Field of the Invention

The invention relates to antisense oligonucleotides (ASOs), especially for use in producing truncated proteins, particularly a truncated version of APOBIOO. The ASOs can be used in therapy, particularly in the treatment of high cholesterol and related conditions.

Background to the Invention

High circulating levels of cholesterol, and particularly low density lipoprotein (LDL) cholesterol, cause atherosclerosis. Atherosclerosis and its complications, heart attacks and strokes, are the major killers in the developed world. This is seen clearly in patients with genetic diseases such as familial hypercholesterolemia (FH) who have very high plasma cholesterol and LDL, and who can die at an early age from atherosclerosis, Drugs such as "statins" that reduce cholesterol and LDL levels decrease the incidence of heart attacks and strokes. Unfortunately, even with these drugs, patients may experience side effects, or cholesterol levels may not be sufficiently lowered, even at high doses. The latter is particularly true for those that suffer from familial hypercholesterolemia, who continue to have an increased risk of death from atherosclerosis despite high-dose drug treatment. There is therefore a need for new drugs to reduce cholesterol levels.

Apolipoprotein B (APOB) is a protein that transports cholesterol in the circulation, largely in the LDL particle. The inventors have identified that APOB's function can be altered by altering its RNA splicing. The alternative R A splicing causes the expression of a shortened isoform of APOB called APOB87 _S KIP27. APOB87 _S TP27 reduces the secretion of LDL, and increase LDL clearance and removal from the circulation. This dual action causes a marked reduction of LDL and cholesterol levels.

APOB exists in two isoforms: APOBIOO (in LDL) is implicated in atherosclerosis; ΑΡΟΒ48 (in chylomicrons) is involved in dietary fat transport from the intestine. Ideally, a cholesterol- lowering agent should interfere with APOBIOO only, and should not affect APOB48 to preserve normal fat absorption. Non-specifically reducing both isoforms (as is done by a number of the currently marketed treatments for high cholesterol) causes a reduction in chylomicron assembly. For example, with APOB RNA interference, there is a 50% reduction in chylomicron levels. PCSK9 down-regulation to increase LDL receptor levels is of no use in FH, where the defect lies in the binding of LDL receptor to APOB100.

The inventors have identified ASOs which can be used to specifically target APOB100. Their inventive treatment has a unique dual action in reducing LDL levels by reducing secretion and increasing clearance which directly treats the physiological problems in FH. It is selective for the APOB100 isoform, and leaves APOB48 alone, evading the mechanism- based toxicity of solutions that knock-down all APOB isoform expression.

Additionally, it is also applicable to polygenic hypercholesterolaemia, for example in those who are intolerant of conventional treatments such as statins.

Brief description of the Invention

A first aspect of the invention provides an isolated antisense oligonucleotide (ASO) for use in exon skipping comprising at least three targeting regions, each of which binds specifically to a splicing region within a target nucleic acid, the splicing regions being selected from a 5' splicing site, a 3 ' splicing site, a branchpoint splicing site, one or more exon-intron junctions, and one or more splicing enhancer elements, and a splicing site within the exon. The target nucleic acid is preferably a pre-mRNA molecule. The pre-mRNA is preferably the pre- mRNA produced during the expression of APOB.

The ASO is particularly efficient at bringing about exon skipping because it targets three sites. The mechanisms that underlie this phenomenon include better binding to the target nucleic acid, interference with spliceosome and other splicing factor association or binding of the ASO to form a secondary structure that prevents efficient splicing. The sites are within a target nucleic acid, preferably a pre-mRNA. The pre-mRNA is preferably the pre-mRNA produced during the expression of APO-B.

As indicated above, the inventors have found that by altering R A splicing it is possible to produce the shortened form of APOB. It is preferable that the exon to be skipped is exon 27. Alternatively, the exon to be skipped is exon 28.

