The invention relates to the field of medicine, in particular to means and methods for the treatment of the devastating skin blistering disease Recessive dystrophic epidermolysis bullosa (RDEB; MIM# 226600).

RDEB is caused by biallelic null mutations in the COL7A1 gene encoding type VII collagen (1). Type VII collagen (C7) is the major component of anchoring fibrils that secure attachment of the epidermis to the dermis and is expressed by both basal keratinocytes and dermal fibroblasts (2). The absence of type VII collagen in RDEB leads to severe blistering of the skin and mucosa just below the lamina densa. Abnormal wound healing with excessive scarring inevitably results in the fusion of fingers and toes (i.e. pseudosyndactyly) (3). Patients have a highly increased risk of aggressive squamous cell carcinomas, which are the major cause of death before the age of 30-40 (4).

The 118 small exons of COL7A1 collectively encode the type VII collagen pro-αΐ chain, which consists of a central 145 kDa triple helix domain (THD) flanked by a 145 kDa amino-terminal non-collagenous 1 (NCI) domain and a 30 kDa carboxyl-terminal non-collagenous 2 (NC2) domain (5). Posttranslational modifications lead to stable trimerization of three pro-αΐ chains to pro-type VII collagen homotrimers, followed by removal of part of the NC2 domain and antiparallel dimerization of type VII collagen trimers (6). Numerous type VII collagen dimers aggregate laterally to form anchoring fibrils that hnk the epidermis to the dermis. Notably, the THD is encoded by exons 29 to 112, which are all in-frame.

At the moment, treatment for RDEB is only symptomatic. Although several approaches are under study (7-12), there still is a great need to test novel approaches, especially systemic strategies. Antisense oligonucleotide (AON)-mediated exon skipping seems to be an attractive therapeutic approach for RDEB. AONs are short, modified RNA molecules designed to modulate pre-mRNA splicing of specific in-frame target exons harbouring the disease-causing mutation. Through complementary binding of the AON to its target exon, this exon is hidden from the splicing

machinery and spliced out with its flanking introns, allowing the production of an internally truncated, but in the ideal outcome a largely functional protein (13).

COL7A1 seems a suitable candidate gene for AON-mediated exon skipping, as most RDEB patients have exonic mutations, and most COL7A1 exons are in-frame and encode highly repetitive Gly-X-Y amino acid sequences. This is underscored by findings that patients carrying COL7A1 mutations that lead to the natural skipping of an in-frame exon have relatively mild phenotypes (14). Additionally, the severity of the clinical phenotype in RDEB is highly correlated to the level of expression of partial type VII collagen variants at the cutaneous basement membrane zone (BMZ) (15).

The potential of AON-mediated exon skipping is underscored further by studies in other genetic diseases (27), most notably Duchenne muscular dystrophy, where marketing authorization applications have been filed with the Food and Drug Administration (FDA, USA) and the European Medicines Agency (EMA) for an AON to induce exon 51 skipping (28). Also, previous studies suggested that this approach may work for COL7A1.

WO2013/053819 relates to an antisense oligonucleotide

complementary to a nucleic acid sequence of COL7A1 gene that is necessary for correct splicing of one or more exons which encode amino acid sequence of type VII collagen implicated in dysfunction of a mutated type VII collagen wherein said exons are selected from the group consisting of exon 73, 74 or 80 of the COL7A1 gene. Only in vitro data are shown in WO2013/053819. Christiano et al. (Human Mol. Genetics, 1995, Vol. 4, 1579-1583) discloses a genetic linkage between the G2623C mutation in exon 105 and pretibial epidermolysis bullosa in Taiwanese subjects.

Roller et al. (J. Invest. Dermatology, 2012 Vol. 132, pg. S93) show correction of mutations in the COL17A1 and COL7A1 genes using double RNA trans-splicing, and propose it as a tool in the treatment of DEB.

Goto et al. (29) reported using AON in targeted exon 70 skipping to modulate COL7A1 splicing. Introduction of a mutation-specific AON into DEB keratinocytes harboring c.5818delC showed that the AON induced skipping of exon 70 in the abnormal c.5818delC allele. Furthermore, 6.2% of DEB keratinocytes started to express type VII collagen in vitro after application of the mutation-specific AON. A single injection directly into the graft of the AON into the rat model grafted with DEB keratinocytes and fibroblasts induced a low amount of type VII collagen expression.

However, despite these attempts there is still a need for AONs capable of inducing collagen expression more efficiently in vivo, in particular AONs that can exert a systemic effect.

The present inventors surprisingly observed this goal can be achieved by the provision of novel, specifically designed AONs against exon 105 or exon 13 of the COL 7A1 gene. More in particular, they found that exon 105 and exon 13 of each contain a target sequence that is preferentially targeted by AONs to achieve highly efficient exon skipping (up to 50% in vitro). The exon 105 AONs are characterized in that they are capable of binding to a target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 105 sequence, which stretch sequence comprises at least one of the nucleotide sequences 5'-CCUGGUA-3' and 5'-AGGAG-3'. Example 5 herein below demonstrates that variant exon 105 AONs complying with

conventional design criteria (length, Tm, CG content etc.) but lacking a sequence that can bind to one of the target sequences of the invention do not induce exon skipping. This clearly shows that there is a special technical effect associated with the claimed sequences, and that the present invention goes beyond the mere provision of exon-skipping antisense molecules targeting COL 7A1.

The exon 13 AONs of the invention are characterized in that they bind to a target sequence, the target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 13 sequence 5' -GAGUCAGACA GCAUUC GACUUGGAUGACGUUCAGGCUGGGCUUAGCUACACUG UGCGG-3'.

The novel AONs lead to in-frame exon skipping at the RNA level and restore C7 protein production in vitro in cultured primary keratinocytes and fibroblasts, and in vivo using a human skin-graft mouse model,

demonstrating the potential of this approach as a systemic therapeutic strategy for RDEB. Thus, whereas the prior art like Goto et al. only show a local effect, the present invention shows a systemic exon skipping.

Accordingly, in one embodiment the invention provides an isolated AON of 14 to 35 nucleotides in length capable of binding to a target sequence of exon 105 in the COL7A1 gene, said target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 105 sequence and comprising at least one of the nucleotide sequences 5'-CCUGGUA-3' and 5'-AGGAG-3'. For example, the AON is 14 to 30 nucleotides in length, preferably 15-28 nucleotides, more preferably 18 to 26 nucleotides. The nucleotides can be naturally occurring nucleotides or analogs thereof. In a specific aspect, said AON comprises between 15-25 nucleotides or analogues thereof.

In one aspect, the exon 105 AON comprises the nucleotide sequence 5'- UACCAGG-3', wherein uracil bases (U) are optionally thymine bases (T). In another aspect, the exonl05 AON comprises the nucleotide sequence 5'- CUCCU-3', wherein uracil bases (U) are optionally thymine bases (T).

