Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
ANTI-REFLECTION FILM, METHOD OF PRODUCING THE SAME, POLARIZING PLATE, LIQUID CRYSTAL DISPLAY
Document Type and Number:
WIPO Patent Application WO/2006/014002
Kind Code:
A1
Abstract:
An anti-reflection film is provided and has a transparent support and a low refractive index layer having a lower refractive index than that of the transparent support. The transparent support is produced by casting and drying a dope containing a polymer and a solvent over a belt-shaped support, in which the dope is stretched under conditions: (a) a maximum stress of the dope in a casting crosswise direction is from 1 MPa to 200 MPa; and (b) a ratio (Sy/Sx) of a stress Sy in the casting crosswise direction to a stress Sx in a dope conveying direction perpendicular to the casting crosswise direction is from 2 to not 50 during the drying.

Inventors:
Nakamura, Kazuhiro
Application Number:
PCT/JP2005/014492
Publication Date:
February 09, 2006
Filing Date:
August 02, 2005
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
FUJIFILM Corporation (26-30, Nishiazabu 2-chome Minato-ku, Tokyo 31, 10600, JP)
Nakamura, Kazuhiro
International Classes:
B29C41/26; B29C55/12; B32B7/02; G02B1/10; G02B5/30; G02F1/1335; B29L11/00; B29C41/00; B29C55/12; B32B7/02; G02B1/10; G02B5/30; G02F1/13
Attorney, Agent or Firm:
Oguri, Shohei (Eikoh Patent Office, 7-13 Nishi-Shimbashi 1-chom, Minato-ku Tokyo 03, 10500, JP)
Download PDF:
Claims:
CLAIMS
1. A polypeptide comprising at least one repeat unit with the sequence V E T E D T K E P G V L M G G.Q S E S V E F T K D T Q T G M S G <T P Q Q T ( (A S Q said sequence imparting fibronectin binding activity to the polypeptide; or a variant of the said sequence in which charged amino acids are similarly concentrated in two domains, each domain having at least two negatively charged amino acids and at least one positively charged amino acid in a substantially continous periodicity within the repeat unit thereby imparting fibronectin binding activity to the polypeptide; the polypeptide being of less than 40 kD, preferably less than 30 kD.
2. A polypeptide according to claim 1, in which each domain of said variant comprises 3 or 4 negatively charge amino acids and 1 positively charged amino acid.
3. A polypeptide according to claim 1 or claim 2, in which the variant has at least 75% homology to the sai sequence.
4. A polypeptide according to any one of the pre¬ ceding claims, in which the variant has a number of amino acid residues in the range of 35 to 40, preferably 37. 5.
5. A polypeptide according to any one of the prece ding claims, which has at least 2, preferably 3, complete contiguous repeat units, said periodicity being maintaine between the contiguous repeat units.
6. A polypeptide according to any one of the prece ding claims, which further comprises a partial copy of th repeat unit contiguous to a complete repeat unit.
7. A polypeptide according to any one of the prece¬ ding claims, which contains less than 500, preferably less than 300, amino acids.
8. A polypeptide according to any preceding claim comprising a hyperexpressed fusion protein of said at least ..one .repeat unit and an heterologous polypeptide.
9. A polypeptide according to claim 8 wherein the heterologous polypeptide comprises an ms2 polymerase fragment.
10. A vaccine composition which comprises an anti¬ genic amount of a polypeptide as defined in any one of the preceding claims and a pharmaceutically acceptable dilu¬ ent, carrier, excipient or adjuvant therefor.
11. A live vaccine which comprises a non pathogenic organism which expresses an antigenic amount of a poly¬ peptide as defined in any one of claims 19, the organism expressing said polypeptide upon administration to a mam¬ mal.
12. A nucleic acid molecule, which codes for a po lypeptide as defined in any one of claims 1 to 9.
13. A nucleic acid molecule according to claim 12, the sequence of which includes at least one of the fol¬ lowing sequences a) to c) defined in Figure 2: a) 154 264; b) 265 375 c) 376 486; ; or d) degenerate variant(s) of a, b and/or c, resul¬ ting in a polypeptide of at least similar fibronectin binding capacity or antigenicity.
14. A probe comprising a nucleic acid molecule as defined in claim 12 or claim 13 and a detectable marker attached thereto:.
15. A probe according to claim 14 in which the de¬ tectable marker comprises a radioactive element, a radio opaque marker, such as a noble metal or biotin, or an enzymic marker.
16. An expression vector comprising a nucleic acid molecule as defined in claim 12 or claim 13 in operating relationship with a promotor.
17. An expression vector according to claim 16 desig nated pSTXl and deposited with DSM under accession No. DS*& 7161.
18. A host cell comprising the expression vector of claim 16 or 17.
19. Use of a nucleic acid molecule as defined in claim 12 or claim 13 a) as a probe b) to express an antigen or c) to express a polypeptide with fibronogen binding activity.
20. A method for the treatment or prophylaxis of streptococcal diseases in a mammal, the method comprising administering an effective amount of the vaccine composi¬ tion of claim 10 or the live vaccine of claim 11 to a mammal afflicted with or susceptible to streptococcal infection.
Description:
NEW POLYPEPTIDE

