BACKGROUND Mycobacteria have caused disease in humans since recorded history began.

Tuberculosis, a disease caused by the actinomycete bacterium Mycobacterium tuberculosis, is estimated by the World Health Organization to be one of the most widespread of pathogenic diseases causing approximately 2,500,000 deaths and 7,500,000 new infections worldwide annually. Often infecting immunocompromised patients, M tuberculosis infections have soared with the HIV/AIDS pandemic. Drug resistant strains of M tuberculosis are being observed at an alarming rate. More than a third of newly diagnosed M. tuberculosis infections in New York and San Francisco were transmitted person-to-person and half of the infections were by drug resistant isolates (Alland, et al.

1994."Transmission of tuberculosis in New York City. An analysis by DNA fingerprinting and conventional epidermiological methods,"NEngl JMed 330 : 1710-1716 and Small, et al. 1994."The epidemiology of tuberculosis in San Francisco. A population- based study using conventional and molecular methods,"NEngl JMed 330 : 1703-1710).

Drug resistance in M tuberculosis is hypothesized to result from the survival of strains with spontaneous random mutations as susceptible organisms are eliminated instead of by a general resistance mechanism that could be pharmacologically targeted (Springer, et al.

2001."Mechanisms of streptomycin resistance: selection of mutations in the 16S rRNA gene conferring resistance,"Antimicrob Agents Chemother 45: 2877-2884; Wu, et al. 1999.

"Molecular mechanisms of drug resistance in Mycobacterium tuberculosis clinical isolates,"Chin Med J 112: 524-528; Bamaga, et al. 2001."New mutations in pncA of in vitro selected pyrazinamide-resistant strains of Mycobacterium tuberculosis,"Microb Drug Resist 7: 223-228). Therefore, new methods to effectively treat the resistant bacteria are desired.

Antisense therapeutics, synthetic nucleic acids complementary to a portion of a transcript desired to be downregulated, can be used to treat antibiotic-resistant M tuberculosis. First, M tuberculosis cells take up synthetic phosphorothioate nucleic acids when covalently modified (Rapaport, et al. 1996."Antimycobacterial activities of antisense oligodeoxynucleotide phosphorothioates in drug-resistant strains,"Proc Natl Acad Sci USA 93: 709-713) or unmodified (Harth, et al. 2000."Treatment of Mycobacterium tuberculosis with antisense oligonucleotides to glutamine synthetase mRNA inhibits glutamine synthetase activity, formation of the poly-L-glutamate/glutamine cell wall structure, and bacterial replication,"Proc Natl Acad Sci USA 97: 418-423).

Secondly, synthetic nucleic acids have been observed in mononuclear phagocytes, the host cells for a M tuberculosis infection, when administered to mice (Zhao, et al. 1998.

"Cellular distribution of phosphorothioate oligonucleotide following intravenous administration in mice,"Ant Nucl Acid Drug Dev 8: 451-458). Thirdly, antisense therapeutics are relatively straightforward to design around genetic mutations in resistant strains. As the pharmacokinetics and economic feasibility improve for synthetic nucleic acids, antisense molecules become more important in treating diseases caused by resistant bacteria. Antisense therapeutics for treatment of mycobacteria infections have been reported wherein antisense oligodeoxyribonucelotides targeted the metabolic genes associated with mycobacterial cell wall components such as aspartate kinase and glutamine synthetase (Rapaport, et al. 1996. Proc Natl Acad Sci USA 93: 709-713; Harth, et al. 2000.

Proc Natl Acad Sci USA 97: 418-423).

A promising target for developing therapies against all M. tuberculosis strains is mycothiol. Because of the destructive effect of free oxygen in cells, organisms have developed mechanisms to detoxify oxygen. For example, mammalian cells synthesize glutathione to protect cells from oxygen toxicity. Actinomycetes, bacteria of the order Actinomycetales, do not make glutathione; instead, they synthesize mycothiol. Mycothiol (1-D-myo-inosityl-2- (N-acetyl-L-cysteinyl) amido-2-deoxy-alpha-D-glucopyranoside; AcCys-GlcN-Ins ; MSH) is the major thiol produced by actinomycetes to prevent oxidative damage and is more resistant than glutathione to autooxidation. Two studies elegantly describe how mycothiol acts: an alkylating agent is converted to an S-conjugate of mycothiol which is cleaved, releasing a mercapturic acid from the cell and maintaining

GlcN-Ins within the cell for the resynthesis of mycothiol (Anderberg, et al. 1998.