In a specific embodiment, the AON comprises the nucleotide sequences 5'- UACCAGG-3' and 5'-CUCCU-3' wherein uracil bases (U) are optionally thymine bases (T).

To allow for efficient target sequence binding, the AON is typically capable of binding to the target sequence with a Tm of at least 44°C, preferably at least 48°C, more preferably at least 50°C.

In our in vitro studies using primary keratinocytes and fibroblasts from a patient with RDEB due to the homozygous COL 7A1 mutation c.7828C>T, p.Arg2610Ter in exon 105, we demonstrated skipping of the mutated exon 105 at the RNA level accompanied by de novo type VII collagen expression at the protein level upon treatment with a combination of two anti-exon 105 AONs. To test the in vivo applicability of AONs, we validated a skin-humanized mouse model in which a human skin graft is grown on the back of athymic nude mice to create a test skin model (17). Exon 105 skipping and de novo type VII collagen expression was observed after systemically treating mice carrying skin grafts constituted of the same patient cells with the same AONs. Our results show that the anti-exon 105 AONs are capable of inducing skipping of their target exon from the

COL 7A1 pre-mRNA and traveling through the treated mice to exert their exon skipping effect in the patient graft at a relative large distance from the site of injection. Our results also demonstrate that the skin -humanized mouse model is a reliable and relative easy model to test systemic therapeutic approaches for genetic skin diseases.

One of the advantages of our skin-humanized mouse model, besides the possibility to easily treat real human skin and monitor the long-term treatment effects, is that it enables a personalized medicine approach by allowing easily targeting different COL7A1 mutations. Because there are more than 700 different RDEB causing mutations known, such a

personalized, mutation independent test model is highly favorable. Our skin graft mouse model lacks an RDEB phenotype that can be corrected by AON treatment, due to the small size of the grafts. A Col7al knock-out mouse model, carrying the human COL7A1 gene harboring a null-mutation and displaying the RDEB phenotype to allow the observation of phenotype correction upon AON treatment, would evidently be ideal. Nevertheless, the grafting model used in this study provides the versatility necessary for the diverse patient population.

The type VII collagen protein that is produced after exon skipping will lack the amino acids encoded by the skipped exon, which might have functional consequences related to the function of the exon involved. Exon 105 is a small exon in the THD and likely has a predominantly structural function. In contrast to many other proteins that do not tolerate the skipping of an exon, skipping of exon 105 has been shown to have rather limited functional consequences on type VII collagen (Bornert et al., manuscript in preparation). This is supported by our findings of the normal incorporation of Δ105 type VII collagen at the graft's BMZ. Taken together, the confirmed high functionality of the Δ105 type VII collagen, and the correlation of type VII collagen expression and the severity of the

phenotype, support the rationale behind the exon skipping approach.

It is yet unknown which cell type is responsible for the restoration of type VII collagen expression upon AON treatment: keratinocytes,

fibroblasts, or both. Notably, basal keratinocytes show higher levels of expression of type VII collagen than fibroblasts (6). Therefore, the treatment effect is anticipated to be higher if the systemically administered AONs reach the basal keratinocytes. Nevertheless, targeting the fibroblasts only may already result in significant amelioration of the phenotype, as indicated by the clinical improvement seen after injections of type VII collagen expressing fibroblasts (21). As only 30-35% of type VII collagen expression is needed to prevent skin fragility (33), complete restoration of type VII collagen expression seems, however, not required for significant phenotypic improvement. Therefore, targeting the fibroblasts alone may already result in significant amelioration of the phenotype, as witnessed by the clinical improvement after injections of type VII collagen expressing fibroblasts (21).

In conclusion, by a systemically induced skipping of exon 105 in vivo, we demonstrate that AON-mediated exon skipping is a promising systemic therapeutic strategy for the treatment of RDEB caused by mutations in one of the -90% in-frame COL7A1 exons.

Exemplary AONs for target exon 105 and inducing exon skipping include oligonucleotides having a sequence selected from the group consisting of

5'- GAUACCAGGCACUCCAUCCU-3'

5'- AUACCAGGCACUCCAUCCU-3'

5'- UACCAGGCACUCCAUCCU-3'

5'- GAUACCAGGCACUCCAUCCUU-3'

5'- CGGAUACCAGGCACUCCAUCCUUUC-3'

5'-CAUGAAGCCAACAUCUCCUU-3'

5'-CAUGAAGCCAACAUCUCCU-3'

5'-CCAUGAAGCCAACAUCUCCUU-3'

5'-CCAUGAAGCCAACAUCUCCU-3'

5'-CAUGAAGCCAACAUCUCCUUUUUCUC-3'

5'- CUCCUUUUUCUCCUCGGAUACCAGG-3'

5'- UCCUUUUUCUCCUCGGAUACCAGG-3'

5'- CCUUUUUCUCCUCGGAUACCAGG-3'

5'- UCCUUUUUCUCCUCGGAUACCAG-3'

5'- CUCCUUUUUCUCCUCGGAUACCAG-3' 5'- CUCCUUUUUCUCCUCGGAUACCA-3'

5'- CUCCUUUUUCUCCUCGGAUACCAGGC-3' and

5'- UCUCCUUUUUCUCCUCGGAUACCAGG-3',

wherein uracil bases (U) are optionally thymine bases (T)

Preferred AONs include 5'- GAUACCAGGCACUCCAUCCU-3' and 5'- CAUGAAGCCAACAUCUCCUU-3'. The AON may be inserted in a vector.

Of particular interest, e.g. for use in therapy, is a pair of two exon 105 AONs, wherein the first member of said pair comprises the nucleotide sequences 5'-UACCAGGCCUGGUA-3' and wherein the second member of said pair comprises the nucleotide sequence 5'-CUCCUAGGAG-3', wherein uracil bases (U) are optionally thymine bases (T). For example, the invention provides a pair of AONs wherein the first member is selected from the group consisting of

5'- GAUACCAGGCACUCCAUCCU-3';

5'- AUACCAGGCACUCCAUCCU-3' ;

5'- UACCAGGCACUCCAUCCU-3';

5'- GAUACCAGGCACUCCAUCCUU-3'; and

5'- CGGAUACCAGGCACUCCAUCCUUUC-3'

and wherein the second member is selected from the group consisting of

5'-CAUGAAGCCAACAUCUCCUU-3';

5'-CAUGAAGCCAACAUCUCCU-3';

5'-CCAUGAAGCCAACAUCUCCUU-3';

5'-CCAUGAAGCCAACAUCUCCU-3'; and

5'-CAUGAAGCCAACAUCUCCUUUUUCUC-3'.