TECHNICAL FIELD:

This invention relates to the field of streptococcal fibronectin binding proteins and their corresponding genes. In particular it relates to a novel repeat unit within the protein having fibronectin binding activity and to the use of this repeat unit or the corresponding nu¬ cleic acid in the production of streptococcal proteins, vaccines and diagnostic reagents. BACKGROUND ART:

Streptococcus is a group of Gram positive bacteria some of which are pathogenic to mammals. Streptococcus pyogenes is a common cause of pyogenic infections in man, some of which may result in serious sequellae such as rheumatic fever and acute glomerulonephritis. Adherence, colonization and invasion of mucosal surfaces are prere¬ quisites of streptococcal infections. Fibronectin, a gly¬ coprotein present in soluble form in plasma and various body fluids and in insoluble form in the extracellular matrix and basement membrane, has the ability to bind to both streptococci and host cells, and is considered to be an important mediator of streptococcal adherence. The na¬ ture of the cognate streptococcal component involved in fibronectin binding has been a controversial topic for some time. Although the fibronectin receptor of Staphylo- coccus aureus has been identified as a protein, its gene cloned and expressed in E.coli (Flock et al. , 1987, ΞMBO J. 6:2351-2357) and sequenced (Signas et al., 1989, Proc. Natl.Acad.Sci., USA, 8_6:699-703), the nature of the fib- ronectin-binding component (fbc) of streptococci is con¬ tentious. Beachey and Simpson (1982 Infection 10:107-110) have proposed a model of S. yogenes adherence to host cells involving the binding of fibronectin to lipoteichoic acids on the bacterial surface, and Courtney et al. (1986 Infect.Immun. 53_:454-459) have reported the binding of streptococcal lipoteichoic acid to fatty-acid-binding

sites of fibronectin. On the other hand, Speziale et al. (1984 J.Bacteriol. 157:420-427) and Chhatwal and Blobel (1987 Comp.Iπunun.Microbiol.Inf.Dis. , 10:98-108) reported that the fbc component of streptococci was sensitive to proteolytic digestion and did not interact with antibodies to lipoteichoic acid.

Earlier work of the present inventors (Talay et al., (1991) Mol. Microbiol. 5_ (7) 1727-1734) implicated a streptococcal protein in the binding of fibronectin al- though the structure of the responsible protein(s) was not characterized and precise interaction between fibronectin and the protein was not identified. The earlier work also suggested that a complex series of specific proteins show¬ ing strain dependant variation were responsible for media- ting fibronectin binding.

GENERAL DISCLOSURE OF THE INVENTION: The present invention is predicated on the finding that it is a small, easily manipulable repeat unit struc¬ ture which is responsible for fibronectin binding. The short repeat units can be configured in various permuta¬ tions of contiguous gene or polypeptide segments to pro¬ duce probes, vaccines and antigens. Furthermore it appears that the short repeat unit exhibits cross hybridization wiτh other pathogenic streptococcal strains pointing to its utility as a multivalent vaccine or diagnostic reag¬ ent.

Thus, in accordance with a first aspect of the in¬ vention there is provided a polypeptide comprising at least one repeat unit with the sequence

V E T E D T K E P G V L M G G Q S E S V E F T K D T Q T G M S G

(T P Q Q T ( (A S Q

said sequence imparting fibronectin binding activity to the polypeptide; or a variant of the said sequence in which charged amino acids are similarly concentrated in two domains, each domain having at least two negatively charged amino acids and at least one positively charged amino acid in a substantially continous periodicity within the repeat unit thereby imparting fibronectin binding activity to the polypeptide; the polypeptide being of less than 40 kD. According to a preferable embodiment of the invention the polypeptide is of less than 30 kD, and according to even more preferable embodiments thereof the number of the amino acids referred to is less than 500, especially less than 300. It is envisaged that even smaller polypeptides, not much larger than one or two repeat units will also be use¬ ful, in particular in competition or swamping assays or vaccines. Smaller polypeptides have the advantage that they can be chemically synthesized and provide fewer op- portunities for indesirable immunoreactions.

Preferably, the domains referred to comprise 3 or 4 negatively charged amino acids and 1 positively charged amino acid. Variation in these numbers may, however, be tolerated in producing a repeat unit with the desired con- tinuous periodicity within the repeat unit and, prefer¬ ably, between contiguous repeat units when the polypeptide comprises more than one repeat unit. A convenient number of amino acids when the repeat unit is defined by a said variant is 35 to 40, preferably 37. Where the repeat unit is a variant of the said sequence it is desirable to have at least 75% homology with the sequence.

According to still another preferable embodiment of the invention the polypeptide claimed has at leas- 2 complete contiguous repeat units and preferably also at least one, and desirably only one, partial copy of said complete repeat unit(s) contiguous to a complete repeat

unit. An arrangement with 3 complete copies of the repeat unit and one further incomplete copy of the repeat unit has been found to be convenient for the present invention and therefore represents an especially preferable embodi- ment thereof.

