FIELD OF THE INVENTION

This present invention relates to an antimicrobial agent which is a fungicide, and more particularly to a 9 mer short cyclic peptide. Particularly the peptide is derived from osmotin protein and provides significant antifungal properties. The invention further relates to a composition comprising of the peptide or its derivates with fungicidal activity with potential antimicrobial and a possible therapeutic agent in other higher organisms including humans.

BACKGROUND OF THE INVENTION

Crops are under constant attack by pests and microbial pathogens that cause major crop losses and are a threat to food supply. Substantial amount of money is being spent by farmers on disease management, though often without adequate technical support, resulting in poor disease control and pollution. Piper nigrum (black pepper) is a tropical indigenous crop and its berries are the source of one of the world's most widely and frequently used spices. Black pepper is also frequently used in traditional medicine.

Foot rot disease caused by the oomycete Phytophthora capsici, is the major production constraint reported globally, where black pepper is cultivated. The disease is caused by Phytophthora capsici an oomycete (fungal-like) pathogen which is one of the most devastating plant pathogens. The key to pathogenic oomycetes' success resides in their capacity to adapt to overcome host resistance and occasionally jump to new hosts. Control of oomycete diseases relies mainly on chemical measures using products within 16 different chemical groups, among which the phenylamides (PAs), quinone outside inhibitors (Qols), carboxylic acid amides (CAAs), and multisite inhibitors are most widely used. However, resistance evolved against most single- site inhibitors in many oomycete pathogen species. Moreover, the overused chemical oomyceticides have resulted in serious environmental pollution and drug resistance. Hence, eco- friendly bio- oomyceticides are required for sustainable development.

There is prior art data on use of combinations of chemical fungicides or certain fungi like Trichoderma or Gliocladium in controlling Phytophthora or the combination of chemical and biocontrol agents but none so far reporting the antifungal activity of a peptide derived from an antifungal plant defense protein isolated from a resistant wild plant source.

The purified osmotin protein from Piper colubrinum showed antifungal activity against the oomycete pathogen Phytophthora capsici. The recombinant nature of the protein and hence its limited commercial scope prompted us to look for novel active peptide derivatives of this protein. A series of in silico docking and simulation studies were performed based on known sequence of human Adiponectin receptor which helped in identifying tentative amino acid binding residues of P. colubrinum osmotin protein that interact with the receptor. The present 9-mer was selected from the list of residues, based on the predicted stability of this peptide, due to the presence of 3 cy stein residues. This sequence (CCNSGSCSP) is unique to Piper colubrinum osmotin protein.

OBJECTIVES OF THE PRESENT INVENTION

The objective of the present invention is to provide a synthetic 9 mer peptide (CCNSGSCSP) which exhibits antifungal properties specifically against highly virulent P.capsici

Another objective of the invention is to provide a compostion which is an antifungal composition comprising the 9 mer peptide (CCNSGSCSP) as one of the active ingredients.

Yet another objective of the present invention is to provide antifungal composition with fungicidal activity in plants, animals and in higher organisms including humans, comprising the 9 mer peptide (CCNSGSCSP) as one of the active ingredients along with the pharmaceutically acceptable peptide stabilizer, carrier and excipients

Yet another objective of the invention is to design derivatives of cyclic 9 mer peptide derived from PcOSM {Piper colubrinum Osmotin) and pharmaceutical compositions comprising 9 mer peptide derivatives.

SUMMARY OF THE INVENTION

The present invention relates to a synthetic 9 mer cyclic peptide sequence CCNSGSCSP derived from osmotin protein isolated from wild piper species i.e., Piper colubrinum which is highly resistant to the pathogen Phytophthora capsici. Osmotin protein from resistant wild pepper {Piper colubrinum) was expressed as a recombinant protein in E. coli. Based on results from in silico docking studies using P. colubrinum osmotin protein sequence, the study had synthesized a short (9-mer) cyclic peptide. It is observed that the short cyclic peptide synthesized from Osmotin protein of P. colubrinum shows significant antifungal activity against Phytophthora capsici which is suggestive of its potential as a promising plant-derived antifungal peptide.

Hence the present invention discloses peptide/s generated from Osmotin protein with potential applications in future in crop protection as a priming agent and as an antimicrobial agent The utility of using plant derived bioactive antifungal peptides in combination with known antifimgals will help in reducing the environmental hazards and associated health risks that result from indiscriminate use of chemical fungicides. The present invention provides a greener and environment-friendly option of fungicide which could be potentially used in all higher organisms including human beings.

The various embodiments of the invention are as stated below.

Embodiment A relates to a synthetic peptide comprising of sequence: CCNSGSCSP; wherein the peptide is a cyclic peptide.

Embodiment B relates to the peptide as defined in a previous embodiment having antimicrobial activity. Embodiment C relates to the peptide as defined in a previous embodiment wherein the peptide is derived from Osmotin protein.

Embodiment D relates to the peptide as defined in a previous embodiment wherein the Osmotin protein is derived from Piper colubrinum

Embodiment E relates to the peptide as defined in a previous embodiment wherein the peptide exhibits antimicrobial activity against Phytophthora capsici.

Embodiment F relates to an antimicrobial composition comprising a cyclic peptide having sequence CCNSGSCSP and at least one active ingredient comprising gylcol chitosan. Embodiment G relates to the antimicrobial composition as defined in a previous embodiment wherein the peptide sequence is derived from Osmotin protein of Piper colubrinum.

Embodiment H relates to the antimicrobial composition as defined in a previous embodiment wherein the peptide exhibits antifungal activity against Phytophthora capsici.

Embodiment I relate to the antimicrobial composition as defined in a previous embodiment wherein the amount of the peptide in the composition is 1 to 200 μg w/v.

Embodiment J relates to the antimicrobial composition as defined in a previous embodiment wherein the amount of glycol chitosan in the composition is lmg w/v

Embodiment K relates to the antimicrobial composition as defined in a previous embodiment comprising priming agents.

Embodiment L relates to the antimicrobial composition as defined in a previous embodiment wherein the composition comprises osmotin protein.

Embodiment M relates to the antimicrobial composition as defined in a previous embodiment wherein the composition comprises peptide stabilizer and/or carrier.

BRIEF DECRIPTION OF THE DRAWINGS

Figure 1: Results of HPLC and MALDI analysis of OSM peptide.

Figure 2: Comparison of inhibitory effect of Piper colubrinum Osmotin protein and its peptide derivative on growth of Phytophthora capsici on leaves of Piper nigrum', The legends indicate; Pn : Piper nigrum leaves without infection, Pn+Pc: P. nigrum leaves infected with Ph. capsici, Pn+OSM peptide+Pc : Infected leaves pretreated with Osmotin peptide (100 μg/mL), Pn+OSM protein+Pc: Infected leaves pretreated with purified Osmotin protein from Piper colubrinum (200μg/mL).

Figure 3: Effect of Osmotin pretreatment on transcript expression levels of critical genes of the phenyl propanoid pathway such as Chalcone synthase (CHS), Caffeoyl-CoA- methyltransferase (COAMT), Glutathione S -transferase (GST), L-ascorbate peroxidase (AsPX) in infected leaves of Piper nigrum. Y-axis- Pn- Piper nigrum leaf (no treatment control); Pn Pc- P. nigrum leaf infected with Ph.capsici', PEP 1-100- Leaves with peptide pretreatment (1,10 and 100 μg/mL); GC- GC (1 mg/ml) treated leaf.

Figure 4: Effect of Osmotin pretreatment on transcript expression levels of critical genes of the phenyl propanoid pathway such as Farnesyl diphosphate synthase (FPS2), Geranyl geranyl pyrophosphate synthase (GGPS), NADPH Oxidase (NAPDHO) in infected leaves of Piper nigrum. Y-axis- Pn- Piper nigrum leaf (no treatment control); Pn Pc- P. nigrum leaf infected with Ph.capsici', PEP 1-100- Leaves with peptide pretreatment (1,10 and 100 pg/mL); GC- GC (1 mg/ml) treated leaf.

Figure 5: Effect of Osmotin pretreatment on transcript expression levels of critical genes of the phenyl propanoid pathway such as Chorismate synthase (CHOS), Phenyl Ammonia Pyase (PAL) in infected leaves of Piper nigrum. Y-axis- Pn- Piper nigrum leaf (no treatment control); Pn Pc- P. nigrum leaf infected with Ph.capsici', PEP 1-100- Leaves with peptide pretreatment (1,10 and 100 μg/mL); GC- GC (1 mg/ml) treated leaf.

Figure 6: Effect of Osmotin pretreatment on transcript expression levels of antioxidant genes such as Superoxide dimutase (SOD), Peroxiredoxin (PRDX), Peroxidase (PEX), Respiratory burst oxidase homolog protein D (RBOHD) and Glutathione peroxidase (GPX) in infected leaves of Piper nigrum. Y-axis- Pn- Piper nigrum leaf (no treatment control); Pn Pc- P. nigrum leaf infected with Ph.capsici; PEP 1-100- Leaves with peptide pretreatment

(1,10 and 100 μg/mL); GC- GC (1 mg/ml) treated leaf.

Figure 7: Effect of osmotin pretreatment on pathogen ( Phytophthora capsici ) growth and survival on Piper nigrum leaves a) Control leaf infected with Ph. Capsici (24hpi) al) hyphal morphology 10x magnification, b) Infected leaf pretreated with osmotin peptide (1 to 100μg/mL) bl) 1 μg/mL, b2) 10 μg/mL b3) 100 μg/mL b4) 1 μg/mL hyphal morphology 10x magnification, b5) 10 μg/mL hyphal morphology 10x magnification b6) 100 μg/mL hyphal morphology 10x magnification.

Figure 8: Hyphal breaks, vesicles and abnormal hyphal morphology (Osmotin peptide 100 μg/mL) 40x magnification (c); dl) shrunken empty sporangium (100 μg/mL peptide) d2) Normal sporangium.

Figure 9: Effect of Osmotin peptide pretreatment on infected leaves (24hpi) in P. nigrum seedlings; a) Control (untreated) b) Osmotin peptide pre treated. Figure 10: Combined effect of GC and peptide pre treatment on pathogen infection (72hpi); a) Control (untreated) b) Osmotin peptide pretreated c) Glycol chitosan, d) Glycol chitosan+os mo tin .

Figure 11: Images of docking simulations performed on two of the target proteins (6IUQ and 3KH8) are illustrated; SI) 6IUQ- Osmotin peptide, S2) 6IUQ-Osmotin peptide labelled, S3) 3KH8-Osmotin peptide; S4) 3KH8-Osmotin labelled.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to a short cyclic 9 mer synthetic peptide derived from the amino acid sequence of the plant antifungal defense protein 'Osmotin' present in wild pepper species {Piper colubrinum ) which is inherently resistant to major pathogens affecting cultivated pepper {Piper nigrum). The peptide and its derivatives act as significant antibiotic/ antifungal agent and function as therapeutic agents for plants. The present invention also relates to synthesis of short stretch of 9 mer amino acid sequence CCNSGSCSP which is a cyclic peptide herein after refered as osmotin peptide and its further functional studies.

The present invention will be described herein after with reference to a number of non limiting examples and experimentation.

In a first embodiment the 9 mer amino acid sequence CCNSGSCSP (osmotin peptide) which is a cyclic peptide was synthezised which is derived from the osmotin protein of Piper colubrinum. Piper colubrinum is a wild species of pepper, which shows resistance to the foot rot disease caused by Phytophthora capsici.

Inventors found that the synthetic osmotin peptide based on sequence derived from osmotin protein of wild pepper Piper colubrinum is more potent than the pure protein in inhibiting growth of the oomycete pathogen Phytophthora capsici ( Ph. capsici ) in cultivated black pepper {Piper nigrum). The peptide shows inhibitory activity on hypha as well as sporangia.

Inventors found that the peptide is functionally active at all concentrations tried, that is from 1-200 μg/mL and inhibitory activity increases with dose. Higher concentrations of peptide (100-200 μg/mL) induce hyphal breakage, change in hyphal morphology, contents and sporangial abnormalities. The abnormalities are evident even after 3 hours of peptide treatment of fungal hypha. Osmotin peptide significantly induces the expression of key genes of secondary metabolite (phenyl propanoid) pathway and Reactive Oxygen Species (ROS) signaling pathways, which is most favoured at the lowest concentration (1 μg/mL). Increased ROS production correlates with expression of innate immune responses in the plant including Hypersensitive Response (HR). It is evident that at lower concentration, Osmotin peptide effectively induces innate immunity in susceptible plants and therefore has very good potential as a plant defense inducer (elicitor) and a priming agent for crop protection. Osmotin peptide exhibits more pronounced defence priming potential than the known commercially available defense elicitor Glycol Chitosan.

The peptide thus has potential application in crop protection both as an antifungal and as a priming agent. The peptide can be used alone or in combination with other defence elicitor/s which could be effective in controlling notoriously devastating pathogens like Phytophthora. Osmotin peptide could be used in combination with defense elicitor/s and/or currently used pesticides for more effective biological control of fungal pathogens. The peptide/ peptide- based scaffolds and peptide containing preparations will have applications in the nursery as well as in plantations. The fungal wall proteins are the potential targets of the peptides and identification of the targets will bring out more information on the nature and mode of activity of the unique and novel peptide derived from the defense protein Osmotin of Piper colubrinum.

The above stated are substantiated herein under Examples. The second embodiment relates to a composition comprising the osmotin peptide and glycol chitosan. It is found that the combination of the two active ingredients show synergy against the pathogens like Phytophthora.

EXAMPLES

Example 1: Synthesis of 9 mer peptide from Osmotin protein

1.1 Cloning and expression of P. colubrinum Osmotin protein in E.coli

Full length osmotin gene was cloned from young leaves (3 ^rd leaves) of P. colubrinum plants using the primers CACCATGTCACTATACAATATAGTAAACATGGCC and TGGGCAGAAGACAACTCTGT as forward and reverse primers of Piper colubinum osmotin gene (GeneBank accession: EU 271754.1). The full length osmotin gene was cloned in pET 100/D TOPO (Champion ™, pET Directional TOPO expression kit, Invitrogen) for the expression of recombinant osmotin protein. PCR was performed in an Eppendorf thermocycler with 35 cycles of amplification under the following conditions -95 °C for 30 sec, 55 °C for 30 sec and 72 °C for 1 min using High fidelity Phusion DNA polymerase. The recombinant plasmid was transformed into the bacterial strain DH5a using standard procedures and colonies were verified by sequencing both the strands of PcOSM using an automated ABI sequencer with Big Dye Terminator v3.1 Cycle sequencing kit.

1.2 IPTG induction and purification of recombinant PcOSM

BL-21 competent cells were transformed with pETlOO/D-TOPO containing recombinant PcOSM. For protein expression, BL 21 E.coli cells carrying recombinant PcOSM were cultured overnight at 37 ° C in 5 mL Luria-Bertani (LB) broth containing 100μg/mL ampicillin with vigorous shaking (220 rpm) until the OD (600nm) reached 0.6-0.8. IPTG Induction was carried out with a concentration of lmM for 8 h and afterwards the cells were pelleted at 4,000g at 4 °C for 20 min. Osmotin being a vacuolar protein requires denaturing buffer (0.1 M Tris HC1 and 6 M Urea, pH 8.0) for extraction of protein from pellet. The pellet was suspended in urea buffer, mixed well and kept in ice for 30 min, and then the slurry was kept under constant shaking for 45 min, to completely dissolve the pellet. The cellular debris was removed by centrifugation at 10,000g at 4 °C for 25 min. The supernatant was collected and the step was repeated twice to solubilize the protein completely.

1.3 SDS PAGE and Western blot analysis

The supernatant was pooled the total protein was analysed by 12% sodium dodecyl sulphate polyacrylamide (SDS PAGE). Blue prestained protein standard was used as protein marker for SDS-PAGE and then visualized by Coomassie brilliant blue staining. The separated recombinant PcOSM protein was transferred to a polyvinlylidene (PVDF) membrane using mini trans blot cell for 1 h at 100 V. The membrane was incubated for 1 h at room temperature in a blocking buffer (5% bovine serum albumin (BSA) in lx tris buffered salina-0.1% tween 20) and then probed with anti-poly Histidine antibody (diluted 1:5000) overnight at 4°C. The membrane was washed with wash buffer 3 times for 10 min and incubated with horseradish peroxidase conjugated anti-mouse IgG secondary antibody (diluted 1:5000) for 1 h at room temperature. Immunoreactive bands were visualized with an enhanced chemiluminescence substrate.

1.4 Protein purification

Protein purification was performed using high-performance immobilized-metal ion affinity chromatographic (IMAC). The IMAC column containing Ni-NTA agarose beads was equilibrated in a buffer containing 0.1 M Tris HC1 and 6 M Urea at pH 8.0 and subsequent wash was performed using buffer (0.1 M Tris HC1, 6 M Urea and 20mM Imidazole, pH 8.0). The recombinant protein was eluted in elution buffer (0.1 M Tris HC1, 6 M Urea and 200 mM Imidazole, pH 8.0) by step gradient elution in AKTA system. The protein purification step was conducted in Centre for Cellular and Molecular Platforms (CCAMP), Bangalore, India). Protein fractions were pooled and subjected to dialysis using 10 KDa MWCO membrane into refolding buffer (20mM Tris HC1 pH 7.2, 500 mM NaCl,10mM reduced glutathione, lmM oxidized glutathione at 4 °C. The dialysed sample was further dialysed against Milliq water at 4 °C to slowly remove denaturants. The dialysed protein was concentrated using Amicon concentrator (10 KDaMWCO) and protein concentration was measured. To confirm the identity of purified recombinant osmotin (PcOSM) protein liquid chromatography tandem mass spectrometry (LC-MS/MS) analysis was carried out.

1.5 Liquid chromatography tandem mass spectrometry

The tryptic peptides were separated using a nano ACQUITY UPLC ^® chromatographic system. Instrument control and data processing was done with MassLynx4.1 SCN781 software. The peptides were separated by reversed-phase chromatography. MS analysis of eluting peptides was carried out on a SYNAPT® G2 High Definition MS™ System (HDMS ^E System. The instrument settings were: nano-ESI capillary voltage 3.5 KV, sample cone 40 V, extraction cone 6 V, IMS gas (N2) flow 90 (mL/min). All analyses were performed in positive mode ESI using a NanoLockSpray TM source.

1.6 LC-MS/MS Data analysis

The acquired ion mobility enhanced MSE spectrum was analysed using Progenesis QI for Proteomics V3.0 for protein identification. Data processing includes lock mass correction post acquisition. Processing parameters for Progenesis were set as follows: noise reduction thresholds for low energy scan and high energy scans were calculated automatically by using ion accounting workflow in the software. The protein identifications were obtained by searching against a custom database having pathogenesis related proteins from Piper colubrinum, Calotropis procera, Nicotiana tabacum, Actinidia deliciose and Arabidopsis thaliana from UniProt. During database search, the protein false positive rate was set to 4%. The parameters for protein identification was made in such a way that a peptide was required to have at least 1 fragment ion match, a protein was required to have at least 3 fragment ion matches and a protein was required to have at least 1 peptide match for identification. Oxidation of methionine was selected as variable modification and cysteine carbamidomethylation was selected as a fixed modification. Trypsin was chosen as the enzyme used with a specificity of one missed cleavage. The purified and refolded PcOSM was assayed for its ability to inhibit mycelial growth of Phythophora capsici oomycete by in vivo leaf infiltration method.

1.7 Identification of Osmotin peptide based on protein sequence of Piper colubrinum

A series of in silico docking and simulation studies were performed based on known sequence of human Adiponectin receptor which helped in identifying tentative aminoacid binding residues of P.colubrinum osmotin protein that interact with the receptor. The present 9-mer was selected from the list of residues, based on the predicted stability of this peptide, due to the presence of 3 cystein residues. This sequence (CCNSGSCSP) is unique to Piper colubrinum osmotin protein.

The peptide stretch of 9 amino acids was synthesized with 98% purity and was found to be water soluble. The identity of the peptide was confirmed by MALDI and MS/Ms analysis as shown in Figure 2. The stock was dissolved in sterile water and diluted to obtain a working concentration of 1, 10, 100 and 200 μg/ml.

Example 2: Plant Material

Leaves or in vitro seedlings of black pepper ( Piper nigrum, variety - Panniyur I) were used in the experiments. Young leaves (third leaves) from 2-year-old vines maintained by uniform watering and growth conditions in the green house of Rajiv Gandhi Centre for Biotechnology, Thiruvananthapuram, India were used. Before experiments, the leaves were surface sterilized with Tween and washed by placing under running tap water for 2-3 hours before subjecting to two to three rinses in double distilled water and were subsequently blotted dry in filter paper.

Example 3: In vitro seedlings preparation

Mature seeds of Piper nigrum were collected and washed in running tap water for 15 min followed by sterile distilled water wash. Surface sterilization were carried out with 70% ethanol for 45 seconds, sterilization in 4% sodium hypochlorite solution for 15 minutes, followed by washing in sterile distilled water 4 to 5 times. Seeds were then placed in moist filter paper placed in sterile petri plates. These seeds were inoculated onto autoclaved sterile soil (soilrite) in bottles followed by incubation at 26 ± 2 C under 12 hours photoperiod adjusted with white fluorescent tube in tissue culture rooms with intermittent watering (once in 5 days) with sterile water.

P. capsici virulent to black pepper is obtained from Kerala Agricultural University, Thiruvananthapuram, India. P. capsici mycelial agar plug inoculation method was performed on detached leaves for infection assay experiment. P. capsici is axenically grown on potato dextrose agar medium (PDA) at 28°C for 4 days prior to inoculation. The abaxial side of the detached leaves (3 ^rd leaf from the top) from at least 10 different plants of Piper nigrum were pinpricked once and P. capsici mycelial agar plug or sterile PDA plugs (mock control) were placed at the pin-pricked sites and incubated. After 24 hours of incubation, the agar plugs from the site of infection were manually removed. Leaf discs of 7.0 mm diameter were harvested using a paper hole puncher from the inoculation site of all the leaves and immediately frozen in liquid nitrogen prior to total RNA and protein isolation.

Example 4: Osmotin peptide treatment

Osmotin peptide (OSMP) was synthesized based on osmotin protein sequence (as previously described). A lmg/mL stock solution was prepared by dissolving OSMP in sterile RNase free water. Different does of the peptide (1, 10, 100 and 200 μg/mL) were prepared and used to treat the leaves or detached leaves by evenly spreading 100 μL of the peptide solution on the leaves using a pipette, allowing a brief period to dry after in between each intermittent application. For seedling treatment, the peptide solution was added in the laminar flow under aseptic conditions, by complete soaking of the seedling at 2-leafed stage of growth. For each experiment at least 3 replications were performed and each experiment was repeated thrice. After 48h, the control and peptide-treated leaves were used for infection assays as described above. There was visual evidence of fungal inhibitory activity of osmotin peptide, as indicated by the marked decrease in disease symptoms in treated leaf. Control leaves however showed typical necrotic lesions at points of infection which spread and caused the death of leaves.

Example 5: Infection assay

Leaf infection assay was performed by agar disc method as previously described. For seedling infection, spore suspension of Ph. capsici prepared in sterile water was used to treat the leaves. After treatment all treated plant materials were incubated in the dark for 24h.

Example 6: Trypan Blue staining of infected leaves

Pathogen inoculated leaf samples were cut into l x l cm ² segments, incubated in an acetic acid: ethanol (1:3, v/v) solution overnight, followed by treating in an acetic acid: ethanol: glycerol (1:5:1, v/v/v) solution for at least 3 h. The samples were subsequently incubated overnight in a staining solution of 0.01% (w/v) trypan blue in lactophenol, rinsed 3-4 times with water and then stored in 60% glycerol until examination. Specimens were transferred onto microscopic slides and examined under a 40X magnification in a compound microscope. Example 7: Pathogen DNA quantification assay for comparing inhibitory potential of Osmotin protein and its derivative peptide on pathogen growth

P. nigrum leaves were pre-treated with osmotin protein (200μg/mL) or osmotin peptide (100 μg/ml) for 24 hours before inoculating with the pathogen (Ph. capsici). 24 hours after pathogen inoculation, total DNA was isolated from the pooled sets of all the samples separately, i.e., control P. nigrum (no treatments), Ph. capsici infected P. nigrum (24 hours post infection), osmotin protein treated + pathogen infected leaves (24 hours post infection) and osmotin peptide treated + pathogen infected leaves (24 hours post infection).

Genomic DNA was isolated and qRT-PCR was done using the primers listed in Table 1. The inhibitory effect of osmotin protein and osmotin peptide on the pathogen {Phytophthora capsici) was analysed by quantifying the amount of pathogen DNA present on the treated sample compared to control untreated (but infected) sample by quantitative Real Time PCR anlysis. Fungi Quant assay method (Fin et al, 2012) was used to accurately quantify the amount of DNA in the biomass of Phytophthora capsici. 28S rRNA was used to detect Ph. capsici in infected leaf and an 18S rRNA of Piper nigrum as an endogenous control using the corresponding gene specific primers that we designed as given in Table 1. Genomic DNA was quantified using qPCR-based approach and followed the guidelines of Minimum information for publication of Qualitative Real Time PCR Experiments (MIQE).

Real Time qPCR was performed in a total reaction volume of 20μL, containing 2 μL template DNA,1 μF of primers, 5.6 pL of sterile water, 10 pL of SYBR premix Ex Taq and 0.4 pL of ROX reference in a MicroAmp optical 96 well plate covered with Micro Amp optical adhesive film. The qPCR temperature profile is as follows- Initial denaturation (2min at 50.0 °C), for successive activation of DNA polymerase (10 min at 95.0 °C) followed by 40 cycles of 15 sec at 95.0 °C and lmin at 60.0 °C. Table 1- List of primers used for pathogen DNA quantification assay

There is a marked decrease in pathogen DNA in infected leaves after 24h of infection compared to the control Tris treated leaves as shown in Fig 2.

Example 8: Expression profiling of key genes of the phenyl propanoid pathway in black pepper {Piper nigrum )

Real Time quantitative PCR analysis was performed in leaves pretreated with osmotin peptide at different concentrations (1, 10 and 100 μg/mF) or Glycol chitosan (1 mg/mF) proceeded by Ph.capsici infection (24hpi) and compared with P. nigrum uninfected leaf (endogenous control) and leaf infected with Ph.capsici.

Genes involved in the secondary metabolite pathways and plant hypersensitive response were identified from the transcriptome data we had generated earlier (Mahadevan et al, unpublished). The selected genes and the corresponding primer sequences are provided in Table 2. Primer sequences for the selected genes were designed using Primer3Plus online tool (https://primer3plus.com/cgi-bin/dev/primer3plus.cgi).

Table!- Candidate Hypersensitive Response (HR) and Phenylpropanoid pathway genes of Piper nigrum and the corresponding primer sequences:

Briefly, P. nigrum leaves were treated with varying concentrations of osmotin peptide (1 μg/ml, 10 μg/ml & 100 μg/ml) for 24 hours before inoculating with the pathogen (P. capsici). 24 hours after the pathogen inoculation, samples were taken, and total RNA was isolated from the pooled sets of all the samples separately, i.e., control P. nigrum (no treatments), P. capsici infected P. nigrum (24 hours post infection), osmotin peptide treated P. nigrum (24 hours post treatment), peptide treated + pathogen infected P. nigrum and glycol chitosan treated + pathogen infected (positive control). RNA was extracted using Nucleospin RNA plant (Macherey-Nagel) kit, following manufacturers’ instructions. This was followed by the first- strand cDNA synthesis using 1 μg of total RNA from each sample using PrimeScript™ RT Reagent Kit (Perfect Real Time) by following manufacturer’s instructions.

For validation of the genes, qRT-PCR analysis was carried out using SYBR Premix Ex Taq II (Takara) on QuantStudio 5 Real-Time PCR system (Applied Biosystems). The PCR volumes were set to 20 μi and contained 10 mΐ SYBR Green PCR Premix (Takara), 2 μi cDNA template, 0.4 mΐ ROX Reference Dye (50X), 10 mM each of the corresponding forward and reverse primers and 6 mΐ sterile purified water. The PCR conditions were 50 °C for 2 min, 95 °C for 10 min, and 40 cycles of 15 s at 95 °C and 1 min at 60 °C. All reactions were performed in triplicates. The comparative CT method (2 ^_ΔΔC T method, Schmittgen and Livak, 2008) was utilized for the quantitative gene expression studies.

Example 9: Osmotin peptide retains the pathogen inhibitory activity of Piper colubrinum Osmotin protein

The pathogen inhibitory activity of osmotin peptide (OSMP) and pure protein was compared by quantifying fungal DNA by Real Time PCR analysis using pathogen specific primer. It was consistently observed that osmotin protein and peptide pretreatment for 24 hours significantly reduced the growth of pathogen on leaf surface as evidenced by the decreased presence of pathogen DNA quantified by measuring the expression level of pathogen specific DNA (28SrRNA) (Figure 2). Plant encoded 18srRNA gene was used as endogenous control.

On comparing the antifungal efficacy of osmotin protein and peptide, data indicate that osmotin peptide is more effective in restricting pathogen growth on leaves than purified Osmotin protein.

Example 10: Piper colubrinum osmotin derived peptide (PcOSMP) shows concentration dependent regulatory activity of gene expression levels in black pepper {Piper nigrum).

At increasing concentrations (1-100 μg/mL) osmotin peptide induces the transcript expression levels of antioxidant defense genes and critical genes of the phenyl propanoid pathway which includes Chalcone synthase (CHS), Caffeoyl-CoA- methyltransferase (COAMT), Glutathione S-transferase (GST), L-ascorbate peroxidase (AsPX) (Figure 3), Farnesyl diphosphate synthase (FPS2), Geranyl geranyl pyrophosphate synthase (GGPS) , NADPH Oxidase (NAPDHO) (Figure 4), Chorismate synthase (CHOS), Phenyl Ammonia Pyase (PAF) (Figure 5), Superoxide dimutase (SOD), Peroxiredoxin (PRDX), Peroxidase (PEX), Respiratory burst oxidase homolog protein D (RBOHD) and Glutathione peroxidase (GPX) (Figure 6). The gene expression profiles were assessed in comparison to the expression levels observed in response to pathogen infection (PnPc) and pretreatment with a positive control Glycol Chitosan (GC), which is a known plant defence elicitor. Fresh non treated P. nigrum leaves served as endogenous control (P.n).

The higher expression of genes in some cases is more pronounced at the lowest dose (1 μg/mL), though direct inhibitory activity was evident at higher doses tried (10-200 pg/mL). The defence protection is possibly routed through the ROS signalling pathway as evident by significant over expression of Phenyl Ammonia Lyase (PAL), Superoxide dimutase (SOD), Peroxiredoxin (PRDX), Peroxidase (PEX), Respiratory burst oxidase homolog protein D (RBOHD) and Glutathione peroxidase (GPX) genes of the ROS signalling pathway in osmotin peptide pre-treated leaves.

Example 11: Osmotin peptide inhibits growth of Phytophthora capsici on leaves of black pepper (. Piper nigrum).

Altogether the observed results suggest a strong defense elicitor role of the osmotin peptide, which is also indicated by the presence of Hyper sensitive Response (HR) at higher doses (10-100 μg) with subsequent fungal inhibition (Figure 7bl-b6). Osmotin peptide treatment on black pepper leaves at all concentrations, (1-100 pg/mL), showed inhibitory effect on the growth of the pathogen (. Phytophthora capsici). However, higher concentrations of peptide treatment caused more pronounced inhibitory activity like hyphal disintegration (Figure 8c, dl, d2), change in hyphal morphology and formation of vesicle-like structures inside the hyphae (Figure 8c) and appearance of malformed non functional sporangia (Figure 8dl,d2).

Apart from detached leaves, pre-treatment and infection assay experiments were also extended to seedlings, which also displayed similar results (Figure 9). The protection provided by osmotin peptide in controlling the severity of disease symptoms was retained upto 72 hpi (hours post infection) in detached leaves (Figure 10). Example 12: Combined pretreatment of Osmotin peptide and Glycol Chitosan (GC) provides added protection to leaves from Ph.capsici infection

Experiments were conducted on detached leaves to evaluate the combined effect of Glycol Chitosan (a commercially available plant defense elicitor) and Osmotn peptide pretreatment (24h) on leaves of P. nigrum prior to infection with Ph.capsici. It was observed that the combined treatment of the two substances had an additive inhibitory effect on growth of Ph.capsici, as evidenced by significant reduction in necrotic lesions on treated leaves, which was more pronounced than the effects of Osmotin peptide and GC applied alone. However, Osmotin peptide showed stronger inhibition compared to GC. The observations were taken at 72hpi. The level of protection was in the order- GC+Osmotin peptide > Osmotin peptide > GC (Figure 10 a-d).

Example 13: Osmotin peptide shows inhibitory activity on fungal hyphae after 3 hours of treatment

Osmotin peptide (lOOand 200 μg/mL) was added to actively growing hyphae removed from culture plates into microwell plates. After 3 hours incubations, the hyphae were stained with Trypan blue and observed under the microscope. Hyphae incubated in sterile water served as control. It was observed that osmotin (peptide) treated hyphae showed abnormality in hyphal morphology like bulging of hyphae, hyphal breakage with leakage of contents and vesicle formation, similar to earlier observations after 24 hours of pre-treatment.

Example 14: Supplementary results

From the observations that the hyphae as well as sporangial walls are targeted by the peptide it could be inferred that the peptide targets and interacts with hyphal cell wall proteins. A literature survey and detailed search of published protein data base (PDB) in Phytophthora sp, helped in narrowing down the focus for further study to few Ph.capsici/ oomycete cell wall proteins as putative targets of osmotin peptide. The selected putative targets and their protein data base (PDB) codes are provided in Table 3.

Table 3

Images of docking simulations performed on two of the target proteins 6IUQ and 3KH8 is illustrated in Figure 11(S1-S4)