Very good results can be obtained with the AON pair consisting of 5'- GAUACCAGGCACUCCAUCCU-3' and 5'-CAUGAAGCCAACAUCUCCUU- 3'. Also provided herein is an AON of 14 to 35 nucleotides in length capable of binding to a target sequence of exon 13 in the COL7A1 gene, said target sequence comprising a stretch of at least 17 contiguous nucleotides of the exon 13 sequence 5' -GAGUCAGACAGCAUUCGACUUGGAUG

ACGUUCAGGCUGGGCUUAGCUACACUGUGCGG-3'. Preferably, the exon 13 AON is capable of binding to a target sequence comprising a stretch of at least 17 contiguous nucleotides of the sequence 5'-GCAUUCG

ACUUGGAUGACGUUCAGGCUGGG-3'.

The AON may be 14 to 30 nucleotides in length, preferably 15-28

nucleotides, more preferably 17 to 22 or 18 to 26 nucleotides.

In a preferred embodiment, the exonl3 AON comprises or consists of the sequence 5'-GCCUGAACGUCAUCCAAGUCG-3' , wherein uracil bases (U) are optionally thymine bases (T). For example, the AON is selected from the group consisting of the sequence 5'-GCCUGAACGUCAUCCAAGUCG-3'

5'-CCUGAACGUCAUCCAAGUCG-3'

5'-CUGAACGUCAUCCAAGUCG-3'

5'-GCCUGAACGUCAUCCAAGUC-3'

5'-GCCUGAACGUCAUCCAAGU-3' 5'-AGCCUGAACGUCAUCCAAGUCG-3'

5'-CAGCCUGAACGUCAUCCAAGUCG-3'

5'-GCCUGAACGUCAUCCAAGUCGA-3'

5'-GCCUGAACGUCAUCCAAGUCGAA-3' and

5'-AGCCUGAACGUCAUCCAAGUCGA-3', wherein uracil bases (U) are optionally thymine bases (T)

Very good results were obtained with the AON 5'-GCCUGAACGU

CAUCCAAGUCG-3'.

An AON of the invention (be it an exonl05 or exonl3 AON) preferably comprises less than 10% nucleotide analogues. An AON preferably comprises less than 4 nucleotide analogues, preferably less than 3, more preferably less than 2. An AON of the invention is preferably a modified oligonucleotide. In one aspect, the AON comprises RNA and wherein said RNA contains a modification. In a particularly preferred embodiment said AON comprises one or more 2'-0- methyl oligoribonucleotides, which render the AON resistant to RNase H induced degradation of DNA/RNA hybrids. Additionally, a phosphorothiate backbone can be used to increase the stability of AONs against nucleases and to enhance cellular uptake. An AON of the invention has in a preferred embodiment a full length

phosphorothioate backbone and all bases (nucleotides) have a 2'-O-methyl modification. The modification can be selected from the group consisting of a 2'-0-methyl phosphorothioate modified ribose (RNA) or deoxyribose (DNA) modification. Alternatively, morpholino phosphorodiamidate DNA

(morpholinos), locked nucleic acids (LNA) and ethylene bridged nucleic acids (ENA) AONs have been used to modulate splicing. An AON of the present invention can therefore also have these modifications. These modifications render the AONs RNase H and nuclease resistant and increase or decrease the affinity for the target RNA. For the ENA and LNA modification this increase is accompanied by a decreased sequence specificity. The AON may also comprise a mixture of different modifications.

An AON of the invention may be delivered in vivo alone or in association with a vector. In its broadest sense, a "vector" is any vehicle capable of facilitating the transfer of the antisense sequence to the cells and preferably cells expressing collagen VII. Preferably, the vector transports the nucleic acid to cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antisense

oligonucleotides sequences. Viral vectors are a preferred type of vector and include, but are not limited to nucleic acid sequences from the following viruses: lentivirus such as HIV-1, retrovirus, such as moloney murine leukemia virus, adenovirus, adeno-associated virus; SV40-type viruses; Herpes viruses such as HSV-1 and vaccinia virus. One can readily employ other vectors not named but known to the art. Among the vectors that have been validated for clinical applications and that can be used to deliver the antisense sequences, lentivirus, retrovirus and AAV show a greater potential for exon skipping strategy.

Retro virus-based and lentivirus-based vectors that are replication- deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle) have been approved for human gene therapy trials. They have the property to integrate into the target cell genome, thus allowing for a persistent transgene expression in the target cells and their progeny.

The human parvovirus Adeno-Associated Virus (AAV) is a dependovirus that is naturally defective for replication which is able to integrate into the genome of the infected cell to establish a latent infection. The last property appears to be unique among mammalian viruses because the integration occurs at a specific site in the human genome, called AAVS1, located on the chromosome 19 (19ql3.3-qter). AAV-based recombinant vectors lack the Rep protein, AAV vectors and integrate with low efficacy and low specificity into the host genome, and are mainly present as stable circular episomes that can persists for months and maybe years in the target cells. Therefore AAV has aroused considerable interest as a potential vector for human gene therapy. Among the favourable properties of the virus are its lack of association with any human disease and the wide range of cell lines derived from different tissues that can be infected. Actually 12 different AAV serotypes (AAVl to 12) are known, each with different tissue tropisms (Wu et al., 2006). Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well known to those skilled in the art. In the last few years, plasmid vectors have been used as DNA vaccines for delivering antigen-encoding genes to cells in vivo. They are particularly advantageous for this because they do not have the same safety concerns as with many of the viral vectors. Plasmids may be delivered by a variety of parenteral, mucosal and topical routes. For example, the DNA plasmid can be injected by intradermal, subcutaneous, or other routes. It may also be administered into the epidermis or a mucosal surface using a gene-gun. The plasmids may be given in an aqueous solution, dried onto gold particles or in association with another DNA delivery system including but not limited to liposomes, dendrimers, cochleate and micro

encapsulation. In a preferred embodiment, the vectorized antisense sequences are fused with a small nuclear NA (snR A) such as U7 or Ul in order to ensure their stability and spliceosome targeting.