It will, however, be appreciated that other permuta¬ tions of complete and optionally incomplete repeat units are also appropriate. For instance a probe may comprise a single repeat unit or a fibronectin binding polypeptide may include a stretch of 5 or more contiguous repeat units. Where multiple repeat units are used, contiguity between the repeat units and between complete and any in¬ complete repeat units is desirable to preserve the desired continuous periodicity. The polypeptides are conveniently substantially free of large amounts of other sequences from native strepto¬ coccal binding protein to assist in keeping the repeat unit easily manipulable. However, in some circumstances flanking streptococcal sequences may be useful. For in- stance a polypeptide intended for insertion into a live vaccine may utilize the native cell wall spanning and membrane anchor signal.

Although it is generally desirable to keep the size of the polypeptide relatively small, in some cases it is advantageous to express the polypeptide as a fusion pro¬ tein with a heterologous polypeptide. Such fusion proteins may include useful cellular signals to enhance hyperex- pression, transmembrane export or polypeptide stability. A useful suion protein with ms-2 polymerase results in hy- perexpression while maintaining fibronectin binding capa¬ city. An example of such a fusion protein is encoded by plasmid pSTXl deposited with DS. under accession No. DSM 7161 on July 9, 1992 in E.coli 537.

Polypeptides in accordance with the invention find utility as antigens in the production of immuno diagnostic reagents such as monoclonal antibodies for the rapid de¬ tection or processing of Streptococcus pyogenes and also

certain other pathogenic species, e.g. other Streptococcus species. In vaccine applications, the polypeptides, either synthetically fabricated or recombinantly derived, can be used to raise an immune response in susceptible indivi- duals. The antigen may be administered to such individuals in the form of a polypeptide composition in conjunction with the usual excipients, immunoadjuvents, carriers or diluents. Alternatively, a live vaccine expressing the an¬ tigen can be prepared, such as a salmonella Aro ~ strain or a recombinant varicella virus. Identification of the fib¬ ronectin binding interaction also allows the creation of competitive inhibition agents to swamp available receptors and/or signals to prevent pathogen adherence and infec¬ tion. Accordingly, a further aspect of the invention pro¬ vides a vaccine composition which comprises an antigenic amount of the polypeptide as defined above together with a pharmaceutically acceptable diluent, carrier, excipient or adjuvant therefore, or alternatively a live vaccine which comprises a non pathogenic organism, eukaryotic, bacterial or viral, that expresses an antigenic amount of said poly¬ peptide, the organism expressing the polypeptide upon ad¬ ministration to a mammal.

Furthermore, the invention provides a method for the treatment or prophylaxis of streptococcal diseases in a mammal, the method comprising administering an effective amount of the vaccine composition or live vaccine of the invention to a mammal afflicted with or susceptible to streptococcal infection. The invention also provides nucleic acid molecules corresponding to the repeat unit or to the polypeptide of the invention as defined above. The invention extends to degenerate variants resulting in an expressed polypeptide having similar or at least an equivalent fibronectin bind- ing capacity or antigenicity or alternatively variants able to bind to nucleic acid corresponding to the repeat unit at moderate stringencies. Segments of especially

preferable nucleic acid molecules will be referred to later on in connection with the figures.

In its nucleic acid aspects, the invention allows the recombinant derived production of polypeptides as antigens or for other fibronectin binding roles. Nucleic acids fal¬ ling within the invention also find utility as probes for streptococcal diagnosis and manipulation and in conjunc¬ tion with gene shears technology may also have a direct role in prophylaxis. The probes of the invention comprise the nucleic acid in conjunction with a detectable marker such as a radioactive element, a radio opaque marker such as gold or biotin or an enzyme marker.

Finally with reference to the one-letter symbols used in connection with the amino acid sequences referred to, they are the generally adopted symbols, viz.: One-letter Symbols A alanine C cysteine D aspartic acid E glutamic acid F phenylaianine G glycine H histidine I isoleucine K lysine L leucine M methionine N asparagine P proline Q glutamine R arginine S serine T threonine

V valine W tryptophan

Y tyrosine

EXPERIMENTAL PART OF THE DESCRIPTION:

The invention will now be illustrated by way of example only with reference to the following example and drawings in which the figures have the following legends:

Fig. 1: (A) Partial restriction map of the lambda insert containing the fibronectin binding protein gene of S. yogenes DSM strain 2071 and insert of the subclone pSTll. The transcriptional direction is indicated by an arrow. *BamHI site indicated in brackets is present only in pSTll.

(B) Cloning scheme for the construction of pSTXl and pSTX2 plasmids expressing fusion proteins with fibronectin binding activity.

Fig. 2: Nucleotide sequence and deduced amino acid se¬ quence of the region coding for the binding do- main of fibronectin binding protein from S.pyo¬ genes DSM 2071. Amino acids are given in the one letter code and the stop codon is marked by an asterisk (*). The four repeated regions were de¬ signated RI to R4 and the first amino acid (va- line) from each repeat is marked with an arrow.

The LPATG consensus sequence is indicated by a box and the potential transcription termination signal is underlined.

Fig. 3: Hopp and Woods hydrophobicity plot of the fib- ronectin-binding peptide of Fig. 2 ranging from amino acid 1 to 268. Hydrophilic regions are re¬ presented by peaks, the positions of charged ami- no acids are indicated by arrows.