"Mycothiol biosynthesis and metabolism. Cellular levels of potential intermediates in the biosynthesis and degradation of mycothiol in Mycobacterium smegmatis,"JBiol Chem 273: 30391-30397 and Newton, et al. 2000."A novel mycothiol-dependent detoxification pathway in mycobacteria involving mycothiol S-conjugate amidase,"Biochem 39: 10739- 10746). Newton and coworkers discovered that the M. smegmatis amidase enzyme is responsible for cleaving the mycothiol S-conjugate and demonstrated that the amidase is capable of doing the same with an electrophilic antibiotic, cerulenin, thus playing an important role in reducing its antimicrobial properties. The importance of mycothiol to bacterial physiology and its hypothesized role in deactivating antibiotics indicates mycothiol to be a target for developing drugs to treat M. tuberculosis infections.

Three open reading frames (ORF) have been identified in the M tuberculosis genome as being important for mycothiol production: Rvl 170 (SEQ ID NO : 1 and FIG. 1), Rvl082 (SEQ ID NO : 2 and FIG. 2), and Rv0323c (SEQ ID NO : 3 and FIG. 3). With a partial amino acid sequence from the Ad smegmatis amidase, the same group found a homologous ORF within the M tuberculosis genome: Rv1082. (Newton, et al. 2000.

Biochem 39: 10739-10746). Functional assignment of Rv1082 as an amidase was based upon genetic and biochemical information (Newton, et al. 2000. Biochem 39: 10739- 10746). Inference from amino acid similarity between Rv1082 and Rv0323c (23% amino acid identity), and sequence similarity between Rv1082 and Rv1170 (33% identity) indicated that Rv0323c and Rvl 170 also play a role in mycothiol biosynthesis. Finally, the amino acid identity between Rvl 170 and Rv0323c was demonstrated to be 23%.

Subsequently, Rv1170 was shown by biochemical assay (Newton, et al. 2000."N-Acetyl- l-D-myo-inosityl-2-amino-2-deoxy-alpha-D-glucopyranoside deacetylase (MshB) is a key enzyme in mycothiol biosynthesis,"JBacteriol 182 : 6958-6963) as well as genetic mutation to play a role in mycothiol biosynthesis.

From the three separate ORFs Rv1170, Rv1082, or Rv0323c identified and implicated in mycothiol production, mycothiol inhibitors have now been found. The mycothiol inhibitors are synthetic nucleic acids that are complementary in sequence to a portion of Rvl 170, Rv1082, or Rv0323c.

SUMMARY OF THE INVENTION In one aspect, the invention is an antisense oligonucleotide comprising 16-24 nucleotides connected by covalent linkages, wherein the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid encoding a mycothiol protein as depicted in SEQ ID NO : 1 and wherein the oligonucleotide inhibits the expression of the mycothiol protein. Exemplary antisense oligonucleotides are selected from the group consisting of SEQ ID NO : 4,5,6,7,8,9,10,11,12 and 13.

In another aspect, the invention is an antisense oligonucleotide comprising 16-24 nucleotides connected by covalent linkages, wherein the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid encoding a mycothiol protein as depicted in SEQ ID NO : 2 and wherein the oligonucleotide inhibits the expression of the mycothiol protein. Exemplary antisense are selected from the group consisting of SEQ ID NO : 14,15,16,17,18,19,20,21,22 and 23.

In another aspect, the invention is an antisense oligonucleotide comprising 16-24 nucleotides connected by covalent linkages, wherein the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid encoding a mycothiol protein as depicted in SEQ ID NO : 3 and wherein the oligonucleotide inhibits the expression of the mycothiol protein. Exemplary antisense oligonucleotides are selected from the group consisting of SEQ ID NO : 24,25,26,27,28,29,30,31,32 and 33.

In another aspect, the invention is a method of reducing mycothiol production in an actinomycete cell, comprising contacting the cell with an effective amount of one or more antisense oligonucleotides comprising 16-24 nucleotides connected by covalent linkages, wherein the oligonucleotide has a sequence which specifically binds to a nucleic acid encoding an actinomycete mycothiol protein and decreases the expression of the mycothiol protein. This method is effective in reducing mycothiol production in Mycobacterium tuberculosis. In one preferred method, the antisense oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 1, preferably selected from the group consisting of SEQ ID NO : 4,5,6,7,8,9,10,11, 12 and 13. In another preferred method, the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 2, preferably selected from the group consisting of SEQ ID N0 : 14,15,16,17,18,19,

20,21,22 and 23. In another preferred method, the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 3, preferably selected from the group consisting of SEQ ID NO : 24,25,26,27,28,29, 30,31,32 and 33. In yet another preferred method, oligonucleotides having a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 1,2 or 3 are used in combination, preferably selected from SEQ ID NO : 4,5, 6,7,8,9,10,11,12,13,14,15,16,17,18,19,20,21,22,23,24,25,26,2 7,28,29,30, 31,32 and 33.

In another aspect, the invention is a method of inhibiting the growth of an actinomycete cell comprising contacting said actinomycete with an effective amount of an antisense oligonucleotide comprising 16-24 nucleotides connected by covalent linkages, wherein the oligonucleotide has a sequence that specifically binds to a nucleic acid encoding a mycothiol protein and decreases the expression of the mycothiol protein so that the exposure of the actinomycete to the destructive effect of free oxygen is increased. This method is useful in the treatment of infections caused by Mycobacterium tuberculosis. In one preferred method, the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 1, preferably selected from the group consisting of SEQ ID NO : 4,5,6,7,8,9,10,11,12 and 13. In another preferred method, the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 2, preferably selected from the group consisting of SEQ ID NO : 14,15,16,17,18,19,20,21,22 and 23.

In another preferred method, the oligonucleotide has a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 3, preferably selected from the group consisting of SEQ ID NO : 24,25,26,27,28,29,30,31,32 and 33.

In yet another preferred method, oligonucleotides having a sequence which specifically binds to an open reading frame region of a nucleic acid as depicted in SEQ ID NO : 1,2 or 3 are used in combination, preferably selected from SEQ ID NO : 4,5,6,7,8,9,10,11,12, 13,14,15,16,17,18,19,20,21,22,23,24,25,26,27,28,29,30,31,32 and 33. The treatment method of the present invention can include the administration of an effective amount of one or more antisense synthetic nucleic acids delivered simultaneously with an antibiotic or concomitantly with an antibiotic.

BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 depicts the nucleotide sequence of M tuberculosis ORF Rvl 170.

FIG. 2 depicts the nucleotide sequence of M. tuberculosis ORF Rv1082.

FIG. 3 depicts the nucleotide sequence of M tuberculosis ORF Rv0323c.

FIG. 4 depicts growth inhibition of Mycobacterium bovis BCG when treated with antisense oligonucleotides (AS) to Rv1082 (open circle) or with sense molecules (S) to Rv1082 (closed squares).

FIG. 5 depicts growth inhibition of Mycobacterium bovis BCG when treated with antisense oligonucleotides (AS) to Rv1170 (open circle) or with sense molecules (S) to Rv1170 (closed squares).

FIG. 6 depicts the growth inhibition of Mycobacterium bovis BCG achieved when simultaneously treated with antisense (AS) to both Rvl 170 and Rv1082 (closed bar).

Cultures to which sense molecules to both Rv1082 and Rv1170 (open bar) were added served as a control.

DETAILED DESCRIPTION OF THE INVENTION Synthetic antisense oligonucleotides useful in the inhibition of mycothiol production in M tuberculosis cells have now been found. These antisense molecules are synthetic nucleic acids that are complementary in sequence to a portion of Rv1170, Rv1082, or Rv0323c. In one aspect, synthetic nucleic acids comprised of adenine, thymine, guanine, and cytosine sugars are designed to bind with a large amount of free energy to particular regions of the Rv1170 ORF (SEQ ID NO : 1) mRNA, Rv1082 ORF (SEQ ID NO : 2) mRNA, or Rv0323c ORF (SEQ ID NO : 3) mRNA in order to inhibit mycothiol production.

In our analysis of these 3 ORFs together, a high degree of amino acid sequence conservation in a region between position 125 and 153 relative to the Rv1082 sequence was noted. This region in Rv1082 contains a cysteine residue at postion 145, and a cysteine is known to play a role in the catalytic functionality of the Rv1082 amidase. By contrast, Rv0323c contains a nonpolar alanine at Rv0323c postion 130 and Rv1170 contains a polar threonine at Rv1170 postion 150, and each of these positions were

presumed to be homologous to position 145 in Rv1082. These amino acid differences at the possible catalytic residue within a conserved region were then considered to indicate a similarity in substrate but a distinct method of catalytic activity for each of these ORFs.

Designing antisense oligonucleotides to inhibit the production of a transcript whose sequence is known is more complicated than simply identifying a complementary sequence. Length, composition, and binding position of antisense oligonucleotide on the transcript are variables that must be determined for each target. Length of an antisense oligonucleotide increases the potential binding energy to the target and sequence discrimination ability to prevent nonspecific binding events. Composition of an antisense oligonucleotide further increases the potential binding energy to the target. The position on the target to which the antisense oligonucleotide binds is critical for activity and sometimes difficult to predict. Many nucleic acid targets, for example are self- complementary in regions, giving them structure in vivo that precludes antisense oligonucleotide targeting at certain positions. Additionally, nucleic acid targets in vivo could become complexed with proteins, further precluding binding. Furthermore, not all positions on a target are equally effective for inhibition when bound.

To aid in the identification of likely antisense oligonucleotides, a method of systematically evaluating a target sequence to identify and rank antisense oligonucleotides is described in U. S. Patent 5,856,103. The method disclosed in this patent uses data generated from thermodynamic stability studies that determined nearest-neighbor nucleic acid pair values to iteratively quantify antisense nucleic acids complementary to a target sequence. The method scans the target sequence iteratively by each base for sequences of antisense nucleic acids of a predetermined length, making a thermodynamic calculation of each antisense nucleic acid. The thermodynamic calculation of each antisense nucleic acid utilizes a combination of nearest-neighbor base pair stabilities, weighted by the fraction of each nearest-neighbor pair in the antisense nucleic acid. After compiling the calculations for each position along the target sequence, the method ranks each antisense nucleic acid sequence by its thermodynamic calculation. The most stable nucleic acid has the highest melting temperature, or most negative AG value, and is predicted to bind most tightly to the target.

Using the method disclosed in U. S. Patent No. 5,856,103, ORF Rv1170, ORF Rv1082, and ORF Rv0323c were analyzed, and the resulting antisense oligonucleotides are listed in Table I as SEQ ID NO : 4-13, in Table II as SEQ ID NO : 14-23, and in Table III as SEQ ID NO : 24-33, respectively, with their binding position to the respective transcript, Tm, and free energy.

Table I. Anti-mycothiol Antisense Oligonucleotides Complementary to Rv1170* SEQ ID NO Antisense sequence (5'-3'! Position** T,-AG (kcal/mol) 4 cctcgccctcctcacccagg 123 67.84 48.85 5 tgacctcgccctcctcaccc 126 65.28 47.00 6 acctcgccctcctcacccag 124 65.19 46.48 7 gacctcgccctcctcaccca 125 65.19 46.48 8 cgccaatgacctcgccctcc 132 64.33 45. 92 9 cctgctcatcggcctcgacg 678 63.58 44.54 10 caatgccccgacggtctgcc 344 63.34 44.50 11 gactccgctggtctgtgccg 297 63.27 43.97 12 atgacctcgccctcctcacc 127 62.51 44.37 13 ccaatgacctcgccctcctc 130 62.25 44.71 * Ru1170 given in SEQ ID NO : 1 ** Position is the 5'most nucleotide on the transcript that binds to the 3'most

nucleotide of the antisense drug.

Table II. Anti-mycothiol Antisense Oligonucleotides Complementary to Rv1082* SEQ ID NO Antisense sequence (5'-3'! Position** G (keal/mol 14 ccacccgcaccagcgcctcg 339 70.19 48.92 15 tctcgccgcgctcaccaccg 120 67.90 47.18 16 ccacagccgctcctgccagg 764 67.31 46.63 17 gcgcccttgctggactcgtc 43 63.83 44.54 18 gccgccgttctcgtcgtagg 389 63.60 44.67 19 gtagccgccgttctcgtcgt 392 63.10 43. 50 20 ccaccagcacgcgatgaccc 90 63.09 43.29 21 ccagcacgcgatgaccctcg 87 63.06 43.10 22 agcgcctcggtggacacctc 328 62.84 43.11 23 cagcgcctcggtggacacct 329 62.84 43.11 * Rv1082 given in SEQ ID NO : 2.

** Position is the 5'most nucleotide on the transcript that binds to the 3'most

nucleotide of the antisense drug.

Table III. Anti-mycothiol Antisense Oligonucleotides Complementary to Rv0323c* SEQ ID NO Antisense sequence (5'-3'! Position** _, <-AG (koal/mol 24 tgaccgtgaccgcgcccccc 499 68. 58 48.84 25 cgtgaccgcgccccccgaag 495 67.86 47.56 26 ctgggtgtcgaagccgccgc 406 65.00 44.99 27 cggctagctgtcggctgcgg 543 64.64 44.72 28 cacccaataccgccccgagc 78 63.28 44.77 29 ggctagctgtcggctgcggt 542 62.55 42.94 30 ggttgcgcgacggtggtcgg 374 62.41 42.89 31 gcccgaaggactcgtcgtcc 60 62.41 43.22 32 tcacccaataccgccccgag 79 61.05 42.74 33 cctgttacgccgttgtcgtc 349 60.71 42.16 * Rv0323c given in SEQ ID NO : 3.

* * Position is the 5'most nucleotide on the transcript that binds to the 3'most nucleotide of the antisense drug.

As used herein, the term"oligonucleotide"refers to an oligomer of nucleotide or nucleoside monomers consisting of naturally-occurring bases, sugars and backbone linkages. The oligonucleotides of the present invention can also include one or more modified or substituted oligomers known in the art to improve cellular uptake, target recognition, discrimination, binding, inhibition efficacy, or increased nuclease resistance, so long as the substitute oligomer (s) essentially functions in the same manner as the oligomer with naturally-occurring bases. The antisense oligonucleotides of the present invention can be made of any synthetic nucleic acid, including single-stranded deoxynucleic acid, ribonucleic acid, or derivatives (modified bases, sugars and backbone linkages) thereof wherein the bases or backbone or sugar moieties are altered, so long as Watson-Crick base pairing between the target mRNA and the antisense oligonucleotide is maintained. Examples of modified bases useful in making the antisense oligonucleotides of the present invention include but are not limited to appropriate oxo, amino, halo, thiol, hydroxy and lower alkyl (C1-C3) substitutions as well as aza ring substitutions of adenine, uracil/thymine, cytosine, or guanine. Other examples of modifications to the oligonucleotide include but are not limited to modifying the phosphorus or oxygen heteroatom in the phosphate backbone, lower alkyl or cycloalkyl backbone linkages, including 2'-fluoridated, 0-methylated, methyl phosphonates, phosphorothionates,

phosphorodithionates, and morpholino oligomers. The most preferred synthetic nucleic acid chemistry for this invention is phosphorothioate chemistry wherein an oxygen atom of the phosphate backbone of a natural nucleic acid is replaced with a sulfur atom. With respect to SEQ ID NO : 4-33, the present invention also includes mismatches within the sequences so long as the inhibition of mycothiol is achieved.

It will be appreciated by those who practice in the art of nucleic acid chemistries that any number of synthetic chemistries can be employed to produce the antisense oligonucleotides described herein. For example, an Applied Biosystems 380B DNA synthesizer can be used. Preferably, the antisense oligonucleotides of the present invention are synthesized to contain 16-24 nucleotides, and more preferably, 20 nucleotides.

The antisense oligonucleotides of the present invention can be used to inhibit the mycothiol production of actinomycete cells and to inhibit the growth of actinomycetes, especially M tuberculosis. Also contemplated is a method to treat humans or animals with A ! tuberculosis infections by inhibiting the production of mycothiol, an antioxidant.

Inhibition of the three ORF's Rvl 170, Rv1082, and Rv0323c by the antisense oligonucleotides of the present invention can be used to produce antibiotic sensitization in formerly resistant M. tuberculosis strains and to inhibit the growth and cellular metabolism of M. tuberculosis cells. Since mycothiol is synthesized by actinomycetes as protection against the damaging effects of oxygen, targeting mycothiol production, turnover, or activity with one or more of the mycothiol antisense nucleic acid molecules of the present invention can be used to treat M. tuberculosis infections directly. The mycothiol-inhibiting antisense oligonucleotides of the present invention can also be used in combination simultaneously or concomitantly with other known drugs used to treat A ! tuberculosis infections. The antisense drugs disclosed herein can also be effectively used to treat infections caused by other actinomycetes besides M tuberculosis, especially other mycobacteria, to the degree that pathogenic microorganism has proteins associated with mycothiol production having ORFs homologous with Rv1170, Rv1082, and Rv0323c.

It can be appreciated by those in the art of drug delivery that the delivery of the anti-mycothiol antisense therapeutics of the present invention can be accomplished by a variety of means, some identified and some yet unknown, all of which are contemplated as part of this invention. For example, the anti-mycothiol oligonucleotides can be delivered

by the usual parenteral injection of antisense molecules (Akhtar, et al. 2000."The delivery of antisense therapeutics,"Adv Drug Deliv Rev 44: 3-21). However, for the treatment of tuberculosis, a more localized delivery route to the nasal muccosa (Finotto, et al. 2001.

"Local administration of antisense phosphorothioate oligonucleotides to the c-kit ligand, stem cell factor, suppresses airway inflammation and IL-4 production in a murine model of asthma,"JAllergy Clin Immunology 107: 279-286), mouth (Templin, et al. 2000.

"Pharmacokinetic and toxicity profile of a phosphorothioate oligonucleotide following inhalation delivery to lung in mice,"Antisense Nucleic Acid Drug Dev 10: 359-368), or lung (Jasti, et al. 2000."Permeability of antisense oligonucleotide through porcine buccal mucosa,"Int JPharm 208: 35-39) are also preferred methods of administration.

EXAMPLE 1: Reduced fluorescence of M for green fluorescent protein (GFP) in the presence of antisense LAS) to Rv1082 and Rvl 170 Mycobacterium bovis BCG transformed with the green fluorescent protein (GFP) expression system pSC300 (Cowley and Av-Gay 2001."Monitoring promoter activity and protein localization in Mycobacterium spp. using green fluorescent protein,"Gene 264: 225-231) was grown in 7H9 medium with 10% OADC and 0.05% Tween-20. Cells were grown for 6 days (144 hours) in the absence of oligonucleotide treatment and subsequently treated with antisense (AS) sequences to either the gene Rv1082 (SEQ ID NO : 14) or Rv1170 (SEQ ID NO : 4). The control used for each experiment was the reverse and compliment (or the sense) sequence with identical phosphorothioate backbone chemistry to the AS sequence. After treatment, cultures were then maintained for an additional 8 days, for a total of 336 hours in culture. GFP fluorescence of bacterial cultures was quantified using a spectrofluorometer (BioRad VersaFluore) at the indicated time intervals shown in FIG. 4 and 5. At the indicated time intervals, 100 mls of each culture was removed, diluted into 12 ml of phosphate buffered saline (PBS), and the relative fluorescence units (RFU) were measured using a 490/10 excitation filter and a 520/10 emission filter.

No significant differences (P > 0.05) were observed between AS treatment and sense treatment control to Rv1082 in the GFP fluorescence, an indicator of cellular activity

(FIG. 4) before treatment. By contrast, significant differences (P < 0.05) in GFP fluorescence of AS treated and sense control cultures to Rv1082 are observed at 264 hours (5 days) and 336 hours (8 days) post-treatment (FIG. 4). The AS treatment with Rvl 170 shows similar patterns to the treatment as shown in Rv1082. Again, no significant differences (P > 0.05) were observed between AS treatment and sense treatment control to Rv1170 in the GFP fluorescence, (FIG. 5) before treatment. Also by contrast to before treatment, significant differences (P < 0.05) in GFP fluorescence of AS treated and sense control cultures to Rv1170 are observed beginning at 240 hours (4 days) and continuing to 336 hours (8 days) post-treatment (FIG. 5).

EXAMPLE 2: Reduced of cellular density of Mvcobacterium bovis BCG in the presence of combined antisense (AS) therapies to both Rv1082 and Rv1170 Mycobacterium bovis BCG was grown in 7H9 medium with 10% OADC and 0.05% Tween-20. Cultures were grown to early log-phase before treatment. Treatment consisted of one of the following treatments: 1) AS (antisense) molecules to both Rv1082 and Rv1170 or 2) the control sense molecules to both Rv1082 (SEQ ID NO : 14) and Rvl 170 (SEQ ID NO : 4). Every 24 hours 1 ml of each culture was removed, and the OD at 600 nm of each culture was measured for each culture in a Jenway 6405 UV/Vis.

Spectrophotometer.

No significant differences are seen either at the time of treatment (0 hours) or 24 hours after treatment (P > 0.05). However, at 48 hours after treatment, there is a significant reduction in the cellular densities in the combined AS treatment cultures when compared to the sense treatment culture controls (P = 0.035) (FIG. 6). Comparing the response times to combined AS treatment versus individual AS treatments, there appears to be a synergistic effect that reduces the response time in growth inhibition with both Rv1082 and Rv1170 administered together rather than individually.