The invention also provides an AON or an AON pair (or a vector comprising the same) as disclosed herein for use in a method for the treatment of a patient suffering from Dystrophic Epidermolysis Bullosa. In its broadest meaning, the term "treating" or "treatment" refers to reversing, alleviating, inhibiting the progress of, or preventing the disorder or condition to which such term applies, or one or more symptoms of such disorder or condition. One skilled in the art will recognize that the amount of an AON (or a vector comprising it) to be administered will be an amount that is sufficient to induce amelioration of unwanted disease symptoms. Such an amount may vary inter alia depending on such factors as the gender, age, weight, overall physical condition, of the patient, etc. and may be determined on a case by case basis. The amount may also vary according to the type of condition being treated, and the other components of a treatment protocol (e.g.

administration of other medicaments such as steroids, etc.). Generally, a suitable dose is in the range of from about 0.1 mg/kg to about 100 mg/kg, hke 1 mg/kg to about 100 mg/kg. If a viral -based delivery of AONs is chosen, suitable doses will depend on different factors such as the viral strain that is employed, the route of delivery (intramuscular, intravenous, intra-arterial or other), but may typically range from lOexp lO to 10exp l2 viral particles /kg. Those skilled in the art will recognize that such parameters are normally worked out during clinical trials. Further, the skilled artisan will recognize that, while disease symptoms may be completely alleviated by the treatments described herein, this need not be the case. Even a partial or intermittent relief of symptoms may be of great benefit to the recipient. In addition, treatment of the patient is usually not a single event. Rather, the AONs of the invention will likely be administered on multiple occasions, that may be, depending on the results obtained, several days apart, several weeks apart, or several months apart, or even several years apart.

A further embodiment relates to a pharmaceutical composition comprising at least one antisense oligonucleotide or oligonucleotide pair according to the invention and at least one pharmaceutically acceptable carrier, diluent or vehicle. "Pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as

appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The invention also relates to methods for restoring the function of mutated proteins of interest using exon skipping technology. The method involves blocking or preventing the incorporation into mature mRNA of one or more targeted exon(s), which encodes amino sequences that are responsible for the protein dysfunction. This is accomplished by exposing the pre-mRNA that includes exons encoding the protein to one or more AONs of the invention which are complementary to the defined target sequence motifs that are required for correct splicing of the one or more targeted exons. Preferably, said method comprises administering at least one of 5'- GAUACCAGGCACUCCAUCCU-3' (AON1 or AON-53), 5'-

CAUGAAGCCAACAUCUCCUU-3' (AON2 or AON-262) and 5'- GCCUGAACGUCAUCCAAGUCG-3'. Most preferably, it comprises administering the pair of 5'- GAUACCAGGCACUCCAUCCU-3' and 5'- CAUGAAGCCAACAUCUCCUU-3'. The AONs bind to complementary required sequences in the pre- mRNA and prevent normal splicing. Instead, the targeted exons are excised and are not included in the mature mRNA that is translated into protein, and the amino acid sequences encoded by the targeted exons are missing from the translated protein. One object of the present invention relates to a method for restoring the function of a mutated type VII collagen comprising the step of preventing splicing of one or more exons, which encode amino acid sequences that cause said type VII collagen dysfunction. In a particular embodiment of the invention, said method for restoring the function of a mutated type VII collagen comprises the step of preventing splicing of at least one exon selected from the group consisting of exon 105 and exon 13 using at least one of the novel AONs as disclosed herein. According to the present invention, one or more exons selected from the group consisting of exon 105 and exon 13 may be removed in order to restore the functionality of a mutated collagen VII. Those skilled in the art will recognize that the selection of exons for removal as described herein will usually be predicated on the expectation of a beneficial result such as restoration of the protein functionality.

The invention herewith provides methods of restoring partial or complete functionality to type VII collagen, e.g. an unstable, defective, dysfunctional, not enough functional or non- functional type VII collagen.

A still further embodiment provides a method for restoring the function of a mutated type VII collagen comprising administering to an individual in need thereof an AON (pair) or a pharmaceutical composition comprising the same. Also, the invention provides a method for alleviating one or more symptom(s) of Dystrophic Epidermolysis Bullosa in an individual, the method comprising administering to said individual an AON (pair) or a pharmaceutical composition comprising the same. AONs of the invention may be used to cause exon skipping resulting in an amelioration of

Dystrophic Epidermolysis Bullosa symptoms (i.e. restoration of protein function or stability) typically in the range of 30 to 100%, compared to a non-treated patient case. Such symptoms may be observed on a micro level (i.e. restoration of protein expression and/or localization evaluated by immunohistochemistry, immunofluorescence, Western-blot analyses;

amelioration of the skin lesion by histological examination;

restoration/amelioration of protein functionality evaluated by the ability to form anchoring fibril between the external epithelia and the underlying stroma.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention. LEGEND TO THE FIGURES

Fig.l. Puzzle like structure of COL7A1 exon organization. The figure represents all COL7A1 exons and their corresponding reading phases. The shapes of the exons depict the phasing of the triplet codons over different exons. Light and dark green boxes indicate skippable exons, which can be divided into two groups: those that start and end with a complete codon (square boxes), all but one located in the THD domain, and those that begin and end with a partial codon (arrow shaped boxes), located exclusively in the NCI and NC2 domains. Red boxes depict unskippable exons. Exons 29 to 112 encode the collagenous triple-helix domain (THD). Dark green boxes depict exons of the THD that encode a Gly-X-Y amino acid sequence only.

Fig.2. Specific AONs restore type VII collagen synthesis in vitro, (a) Position of AON 1 and AON2 and patient's mutation (red arrow) in exon 105. Predicted exon splice enhancer sequences reveal two potential regions for AON targeting (pink bars and orange curve), (b) RT-PCR on patient keratinocytes showed most effective exon skipping with 250 mM of both AONs. Healthy keratinocytes (1), Scrambled AONs (2-3), 250 mM and 500 mM AON1 (4-5), AON2 (6-7) or AON1+AON2 (8-9). (c) RT-PCR on healthy and patient keratinocytes and fibroblasts after transfection with 250mM AONs (3-4 and 7-8 respectively) or scrambled AON (1-2 and 5-6

respectively). Lower panel shows confirmation of exon 105 skipping by Sanger sequencing, (d) Cells immunostained for type VII collagen treated or untreated with 250mM AONs (percentage represents number of type VII collagen expressing cells). Scale bar = 15 μιη. (e) Western blot analysis on healthy control, untreated patient, and treated patient keratinocyte cell lysates, reveals the expression of type VII collagen by transfected patient keratinocytes. (f) Dot blot analysis on conditioned medium reveals that the newly formed Δ105 type VII collagen can be secreted. N.B. Due to overexpression of the membrane, and the use of a polyclonal antibody, the blots in e and f showed minor residual staining in untreated patient cells, whereas no staining was observed with LH7.2 monoclonal antibody in d. Fig.3. Validation of the skin-humanized mouse model Eight weeks after grafting, the mice were sacrificed and skin grafts cryopreserved. H&E staining in combination with keratin 10, involucrin, keratin 5, and desmocollin 1 staining showed well-differentiated skin comparable to human normal healthy skin (NHS). Double staining for mouse keratin 1 and human type VII collagen indicates a clear separation of human and mouse skin and confirms specificity of the LH7.2 antibody to human type VII collagen. Scale bar = 50 μιη.