Fig. 4: Alignment of the peptides representing the re¬ peats of the fibronectin-binding proteins from

S.aureus and S.pyogenes DSM 2071. The upper se¬ quence represents the D3 repeat of S.aureus, ranging from amino acid 8 to 38, the lower se¬ quence shows amino acid 1 to 30 of the S.pyogenes repeats. Homologous amino acids are connected by a colon.

Fig. 5: Comparison of the C-terminal amino acid sequences of streptococcal and staphylococcal surface pro- teins with the C-terminal amino acid sequence of the fibronectin binding protein of S. yogenes. S.pyogenes M6, S.pyogenes M49, S.pyogenes IgA binding protein, protein G from group G strepto¬ cocci, S.mutans wap A, S.aureus protein A, S.aureus fibronectin binding protein FnBP. The

LP.TG region is boxed.

Fig. 6: Coomassie blue stained SDS polyacrylamide gel (A) and western blot with fibronectin and anti-fibro- nectin antibodies (B) of lysate from E.coli har¬ bouring plasmid without insert (1 ), lysate with fibronectin binding fusion protein (2) and puri¬ fied fusion protein (3).

Fig. 7: Inhibition by fibronectin binding protein of fib¬ ronectin binding and epithelial cell adherence o S.pyogenes strain DSM 2071. In binding experi¬ ments, streptococci were incubated for 45 min with 125I-labelled fibronectin in presence of in- creasing amounts of purified fusion protein, af¬ ter which free fibronectin was removed and cell- bound fibronectin determined. For adherence, streptococci were incubated with HEp2 cells in presence of indicated amounts of fusion protein after which they were washed and adherent bacte¬ ria quantitated by fluoroscanning.

Fig. 8: Electrophoretic gel of the genomic libraries of various streptococcal and other species probed with a nucleic acid of the present invention.

EXAMPLE

Construction of a plasmid expressing a fibronectin binding polypeptide. A plasmid, pSTII, was constructed which expressed a fibronectin binding protein of the type strain Strepto¬ coccus pyogenes DSM 2071. Details of the construction may be found in Talay et al., Mol.Microbiol. (1991) 5_ (7) 1727-1734, but, in brief, total DNA of the streptococcus was partially digested with Sau3A and the fragments size fractionated on a NaCl gradient. Fractions containing fragments of 8-20 kb in length were pooled, ligated to the lambda vector XEMBL3 at a molar ratio of 3:1 and plated onto E.coli P2392. Immunoscreening of plaque lifts with fibronectin and antifibronectin antibodies was used to detect fibronectin positive clones. A stable plaque with an insert corresponding to 13.8 kb was selected and excis¬ ed from the vector by Sail digestion. E.coli expression vector pJLA601 was used for subcloning as it contains a single Sail site in the polylinker region downstream from the temperature-inducible λ P and P. promoters. Insertion of the λ insert as a Sail fragment into this vector crea¬ ted the fibronectin binding protein expression plasmid pSTl; colonies containing the plasmid are readily detected immunologically by the colony blot procedure. Deletion of the left-hand 4.2 kb Sall/Eco RI fragment created pST2 which still expressed fibronectin binding activity. To express a smaller part of the protein which still binds fibronectin, the insert DNA of pST2 was partially digested with Sau3A and cloned into the polylinker region of pJLA601. Two clones out of 300 bound fibronectin after heat induction and one of the pSTll clones was found to

contain 2.3 kb of streptococcal DNA, including the fibro¬ nectin binding determinant.

Identification and isolation of the fibronectin binding determinant.

Deletion analysis of pSTll suggested that the fib¬ ronectin binding activity was encoded by a lkb BamHI/- Hindlll fragment. A BamHI/Xbal fragment of plasmid pSTll comprising the relevant BamHI/Hind III fragment and an additional 300 bp of streptococcal DNA was cloned into the A, B and C frames of pEx31, the E.coli expression vector constructed by Strebel et al. (1986) J.Virol. 5_7: 983-991; as follows. Plasmid DNA of pSTll and DNA of pEx31 A, B and C (representing all reading frames in the polylinker regi- on) were digested with BamHI/Xbal. The resulting fragments were separated on agarose gels and the 3.3 kb fragment of pEx31 and the 1.4 kb fibronectin-binding domain encoding fragment of pSTll were isolated using a DNA extraction kit (Quiaex, Diagen, Hilden, Germany), ligated together and transformed into competent cells of E.coli 537 (harbouring plasmid pcI857 encoding kanamycin resisance and the tempe¬ rature sensitive cl represεor of bacteriophage lambda and obtained from W. Schalles - see Strebel et al., supra). After growth at 28°C the colonies were incubated at 42°C for 2 h and tested for expression of fusion proteins. Fu¬ sion protein-expressing plasmid pSTXl was isolated, diges¬ ted with Hindlll and religated to eliminate the 400 bp in¬ ternal Hindlll fragment to produce pSTX2.