The ASO may have any appropriate nucleotide sequence in order to bind the three selected regions in the target nucleic acid. When the target is APOB pre-mRNA, the splicing regions preferably include at least two, more preferably all three of the 5' splicing site, the 3' splicing site, the branchpoint splicing site. In particular, the ASO preferably comprises at least one of the following sequences: CCAUAC; CUGUAUAGGAGAGA; AUUAGAUUCAUA; CCATAC; CTGTATAGGAGAGA; and ATTAGATTCATA, or at least five, six, seven, eight, nine or ten contiguous amino acids taken from one of these sequences. More preferably, it comprises at least one of the following sequences: CCAUAC; CUGUAUAGGAGAGA; and AUUAGAUUCAUA. Even more preferably, it comprises at least two, even more preferably all three of those sequences.

Further, the sequences are preferably arranged in the order provided. The sequences may be contiguous or may be separated by one or more bases. It is preferred that sequences CCAUAC and CUGUAUAGGAGAGA are contiguous. It is preferable that sequences CUGUAUAGGAGAGA and AUUAGAUUCAUA are separated by between 5 and 15 bases.

In one embodiment, the ASO comprises or consists of one of the following nucleotide sequences:

AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAUUCAUAACA; AGCUCCAUGUAUAGGAGAGAUUAGAUUCAUAACA; and AGCUCCAUGUAUAGGAGAGAUUUUAUUAGAUUCAUAACA or a nucleotide sequence having significant homology to one of those sequences. In another embodiment, the ASO comprises or consists of any one of the nucleotide sequences shown in table A or table C, optionally including the modifications mentioned.

In particular, it preferably comprises or consists of a nucleotide sequence having at least 50%, more preferably at least 55%, preferably at least 57%, more preferably at least 60%, even more preferably at least 70%, more preferably at least 80%, more preferably at least 90% homology with that sequence. Further, it preferably shows similar binding affinity, such as at least 65%, more preferably at least 70%, more preferably at least 75% even more preferably at least 80% of the binding affinity of that sequence for APOB pre-mRNA.

The ASO according to the invention may comprise components other than nucleotides. In particular, it may comprise a molecule, such as biotin, cholesterol or fluorescein, preferably at its 5' end. The term oligonucleotide is considered, herein, to encompass any molecule which has a base sequence with a structure similar to that of DNA or RNA so that the base sequence of the molecule can base pair with a complementary base sequence such as an oligodeoxyribonucleotide or an oligoribonucleotide, a phosphorodiamidate morpholino oligonucleotide (PMO), a 2'-0-methyl (2'OMe) oligonucleotide, a locked nucleic acid (LNA) or a peptide nucleic acid (PNA), oligonucleotides containing phosporothioate bonds, 2'-fluoro oligonucleotides, hexitol nucleic acid, 2'-0-methoxyethyl oligonucleotide, 2'-0-allyl oligonucleotide, 2'-0-propyl oligonucleotide, 2'-0-pentyl oligonucleotide, or oligonucleotides with multiple modifications, such as those comprising phosphorothioate bonds and fluoro or allyl groups.

The ASO may be modified in order to increase its effectiveness. For example it may contain phosphorothioate (PTO) backbone modifications. The PTO modification, in which a sulphur atom is substituted for one of the non-bridging oxygen atoms in the phosphate backbone of oligonucleotides, particularly in 2'-Omethyl ribose oligonucleotides is a common modification to increase the ASO resistance to exonuclease degradation in vivo. The inventors surprisingly found that partial PTO modification improved exon skipping more than full PTO modification. Accordingly, the ASO preferably comprises modified phosphate backbones in between 5 and 12 phosphate groups at one or both of its 5' and 3' ends, Other backbone modifications may also be made, such as using phosphoramidate morpholinos, locked nucleic acids, and 2'-0-methoxyethyl modifications.

Also provided is a vector, especially a viral vector, such as an AAV vector, comprising a nucleotide sequence according to the invention.

A second aspect of the invention provides a method of exon- skipping, comprising targeting a nucleic acid, with at least one splicing agent wherein the splicing agent specifically binds to at least three splicing regions within a target nucleic acid, the splicing regions being selected from a 5' splicing site, a 3' splicing site, a branchpoint splicing site, one or more exon-intron junctions, and one or more splicing enhancer elements and an internal exon sequence

The method preferably comprises using at least one splicing agent which binds to three splicing regions. The one or more splicing agents may be, for example an oligonucleotide, especially an antisense oligonucleotide, especially an ASO according to the first aspect of the invention. Alternatively they may be one or more small molecules, or a combination of small molecules and oligonucleotides,

A third aspect of the invention provides a pharmaceutical composition comprising the ASO of the first aspect of the invention and a pharmaceutically acceptable carrier or excipient. In particular, the composition may comprise a carrier which enables the ASO to be delivered to the relevant site for use. The carrier may target a particular site or otherwise improve delivery to that site. It may also comprise an excipient which stabilises the ASO. Such stabilisers are well known in the art. Any appropriate stabiliser may be used.