Fig.4 In vivo AON-induced exon skipping leads to restoration of type VII collagen synthesis upon systemic treatment, (a) Illustration of the skin -humanized mouse model. Primary control keratinocytes and fibroblasts were seeded into silicone grafting chambers implanted on the back of athymic nude mice. The injection site is indicated (grey dotted circle), (b) RT-PCR showed in vivo exon 105 skipping after eight weeks of treatment. Saline treated healthy and patient skin grafts (lane 1 and 2, respectively) show only a wild-type RNA product including exon 105, whereas patient skin grafts from specific AON treated mice revealed skipping of exon 105 (lane 3). Sanger sequencing confirmed skipping of exon 105. (c) IF staining on cryosections of grafts from mice treated as in a, revealed de novo expression of type VII collagen (green) in patient grafts grown on AON treated mice. Type VII collagen expression varied along the BMZ and the overall amount of protein expression was reduced compared to the control graft, (d) Staining for type IV collagen (red), reveals widening and off shoots of the basement membrane zone in untreated patient skin grafts, indicated by white arrows. This widening is neither observed in healthy control nor treated patient skin grafts. Dotted line indicates graft border, and human (H) and mouse (M) epidermis is indicated. Scale bar = 50 μηι. Fig. 5. AON-3'splice and AON-overlap53 do not induce exon 105 skipping. Nested PCR products using primers spanning exon 102- 108 separated on 2% agarose gel. Expected wild-type size (WT) and product size after skipping of exon 105 (Δ105) are indicated. The transfection of primary keratinocytes was performed in duplicate.

Fig.6 RNA analysis of exon 13 AON transfected fibroblasts. (A). Gel electrophoresis showed a product at wild-type (WT) length and an additional smaller product (Skip). From left to right: ladder; 250 nM exon 13 -specific AON469; 500 nM AON469, control. (B). Sanger sequencing of this product revealed a lack of exon 13 in this product, i.e. the exon is skipped.

EXPERIMENTAL SECTION

Materials and Methods

The institutional animal care and use committee approved the use of experimental animals for this study.

Cell culture

Control keratinocytes and fibroblasts were isolated from skin after informed consent of healthy patients undergoing reconstructive surgery. RDEB patient keratinocytes and fibroblasts were isolated from a biopsy after informed consent of a patient having the homozygous c.7828C>T,

pArg2610Ter null mutation in exon 105 of the COL 7A1 gene. After incubation of the skin in trypsin (Invitrogen) for 1 hour at 37°C 5% CO2, the epidermis sheet was separated from the dermis with tweezers.

Subsequently, the epidermis was cut into small ~ lxl mm pieces followed by a five to ten minutes incubation in trypsin (Invitrogen) at 37°C for separation. Bovine calf serum (BCS) (Gibco) was added to the solution to stop trypsinization. The cells were pelleted by centrifugation for 10 minutes at 200 g and resuspended in complete Cnt-07 (CELLnTEC Advanced Cell Systems AG) serum free medium to be plated into a culture Petri dish. For continuation of culture, the cells are split in 3 when 90% confluence was reached. The dermis tissue obtained after the first trypsinization step described above, was cut into small pieces and spread to the bottom of a culture petri dish. Culture medium was daily added drop-wise to prevent floating of the tissue. Once the tissue-surrounding area was confluent with fibroblasts, the tissue was removed from the Petri dish and the monolayer cells were harvested and seeded into a new Petri dish. For continuation of culture, the cells were split in 3 when 90% confluence was reached. For the culture of fibroblasts, a mixture with a 6:4 ratio of F-12 nutrient (Gibco) (completed with 10% BCS (Gibco), glutamin (Invitrogen), streptomycin (Invitrogen), and penicillin (Invitrogen)) and Amniochrome (Lonza) was used.

Antisense oligonucleotides (AONs)

Two specific AONs were used to induce skipping of exon 105 of the COL 7A1 gene. AON1 (herein also referred to as AON-53) , 5'- GAUACCAGGCACUCCAUCCU-3', and AON2 (herein also referred to as AON-262), 5'-CAUGAAGCCAACAUCUCCUU-3'. A nonspecific AON 5'-

GCUUUUCUUUUAGUUGCUGC-3' was used as negative control and with the addition of a 5'-FAM 537.46 fluorescent label as positive control. All AONs comprise 2' O-methyl modified bases and phosphorothioate linkages, and were synthesized and purified by reverse-phase high performance liquid chromatography (Eurogentec BV). In vitro transfection

In vitro cationic lipid transfection experiments were performed in 12-well plates using polyethylenimine (PEI) (MBI Fermentas, St Leon-Roth, Germany) and Lipofectamine-2000 (LF) (Invitrogen). The lipid-AON complex formation was optimized to a weight: weight ratio of 1: 1 for both PEI and LF. PEI was used to transfect fibroblasts and LF was used to transfect keratinocytes. Prior to transfection, cells were grown to 70-80% confluency, washed, and fresh medium was added to the wells. For the transfection using LF, the medium was replaced with Opti-MEM (Gibco). Lipid-AON complexes were formed according to the manufacturer's protocol and drop-wise added to the cells at a final concentration of 250 nM of AON in the medium. After six hours of incubation at 37°C 5% CO2 the medium was removed, cells were washed, and complete culture medium was added.

In vitro RNA and protein analysis

For the analysis of exon skipping on RNA level, RNA was isolated 48 hours after transfection using RNeasy Micro Kit (Qiagen). Medium was removed from the wells prior to the adding of the lysis buffer (provided by the kit). A cell scraper was used to help lyse the cell monolayers. The lysate was collected in a 1.5 ml tube, vortexed for 1 minute, flash frozen in liquid nitrogen, and stored at -80°C before RNA isolation according to the manufacturer's protocol. Subsequently to the RNA isolation, RNA was immediately reverse transcribed using Superscript-Ill (Invitrogen) reverse transcriptase. Reverse transcription was followed by PCR analysis of exon 105 of the COL7A1 gene using nested PCR primers (Table 1). Table 1. PCR primers used for the analysis of exon 105 skipping of COL7A1 the on the RNA level.

PCR Primers Product size

Forward Reverse

First 5'-TCAGCTGTGATCCTG 5'-CTGGCTGCCCG 511

GGGCCT-3' TCAAAGCCT-3'

Nested 5' - AGGGCAGCAAG 5'-TTTGTGTCCTG 290

GGAGAGCCT-3' CCAGCCCGG-3'

For the analysis of C7 expression, cells were grown on glass coverslips

(Menzel-Glaser, Braunschweig) in 12 well plates. The culture medium was removed from the wells 72 hours after transfection and the cells were washed followed by fixation using an ice-cold 1: 1 methanol-acetone solution followed by air-drying and storage in -20°C. Immunofluorescence (IF) staining with was used to visualize C7. The cells were stained using LH7.2 (gift prof. dr. I.M. Leigh) primary and goat anti mouse Alexa488 labelled secondary antibody as described (15).