In other words, this resulted in the BamHI/Xbal frag- ment of plasmid pSTll. being cloned into pEx31 A, B and C in an oriented fashion downstream of the inducible lambda promoter P L such that the C-terminal binding domain of th fibronectin binding protein was fused to the N-terminal part of MS2 polymerase in one of the three possible read- ing frames represented in the three vectors (Fig. 1). Af¬ ter temperature induction of the transformants (Jerlstrόm et al., 1991, Mol.Microbiol. 5: 843-849), clones expres-

sing fibronectin binding protein were isolated at high frequency from each reaction. Western blot analysis (per¬ formed as per Talay et al., 1991, supra) of lysates from positive clones showed that only insertion of the BamHI/- Xbal fragment into reading frame B resulted in expression of a fibronectin binding fusion protein (M 55 kD as a result of its fusion with the N-terminal fragment of MS2 polymerase); positive transformants from the two other experiments expressed only a 40 kD truncated non-fusion protein. The hybrid plasmid pSTXl thereby generated was further reduced in size by deletion of the 300 bp Hindlll/Hindlll fragment, creating plasmid pSTX2. Western blot analysis of E.coli 537 cells harbouring pSTX2 sugges that the sizes of fusion proteins expressed by pSTXl and pSTX2 are identical.

Restriction enzymes and T. ligase were purchased fro GIBCO/BRL (Germany) and used according to the manufactu¬ rers' instructions. Transformation of E.coli, isolation o plasmid DNA, agarose gel electrophoresis and other miscel laneous techniques were performed as per Sambrook et al., 1989, Molecular Cloning A Laboratorial Manual, Cold Sprin Harbour, Laboratory Press.

Sequence determination of the coding region of the fibro- nectin binding domain of fibronectin binding protein.

Both strands of the insert in pSTX2 were sequenced using the dideoxy chain-termination method (Sanger et al. 1977, Proc. atl.Acad.Sci. , USA, 74:4767-4771) in combina¬ tion with synthetic oligonucleotide primers (Cher & See- burg, 1985, DNA 4:165-170) homologous to vector DNA regi¬ ons 30 nucleotides up- and downstream of the inserted streptococcal DNA. Further oligonucleotide primers for se quencing within the streptococcal DNA region were designe on the basis of sequence information thereby obtained. A Sequenace sequencing kit (USB Cleveland, Ohio) was used according to the protocol of the manufacturers. Sequencin samples were analysed by polyacrylamide gel electrophore-

sis with 6% gels, 48% urea. Computer programs were used to record and analyse the sequence data.

Since the construct represents an active in frame fu¬ sion with MS2 polymerase the translational reading frame of the sequenced region (Fig. 2) was inferred from that of the polymerase. The sequence exhibits an open reading fra¬ me comprising 804 nucleotides that codes for a polypeptide of 268 amino acids and that terminates with a TAA stop co¬ don at nucleotide 805. 126 nucleotides downstream of the stop codon is located a region with the potential ability to form a hairpin structure characteristic of transcrip- tional terminators. One characteristic feature of the se¬ quence is the existence of a region starting at nucleotide 154 and being composed of 4 nearly identical repeat se- quences, designated R1-R4. Downstream of the region of re¬ peats follows a stretch of 40 amiήo acids exhibiting no special structural features which might constitute the cell-wall-spanning region of the protein. This stretch is followed by an LPATG consensus sequence. This sequence has been found in all surface proteins of gram-positive cocci characterized so far and is thought to be a signal sequen¬ ce for anchorage in the membrane. The LPATG sequence is followed by an hydrophobic region of 20 amino acids (Fig. 3) that probably forms the transmembrane segment of the protein and a stretch of 6 mainly basic amino acids at the C-terminus which is thought to be located at the cytoplas- mic side of the membrane (Fig. 2 and 3).

Analysis of the repeats. From the foregoing we propose that the repeats R1-R4, which represent more than 3/4 of the peptide region expec¬ ted to be exposed on the surface of S.pyogenes, constitute the fibronectin binding structures. It is unlikely that cell-wall and membrane associated regions are involved in binding of an external ligand. Moreover, the 51 amino acid peptide on the N-terminal side of the repeats is not" ex¬ pected to be involved in the binding of fibronectin be-

cause the out of reading frame cloning in pEx31 resulted in expression of truncated peptides that still expressed binding activity. These peptides lack the N-terminal 51 amino acids since there is an ATG codon just before the coding sequence of the first repeat and an "AGGA" motiv a few nucleotides upstream of the ATG, which might enable translational initiation at this locus.

R1-R3 consist of 37 amino acids each whereas the fourth repeat contains only 32 amino acids. The repeats are highly conserved with respect to their amino acid and nucleotide sequence: the only differences in the amino acid sequences are found in repeat R2 at positions 35 and 36 and the only differences in nucleic acid sequences are some 2-3 variations per repeat in the codon wobble posi- tions. Figure 3 promotes detailed information on the dis¬ tribution of hydrophilic and hydrophobic regions within the repeats. Each repeat exhibits two internal domains in which charged amino acids are concentrated; these domains are formed by three or four negatively and one positively charged amino acid. The alternation of charged and unchar¬ ged domains results in a continuous periodicity within one repeat that is maintained over the whole repeated region.