Pharmaceutical compositions of this invention comprise any of the molecules of the present invention, and pharmaceutically acceptable salts thereof, with any pharmaceutically acceptable carrier, adjuvant or vehicle. Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions include, but are not limited to, ion exchangers, alumina, aluminium stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulphate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose- based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene- polyoxypropylene-block polymers, polyethylene glycol and wool fat.

The molecule of the invention may be provided in a nanoparticle, for example, to enhance delivery. Such nanoparticles may be lipid based, for example, the molecule being encapsulated in a lipid membrane. Alternatively, the composition itself may be a lipid formation, or may comprise, for example cell penetrating peptides.

The pharmaceutical compositions of this invention may be administered orally, parenterally, by inhalation spray, topically, rectally, nasally, buccally, vaginally or via an implanted reservoir. Preferably, the pharmaceutical compositions are administered orally or by injection. The pharmaceutical compositions may contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. The term parenteral as used herein includes subcutaneous, intracutaneous, intravenous, intramuscular, intra- articular, intrasynovial, intrasternal, intrathecal, intralesional and intracranial injection or infusion techniques. Preferably, the route of administration of the composition is transdermal or intrathecal administration.

The pharmaceutical compositions may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example, as a solution in 1,3-butanedioi. Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerides. Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of injectables, as are natural pharmaceutically-acceptable oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant such as Ph, Helv or a similar alcohol.

The pharmaceutical compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, and aqueous suspensions and solutions. In the case of tablets for oral use, carriers which are commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents include lactose and dried com starch. When aqueous suspensions are administered orally, the active ingredient is combined with emulsifying and suspending agents. If desired, certain sweetening and/or flavouring and/or colouring agents may be added.

The pharmaceutical compositions of this invention may also be administered in the form of suppositories for rectal administration. These compositions can be prepared by mixing a molecule of this invention with a suitable non- irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components. Such materials include, but are not limited to, cocoa butter, beeswax and polyethylene glycols. Topical administration of the pharmaceutical compositions of this invention is especially useful when the desired treatment involves areas or organs readily accessible by topical application. For application topically to the skin, the pharmaceutical composition should be formulated with a suitable ointment containing the active components suspended or dissolved in a carrier. Carriers for topical administration of the molecules of this invention include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxyethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, the pharmaceutical composition can be formulated with a suitable lotion or cream containing the active compound suspended or dissolved in a carrier. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. The pharmaceutical compositions of this invention may also be topically applied to the lower intestinal tract by rectal suppository formulation or in a suitable enema formulation. Topically-transdermai patches are also included in this invention.

The pharmaceutical compositions of this invention may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known in the art of pharmaceutical formulation and may be prepared as solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilising or dispersing agents known in the art.

The invention further provides the ASO of the first aspect or the pharmaceutical composition according to the third aspect, for use in therapy especially for use in the treatment of high cholesterol or to reduce levels of low density lipoprotein particles. Accordingly the ASO or pharmaceutical composition may be used in the treatment of conditions related to or worsened by high cholesterol, such as atherosclerosis. Specifically, the ASO or pharmaceutical composition may be used in the treatment of familial hypercholesterolaemia due to defects in the LDL receptor or gain-of-function mutations in PCSK9, and familial defective APOB100. The invention also provides a method of treating high cholesterol and related conditions by administering the ASO or pharmaceutical composition to a subject.

As mentioned above, the inventors have also identified that the efficiency of exon skipping can be improved by modifying the ASOs used. There is therefore provided a method of increasing the efficiency of exon skipping using an ASO, comprising tagging the 5' end of the ASO with biotin, cholesterol or fluorescein. Also provided is a method of increasing the efficiency of exon skipping using an ASO, comprising making partial phosphorothioate backbone modifications to the ASO.