Generation of human skin grafts

For the generation of skin grafts, a mouse model was used as described (17). Briefly, primary cultured fibroblasts and keratinocytes were used to reconstitute human skin on the back of Atymic nude mice (Charles River strain 490). For the validation of the mouse model, four mice were grafted using healthy control cells. After validation, six mice were grafted with RDEB-gen sev patient cells. After implantation of the silicone grafting chamber, a mixture of 6xl0 ⁶ fibroblasts and 6xl0 ⁶ keratinocytes was seeded in the grafting chamber in a total volume of 400 μΐ _^ in 1% low calcium BCS (HyClone) DMEM (Gibco). Prior to use, the BCS was chelexed using Chelex- 100 (Bio-Rad) resin to remove calcium ions. Eight days after implantation, the silicone grafting chamber was removed and the wound was left to heal forming a scab in the process. Around ten days post removal of the grafting chamber, the scab fell off and the treatment phase was initiated.

Treatment of the patient mice

Once the scabs fell off, the treatment was started. The treatment scheme was composed of five daily injections of 50 mg/kg of each AON in a 0.15M NaCl solution for eight weeks. The subcutaneous injections were given in the trunk of the mice around 7 cm distal to the graft. Four mice with patient grafts were treated with the mixture of AON 1 and AON2 solution, and two mice with patient grafts and two mice with control grafts were injected with saline solutions as negative controls.

In vivo RNA and protein analysis

One day after the last injection of eight weeks of treatment, the mice were sacrificed and the skin grafts were harvested. The entire full skin thickness grafts were removed from the back of the mice and flash frozen using hquid nitrogen and stored at -80°C prior to further analysis. For the analysis of exon skipping at the RNA level, a cryosection of 50 μιη was cut on a Leica CM3050S cryostat and RNA was isolated, reverse transcribed, and PCR was performed as described above. For the analysis of C7 expression, 4 μιη cryosections were stained using Zenon (Thermo Fisher Scientific) labelled LH7.2 monoclonal antibody. Cell nuclei were stained using Hoechst staining. Sections were analysed using a Leica DMRA fluorescence microscope.

EXAMPLE 1 : In silico analysis of COL7A1

The COL7A1 analysis gives an overview of important details of the gene, in relation to exon skipping. In-frame exons could theoretically be skipped by antisense oligonucleotides. However, the functionality of the gene might be compromised (Figure 1). The study of Bornert et al., 2016 (Molecular

Therapy; DOI: 10.1038/mt.2016.92) presents a method to examine the functionality of an internally truncated type VII collagen. The exon 105- deleted type VII collagen was shown to be functional.

EXAMPLE 2: In vitro exon skipping and restoration of type VII collagen synthesis

To address the applicability of AONs as systemic therapy for RDEB we chose to target exon 105, as primary keratinocyte and fibroblast cultures from a patient (EB-023, patient 4 in ref (15)) with RDEB due to the homozygous nonsense mutation in exon 105 (c.7828C>T, p.Arg2610Ter) were readily available. This nonsense mutation introduces a premature termination codon (PTC) that leads to the total absence of type VII collagen in his skin and explains the individual's severe phenotype (Figure 2A).

All 1134 possible 17-23 base pair long sequences in the region of exon 105 were analyzed for their Tm (>48°C), GC-content (40-60%), binding energy (15-30), and off target binding, in silico. Online software was used to predict splice enhancer sequences in and around exon 105 (REF: FO Desmet, Hamroun D, Lalande M, Collod-Beroud G, Claustres M, Beroud C. Human Splicing Finder: an online bioinformatics tool to predict splicing signals. Nucleic Acid Research, 2009). AONs were synthesized and analysed for their exon skipping abilities. Optimization of the transfection experiments in control cells showed that the highest exon-skipping efficiency was achieved using both AONs in combination in a total concentration of 250 mM (asterisk in Figure 2B), and this combination of the two AONs was used in further experiments.

Control and patient primary keratinocytes and fibroblasts were subsequently cultured and transfected with non-specific AONs or the combination of specific AONs. Forty-eight hours after transfection, RNA was isolated from transfected control and patient keratinocytes and fibroblasts. In the control and patient cells transfected with the anti-exonl05 AONs, RT-PCR analysis revealed exon skipping at the RNA level in both control and patient keratinocytes and fibroblasts, which was confirmed by Sanger sequencing (Figure 2C). The keratinocytes and fibroblast from the patient carrying mutation c.7828C>T in exon 105 exhibit no expression of type VII collagen. To assess protein re-expression upon exon 105 skipping, control and patient cells were cultured on cover slips prior to transfection with the two AONs targeting exon 105. Seventy-two hours after transfection, the cells were fixated to the cover slips and analysed by immunofluorescence staining. In comparison to control keratinocytes and fibroblast, no expression of type VII collagen is observed in patient cells, either untransfected or transfected with

nonspecific AON. Nevertheless, when patient keratinocytes and fibroblasts were transfected with the specific AONs against exon 105, a distinct re- expression of type VII collagen was observed (Figure 2D). We calculated that approximately 50% and 30% of expected levels of type VII collagen were restored in keratinocytes and fibroblasts, respectively.

EXAMPLE 3: Validation of the skin graft mouse model

To establish clinical relevance of the selected AONs we tested the ability to target exon 105 and restore collagen VII expression in an in vivo model. To this end we reconstituted a skin graft of patient fibroblasts and

keratinocytes on athymic immune deficient nude mice (17). This model constitutes a personalized model offering the opportunity to easily and directly test the in vivo efficacy of AONs on patient cells and additionally allows long-term treatment and observation of treatment effect of the target skin. Cultured control or patient keratinocytes and fibroblasts were seeded into grafting chambers on the back of athymic nude mice (Figure 3A). After eight weeks, the skin grafts were harvested. Haematoxyhn and eosin (H and E) staining, and IF staining for the differentiation markers keratin 5, desmocollin 1, keratin 10, and involucrin revealed a well-differentiated pattern comparable to that of normal healthy skin (Figure 3B).

IF staining for human type VII collagen showed brightly positive staining of the BMZ in the human skin graft and negative staining in mouse skin, confirming the specificity of the LH7.2 antibody against human type VII collagen. These positive validation results demonstrate that this skin- humanized mouse model provides a useful and reliable tool to test the in vivo applicability of AON-mediated exon skipping on RDEB skin.