Lack of homology to M protein. M proteins have previously been implicated in strep¬ tococcal adherence. In order to know whether or not the present embodiment is an M or M-like protein or is related to one, we compared its C-terminal region with that of different M-like proteins (Fig. 5). The C-terminal region of M proteins is highly conserved with homologies between different M proteins ranging from 70% to 100% , whereas the protein of the present embodiment exhibits only 18% homology with M proteins in this region. Comparison of the present sequence with the two staphylococcal surface pro- teins FnBP and protein A revealed 22% and 14% homology.

Neither the nucleotide sequence of the LPATG region of the present embodiment shared common features of the M prote-

ins nor the sequence N-terminal from the LPATG region (da¬ ta not shown). Thus, the present embodiment is homologous with M protein only to the extent that is common to most of the characterized surface proteins of gram positive cocci. We therefore conclude that the present embodiment is not an M or M-like protein but represents a novel type of surface protein of group A streptococci.

Purification of fibronectin binding protein fusion pro- tein.

Cell fractionation of recombinant E.coli cells re¬ vealed that the fibronectin binding activity was equally distributed in cytoplasm and inclusion body fractions whereas membrane fractions possessed only weak activities. E.coli 537 harbouring the cell fractionation procedure was carried out as follows. Cells of an induced culture of E.coli 537 harbouring plasmid pSTX2 were harvested by centrifugation. The pellet was resuspended in lysis buffer containing 50 mM Tris-CHCl pH 8.0, 25% sucrose, 1 mM EDTA, 0.4% lysozyme and incubated for 30 min on ice. MgCl- was added to a final concentration of 10 mM. MnCl- to 1 mM, and DNasel to 10 μg/ml. After incubating the suspension en ice for 30 min, 2 vol of detergent mix I containing 20 mM Tris-HCl pH 7.5, 200 mM NaCl, 1% Sodiu -Deoxycholate, 1% Nonidet P-40, 2 mM EDTA were added and the lysate was in¬ cubated on ice for 5 min. After centrifugation for 15 min, the supernatant fluid containing the cyplasmic fraction was collected, and the pellet was suspended in 1/10 of th original culture volume of detergent mix II containing 0.05% Triton X-100, 1 mM EDTA. The pellet mizture was in¬ cubated on ice for 30 min and periodically vortexed. Afte centrifugation for 15 min, inclusion body (pellet) and membrane fractions (supernatant) were obtained. The inclu sion body fraction was then resuspended in 1/10 of the original culture volume of TE buffer and all fractions subjected to SDS-PAGE, followed by immunoblotting with fibronectin and anti-fibronectin antibodies.

The fusion protein of the present embodiment was pu¬ rified from the cytoplasmic fraction by FPLC mono Qion- exchange column as follows: Cells from 1 1 induced culture of E.coli 537 harbouring plasmid pSTX2 were harvested by centrifugation and resuspended in 10 ml phosphate buffered saline pH 7.5 (PBS). 10 mM iodoacetic acid and 10 mM ben- zamidine chloride were added to inhibit proteases and af¬ ter cooling the suspendsion to 4°C the cells were disrup¬ ted in a French press cell. The suspension was centrifuged and the particle-free supernatant was collected and equi¬ librated with 4 M urea in 20 mM Tris-HCl, pH 7.0. The fu¬ sion protein was then purified by FPLC using a Mono Qion- exchange column (HR 10x10, Pharmacia LKB, Uppsala, Swed¬ en), eluted by a linear salt gradient. Fractions under each peak were pooled and dialyzed against PBS before use in binding and adherence experiments. The peak containing active fusion protein was eluted at 0.3 M salt concen¬ tration. The fusion protein of the present embodiment gave two main bands on SDS-PAGE gels both of which reacted with fibronectin in western blots (Fig. 6). This protein was used in binding and adherence assays without any further purification.

Inhibition of fibronectin binding to S.pyogenes by fibro- nectin binding protein fusion protein. Binding experiments.

Cells of streptococcal cultures were harvested by centrifugation, washed twice with PBS and suspended in PBS containing 0.1% Tween 20 (PBST) to give 10% transmission at 600 nm (8,10). 200 μl of the cell suspension were added to 10 ng 125I-labelled fibronectin (specific activity 2.91 mCi/mg) which had been preincubated for five minutes with either 20μl quantities of increasing concentrations (0.05 to 2.5 mg total protein per ml) of lysate from E.coli har- bouring the present overexpressed fusion protein or 50μl quantities (2.5 to 100 μg/ml) of purified fusion protein.

The suspension containing streptocci, labelled fibronec-

tin, and lysate or purified fusion protein was further in¬ cubated for another 40 min at room temperature. Non-bound fibronectin was separated by centrifugation and the amount of cell-bound fibronectin was determined in a y-counter. In parallel, 25 μg of nonlabelled fibronectin and 50 μg (total protein) of lysate from bacteria harbouring pSTX2 without insert were used as positive and negative con¬ trols, respectively. Fibronectin binding of S.pyogenes was also studied in the presence of purified LTA (at 1 μM phosphorus per assay). The results were as follows:

Increasing concentrations of french press lysates containing fusion protein substantially inhibited the binding of 125I-labelled fibronectin to S.pyogenes (Tab.