The invention will now be described in detail with reference to the drawings, in which:

Figure 1 shows the Principle of cholesterol reduction using exon 27 skipping to truncate Apolipoprotein B100 (APOB 100)

Middle of figure: the partial genomic structure of APOB is shown, with boxes representing exons and interconnecting lines representing introns. Top of figure: Normally APOB mR A includes exon 27 and this RNA is translated to APOB 100 in the liver and to APOB48 in the intestine, where RNA editing takes place (the red box within exon 26 ('edit') represents the RNA editing site that changes the CAA codon to a UAA termination codon). Bottom of figure: By inducing exon 27 skipping, the RNA is translated to APOB87SKIP27 in the liver due to a premature termination codon within the exon 28 sequence (red box: 'PTC'). Importantly, APOB48 is expressed as normal in the intestine, as RNA editing proceeds as normal in exon 26.

Figure 2 shows the results of the comparison of exon 27 skipping induced by test skip27 ASOs in vitro.

All ASOs are 2'-0-methyl ribose ASOs. Key to abbreviations: s27=skip27; 3B = ASO sequence targeting 3'+BPS; 3Bs = 3B sequence, scrambled (negative control); 53B4 = ASO sequence targeting 5'+3'+BPS; 53B4s = 53B4 sequence, scrambled (negative control); Fluo = 5' fluorescein group added; PTO = phosphorothioate modification to backbone of ASOs at all phosphates; 53PTO = phosphorothioate modification to ASO backbone only for the 10 phosphates at either end of the ASO. *** ~ p O.001, one-way ANOVA, Dunnett's post-hoc test). The table underneath the graph shows the mean, S.D. and S.E.M. for each ASO.

Figure 3: Effect of skip27 ASO 53B4 53PTO-Fluo on exon 27 skipping in vivo.

Figures 4 to 1 1 show the sequence of introns 26-27 and 27-28 surrounding exon 27 and associated branch point splice sites and the 3' and 5' splice sites with the position of the various ASOs. PTO modifications are indicated by the pattern, for example, ASO #27 contains the same nucleotide sequence as ASO #14, but has 5 PTO modifications on each end. Skipping efficiency (%) was determined using our established RT-qPCR assays and calculated as copy number of skipped divided by copy number of skipped plus non-skipped.

Example 1. Inducing exon skipping.

The inventors have tested new ASO sequences that target three splice sites, i.e. the 5', 3' and branchpoint sequence, simultaneously in the same ASO. They have found that this strategy is able to increase the efficiency of exon skipping. The inventors tested various sequences to increase the efficiency of exon-skipping. These designs were tested in vitro by transfection into HepG2 cells, which express APOB mRNA. The amount of exon 27 skipping was quantified using a quantitative RT-PCR assay. The sequences of the new ASOs are shown in Table A.

Transfection of HepG2 cells

The following steps were taken to transfect the cells:

• Wash cells in PBS, add 5 ml 0.05% Trypsin-EDTA and incubate 10 min at 37 °C, 5% C0 ₂ .

• Make up Lipofectamine 2000 (Trifectin) mixtures in 100 μΐ Opti-MEM Ilncubate transfection reagent dilutions for 5 mins at RT, while making up the oligo mixtures in 100 μΐ Opti-MEM I.

• Add the oligo dilutions to the corresponding transfection reagent mixtures.

• Incubate for 20 mins at RT.

• Resuspend the cells by adding 5 ml full medium and squeezing through a 21 G needle.

• Take a 100 μΐ aliquot for counting and spin down cells for 8 min at 1400 rpm.

• Count using Nucleocounter:

1. Add 100 μΐ Solution A, vortex briefly

2. Add 100 μΐ Solution B, vortex briefly

3. Load cassette by pushing the plunger

• Resuspend HepG2 cells to 1 x 10 ⁶ cells/ml (so 500 μΐ = 5x10 ^" ) in full medium.

• Add 500 μΐ of the cell suspension per well in two 12 well plates. Add 50 μΐ full medium to each well.

• Add 200 μΐ oligo/transfection complexes to the cells, to make up 750 μΐ per well final volume. Add an extra 250 μΐ medium to sample 8.

• Incubate at 37 °C.

• 24 h post-transfection add 1 ml fresh medium to samples 1-6 and 11 and incubate a further 24 h. • 24 h post-transfection use samples 7-10 for flow cytometric determination of transfection efficiency.

Flow cytometry was used to determine transfection efficiency.

The following steps were taken:

Wash cells in PBS, add 500 μΐ 0.05% Trypsin-EDTA and incubate 8 min at 37 °C, 5% co ₂ .

Resuspend the cells by adding 500 μΐ full medium and transfer to FACS tubes.

Spin down cells for 8 min at 1400 rpm.

Resuspend in 200 μΐ PBS and add 2 μΐ Propidium Iodide (1 mg/ml), keep on ice.

Squeeze through 30G needle twice immediately before running on BD FACScan flow cytometer.

Acquire data without compensation, use WinList 6.0 to auto-compensate and analyse data.

R A extraction

R A extraction was carried out using the following steps:

• In tissue culture flow hood: Wash cells in PBS, add 500 μΐ 0.05% Trypsin-EDTA and incubate 8 min at 37 °C, 5% C0 ₂ .

• Resuspend the cells by adding 500 μΐ full medium and transfer to 1.5 ml microcentrifuge tubes.

• Take a 100 μΐ aliquot for counting and spin down cells for 8 min at 1400 rpm.

• Count using Nucleocounter:

1. Add 100 μΐ Solution A, vortex briefly

2. Add 100 μΐ Solution B, vortex briefly

3. Load cassette by pushing the plunger

• Take off supernatant and resuspend cells in PBS to 1 x 10 cells/ml (so 500 μΐ = 5x10 ^" ), vortex vigorously.

• Take 500 μΐ of each sample and spin down cells for 8 min at 1400 rpm.

• Resuspend in 350 μΐ Buffer RLT containing 10 μΐ β-Mercaptethanol/ml, vortex briefly

• Pass the lysate 5 times through a 30G needle attached to an RNase-free syringe

• Move to RNA bench in lab • For each sample, add 1 volume of 70% ethanol to the lysate and mix well by pipetting, immediately transfer to an RNeasy MinElute column placed in a 2 ml collection tube.

• Centrifuge 15 s at 10,000 rpm, discard the flow- through.

• Add 350 μΐ Buffer RWl to the column and centrifuge 15 s at 10,000 rpm, discard the flow-through.

• Add 1 μΐ Ambion Turbo DNase I to 79 μΐ of Buffer RDD and pipette directly onto the spin column membrane. Incubate for 10 min.

• Add 350 μΐ Buffer RWl to the column and centrifuge 15 s at 10,000 rpm, discard the flow- through and collection tube.

• Add 500 μΐ Buffer RPE to the column and centrifuge 15 s at 10,000 rpm, discard the flow-through.

• Add 00 μΐ of 80% ethanol to the column in a new collection tube and centrifuge 2 min at 10,000 rpm, discard the flow-through and collection tube.

• Put the column into a new collection tube and centrifuge 5 min at full speed with the lid of the spin column open. Discard the flow-through and collection tube.

• Put the column into a 1 ,5 ml microcentrifuge tube, add 14 μΐ water and centrifuge 1 min at full speed to elute.

• Measure R A concentration on the Nanodrop: RNA quality

The following steps were carried out to check RNA quality:

• Equilibrate all reagents to RT before use, but keep samples and RNA ladder on ice

• Heat denature RNA samples and ladder by incubation in 70°C for 2 min

• Preparing the gel:

o Pipette 550 μΐ of RNA 6000 Nano gel matrix into a spin filter

o Centrifuge at 1500 g (4000 rpm) for 10 min at RT

o Aliquot 65 μΐ filtered gel into 0.5 ml RNAse-free tubes. Use filtered gel within 4 weeks

• Preparing the gel-dye mix:

o Vortex the RNA 6000 dye concentrate for 10 s, spin down and add 1 μΐ of dye to 65 μΐ of filtered gel

o Vortex and spin down at 13000 g (11700 rpm) for 10 min at RT. Use within one day.

• Loading the gel-dye mix:

o Put a new RNA 6000 Nano chip on the chip priming station

o Pipette 9 μΐ of gel-dye mix into the well marked G

o Make sure that the plunger is positioned at 1 ml and then close the chip priming station o Press the plunger until it is held by the clip, wait 30 s and then release the clip o Wait for 5 s, then slowly pull back the plunger to the 1 ml position

o Open the chip priming station and pipette 9 μΐ of gel-dye mix into the well marked G

o Discard the remaining gel dye mix

• Pipette 5 μΐ of RNA 6000 Nano Marker into the 12 sample wells and the ladder well

• Pipette 1 μΐ of ladder into the ladder well and 1 μΐ sample (5-500 ng/μΐ) each into the sample wells or RNA 6000 Nano marker in unused wells,

• Put the chip horizontally into the IKA vortex and vortex for 1 min at 2400 rpm

• Run the chip within 5 min

Reverse transcription of the transfection products

The following steps were taken

• In a sterile, nuclease-free, thin-walled PCR tube on ice, prepare the template-primer mixture for one 20 μΐ reaction by adding the components in the order listed:

μΐ total RNA (1 μg)

1 μΐ Anchored-oligo(dT), ₈ primer (2,5 μΜ)

μ1 ¾0

13 μΐ total volume

• Include one minus reverse transcriptase (-RT) control per sample

• Denature the template-primer mixture for 10 min at 65 °C in the PCR machine

• Immediately cool on ice

• Mastermix (16 x)

64 μΐ 5x Transcriptor Reverse Transcriptase buffer (8 mM MgCl ₂ )

8 μΐ Protector RNase Inhibitor (20 U)

32 μΐ dNTP mix (10 mM each)

8 μΐ Transcriptor Reverse Transcriptase (10 U)

1 12 μΐ total volume

For the -RT samples, substitute H ₂ 0 for Reverse Transcriptase

• Mix carefully, but do not vortex, spin down briefly

• Incubate for 30 min at 55 °C in a PCR machine with heated lid • Inactivate Transcriptase by heating to 85 °C for 5 min

• Freeze at -20 °C until used

qPCR was used to check the amount of exon 27 skipping that occurred using the following conditions:

45x

DNA template (0.5 μΐ each) (18.50 μΐ) Melt

As mentioned above, the inventors compared the levels of exon skipping induced by various ASOs in vitro, the results being shown in Figure 2.

Figure 2 shows the summarised results of screening of 36 skip27 ASOs. The new ASOs which target three splice sites (named 53B4) were compared with the former benchmark ASO, 3B, which targets only two splice sites. 3B showed a mean skipping percentage of 4.14%. Scramble controls 3Bs and 53B4s were also tested and did not affect skipping to a significant degree (0.21 % and 0.09% respectively). Targeting all three splice sites in 53B4 increased efficiency by 3.6-fold [compare 53B4 (15.01%) to 3B (4.14%)]. 53B4 is a 50-mer with the sequence 5'- AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAUUCAUAACA— 3'.

Example 2. The use of 5' fluoresceination of ASOs to increase exon skipping efficiency of ASOs.

The inventors used fluorescent dyes to label ASOs to allow for visualisation of transfection efficiency as well as subcellular localisation. The skip27 ASOs were tagged with 5' fluorescein (Fluo in Figure 2). The inventors identified that this had the effect of increasing exon-skipping efficiency in both the 3B two splice site targeting ASOs and the new 53B three splice site targeting ASOs [compare 3B (4.14%) to 3B-Fluo (25.51%) and 53B4 (15.01%) to 53B4-Fluo (22.78%)]. The inventors also tested adding other groups to the 5' end of the ASO, adding biotin increased efficiency two fold.

Example 3. The use of partial phosphorothioate backbone modification to increase exon skipping efficiency of ASOs.

The inventors tested the effect phosphorothioate (PTO) backbone modification, in which a sulphur atom is substituted for one of the non-bridging oxygen atoms in the phosphate backbone of the 2'-0-methyl ribose oligos and which can be introduced using standard techniques. The inventors tested the effect of PTO modification of the entire backbone; however, this seemed to reduce the efficiency of exon-skipping [compare 53B4 (15.01%) vs 53B4 PTO (12.55%), and also compare 53B4-Fluo (22.78%) vs 53B4_PTO-Fluo (11.35%)]. The inventors then tested the effect of partial PTO protection, with the addition of PTO to the 10 phosphate groups at the 5' and the 10 phosphate groups at the 3' end (the 53PTO modification). This increased the efficiency of exon-skipping by 3.9-fold [compare 53B4 (15.01%) vs 53B4_53PTO (58.73%)]. It therefore appears that the partial PTO protect modification does increase efficiency.

Example 4. The combination of the modifications to increase exon skipping efficiency of ASOs.

The inventors have synthesised a skip27 ASO, 53B4_53PTO-Fluo, which incorporates all three modifications referred to above, namely targeting three splice sites, having partial PTO backbone modifications and being modified by the addition of fluorescein. The inventors have tested the efficiency of this ASO using human APOB transgenic mice (Figure 3). The mice were injected with doses of the skip27 ASO formulated in Invivofectamine 2,0 IV, available from Life Technologies. The mice were sacrificed 24 hours later and liver RNA was subjected to quantification for exon 27 skipping using qRT-PCR as described above. The results are shown in figure 3. The ASO effectively brought about skipping of exon 27.

Example 5

The inventors focussed on reducing the size of the skip27 ASOs from the 50 nucleotide (nt) length of the lead ASO 53B4 (ASO #27) while screening sequence variants. As previous attempts to delete larger fragments from the sequence had been unsuccessful we tested ASOs with only a few reductions (Fig. 4). In order to keep costs to a minimum, initially we used 2'- O-methyl RNA ASOs without phosphorthio te (PTO) modifications. As shown in Fig. 4, these reductions affected skipping efficiency positively. The smallest ASO contained 45 nt.

We therefore investigated the possibility of combining the various small nucleotide reductions to achieve further reductions in size (Fig. 5). Again, this resulted in ASOs that were reduced in size (40-43 nt), but showed comparable or better skipping efficiency than the 2'0-methyl version of the lead at 24 or 48 h after transfection.

In another series of experiments we evaluated ASO #14/27 sequence variants with even larger deletions. As shown in Fig. 6, ASO #52 at 39 Nt showed higher skipping efficiency than the lead #14. We also tested the effectivity of the shorter. Also #56. This ASO shows comparable skipping efficiency to ASO #14 with only 34 nt. Any further deletions resulted in reduced activity.

At the same time, we tested the influence of locked nucleic acid (LNA) modifications on the skipping efficiency of ASOs. We therefore tested a 25 Nt sequence variant (ASO #51) in comparison to a 2'0-methyl ASO of equal length (ASO #50). From the data depicted in Fig. 7, it is clear that partial LNA modification is able to increase skipping efficiency 4 fold.

We also investigated the influence of varying numbers of PTO modifications on skipping efficiency. The specific importance of increasing PTO modifications is that this will enable serum protein binding and retention in the bloodstream, obviating the need to encapsulate the ASO in a delivery reagent. However, this needs to be balanced out against the fact that complete PTO modification tends to reduce skipping efficiency. As shown in Fig. 8, increasing the number of PTO reduces skipping efficiency slightly, but not significantly in vitro. In figure 8, PTO modifications are indicated by the pattern, for example, ASO #27 contains 5 PTO modifications on each end. ASO #34 is a 5' fluoresceinated version of ASO #27 (Fluorescein denoted by star).

Further experiments with variants of ASO #52 and #56 containing ten PTOs on each end (#64 and #66, respectively) or fully PTO-modified (#65 and #67) demonstrated that the number of PTOs bore no direct relationship to efficiency. Skipping efficiency increases with the number of PTOs for the #52 sequence, but is reduced for the #56 sequence. ASO #66 (the partial PTO version of #56) retains 38.57% skipping efficiency in comparison to 58.73% induced by ASO #27. The results are shown in figure 9. Again, PTO modifications are indicated by the pattern. For example, ASO #27 contains 5 PTO modifications on each end. ASO #34 is a 5' fluoresceinated version of ASO #27.

We also tested three more ASOs targeting exon 27 sequences (Fig. 10). Previous tests had shown that ASOs targeted against the exon sequences caused levels of exon skipping well below the published ASO 3B. ² These new exon targeted ASOs were designed according to guidelines published by Aartsma- us. ³ The ASOs confirmed the previous data as only low levels of exon skipping were detected (Fig. 10). The sequence of human ApoB exon 27 with stretches of three or more cytosines or gua idines shown in the top row. ASOs ex6-25, ex31- 50, ex 61-80, ex88-107, 68, 69 and 70 are also shown.

Example 6. In vitro and in vivo testing of a mouse skip27 ASO

We designed and tested two ASOs specific to the mouse sequence and that cover the same nucleotide sequence as the original lead ASO #27 in human. These ASOs were tested in Hepa 1-6 cells, as these cells are derived from C57 mice. As shown in Fig. 11, both ASOs induce exon 27 skipping at high levels in these cells. Due to the industry feedback stressing the importance of reducing the size of the ASO, we did not test these 50 nt long ASOs in mice but concentrated on reducing the length of the human ASO. Our future plan is to construct and test shortened 34 nt ASOs similar to #56 and #66, but directed to the mouse sequence. In figure 1 1, the structure and sequence of the introns 26-27 and 27-28 surrounding the mouse exon 27 sequence with the human sequence and structure shown in comparison. Nucleotide differences in the mouse sequence are delineated by orange fill, Various sequence motifs in the mouse sequence are indicated below the sequence. ASOs #10-34 and #10-01 contain a 5' fluorescein (star) and PTO modifications as indicated by the pattern.

Conclusions

We have demonstrated that a number of 53B4 (ASO #14/27) sequence variants can induce exon 27 skipping to varying degrees. In particular ASO #56 (AGCUCCAUGUAUAGGAGAGAUUAGAUUCAUAACA) and ASO #52 (AGCUCCAUGUAUAGGAGAGAUUUUAUUAGAUUCAUAACA) are very effective. These ASOs still target three splice sites surrounding the human ApoB exon 27, but are significantly shorter at 34 and 39 nucleotides, respectively.

Table A

ASO Sequence

s27 53B1 2Ό- ccauaccuguauaggagagauucaua

Me

s27 53B2 2Ό- ccauaccuguauag gagagaauuaga

Me

s27 53B3 2Ό- ccauaccuguauaggagagaauuagauucaua

Me

s27 53B4 2Ό- AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA Me UUCAUAACA

s27_53B4 2Ό- Fluorescein- Me-Fluo AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA

UUCAUAACA

s27_53B4 2Ό- Biotin- Me-Bio AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA

UUCAUAACA

s27_53B4 2Ό- AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA Me-PTO UUCAUAACA (full PTO modification)

s27 53B4 2Ό- AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA Me-53PTO UUCAUAACA PTO for 5 residues at 5' and 3' ends

s27 53B4 2Ό- Fluorescein- Me-53PTO-Fluo AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA

UUCAUAACA

s27 53B5 2Ό- AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA Me UUCAUA

s27 53B6 2Ό- CCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAUUCA Me UAACA

s27_53B7 2Ό- AGCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGA Me UUCAUAAC

s27 53B8 2Ό- GCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAU Me UCAUAACA

s27 53B9 2Ό- GCUCCAUACCUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAU Me UCAUAAC

s27 53B10 2Ό- AGCUCCAUACCUGUAUAGGAGAGAUAUUUUAUUAGAUUCAU Me AACA

s27_53Bl l 2Ό- AGCUCCAUACUGAAGUCCUUGUUCCCAAAACUGUAUAGGAGA Me GAUUUUGUAUUUUAUUAGAUUCAUAACA

Table B

ASO Sequence

s27 3B 2O-Me CUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAUUCAUAACA s27_3B 2'0-Me- Fluorescein- Fluor CUGUAUAGGAGAGAUUUUGUAUUUUAUUAGAUUCAUAACA s27_3Bs 2'0-Me CAAGUAGAUAUUAUAUGUUGUUACUUGUAUAUAUCGAAUG

Where m = 2'O-methy) modification, * * phosphoroihioate modification, + ^■ = L modification, star= 5' Fluorescein Table C