chain variable regions and the amino acid sequences of CDRs, which were determined by those skilled in the art, various forms of recombinant antibodies may be prepared according to the intended use, and the resulting antibodies are included in the scope of the present invention. For example, such antibodies may be prepared using CDR shuffling and implantation technologies.

In yet another aspect, the present invention relates to a hybridoma having accession number KCTC10899BP or KCTC10900BP.

Hybridomas producing 4F3E1 and 4F9A5 monoclonal antibodies having the aforementioned properties were deposited at KCTC (Korean Collection for Type Cultures, Korean Research Institute of Bioscience and Biotechnology (KRIBB)) on Jan. 19, 2006 and assigned accession number KCTC10899BP and KCTC10900BP, respectively. In still another aspect, the present invention relates to a nucleotide sequence encoding a heavy chain variable region having the amino acid sequence of SEQ ID No.2 or 10.

In still another aspect, the present invention relates to a nucleotide sequence encoding a light

chain variable region having the amino acid sequence of SEQ E ⁾ No.7 or 14.

The nucleotide sequences of the heavy chain and light chain variable regions may be modified with one or more additions, deletions, or non-conservative or conservative substitutions of nucleotide bases. The nucleotide sequences may be inserted into a vector for expression thereof.

In still another aspect, the present invention relates to a recombinant vector comprising the nucleotide sequence.

The vector of the present invention includes, but is not limited to, plasmid vectors, cosmid vectors, bacteriophage vectors, and viral vectors. A suitable expression vector includes expression regulatory elements, such as a promoter, an operator, an initiation codon, a stop codon, a polyadenylation signal, and an enhancer, as well as signal sequences for membrane targeting or secretion. The promoter of the vector may be constitutive or inducible. An expression vector may also include a selectable marker that allows the selection of host cells containing the vector. The vector expressing an antibody or an antibody fragment may be a vector system that simultaneously expresses a light chain and a heavy chain in a single vector, or a system that expresses a light chain and a heavy chain in two separate vectors.

Li still another aspect, the present invention relates to a transformant transformed with the vector. The transformation includes any method by which nucleic acids can be introduced into organisms, cells, tissues or organs, and, as known in the art, may be performed by selecting suitable standard techniques according to host cells. These methods include, but are not limited to, electroporation, protoplast fusion, calcium phosphate (CaPO ₄ ) precipitation, calcium chloride (CaCl ₂ ) precipitation, agitation with silicon carbide fiber, agrobacterium- mediated transformation, and PEG-, dextran sulfate- and lipofectamine-mediated transformation.

Host cells most suitable for objects may be selected and used because expression levels,

modification, or the like of proteins vary depending on host cells. Host cells include, but are not limited to, prokaryotic cells such as Escherichia coli, Bacillus subtilis, Streptomyces, Pseudomonas, Proteus mirabilis or Staphylococcus. In addition, eukaryotic cells useful as host cells include lower eukaryotic cells, such as fungi (e.g., Aspergillus) and yeasts (e.g., Pichia pastoris, Saccharomyces cerevisiae, Schizosaccharomyces, Neurospom crassa), and cells derived from higher eukaryotes, such as insect cells, plant cells and mammalian cells.

In still another aspect, the present invention relates to a method of preparing an antibody specific to anthrax toxin protective antigen using the transfbrmant.

An antibody may be prepared by cultivating the transfbrmant under suitable conditions and recovering the antibody from the host cell culture (e.g., culture medium of the transformant).

The cultivation of host cells for antibody production may be performed under suitable culture conditions and using proper media, which are known in the art. The culture conditions and media may be readily determined and applied by those skilled in the art. Various culture methods are described in numerous literature (e.g., Biochemical Engineering,

James M. Lee, Prentice-Hall International Editions, pp 138-176). An antibody produced may be purified using ordinary methods, which may be used separately or in combination, for example, dialysis, salting out (e.g., ammonium sulfate precipitation, sodium phosphate precipitation, etc.), ion exchange chromatography, size exclusion chromatography, and affinity chromatography.

Li still another aspect, Ihe present invention relates to a composition for neutralizing anthrax toxin, comprising one or more antibodies selected from the antibodies specific to protective antigen.

In one embodiment, the antibodies of the present invention have a neutralization effect against anthrax toxin by inhibiting the binding of protective antigen to its cellular receptor.

Also, the present antibodies may be used as preventive agents as well as therapeutic agents for anthrax because they exhibit an excellent neutralization effect after as well as before

exposure to anthrax toxin. For certain embodiments, when the antibodies are administered before and after toxin administration (the time point at which toxin was administered was designated "0"), namely at time points of -60, -30, 0, 15, 30, 60 and 120 min, in order to examine viability according to the administration time of flie antibodies, the antibodies display a roughly 50% neutralization effect even when administered 15 min after toxin administration.

The present composition may be provide for preventing and treating anthrax in humans, as well as in anthrax infection-susceptible livestock, such as cows, horses, sheep, swine, goats, camels, and antelopes. The term "prevention", as used herein, means all activities that inhibit or delay the incidence of anthrax through the administration of a composition comprising the present antibody. The term "treatment ⁵ ', as used herein, refers to all activities that alleviate and beneficially affect anthrax symptoms through the administration of the present antibody. Although preferred, it is not intended that prevention and treatment be entirely effective; prevention and treatment included partial prevention and partial benefits (e.g. the severity of one or more symptoms is reduced).

When used as a therapeutic antibody, the present antibodies may be linked to a known therapeutic agent by direct or indirect coupling (e.g., covalent bonding) through a linker, and administered to the body in antibody-therapeutic agent conjugates in order to prevent or treat anthrax. Available therapeutic agents include chemical therapeutic agents, immunotherapeutic agents, cytokines, chemokines, antiviral agents, biological agents, and enzyme inhibitors. Effective therapeutic agents may have enhanced efficacy when they are administered with an antibody that is highly specific to an antigen so as to remain at high concentrations at an infection site. A therapeutic comprising the antibody according to the present invention includes a pharmaceutically acceptable carrier and may be formulated into dosage fonns for use in humans or veterinary use. For oral administration, the pharmaceutical composition may be

presented as discrete units, for example, capsules or tablets; powders or granules; solutions, syrups or suspensions (edible foam or whip formulations in aqueous or non-aqueous liquids); or emulsions. For parental administration, the pharmaceutical composition may include aqueous and non-aqueous sterile injection solutions which may contain anti-oxidants, buffers, bacteriostatics and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents. Excipients available for use in injectable solutions include, for example, water, alcohol, polyols, glycerin, and vegetable oils. Such a composition may be presented in unit-dose (single dose) or multiple dose (several doses) containers, for example, sealed ampoules and vials, and may be stored in a freeze-dried

(lyophilized) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets.

In still another aspect, an embodiment of the present invention relates to a method of preventing or treating anthrax by administering the antibody specific to protective antigen.

The composition comprising the antibody may be administered to B. anthracis-iπfected or susceptible subject such as humans and livestock, such as cows, horses, sheep, swine, goats, camels, and antelopes, in order to prevent or treat the incidence of anthrax. The antibody composition of the present invention may be administered in a pharmaceutically effective amount in a single- or multiple-dose. The pharmaceutical composition of the present invention may be administered via any of the common routes, as long as it is able to reach the desired tissue. A variety of modes of administration are contemplated, including intraperitoneally, intravenously, intramuscularly, subcutaneously, intradermally, orally, intranasally, intrapulmonarily and intrarectally, but the present invention is not limited to these exemplified modes of administration. However, since proteins are digested upon oral administration, active drugs of a composition for oral administration should be coated or formulated for protection against degradation in the

stomach. In addition, the pharmaceutical composition may be administered using a certain apparatus capable of transporting active substances into target cells.

The antibody composition of the present invention may be administered in a pharmaceutically effective amount. The term "pharmaceutically effective amount", as used herein, refers to an amount sufficient for treating or preventing diseases, which is commensurate with a reasonable benefit/risk ratio applicable for medical treatment or prevention. An effective dosage amount of the composition may be determined depending on the severity of the illness, drug activity, the patient's age, weight, health state, gender and drug sensitivity, administration routes, drugs used in combination with the composition; and other factors known in medicine, and may be readily determined by those skilled in the art. The antibody composition of the present invention may be administered as a sole therapeutic agent or in combination with other therapeutic agents, and may be administered sequentially or simultaneously with conventional therapeutic agents. This administration may be provided in single or multiple doses. In still another aspect, an embodiment of the present invention relates to a kit for detecting anthrax toxin, comprising the antibody specific to protective antigen.

With the kit comprising the antibody, anthrax infection may be easily and simply diagnosed by detecting anthrax toxin in a biological sample. Anthrax infection may be diagnosed by reacting a biological sample with the antibody and detecting antigen-antibody complex formation.

The tenn "Ihe detection of anthrax toxin", as used herein, refers to the identification of the presence and amount of protective antigen by quantitatively or qualitatively measuring the signal size of a detection label bound to antigen-antibody complexes.

Such a detection kit includes the antibody of the present invention, as well as tools, reagents, and the like, which are generally used in the art for immunological analysis.

These tools/reagents include, but are not limited to, suitable carriers, labeling substances capable of generating detectable signals, solubilizing agents, detergents, buffering agents and

stabilizing agents. When the labeling substance is an enzyme, the kit may include a substrate allowing the measurement of enzyme activity and a reaction terminator.

Antigen-antibody complex formation may be detected using histoimmunological staining, radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), immunoprecipitation assay, immunodifilision assay, complement fixation assay, FACS, and protein chips, but the present invention is not limited to these examples.

Labels enabling the quantitative or qualitative measurement of the formation of antigen- antibody complexes include, but are not limited to, enzymes, fluorescent substances, ligands, luminescent substances, microparticles, redox molecules and radioactive isotopes. Examples of enzymes available as detection labels include, but are not limited to, β-glucuronidase, β-D- glucosidase, β-D-galactosidase, urase, peroxidase, alkaline phosphatase, acetylcholinesterase, glucose oxidase, hexokinase and GDPase, RNase, glucose oxidase and luciferase, phosphofhictokinase, phosphoenolpyruvate carboxylase, aspartate aminotransferase, phosphenolpyravate decarboxylase, and β-latamase. Examples of the fluorescent substances include, but are not limited to, fluorescin, isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamin. Examples of the ligands include, but are not limited to, biotin derivatives. Examples of luminescent substances include, but are not limited to, acridinium esters, luciferin and luciferase. Examples of the microparticles include, but are not limited to, colloidal gold and colored latex. Examples of the redox molecules include, but are not limited to, ferrocene, ruthenium complexes, viologen, quinone, Ti ions, Cs ions, diimide, 1,4-benzoquinone, hydroquinone, K ₄ W(CN) ₈ ,

[Os(bpy) ₃ ] ²⁺ , [RU(bpy) ₃ ] ²⁺ , and [MO(CN) ₈ ] ^4" . Examples of the radioactive isotopes include, but are not limited to, ³ H, ¹⁴ C, ³² P, ³⁵ S, ³⁶ Cl, ⁵¹ Cr, ⁵⁷ Co, ⁵⁸ Co, ⁵⁹ Fe, ⁹⁰ Y, ¹²⁵ 1, ¹³¹ I, and ¹⁸⁶ Re.

The protective antigen-specific antibodies, provided in the present invention, exhibit a synergistic anthrax-neutralizing effect when administered in combination with an antibody specific to lethal factor, compared to use alone. Thus, in still another aspect, an embodiment of the present invention relates to a

composition for neutralizing anthrax toxin, comprising one or more antibodies specific to anthrax toxin protective antigen, selected from the antibodies, and an antibody specific to anthrax toxin lethal factor.

The present inventors found through in vitro cell and in vivo animal studies that the combined use of the protective antigen (PA)-specific antibody of the present invention with a lethal factor (LF)-specific antibody provides a synergistic anthrax-neutralizing effect. Thus, when the PA-specific antibody of the present invention is administered in combination with an LA-specific antibody, it has high preventive and therapeutic effects even in a small amount LF-specific antibodies which can be used in combination with the present antibodies are not specifically limited. For example, 5B13B1 and 3C16C3 antibodies may be used. The 5B13B1 and 3C16C3 antibodies are LF-specific antibodies, which were prepared using a lethal factor as an immunogen for mice and the aforementioned hybridoma method. Of the two antibodies, the 5Bl 3Bl antibody has a heavy chain variable region having the amino acid sequence of SEQ ID No. 34 and a light chain variable region having the amino acid sequence of SEQ ID No. 35, and has an activity to eliminate or significantly reduce the function of lethal factor or lethal toxin.

The ratio of the PA-specific antibody and the LA-specific antibody may vary depending on the type of antibodies used. For example, when the PA-specific 4F3E1 antibody is used in combination with the LA-specific 5B13B1 antibody at a ratio of 1:2, it has a high toxin- neutralizing activity.

Pharmaceutically acceptable carriers, useful in the composition of the antibody specific to anthrax toxin protective antigen and the antibody specific to anthrax toxin lethal factor according to the present invention, and pharmaceutical formulations and administration modes of the composition are as described above.

The present antibodies specific to anthrax toxin have very high antigen affinity and toxin- neutralizing activity, and effectively neutralize anthrax toxin when administered after as well

as before exposure to anthrax toxin. Thus, the present antibodies are useful as both preventive and therapeutic agents for anthrax. In addition, the combination of the protective antigen-binding antibody and a lethal factor-binding antibody has a synergistic effect on toxin neutralization, and thus may provide much higher therapeutic and preventive effects. A better understanding of the present invention may be obtained through the following examples which are set forth to illustrate, but are not to be construed as the limit of the present invention.

EXAMPLE 1 : Preparation and production of toxin antigens

1. Construction of plasmids expressing toxin antigens

The Bacillus anthracis pXOl plasmid carrying the genes coding for protective antigen and lethal factor and a pT7-PA plasmid carrying the protective antigen gene were obtained from

Ihe Pathogen Control Laboratory, the Center for Disease Control (Seoul, Korea). The protective antigen gene was digested with BamHI and SaIL and inserted into a pBSl-1 vector, thus yielding an expression vector, pBSl-1-PA. Separately, the lethal factor gene was amplified by polymerase chain reaction (PCR) using the B. anthracis pXOl plasmid as a template with a pair of primers, represented by SEQ ID Nos. 18 and 19, and cloned into pBSl-1 containing Sl-tag, which was obtained from Aprogen Inc., Korea (Meesook et al., J Immunol Methods.2003 Dec;283(l-2):77-89).

5'-primer: 5'-cgtggatccatggcgggcggtcatggtgatg-3' (SEQIDNo. 18) 3'-primer: 5'-gatotagatøtgagttaataafgaac-3' (SEQ ID No. 19)

Carboxyl-terminal domain of PA (PAc)gene was amplified by polymerase chain reaction (PCR) using the pBS 1-1 -PA plasmid as a template with a pair of primers, represented by SEQ ID Nos.20 and 21, and cloned into pGEX-4T-l containing Glutathione S-Transferase (GST)- tag yielding an expression vector pGEX-PAc.

5'-primer: 5'-ATTGGdTCC TTTCATTATG ATAGAAATAA-3' _(SEQ ID No.20)

3'-primer: 5'- ATTCTCGAGTTATCCTATCTCATAGCCTTTTT-S' (SEQ ID No.21)

2. Production and purification of toxin antigens

E coli HB2151 was transfonned with the constructed plasmids, cultured in 2x YT medium, and treated with 1 mM IPTG (isopropyl-β-D-thiogalactopyranoside) to induce protein expression. E coli cells were tfien harvested by centrifugation, resuspended in Ix TES (0.2 M Tris-Cl, 0.5 mM EDTA, 0.5 M sucrose, pH 8.0), and lysed with l/5x TES. After the cell

lysate was centrifiiged, the supernatant was recovered, passed through a 0.22-μm filter, and subjected to affinity chromatography

For the production of PA and LF, a Sepharose column (Aprogen) to which an antibody to Sl-tag, API, was bound was used. The column was loaded with the protein sample (supernatant), and washed with 0.5 M NaCl in 0.1 M Tris-Cl (pH 8.0). The bound protein was then eluted with 0.2 M Glycin-HCl (pH 2.7). The eluted protein was immediately neutralized with 0.1 M Tris-Cl (pH 9.0) and dialyzed in phosphate buffer. The protein was then treated with thrombin (1 U/100 μg of fusion protein) for 2 hrs to remove the Sl-tag therefrom, equilibrated with phosphate buffer, and purified by fast protein liquid chromatography using a Superose 6 column (gel filtration). Toxin protein-containing fractions were collected.

For the production of PAc, a Glutathione-Sepharose column was used. The column was loaded with the protein sample (supernatant) and washed with PBS. GST-PAc was eluted with 20 mM GSH (reduced form of glutathione). To obtain PAc not containing GST, on- column cleavage was done with 20 U of thrombin. After the amount of protein was determined, the purified protein was analyzed using SDS-PAGE and Western blotting.

EXAMPLE 2: Establishment of mouse hybridomas

1. Mouse immunization with protective antigen of Bacillus anthracis

The purified protective antigen of B. anthracis was subcutaneously injected into Balb/c mice. Mice were immunized first with 20 μg of protective antigen emulsified in complete Freund's adjuvant, and were then immunized with 20 μg of protective antigen emulsified in incomplete Freund's adjuvant three times more, once every two weeks. After two weeks, the protective antigen was diluted with phosphate buffer and intravenously injected into mice.

2. Evaluation of polyclonal antibodies in sera for anthrax-neutralizing activity after immunization injection

After the fourth immunization, blood samples were collected from orbital venous plexus

of mice, and isolated sera were assessed for anthrax toxin-neutralizing activity. A neutralization assay was carried out using a mouse macrophage cell line, J774A.1. 4x10 ⁴ J774A.1 cells were seeded onto a 96-well cell culture plate, and cultured for 18 hrs. The protective antigen and lethal factor were added to each well in final concentrations of 400 ng/ml and 200 ng/ml, respectively. An antiserum against the lethal factor was applied to cells after being serially diluted and reacted with the toxin antigen.

After incubation for 3 hrs, MTT (3-(4,5-dimethylthiazol-2-yl)— 2,5-diphenyl tetrazolium bromide) was added to each well in a final concentration of 1.5 mg/ml, followed by incubation for 1 hr. After the culture medium was then removed, dimethyl sulfoxide (DMSO) was added to each well, and absorbance was measured at 540 nm to determine cell viability. Cell viability was expressed as relative viability, in which cell viability in the presence of anthrax toxin alone was designated "0%" and the viability of cells not treated with the toxin was designated "100%" (Fig.1).

1/20 dilutions of antisera obtained from the mouse immunized with PA and used for preparing monoclonal antibodies were found to inhibit cell death by the action of anthrax toxin by about 61%. Also, 1/200 dilutions of the antisera exhibited about 37% neutralization activity.

3. Establishment of mouse hybridomas producing monoclonal antibodies After the immunized mice were sacrificed, the spleens were excised from the mice. Splenocytes were extracted and fused with mouse myeloma FO cells. Then, fused cells were selected using HAT medium. The fused cells were cultured in 96-well cell culture plates, and the cell culture fluids were assessed using ELISA to select cells specifically responding to the protective antigen.

Cell culture fluids, which were found to bind the protective antigen, were analyzed using a neutralization assay for anthrax toxin according to the same procedure as in Example <2-2> to determine cells having toxin-neutralizing activity. Cells having anthrax toxin-neutralizing activity by specifically binding to protective antigen were subcloned using limiting dilution.

Finally, two monoclonal antibodies against protective antigen, 4F3E1 and 4F9A5, which were able to neutralize anthrax toxin, were selected. Two antibodies against lethal factor , 5Bl 13Bl and 3C16C3 which were able to neutralize anthrax toxin were selected. The reactivity of the antibodies against protective antigen was analyzed by Western blotting (Fig.2A) as well as ELISA (Rg. 2B). Western blotting against the PAc region of protective antigen revealed fliat the present antibodies actually bind to PAc, which is the cellular receptor-binding region of protective antigen (Fig.2).

TABLE l

PA-binding activity and anthrax toxin-neutralizing activity of the selected monoclonal antibodies

^a PA-binding activity determined by ELISA ^b LeTx-neutralizing activity determined by in vitro cytotoxicity assay

4. Production and purification of monoclonal antibodies

The selected hybridomas were cultured in DMEM medium supplemented with 10% FBS and streptomycin-penicillin, and the FBS concentration decreased to 5% and then 2%. After cells were finally adapted for growth in serum-free medium, they were cultured in serum-free medium. The culture fluids were recovered, and subjected to Protein G affinity chromatography to purify monoclonal antibodies contained in the culture fluids, thereby selecting the two monoclonal antibodies, 4F3E1 and 4F9A5.

EXAMPLE 3 : Evaluation of toxin-neutralizing activity of the monoclonal antibodies

1. Evaluation of antigen binding ability of the monoclonal antibodies The selected monoclonal antibodies were evaluated for antigen binding activity using

surface plasmon resonance with a BiaCoreX instrument The expressed protective antigen was immobilized onto a CM5 chip and reacted with serial dilutions of the antibody. As a result, the 4F3E1 antibody was found to have a K _0n value of 2.99xlO ⁵ /MS and a K ₀ ^ of

5.83xlO ⁴ /S. From these K _0n and K ₀ S- values, a Kd of 1.94xlO ^'9 M was calculated, indicating that the 4F3E1 antibody has a high antigen affinity. The 4F9A5 antibody was found to have a K _0n of 2.34x1 O ⁵ ZMS and a K^ of 2.32x10 ⁴ /S. From these K _0n and K _off values, a K _d of 0.99x10 ^~9 M was calculated, indicating that the 4F9A5 antibody has a high antigen affinity (Fig.3).

The expressed lethal factor was immobilized onto a CM5 chip and reacted with serial dilutions of the antibody. As a result, the 5B 13B 1 antibody was found to have a K _0n value of 4.34XIO ⁴ JVT ¹ S ^'1 and a Koff of 1.14XlO ⁴ S- ¹ . From these K _0n and K ₀ (F values, a Kd of 2.2 nM was calculated, indicating that the 5B 13B 1 antibody has a high affinity to its antigen.

2. Evaluation of toxin-neutralizing activity at the cell level The two selected monoclonal antibodies against protective antigen were serially diluted and analyzed for anthrax toxin-neutralizing activity using a mouse macrophage cell line, J774A.1. Each antibody was serially diluted, reacted with anthrax toxin at 4°C for 30 min, and applied to the cell line. For standard measurement, protective antigen (Cat. No. 171) and lethal factor (Cat. No. 172) were purchased from List Biological Laboratories, USA, and used in this test. A neutralization assay for anthrax toxin was carried out according to the same method as in Example <2-2>. As a result, the monoclonal antibodies were found to protect cells against anthrax toxin by inhibiting the action of the toxin in a dose-dependent manner.

When cells were exposed to 200 μg/ml of protective antigen and 100 μg/ml of lethal factor, the concentrations of the antibodies that protect 50% of the cells, IQo, were calculated. The 4F3E1 antibody displayed an IC ₅₀ of 1.24 μg/ml, and the 4F9A5 antibody showed an IQo of 1.39 μg/ml. The 4F3E1 antibody exhibited very high neutralization activity, so that about 1.87 antibody molecules per protective antigen molecule yielded 50% inhibition of

toxin action (Fig.4).

When cells were exposed to 400 μg/ml of protective antigen and 200 μg/ml of lethal factor, the concentrations of the antibodies that protect 50% of the cells, IC50, were calculated. The 5B13B1 antibody displayed an IC ₅₀ of 0.212 μg/ml, and the 3C16C3 antibody showed an IC50 of 0.604 μg/ml. The 5Bl 3Bl antibody was found to have potent neutralizing activity because about 0.64 antibody molecules per lethal factor molecule resulted in 50% inhibition of toxin action.

Based on the above results, cell viability was examined according to the administration time of the antibodies. The time point at which toxin was administered was designated "0", and each antibody was applied to cells attime points of -60, -30, 0, 5, 15, 30, 60 and 120 min. When an antibody was administered in an amount of four times IC5 ₀ , it displayed about 80% neutralization activity when administered at -60, -30, 0 and 5 min and about 60% neutralization activity when administered at 15 min, based on the time of toxin administration. These results, in which the antibodies effectively neutralized anthrax toxin after as well as before exposure to the toxin, indicate that these antibodies are useful as therapeutic and preventive agents for anthrax toxin (Fig.5).

The 5B 13B 1 antibody was evaluated for in vivo toxin-neutralizing activity using an in vivo neutralization assay using Fisher 344 rats. 80 μg of protective antigen and 40 μg of lethal factor, which cause the death of rats within 100 min, were dissolved in 200 μl of phosphate buffer and injected into the tail vein of rats. 42.2 μg of the 5B 13B 1 antibody was pre-incubated with the toxin antigens (PA and LF) and injected into rats. The amount of the antibody used was determined based on a concentration that protected 100% of cells in the toxin-neutralizing assay using the murine macrophage cell line.

A control group was administered with the toxin alone, an antibody control group with the antibody alone, and a test group with both the toxin and the antibody. Each group consisted of six rats. The six rats in the antibody control group and the test group all survived for a period of 3 days. In contrast, toxin control rats were all killed within 100 min,

with an average time to death of 68122 min. These results indicate that the present antibodies are capable of effectively neutralizing anthrax toxin in vivo.

4. Evaluation of toxin-neutralizing activity of the monoclonal antibodies after infection with Bacillus anthracis In order to determine whether the antibodies have a tiierapeutic effect after infection with B. anthracis, an in vivo neutralization assay against anthrax toxin was performed. After the anthrax toxin was injected into rats, the 5Bl 3Bl antibody was injected into the rats. 80 μg of protective antigen and 40 μg of lethal factor were dissolved in 200 μl of phosphate buffer and injected into the tail vein of rats. After 5, 15 and 30 min, 42.2 μg of the 5B 13B 1 antibody were injected into the rats through the tail vein, and the rats were monitored for survival for a period of three days.

All four rats in a toxin control group died an average of 52 min after the toxin challenge. All four rats survived for the test period when receiving the antibody 5 min after the toxin challenge. When the antibody was administered to rats 15 min after the toxin challenge, 50% of the rats survived, and the average time to death was 314 min. All rats that received the antibody 30 min after exposure to the toxin died, and the time to death, which was an average of 55 min, was similar to that of the toxin control group

5. Evaluation of in vivo toxin-neutralizing activity using rats The 4F3E1 antibody was evaluated for in vivo toxin-neutralizing activity using an in vivo neutralization assay using Fisher 344 rats. 20 μg of protective antigen and 10 μg of lethal factor, which lead to the death of rats within 100 min, were dissolved in 200 μl of phosphate buffer and injected into the tail vein of rats. The 4F3E1 antibody was administered in a maximum of 200 μg and lower concentrations. A control group was administered with only toxins, and an antibody control group with toxins and an unrelated antibody. Each group consisted of six rats. The six rats in the

antibody control group all survived for 24 hrs, but the toxin control rats were all killed within 100 min. When the toxin was administered to rats along with a minimum of 40 μg of Hie 4F3E1 antibody, all six rats survived. These results indicate that the present antibodies are able to effectively neutralize anthrax toxin in vivo (Fig.6).

EXAMPLE 4: Identification of the neutralization mechanism of the novel monoclonal antibodies 4F3E1 and 4F9A5

1. Identification of the neutralization mechanism of the monoclonal antibodies To identify the neutralization mechanism of the antibody, the 4F3E1 and 4F9A5 antibodies were evaluated for whether they inhibit binding between protective antigen and cells. The purified protective antigen was coupled to biotin to yield biotin-PA. 1 mg/ml of each of 4F3E1, 4F9A5 and anti-GST monoclonal antibodies was mixed with 112 μg/ml of biotin-PA, and applied to CHO-Kl cells (grown on a 24-well plate) pre-chilled to 4 ⁰ C. The plate was then incubated at 4°C for 12 hrs. The cells were washed with PBS three times, and collected. The collected cells were dissolved in sample buffer and electrophoresed on a 10% SDS-PAGE gel. Separated proteins were transferred onto a nitrocellulose membrane, and analyzed using Western blotting to detect the binding of protective antigen to cells. The blot was reacted with streptavidin-HRP and developed using West Femto substrate (Pierce).

As shown in panel A of Fig. 7, when cells were treated with only biotin-PA or with anti- GST antibody, the protective antigen bound to cells was detected. In contrast, such detection was not observed in the treatment of the 4F3E1 or 4F9A5 antibody. These results indicate that the present antibodies neutralize the action of anthrax toxin by inhibiting the binding between protective antigen and cells. ' These results were confirmed through ELISA (Fig. 7, panel B). Biotin-PA was incubated with increasing concentrarions of 4F3E1 antibody and added to CHO-Kl cells. After washing and fixation, the protective antigen bound to cells was detected by cell ELISA using sterptavidin-HRP. As shown in panel B of Fig. 7, 4F3E1 inhibited the binding of PA to cell in a dose-dependent manner.

2. Determination of the epitope recognized by 4F3E1 antibody

To determine the epitope recognized by 4F3E1 antibody precisely, epitope-extraction and epitope-excision method were used (Macht et al., 2004 analytical and Bioanalytical Chemistry 378:1102-1111). For the epitope extraction, 4F3E1 antibody coupled CNBr-activated sepharose 4

(Amersham biosciences) resin was prepared according to the manufacturer's instruction. Twenty-five microgram of purified PA was treated with 1 μg of endoproteinase Lys-C, GIu ¹ C, or trypsin (TPCK-treated, Sigma), respectively. The coupled resin was incubated with PA pretreated with proteinases at 4°C for overnight The mixture was loaded onto a small spin- column (Pierce) and the matrix was washed with PBS. After extensive washing with PBS, retained peptides were eluted by 0.1% trifluoroacetic acid. Eluted peptides were analyzed with MALDI-MS with a Voyager-DE STR instrument (Applied Biosystems). Analysis was performed in the reflector mode with an accelerating voltage of 20 kV, a grid voltage of 72%, and a delay time of 150 ns. For the epitope excision, 25 μg of PA was applied to the antibody- immobilized column and on-column cleavage was done by the addition of 1 μg of each enzyme and incubation for 2 h at 37°C. After extensive washing with PBS, retained peptides were analyzed by the same method. "FindPept tool" program (http://www.expasy.ch/cgi- bin/findpeptpl) was used to find the peptides exist in PAc and matched with the mass data. Difference in mass between predicted mass and detected mass were less than 1 dalton for all peaks. In the epitope extraction and excision experiments using Lys-C only the peptide fragment encompassing 670-680 amino acid was identified as an epitope and in the experiment using GIu-C peptide fragments within 670-704 of PA were mainly detected. And peptide fragments corresponding to the 643-657, 677-695, and 676-691 were detected in the epitope fraction when trypsin was used for digestion (Fig. 2a). Collectively, the epitope recognized by 4F3E1 might be located at the region near 670-704 of PA which include small loop within PAc previously suggested as a receptor binding motif

679KKYNDKLPLYISNPN693 (Varughese et al., 1999 Infection and Immunity 67: 1860- 1865; Santellietal., 2004 Nature 430: 905-908.).

To confirm the epitope region, deletion mutant of PAc was constructed from pBSl-1-PA by PCR. Two PCR reactions were performed using two pairs of PCR primers, represented by SEQIDNOS22and23, or24and25.

5'-primer: 5'-ATTGGATCC TTTCATTATG ATAGAAATAA-3' _(SEQ ID No.22)

3'-primer: 5'- AGCATATACATITACCrTAAATGTTTTTCCATCTTGC-S' (SEQ ID No.23)

5'-primer: 5'- GATGGAAAAACATTTAAGGTAAATGTATATGCTθ' (SEQ

ID No.24)

3'-primer: 5'- ATγCTCGAGTTATCCTATCTCATAGCCγI I i 1-3' (SEQ ID

No.25)

And then the resulting two PCR products were combined by recombinant PCR using the pairs of PCR primers, represented by SEQ ID NOS 22 and 24. The final PCR product was digested with BamHI and Xhol and was subcloned into the BamHI-XhoI site of the pGEX4T-l vector (Thvitrogen). GST-PAc was constructed in a similar manner using the the pairs of PCR primers, represented by SEQ ID NOS 22 and 24. The resulting GST- PAcδ676- 694 and GST-PAc were expressed in E. coli and the lysates were subjected slot-blot analysis. Briefly, the lysates were absorbed onto a nitrocellulose membrane. After blocking, the membrane was incubated with anti-GST mAb, anti-PA mouse polyserum, or 4F3E1, followed by HRP-coηjugated goat-anti-mouse IgG antibody, and the protein bands were detected by chemiluminescence kit 4F3E1 did not bind to PAcδ676-694, whereas anti-GST mAb and anti-PA mouse polyserum recognized Hie PAcδ676-694 (Fig. 8b). It strongly

suggests that the niAb binds to the receptor binding region of PA, and thus neutralizes Hie LeTx by interrupting the binding of PA to the receptor.

EXAMPLE 5: Identification of the neutralization mechanism of the novel 5B13B1 monoclonal antibody

To identify the neutralization mechanism of the antibody, the 5B13B1 antibody was evaluated for whether it inhibited the binding of protective antigen and lethal factor. Trysin was reacted with tiie purified protective antigen at a ratio of 1:1000 at room temperature for 20 min, and the reaction was terminated by the addition of soybean trypsin inhibitor. The activated [PA63] ₇ was purified through Mono Q anion-exchange chromatography (Pharmarcia). The purified βPA63J7 was dialyzed in 20 mM Tris (pH 8.0),

and 2 μg of the purified [PA63] ₇ was then reacted with 4 μg of lethal factor at room

temperature for 1 hr. The 5B13B1 antibody or an irrelevant antibody (anti-angiopoietin 2) was added to the reaction solution in an amount equal to the amount of lethal factor. The resulting reaction mixture was electrophoresed on a 4-15% native gel.

When the reaction proceeded in the presence of all of the 5B13B1 antibody, the lethal factor (LF) and the protective antigen (PA), the three components together formed tertiary complexes having a high molecular weight. In contrast, when an irrelevant antibody was used, the normal PA-LF complexes were formed. These results indicate that the neutralization mechanism of Ihe present antibodies does not involve directly inhibiting the binding of PA and LF. A previously reported LF-neutralizing antibody, LF8, was tested according to the same method. As a result, the LF8 antibody was found to interrupt the formation of lethal toxin by inhibiting the binding of PA and LF (Fig. 11). That is, the LF8 antibody inhibits the binding of PA and LF by binding near the PA-binding domain of LF. Ih contrast, since the 5B13B1 antibody binds to a region other than the PA-

binding domain of LF, it has the ability to bind to both LF and lethal toxin. Thus, the neutralization mechanisms of the two antibodies were considered distinctly different

Deletion mutants of lethal factor (LF) were constructed through slot-blot analysis so as to identify a domain of an antigen, to which the present antibodies bind. To determine the epitope recognized by the LF-neutralizing antibodies, six deletion mutants (Ll, L2, L3, L4, L5, and L6) of LF were constructed from pBSl-1 LF by PCR The Ll, L2 and L3 mutants were synthesized using 1-3F as a 5' primer and IR, 2R and 3R ₅ respectively, as 3' primers. The L4 mutant was synthesized using 4F as a 5' primer and 4R as a 3' primer. To construct the L5 mutant, two PCR reactions were carried out using the 5' primer 1-3F and the 3' primer 5R, and the 5' primer 5F and the 3' primer 2R, and the two PCR products were subjected to recombinant PCR using the 5' primer 1-3F and the 3' primer 2R. To construct the L6 mutant, two PCR reactions were carried out using the 5' primer 1-3F and the 3' primer 6R, and the 5' primer 6F and the 3' primer 4R, and the two PCR products were subjected to recombinant PCR using the 5' primer 1-3F and the 3' primer 4R. The final PCR products were digested with BamHI and Xbal and subcloned into the BamHI-Xbal sites of a pBS 1-2 expression vector (Aprogen, Korea). •

The resulting six deletion mutants of LF were expressed in E. cott HB2151 and purified by affinity chromatography using an Apl-conjugated Sepharose column. After the size and other features of each purified protein were confinned using Western blot analysis,

the same amounts of the LF proteins were subjected to slot-blot analysis. 1 μg of the

native LF or each of the mutant LF proteins was absorbed onto a nitrocellulose membrane. After being blocked with 2% BSA, the membrane was incubated with 5B13B1, 3C16B or ApI and then with HRP-conjugated goat anti-mouse IgG (Fc-specific) antibody. Protein bands were detected by chemiluminescence using an ECL kit (Intron, Korea). The present antibodies were found to bind to mutants containing the III of LF, among the Ll to L4 mutants. Two additional mutants, L5 (domain I plus domain IE) and L6 (full LF minus domain IH), were constructed and subjected to slot blot analysis. The

antibody reactivity was observed in L5, but not in 16. These results indicate that the epitope recognized by the present antibodies is on the domain IH of LF.

For fine epitope mapping, four peptides from the domain HI were synthesized and conjugated to KLH. The sequences of the peptides were as follows.

(SEQIDNo.37)

R3: Ac-SDFLSTEEKEFLKKLQIDIC (SEQ ID No.38) R4: Ac-DSLSEEEKELLNRIQVDSC (SEQ ID No.39) R5: Ac-NPLSEKEKEFLKKLKLDIC (SEQ ID No.40)

The binding of the monoclonal antibodies to each peptide was determined by J indirect ELISA using 200 ngofthepeptide-KLH conjugate as a coating antigen. A peptide

(SEQ ID No.41) derived from the F protein of respiratory syncytial virus (RSV) was used as a control. As a result, the present antibodies displayed very strong binding affinity to the amino acid sequence of the R4 peptide. These results were consistent with the results of competitive inhibition. For competitive inhibition, the antibodies were reacted with increasing concentrations of R4 and R5, and analyzed by ELISA using LF as a coating antigen. As a result, only R4 was found to competitively inhibit the binding of the antibodies to LF, indicating that the R4 repeat sequence is the epitope recognized by the present antibodies.

EXAMPLE 6: Evaluation of synergistic effect of the combination of the protective antigen (PA)-neutralizing antibody and a lethal factor (LF)-neutralizing antibody

1. Evaluation of synergistic effect of the combination of the PA-neutralizing antibody and an LF-neutralizing antibody at the cell level

The PA-binding toxin-neutralizing antibody, 4F3E1, was evaluated for a synergistic effect on toxin-neutralizing activity when administered in combination with a previously developed

LF-binding toxin-neutralizing antibody, 5B13B1. The PA-binding monoclonal antibody and the LF-binding monoclonal antibody were mixed at various ratios, and the resulting antibody mixtures were assessed for toxin-neutralizing activity (Table 2). To present the actual effects of the antibody mixtures, I values were calculated using the isobole method according to the following Equation 1 :

[Equation 1]

AcIAe +BcZBe=I

wherein Ac and Bc indicate the concentrations of A and B antibodies when used in combination at IC50 concentrations, and Ae and Be indicate IC50 values of A and B antibodies when used alone.

The combination of the two antibodies exhibited a synergistic effect at all ratios of this test, indicating that the toxin-neutralizing activity of the PA-binding monoclonal antibody actually enhanced the toxin-neutralizing activity of the LF-binding antibody. In particular, the 1:2 combination of the PA-binding antibody and the LF-binding antibody displayed the lowest I value and thus most enhanced the neutralization effect Also, this combination had the lowest IC50 value (Table 2). These results indicate that the combination of the PA-binding antibody, developed in the present invention, and the conventionally developed LF-binding antibody is very effective in neutralizing anthrax toxin.

TABLE 2

Toxin-neutralizing activity of the combination of PA-binding antibody and the LF- binding antibody

mAb IC ₅₀ PI PI f group (μg/ml) (5B13Bl) ^a (4E3El) ^b

5B13B1 Oϊ3 • NA ^" NA NA ^~ only

4F3E1 1.26 NA NA NA only

1.08 12.06 1.18 0.93

5B13B1

+4F3E1

' (1:100)

0.35 4.07 4.00 0.50

5B13B1

+4F3E1

(1:10)

0.17 1.50 14.65 0.73

5B13B1

+4F3E1

(1:1)

0.07 2.64 51.56 0.40

5B13B1

+4F3E1

(2:1)

0.12 1.21 118.44 0.83

5B13B1

+4F3E1

(10:1)

^PI : Potentiation Index

⁰ I : Synergistic index calculated by Isobole method

NA : Not applicable

The data are from one experiment representative of three independent repetitions.

2. Evaluation of the enhanced effect of the PA-neutralizing antibody in combination with LA-neutralizing antibody

The PA-binding antibody, 4F3E1, and me LF-binding antibody, 5B13B1, were mixed at ratios considered to effectively neutralize the toxin, and evaluated for anthrax toxin- neutralizing activity in rats. As shown in Table 3, an in vivo test using rats revealed that the

PA-binding 4F3E1 antibody has an enhanced neutralization effect when used in combination with the 5B13B1 antibody.

TABLE 3

In vivo toxin-neutralizing activity of the combination of PA-binding antibody and Hie LF-binding antibody

EXAMPLE 6: Analysis of amino acid sequences and nucleotide sequences of heavy chain and light chain variable regions of the monoclonal antibodies

1. Analysis of nucleotide sequences of heavy chain and light chain variable regions of the antibodies

To determine nucleotide sequences of heavy chain and light chain variable regions of the antibodies, total KNA was isolated from mouse hybridomas expressing the 4F3E1 and 4F9A5 antibodies using an RNA extraction kit. The isolated total RNA was reverse transcribed by RT-PCR to synthesize cDNA. Using the synthesized cDNA, PCR was carried out with primers for amplifying the heavy chain variable region, DGH3 (5'- ATATGTCGACGAGGTGGAGCTGCAGGAGTCAGGACCTAGCCTGGTG: SEQ ID No. 26), DGH3B (5'-ATATGTCGACAGGTSMAACTGCAGSAGTCWGG: SEQ ID No. 27), DGH3D (5'-ATATGTCGACAGGTSCAGCTGCAGSAGTCWGG: SEQ ID No. 28), and CrI (5'-CGGTCGACAGGGATCCAGAGTTCCAGGTCAC: SEQ ID NO. 29); and primers for amplifying the light chain variable region, MKl-I (5'- CAGCATGTGGCCCAGGCGGCCGAYATTGTGMTSACMCARWCTMCA: SEQ ID No. 30), and MuCk (5'-GCAGTCGACTGAGGCACCTCCAGATGTTAAC: SEQ ID

No. 31). PCR conditions included 30 cycles of 1 min at 94°C, 30 sec at 6O ⁰ C and 1 min at

72°C. As a result, a 480-bp DNA fragment, which was the heavy chain variable region, and a 410-bp DNA fragment, which was the light chain variable region, were amplified.

Each DNA fragment was cloned into a pGEM-T Easy vector (Promega), and subjected to DNA sequencing analysis to determine the DNA sequences of the heavy chain and light chain variable regions.

2. Determination of CDR regions of the heavy chain and light chain variable regions The CDR regions of the heavy chain and light chain variable regions were determined using a method available from an Internet site, http://www.bioinf.org.uk/abs/seqtest.htmL and an antibody sequence was tested against the

Kabat sequence database. CDR regions were underlined (Fig. 10).