1) . The 67% inhibition of binding by lysate at a concen- tration of 50 μg of total protein per assay was equivalent to the inhibition obtained by 25 ug of non-labelled fib¬ ronectin per assay. Purified fusion protein was about 10- fold more active in inhibition of fibronectin binding which corresponds to the degree of purification (Tab. 1, Fig. 7). In control experiments, lysates from bacteria containing plasmid without insert and LTA purified from S.pyogenes showed no significant inhibition of fibronectin binding (Tab. 1).

Table 1 Competitive inhibition of fibro¬ nectin binding and adherence to HEp2 cells of

S.pyogenes strain DSM 2071 by Sfb fusion protein

* Means % of Inhibition of

* Means were obtained from quadruplicate assays ** Total protein

Inhibition of adherence of S.pyogenes to HEp2 cells by fibronectin binding protein fusion protein

A human epithelial cell line (Hep2, ATCC strain CCL 23) was used to study effects of the fusion protein of the present embodiment on fibronectin-mediated adherence of streptococci to epithelial cells. Preliminary studies had shown that S.pyogenes adhered to these cells mainly through a fibronectin-mediated mechanism. Epithelial cells were grown in Dulbecco's modified Eagle medium (DME, GIBCO) containing 10% fetal calf serum (FCS, GIBCO), 5 mM glutamine (Flow Laboratories Inc., McLean, Va., USA), 1 mM pyruvate (Flow), 100 IU/ml penicillin, and 100 μg/ml of streptomycin (Flow) at 37°C in an atmosphere containing 8% C0_. For adherence assays, cells were harvested by tryp- sinization and seeded on 96 well microtiter plates (Nunc, Roskilde, Denmark) at a concentration of approximately 10° cells per well. The cells were grown to confluency and then used for adherence experiments.

A previously described fluorometric microassay (Valentin Wergard et al., 1988, Infect.Immun, 56:2851- 2855) was used to directly determine streptococcal adhe¬ rence to epithelial cells in the microtiter plates. Brief- ly, 100 μl samples of FITC-labelled streptococci contain- 7 ing 2.5x10 bacteria in HEPES-buffered DME were added to each well. After 45 min at 37°C non-adherent streptococci were removed by 3 washings with HEPES-buffered DME and adherent bacteria quantitated by fluoroscanning (Fluore- scan II Titertek, Flow). Controls contained buffer without streptococci. Each test was done in quadruplicate and re¬ sults expressed as means ±SD.

Inhibition experiments were done with crude particle- free supernatants of the french press extracts from E.coli cultures harbouring either the present fusion protein- expressing plasmid pSTX2 or plasmid without insert (con¬ trol) at concentrations of 1 to 50 μg of total protein per assay. Adherence was also studied in presence of FPLC pu¬ rified fusion protein of the present embodiment (0.125 to 5 μg per assay) and purified streptpcoccal LTA at similar concentrations as used in the binding assays.

Under our adherence assay conditions, approximately 15 bacteria of S.pyogenes strain DSM 2071 per well adhered to each HEp2 cell grown in 96 well microtiter plates. That this adherence is mediated by fibronectin was confirmed in preliminary experiments. Streptococcal adherence to HEp2 cells was competitively inhibited by up to 50% by lysates containing fusion protein, which correlated well with the ability of lysates to inhibit fibronectin binding (Tab. 1). Purified fusion protein also competitively inhibited adherence of S.pyogenes in a concentration dependant man¬ ner by up to 46%. As in binding experiments, the purified material was about 10-fold more effective than the crude lysate (Tab. 1, Fig. 7). Control preparations, i.e. lysate from bacteria containing plasmid without insert and puri¬ fied streptococcal LTA, reduced adherence by only 16% (Tab. 1).

Southern blot experiments.

Southern blot experiments were carried out in order to investigate whether probes in accordance with the pre¬ sent invention also show homology with corresponding por¬ tions of the genome of other streptococcal strains. A 1 kb BamHI/Hindlll fragment encoding the binding domain and the C-terminal part of the protein was labelled with dioxyge- nin-dUTP and used as probe against Hindlll digested strep¬ tococcal chromosome.

Table 2 shows the hybridization pattern of the dif¬ ferent chromosomal DNAs tested. Six out of nine S.pyogenes strains used in this experiment showed one strong hybri¬ dizing signal corresponding to fragments with a size of 5 kb and 1 kb, respectively. The only positively reacting strain of non-group A streptococci was S.equisimilis, known as the human pathogen of group C streptococci.

Signal Strains tested Signal

S. S.pyogems A$5

9. " A6

10. S. equi DSM 20561

11. S. άysgalacriae 5

12. S. equisimilis C85

13. S. s nguis DSM 20567

The invention has been illustrated with an example employing a fusion protein from Streptococcus pyogenes but it will be readily apparent that other polypeptides and nucleic acid molecules can be constructed with fewer than or more than 3 complete and 1 incomplete copy of the re¬ peat unit. The manipulation of gene segments from within the sequences herein dissolved can be achieved with stan¬ dard restriction endonuclease or shotgun techniques in conjunction with synthetic probe screening. Similarly, the production of variants of the repeat unit falling within the charge distribution criteria defined herein, either by point mutation of the nucleic acid or polypeptide or dur¬ ing synthetic construction, is well within the normal skill of those in the art. All such variants and permuta- tions fall within the spirit and scope of the invention.