EXAMPLE 4: In vivo exon skipping restores type VII collagen expression

Systemically administered, subcutaneously injected AONs against exon 23 of the mouse Dmd gene in a mouse model for Duchenne muscular dystrophy were shown to induce exon 23 skipping in mouse skin (data not shown). Therefore, we chose to deliver the AONs by subcutaneous injections distal to the skin grafts to address the applicabihty of AONs as a potential systemic causative therapy for RDEB.

Six mice were grafted with patient keratinocytes and fibroblasts carrying the premature termination codon c.7828C>T mutation in exon 105 and two mice were grafted with healthy control keratinocytes and

fibroblasts. During the treatment phase, four out of the six mice bearing patient skin grafts were treated with 50 mg/kg of each AON (AON1 and AON2 described herein above) via subcutaneously injections at the tail base for a period of eight weeks (injection site indicated in Figure 3A). The four remaining mice bearing either patient or healthy control skin grafts were given saline solution as a negative control. After eight weeks of treatment, the human skin grafts were harvested and RNA was isolated from graft cryosections. RT-PCR analysis revealed exon 105 skipping in the RNA isolated from the patient grafts grown on mice treated with the specific anti- exon 105 AONs. As expected exon 105 skipping was not observed in RNA isolated from the patient or control grafts grown on mice injected with saline solution. Sanger sequencing confirmed exon 105 skipping (Figure 4A).

In parallel, human skin graft cryosections were immunostained for human C7, which revealed bright C7 staining at the BMZ in control graft sections treated with saline and no C7 expression in patient graft sections treated with saline. In contrast, clear de novo expression of C7 at the BMZ was evident in patient graft sections isolated from mice treated systemically with the specific anti-exon 105 AONs (Figure 4B). The staining intensity of C7 varied along the BMZ and the overall amount of protein expression was reduced compared to the control graft, but restoration of C7 expression was unequivocally seen, opposite to the complete absence of C 7 in the untreated patient grafts. These results indicate that the AON-mediated exon 105 skipping indeed results in restoration of C7 expression in C7-deficient RDEB skin due to a homozygous COL 7A1 exon 105 null-mutation in the skin-humanized mouse model.

EXAMPLE 5: Criticality of target sequences for exon 105

In this additional experiment two exon 105 AONs were tested (indicated in bold below), which both comply with the conventional design guidelines (17- 23 nt long, Tm >44°C, no G or C triplets, low self-dimerization, binding affinity 18-28), but which do not comprise the unique target sequences for exon 105: 5'-CCUGGUA-3' and 5'-AGGAG-3' according to the present invention (indicated as underlined sequence).

GGATC C C C AGGAAAGGATGGAGTGC CTGGTATC C GAGGAGAAA

AAGGAGATGTTGGCTTCATGGGTCCCCGGGGCCTCAAGgtaggaaagaaa ca The sequences of both AONs were as follows:

"AON-overlap53": 5'-ACUCCAUCCUUUCCUGG-3'

(Tm=49.5°C, binding energy: 24.6)

"AON-3'splice": 5'-UGUUUCUUUCCUACCUUGAG-3'

(Tm=51°C, binding energy: 19.9)

Both AONs were transfected in primary cultured normal healthy control keratinocytes in duplicate (Table 2). The AONs according to the invention ("AON-53" and "AON-262"; see above) were also included for back-to-back comparison.

Table 2. List of transfection conditions.

1 AON-3'splice; 250 nmol/1

2 AON-3'splice; 500 nmol/1

3 AON-overlap53; 250 nmol/1

4 AON-overlap53; 500 nmol/1

5 AON-53; 250 nmol/1

6 AON-53; 500 nmol/1

7 AON-262; 250 nmol/1

8 AON-262; 500 nmol/1

9 AON-53+AON-262; 250 nmol/l[ATi]

10 AON-53+AON-262; 500 nmol/l[AT2]

11 Fluorescently labelled AON; 500 nmol/1 (positive control

transfection, no RNA isolated)

12 No transfection (negative control for transfection, RNA isolated as positive control for PCR) Results

Primary cultured healthy control keratinocytes were transfected as in the overview in Table 2. 48 hours after transfection, RNA was isolated and nested RT-PCR was performed to amplify the region of exon 102-108.

Subsequently, PCR products were separated on a 2% agarose gel (Figure 5). AON-53 targets the claimed sequence 5'-CCUGGUA-3'. AON-262 targets the claimed sequence 5'-AGGAG-3'. Results consistent with previous

experiments were observed when AON-53 and AON-262 were transfected, both individually and combined. Separately, and combined, they induced skipping of exon 105 but most efficient skipping of exon 105 is observed when both sequences 5'-CCUGGUA-3' and 5'-AGGAG-3' are targeted by the AONs (banes 5- 10 and 17-22).

The additionally tested AONs, AON-3'splice and AON -overlap 53, both comply with the design guidelines, but do not target the one of the claimed exon 105 target sequences. When AON-3'splice and AON-overlap 53 where transfected into cells, no skipping of exon 105 was observed (lane 1-4 and 13- 16). This demonstrates the unexpected importance of sequences 5'- CCUGGUA-3' and 5'-AGGAG-3' as targets for AON-mediated exon skipping of exon 105.

EXAMPLE 6: In vitro exon 13 skipping

Exon skipping is a personalized therapy. To be able to develop a therapy for which many patients will profit, we have also looked at other exons than exon 105. In this case at exon 13 of the COL7A1 gene, as in the British population there is a recurrent mutation in this exon, i.e. c. l732C>T;

p.Arg578Ter (Mellerio et al., 1997, J Invest Dermatol, Recurrent mutations in the type VII collagen gene (COL7A1) in patients with recessive

dystrophic epidermolysis bullosa). This substitution of a C to a T changes the codon of an arginine to a premature termination codon, leading to nonsense mediated RNA decay, and the complete lack of type VII collagen.

Exon 13 contains 144 bp, which is a multiple of 3. Therefore, skipping of this exon will keep the reading frame intact. The sequence of exon 13 plus minus 50 base pairs is as follows (Exon 13 indicated in bold):

5' - atccct gtctctttct gacccct gcccacct accct gacttctctctt agGGGTTGAG C GGAC CCTGGTGCTTCCTGGGAGTCAGACAGCATTCGACTTGGATGACGT TCAGGCTGGGCTTAGCTACACTGTGCGGGTGTCTGCTCGAGTGGG TCCCCGTGAGGGCAGTGCCAGTGTCCTCACTGTCCGCCGGGgtgagt actgcaggaggcttgtggaggacagctgcctgcctcactctggt-3'

It was surprisingly found that the underlined part of the exon 13 sequence is particularly suitable as target sequence for exon skipping. A

representative AON (5'- GCCUGAACGUCAUCCAAGUCG-'3; AON469) was designed to specifically target this sequence and it was evaluated for its ability to induce exon 13 skipping. A nonspecific AON 5'- GCUUUUCUUUUAGUUGCUGC-3' was used as negative control and with the addition of a 5'-FAM 537.46 fluorescent label as positive control. All AONs comprise 2' O-methyl modified bases and phosphorothioate linkages, and were synthesized and purified by reverse-phase high performance liquid chromatography (Eurogentec BV).

Control keratinocytes were isolated from skin after informed consent of healthy patients undergoing reconstructive surgery. After incubation of the skin in trypsin (Invitrogen) for 1 hour at 37°C 5% CO2, the epidermis sheet was separated from the dermis with tweezers. Subsequently, the epidermis was cut into small ~lxl mm pieces followed by a five to ten minutes incubation in trypsin (Invitrogen) at 37°C for separation. Bovine calf serum (BCS) (Gibco) was added to the solution to stop trypsinization. The cells were pelleted by centrifugation for 10 minutes at 200 g and resuspended in complete Cnt-07 (CELLnTEC Advanced Cell Systems AG) serum free medium to be plated into a culture petri dish. For continuation of culture, the cells are split in 3 when 90% confluence was reached.

In vitro cationic lipid transfection experiments were performed in 12-well plates using Lipofectamine-2000 (LF) (Invitrogen). The lipid-AON complex formation was optimized to a weight: weight ratio of 1: 1. Prior to

transfection, cells were grown to 70-80% confluency, washed, and fresh Opti-MEM (Gibco) medium was added to the wells. Lipid-AON complexes were formed according to the manufacturer's protocol and drop-wise added to the cells at a final concentration of 250 nM or 500 nM of AON in the medium. After six hours of incubation at 37°C 5% CO2 the medium was removed, cells were washed, and complete culture medium was added.

For the analysis of exon skipping on RNA level, RNA was isolated 48 hours after transfection using RNeasy Micro Kit (Qiagen). Medium was removed from the wells prior to the adding of the lysis buffer (provided by the kit). A cell scraper was used to help lyse the cell monolayers. The lysate was collected in a 1.5 ml tube, vortexed for 1 minute, flash frozen in liquid nitrogen, and stored at -80°C before RNA isolation according to the manufacturer's protocol. Subsequently to the RNA isolation, RNA was immediately reverse transcribed using Superscript-Ill (Invitrogen) reverse transcriptase. Reverse transcription was followed by PCR analysis of exon 13 of the COL7A1 gene using nested PCR primers (first forward: 5'- GGTGGTACTGCCCTCTGATG-'3, first reverse: 5'- TCCGTTCGAGCCACGATGAC-'3, nested forward: 5'- CCGCCTCACACTCTACACTC-'3, nested reverse: 5'- AGCCACCTGGTAGGTGGTTC-'3) For testing the exon 13 skipping efficiency in vitro, primary fibroblasts were cultured until 70-80% confluence in a 12 well plate prior transfection. The fibroblasts were transfected using 250nM and 500nM of exon 13 specific AON469 using polyethylenimine in complete culture medium. 48 Hours post transfection RNA was isolated and RT-PCR performed surrounding exon 13. In the wells with transfected fibroblasts both 250 nM AON469 and 500 nM AON469 resulted in an additional smaller product, which was confirmed by Sanger sequencing as exon 13 skipped mRNA product (see Fig. 6). The lower concentration of 250 nM led to a higher skipping efficiency than the higher concentration of 500 nM. These results surprisingly show that a single AON for exon 13 can result in exon skipping.

REFERENCES

1. Fine et al., Journal of the American Academy of Dermatology.

2014;70(6): 1103-26.

2. Sakai LY et al., Journal of Cell Biology. 1986; 103(4): 1141.

3. Fine et al., Journal of the American Academy of Dermatology.

2009;61(3):367-84.

4. Martins et al., Journal of CeU Science. 2009; 122(11): 1788-99. 5. Burgeson et al., Annals of the New York Academy of Sciences.

1985;460(l):47-57.

6. Chen et al., Journal of Biological Chemistry. 2001;276(24):21649-55.

7. Fritsch et al., Journal of Clinical Investigation. 2008; 118(5): 1669-79.

8. Wenzel et al., Science Translational Medicine. 2014;6(264):264ral65-. 9. Filareto et al., Nature Communications. 2013;4: 1549.

10. Sebastiano et al., Science Translational Medicine. 2014;6(264):264ral63- 11. Tolar et al., Journal of Investigative Dermatology. 2013; 134(5): 1246-54.

12. Remington et al., Molecular Therapy. 2008; 17(l):26-33.

13. Aartsma-Rus et al., Oligonucleotides. 2010;20(2):69-77.

14. Toyonaga et al., British Journal of Dermatology. 2015; 172(4): 1141-4. 15. van den Akker et al., Journal of Dermatological Science. 2009;56(1):9- 18.

16. Aartsma-Rus et al., Molecular Therapy. 2008; 17(3):548-53.

17. Wang et al., Journal of Investigative Dermatology. 2000; 114(4):674-80.

18. Fritsch et al., Journal of Clinical Investigation. 2008; 118(5): 1669-79. 19. Heinonen Seppo et al., Journal of Cell Science. 1999; 112:3648.

20. Ito et al., The American Journal of Pathology. 2009; 175(6):2508- 17.

21. Venugopal et al., Journal of the American Academy of Dermatology. 2013;69(6):898,908.e7.

22. Umegaki-Arao N et al., Science Translational Medicine. 2014;

6(264):264ral64-.

23. Tolar et al., Journal of Investigative Dermatology. 2013; 134(5): 1246-54.

24. Nevala-Plagemann et al., Cytotherapy. 2015; 17(6):786-95.

25. Christiano AM et al., Genomics. 1994;21(1): 160-8.

26. Pasmooij AMG et al., Experimental Dermatology. 2004; 13(2): 125-128. 27. van Roon-Mom et al., Methods in Molecular Biology. 2012: 1179.

28. Koo et al., Human Gene Therapy. 2013;24(5):479-88.

29. Goto et al., Journal of Investigative Dermatology. 2006; 126(12):2614-20.

30. Turczynski S et al., Methods Molecular Biology. 2012:221-38. 31. Wang et al., Journal of Investigative Dermatology. 2000;114(4):674-80.

32. Chen YQ et al., Journal of Investigative Dermatology. 1994; 102(2):205-9.

33. Kern et al., Molecular Therapy. 2009; 17(9): 1605-15.

34. Goemans et al., New England Journal of Medicine. 2011;364(16): 1513- 22.

35. Voit T et al., The Lancet Neurology. 2014 October; 13(10):987-96.

36. Aartsma-Rus, Muntoni. Neuromuscular Disorders. 2013;23(l l):934-44.