On the basis of the present disclosure of the utility of the repeat unit and its activity in vitro the invention extends to the construction of polypeptide containing vaccines or live vaccines expressing the polypeptide antigenically.

Sequence List

D P R Y E F N N K D Q S P L A G E S G E 20

5' GATCCTCGTTATGAGTTTAACAATAAAGACCAATCACCTCTAGCGGGTGAGTCTGGTGAG 60

T E Y I T E V Y G N Q Q N P V D I D K K 40

ACGGAGTATATTACCGAAGTTTATGGAAATCAACAGAACCCTGTTGATATTGATAAA AAA 120

R]

L P N E T G F S G N M |_V) E " T E D T K E P 60

CTTCCG-^TGAAACAGGTTTTTCAGGAAATATGGTTGAGACAGAAGATACGAAAGAG CCA-- 180

G V L M G G Q S E S V E F T K D T Q T G 80

GG AGTGTTGATGGGAGGTCAAAGTG AGTCTGTTGAATTTACTAAAGACACTCAAACAGG C 240

M S G Q T T P Q [Vj E T Ξ D T K E P G V 100

ATGAGTGGTCAAACAACTCCTCAGGTTGAGACAGAAGACACGAAAGAGCCAGGAGTG CTG 300

M G G Q S E S V E F T K D T Q T G M S G 120

ATGGGAGGTCAAAGTGAGTCTGTTGAATTTACCAAAGATACTCAAACAGGCATGAGT GGT 360

. R3 .

Q T A S Q _VJ E T E D T K E P G V L M G G 140

CAAACAGCTTCTCAGGTTGAGACAGAAGATACGAAAGAGCCAGGAGTGCTGATGGGA GGC 420

Q S E S V E F T D T Q T G M S G Q T T 160

CAAAGTGAGTCTGTTGAATTTACTAAAGACACTCAAACAGGCATGAGTGGTCAAACA ACT 480 4

P Q Lyj E" T E D T K E P G V L M G G Q S E 180

CCTCAGGTTG AGACAG AAGACACG AAAGAGCCAGGAGTATTGATGGG AGGTCAAAGTG AA 540

S V E F T K D T Q T G H S G F S E T V T 200

TCTGTTGAATTTACTAAAGACACTCAAACAGGCATGAGCGGTTTCAGTGAAACAGTG ACC 600

I V Ξ D T R P K L V F H F D N N E P K V 220

ATTGTTG AAG ATACGCGTCCGAAGTTAGTGTTCCATTTTGACAATAATGAGCCCAAAGTG 660

N R Ξ K P T K N 240

GAAGAGAATCGGGAAAAGCCTACAAAAAATATAACACCTATCCTTCCTGCAAGAGGA GAT 720 l E N V A F L G I I L S V L P I F S 260

ATTGAGAATGTTTTGGCCTTTCTTGGAATCCTTATTTTGTCAGTACTTCCTATTTTT AGT 730 L X K Q T X Q * " 263

CTTTTAAAAAAACAAACAAAACAATAAAGTCTGATCGTAAAAGTGTTCCATAAGAAA TAA 340

TGCGCAAATATGCTGAATAGTGGATAACTGCTACAGTCAAGACAAGTGTTAATTCAA AAG 900

GTACTACTTATACATCTGATAATAATAAGGTGACAGATAATTCAGAGCAAGTAGGAT GGC 960

TAAAAAATGGTGTATTCTATGTATAATAGACTACATAGAAATCAAGTTATTGTTAAA CGT 1020

CGTAAAGCTT 3' 1030

INDICATIONS RELATING TO A DEPOSITED MICROORGANISM

(PCT Rule 13bis)

A. The indications made below relate to the microorganism referred to in the description on page 2 . line 31-35

B. mENππcATioN OF DEPOSIT Further deposits are identified on an additional sheet

Name of depositary institution

Deutsche Sammlung fϋr Mikroorganismen

Address of depositary institution (including postal code and country)

Macheroder Weg 1 B D-3300 Braunschweig Germany

Date of deposit Accession Number 09 July 1992 DSM 7161

C. ADDITIONAL INDICATIONS (leave blank if not applicable) This information is continued on an additional sheet

D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADE (if the indications are not for all designated States)

E. SEPARATE FURNISHING OF INDICATIONS (leave blank if not applicable)

The indications listed belowwill be submitted to the International Bureau later (specify the general ature of the indications e.g., 'Accessio Number of Deposit')

For receiving Office use only For International Bureau use only

I I This sheet was received with the international application I I This sheet was received by the International Bureau on

Authorized officer Authorized officer ly-«~? yillέn

Form PC17RO/134 (July 1992)




 
Previous Patent: Abstract:

Next Patent: Abstract: