Apparatus and method for separation and detection of molecules Field of the invention

The present invention relates to apparatus and a method for separation and detection of molecules. More specifically, it relates to electrophoretic separation and detection of charged molecules, especially of nucleic acids such as DNA and RNA. The invention also relates to the application of such apparatus and method in analysis of samples where specific nucleic acid chains are efficiently identified and quantified from the noise of nonspecific polymerase chain reaction (PCR) amplification.

Background of the invention

Identification of charged molecules such as DNA, including DNA-fragments, is a fundamental part of molecular biology research, detection, and diagnosis of infectious diseases. Most of today's DNA analyses are based on PCR and use of amplified DNA fragments, where a few fragments, or in other words, copies of a DNA sequence can be amplified thousands to million times.

Electrophoresis is the traditional method to analyze PCR amplified DNA fragments. These DNA fragments are then separated by size in a matrix, usually agarose, and visualized by using fluorophores such as Etidium Bromide.

Real time PCR (RT-PCR) is a more recent method where an increase in amplified DNA is measured as an increase of light. The simple work flow, the ability to analyze many samples at once and convenient digitalization of the results have made RT-PCR a widely used tool in both research and diagnostics. Digital PCR (dPCR) is another recent developed method where DNA samples are highly diluted and after running numerous parallel amplification reactions the original DNA concentration can be calculated from the number of positive amplification reactions.

RT-PCR has had a major impact on the way diagnostics of infectious diseases are performed and, most likely, it will replace current time consuming methods, such as culturing. PCR methods have a problem with nonspecific amplification of DNA. Today's PCR systems are not specific enough to identify low amounts of target DNA in samples with an excess of background DNA. Nested PCR is a method that can increase PCR specificity. Two sets of primers are used in two successive amplification reactions. The idea is to enhance the amount of target sequence in the first reaction to decrease background contamination in the second reaction. This method is commonly used in research when quantifying low amounts of DNA but has to our knowledge not been implemented as a routine diagnostic tool, most likely due to complex and time consuming work flows.

Summary of the invention

An object of the present invention is to solve the problem with detection of signals of one or more desired molecules or other desired entities from a background of other unwanted signals during PCR.

In one aspect, the present invention relates to a device for electrophoretic separation of molecules in a sample. The device comprises at least one member for supporting separation matrix, which matrix has a first and a second end. The device further comprises at least two containers for containing electrophoresis buffer in fluid contact with each of said first and second end, respectively; electrodes for applying an electric potential between said first and second end; and a light emitting device arranged in connection with said member so as to emit light into a separation matrix supported on said member, and at least one light detecting device arranged so as to detect light from migrating molecules or molecule-dye-complexes in said separation matrix over time, and configured to generate a signal corresponding to the intensity of detected light. The separation matrix has a sample loading well arranged near said first end and an analysis well arranged near said second end. The light emitting device and light detecting device are arranged in the analysis well.

By means of the location of the light emitting device and the light detecting there is provided an electrophoresis device having the ability to analyse, including, but not limited to: separate, detect and extract specific DNA fragments in an efficient and simple work flow.

An advantage with the present invention provides, is to solve the problem of detection a few bacteria from a DNA background of other microorganisms or cells. This is especially a problem when to identify bacteria in food production. Today this is solved by enriching the bacteria by culturing, a process usually taking 12-48h, before running RT-PCR. The apparatus and related methods according to various embodiments of the present invention can reduce the analysis time during food production from days to a few hours. An advantage with the present invention increases PCR specificity, a characteristic beneficial for various fields of DNA analysis.

This aspect is further explained in the detailed description below and defined in the appended claim 1. Further embodiments are also explained below and defined in depending claims.

According to an aspect of the present invention, there is provided an electrophoresis device configured to perform a so-called "loop back PCR work flow", wherein at least one primary PCR amplification cycle is performed initially on a sample, and a purified sample containing target molecules or molecule-dye-complexes is extracted after electrophoresis.

The present invention, in particular according to the above disclosed embodiment configured to perform a loop back PCR work flow, for instance solves the problem with difficulty of evaluating a particular DNA signal from background DNA signals with PCR, RT-PCR, dPCR and similar techniques, which is a problem since all amplified DNA, not only the particular DNA, in a sample adds up to the result.

In another aspect, the invention relates to systems including devices according to the above discussed aspect. This aspect is further explained in the detailed description below and generally defined in claim 6 and claims dependent thereon.

In a further aspect, the invention relates to methods for electrophoretic separation of ions. The invention according to this aspect can be performed on a device or system according to the aspect discussed above. This aspect is further explained in the detailed description below and generally defined in claim 10 and claims dependent thereon.

In a further aspect, the invention relates to methods for identifying a sample's ion composition comprising electrophoretic separation of ions according to the aspect discussed above. This aspect is further explained in the detailed description below and generally defined in claim 16 and claims dependent thereon. In a further aspect, the invention relates to a computer readable storage medium storing computer-readable instructions for performing a method for generating a sample specific pattern based on a time-resolved signal. This aspect is further explained in the detailed description below and generally defined in claim 19.

Embodiments are set forth in the dependent claims.

Short description of the appended drawings

Figure 1 is a schematic drawing of an electrophoresis device for electrophoretic separation and/or detection of charged molecules in a sample according to an

embodiment of the present invention;

Figure 2 is a schematic drawing of an array of electrophoresis devices configured to analyze a plurality of samples at the same time according to another embodiment of the present invention;

Figure 3 is a schematic drawing of the electrophoresis device shown in Figure 1 provided with a loop back PCR work flow according to another embodiment of the present invention;

Figure 4A-B show two different PCR reactions performed in an electrophoresis device according to an embodiment of the invention; and

Figure 5A-B show the correlation between an electrophoresis run on a gel and a corresponding graph of light detected over time in an electrophoresis device according to an embodiment of the present invention. Detailed description of embodiments of the invention

According to a first aspect, the present invention relates to a device for electrophoretic separation and/or detection of molecules in a sample. With reference to Figure 1 , according to an embodiment of the present invention, there is provided, without limitation thereto, an electrophoresis device 1 which in use contains a separation matrix 2 suitable for separation of charged molecules and/or molecule-dye-complexes in a sample, molecular fragments such as DNA fragments, or ions by migration at different speeds dependent on the charge and size, thereby separating the molecules in the sample based on charge and size when an electrical potential is applied over the separation matrix 2. Typically, the electrophoresis device 1 comprises a support member 3 adapted to support the separation matrix 2 having a first end 2a and a second end 2b. The support member 3 can be any suitable member able to support the separation matrix 2 such as a rectangular tray having two long sides and two short sides.

The electrophoresis device 1 further comprises containers 4a, 4b for containing electrophoresis buffer and allowing the buffer to keep in contact with the separation matrix 2 at the short sides of the support member 3. The separation matrix 2 is arranged so that only the first end 2a and the second end 2b of the separation matrix 3 is in contact with the electrophoresis buffer, for instance TBE, TEA or others. The electrophoresis device 1 further comprises electrodes, an anode 5 and a cathode 6, for applying an electric potential over the separation matrix 2. If negatively charged molecules or molecule-dye-complexes are to be separated, the anode 5 is placed at the first, herein lower, end 2a of the separation matrix 2 and the cathode 6 at the second, herein an upper, end 2b of the separation matrix 2. If positively charged molecules or molecule-dye- complexes are to be separated, the anode 5 is placed at the first 2a, herein upper end of the separation matrix 2 and the cathode 6 at the second 2b, herein lower end.

The electrophoresis device 1 comprises a first, sample loading well 7, for loading a sample, provided near the first, upper end 2a and a second, analysis well 8, for analysing the sample, provided near the second, lower end 2b. Even though herein, only one lane and analysis well 8 is shown and disclosed, it is possible to provide more than one analysis well per lane.

Herein, the term "near" means in a location adjacent, up to a distance within at least that half of the matrix.

The electrophoresis device 1 further comprises a light emitting device 9, such as a light source, in particular in the form of a UV-LED diode, arranged in connection with the member 3 for supporting the separation matrix 2 configured to, in use, be arranged to emit light having a particular wavelength into the separation matrix 2. The emitted light should be of a wavelength capable of exciting, or be absorbed by, a charged molecule or molecule-dye-complex, in the following denoted a "target" molecule or molecule-dye- complex, to be separated and detected in the separation matrix 2.

The device 1 further has a light detecting device 10, such as a detector for visible light, in particular a photodiode, configured to, in use, detect light λ ₂ , typically visible light, emitted from a target molecule or molecule-dye-complex excited by the light from the above mentioned light emitting device 9. For instance, one or more target molecules, such as amplified DNA fragments, are measured as an increase in light detected by means of the detector, but also other molecules may give rise to an increase in light, normally referred to as "background light", adding to an overall changed light intensity, for instance an increase in light, which is normally not intended.

Typically, a few DNA fragments can be amplified thousands to million times by

conventional methods and treated for further improving visualisation for instance by using fluorophores, and then detected as visible light by means of the detector following excitation by means of light, typically UV light, from the light emitting device. Alternatively, light absorbed by a target molecule or a molecule-dye-complex may be measured instead of increased light measured by means of the detector as a decrease in light . Herein, no shift in wavelength will occur, thus there is only one wavelength coming from the light emitting device 9. The decrease in light of this specific wavelength is measured.

The choice of light detecting device 10 and light emitting device 9 depends on the intended use of the device 1 such as which molecules or molecule-dye-complexes are to be separated and/or detected in which background.

The light emitting device 9 and the light detecting device 10 are arranged in the analysis well 8, typically separated from each other as much as allowed by the member 3 containing the separation matrix 2, for instance at a respective side thereof, herein to a left and a right side thereof, but may be alternatively be arranged also in another suitable direction, for instance in a direction perpendicular to the particular direction shown in Figure 1 , which is only an example of arrangement of the light emitting device 9 and the light detecting device 10.

A light specific filter, such as a band pass filter 1 1 , in particular an optical 400 - 600 nm band pass filter may also be arranged between the separation matrix 2 and the detector 10, for instance a photo diode, to only allow light emitted by the target molecules or molecule/dye-complex to pass to the detector 10, or to at least filter out disturbing or otherwise unwanted light, such as background light arising for instance from other molecules which are not the target molecules. This band pass filter 1 1 may also be provided to avoid unwanted UV-emitted light from exposing the detector. Two or more filters can also be used in combination, for instance a Wratten 2A filter blocking UV-light and an IR cut off filter for blocking wave lengths that could affect the photo diode in the IR spectra. Another filter, for instance an optical UV band pass filter, 12 may be arranged between the light emitting device 9 and the matrix 2 for filtering out disturbing light from illuminating the target molecules.

As an example, a sample containing DNA fragments, is applied into the sample loading well 7, electrophoresis turned on by applying the potential over the ends 2a, 2b, wherein the DNA fragments being charged or forming complexes with charged dye-molecules, if dye is present, are separated in the separation matrix 2 by means of electrophoresis and analysed in the analysis well 8 by means of the light emitting 9 and detecting 10 devices. This/these DNA fragment(s) is/are typically extracted and can now be used for downstream applications such as RT-PCR, sequencing or cloning since they are pure, or at least in a purer form than in the sample.

One or several fragments may be separated and extracted in one electrophoresis run, even if mainly only one has been described in the examples.

An advantage with the inventive electrophoresis device is the ability to analyse, including, but not limited to: separate, detect and extract specific DNA fragments in an efficient and simple work flow. According to an aspect, this is provided by having a DNA detection system in the analysis well.

By means of the location of the detector, the problem with detection of signals of particular molecules from a background of other unwanted signals can be solved by means of the invention. The invention provides separation, detection and extraction of specific DNA fragments in an efficient and simple work flow. This is an advantage compared to for instance conventional RT-PCR techniques suffering from this problem.

As disclosed above, the choice of light emitting device 9 depends on the intended use of the device 1. As an example, for detection of DNA forming a complex with a dye such as GelRed, a light source such as an UV diode emitting light of a wavelength around 260- 360 nm or emitting a wavelength within an interval between 470-550 nm may be used. Other light emitting devices may be used for this and other applications, as appreciated by the skilled person. If the light emitting device emits light that may disturb the separation matrix or is otherwise unwanted, a filter 12 such as an UV band pass filter may also be mounted between the light emitting device 9 and the separation matrix 2. Typically, to block unwanted light not generated by an UV-diode an optical UV-light band pass filter 12 is mounted between the UV-diode and matrix 2 in the analysis well 8.

The described wavelengths and filters are only examples, depending on type of dyes or combination of dyes, other wavelengths and filters may be used instead.

As disclosed above, only when in use, the device 1 for electrophoretic separation and/or detection includes a separation matrix 2. The separation matrix 2 is itself not part of the device 1 and numerous suitable separation matrices 2 are known in the art. A presently preferred separation matrix for use with the invention, particularly if the molecules are DNA, is agarose gel. When in use, the charged molecules, such as DNA fragments are first loaded in the sample loading well 7, then separated by size and charge by migration in the separation matrix 2 due to the applied potential, and visualized in the analysis well 8. Visualization can be aided by using fluorophores such as Etidium Bromide or other dyes or substances that can be form complexes with the target molecules and be detected by the detector 10, but may in some applications be avoided for instance because of high cost or hazardous substances. Also conventional primers may be used to enhance detection, but is typically avoided due to complicated DNA primer designs, e. g. in Chip-assays, which is also a problem with prior art technology, which the invention solves.

The light detecting device 10 generates a detection signal T corresponding to the intensity of detected light. The detection signal T can be generated continuously or at regular or irregular time intervals. Typically, the detection signal T varies over time in response to the intensity of the detected light, i.e. it is time-resolved. The detection signal T can be transmitted directly to a signal-processor unit 14 or stored in a suitable storage unit 16, such as a computer memory, for future use such as being transmitted to the processor unit 14 later on for processing.

If the sample contains a molecule being difficult to visualize, or if visualization requires unwanted expensive or hazardous substances, it is possible to provide an electrophoresis reference lane running in parallel to the sample lane. The reference lane is used to known when to sample to be sure that the desired molecule will at least essentially be sampled but no other disturbing substances. The reference lane may then be provided as a similar sample lane as the real sample lane, but may include a sample containing the desired substance, possibly provided with means for visualization.

In an embodiment, the electrophoresis device 1 includes sample means for fully automated or semi-automated collection of a molecule or molecule-dye-complex. The sample means for fully automated sample collection can be triggered on the detection signal T from the light detecting device 10. Such means may then include, or be configured to communicate with the processor unit 14 having a computer program running on a microprocessor receiving the time-resolved signal T originating from the light detecting device 10, and in response thereto being configured to provide a signal indicating that a sample can be taken (semi-automated) or even provide sampling (fully automated). An example of a semi-automated embodiment is that a user uses a pipette (not shown) to take a sample when the processor unit 14 indicates that a sample can be taken. An example of a fully-automated embodiment is to employ a robot (not shown) that is able to remove the desired target molecule, molecules or molecule-dye-complex, or molecule-dye-complexes from the separation matrix by suction, excision or other suitable operations. Typically, the computer program product is arranged to control the robot to remove samples containing the target molecules, and optionally solvent or part of the separation matrix, at one or more locations, between the first 2a and second 2b end of the separation matrix 2, typically from the analysis well 8, based on the time-resolved signal from the light-detecting device, optionally in combination with input from a user of the electrophoresis device. This embodiment for instance provides specific DNA fragments to be purified from all background DNA.

In a further aspect, by reference back to Figure 1 , the invention relates to a system comprising a device 1 for electrophoretic separation according to the first aspect and further units with further functionalities. These further units may be arranged in physical proximity to the electrophoresis device 1 , or included in one and the same instrument, but may also be located at a distance from the electrophoresis device 1 and each other, and interconnected through a computer network. Such a system may comprise a signal processor unit 14 configured to generate a sample specific pattern based on the time resolved detection signal T generated by the light detecting device 10. Such a system may also comprise a storage unit 16 for storing a plurality of sample specific patterns generated by the signal processor unit. Such a storage unit 16 is typically a standard computer readable memory with sufficient capacity to store a desired amount of data. Such a system may also include a comparative unit 18 able to compare a sample specific pattern generated by the signal processor unit 14 to some or all patterns stored in the storage unit 16 and provide a value quantifying the similarity between the sample specific pattern and each of the stored patterns to which the sample specific pattern is compared. This may be provided by the comparative unit 18 comprising interpreting software.

Typically, even if not explicitly shown and disclosed, the microprocessor 14 can also communicate with a computer or remote servers, for instance providing a user interface for controlling the electrophoresis device and system including the same. The functions of the various elements including functional blocks, including but not limited to those labeled or described as "computer", or "processor" may be provided through the use of hardware such as circuit hardware and/or hardware capable of executing software in the form of coded instructions stored on computer readable medium. Thus, such functions and illustrated functional blocks are to be understood as being hardware- implemented and/or computer-implemented, (e.g., machine-implemented).

In terms of computer implementation, a computer is generally understood to comprise one or more processors, or one or more controllers, and the terms computer and processor and controller may be employed interchangeably herein.

Now is also referred to Figure 2, which is a schematic drawing of an array 20 of a plurality of electrophoresis devices 1 configured to analyze a plurality of samples at the same time according to another embodiment of the present invention, wherein a robot can be configured to sample a plurality of samples more or less simultaneously, wherein each electrophoresis device 1 comprises two wells 7, 8 for each sample lane. This embodiment provides high throughput analysis useful for health care diagnostics, fast identification of microorganisms in food production and research purposes for instance.

According to an embodiment, an UV light source with an optical UV band pass filter and light sensor with an optical 400-600nm band pass filter setup is located at each analysis well 8. The purposes of the analysis wells 8 are to detect the migrating DNA fragments. Upon exposure to UV light, visible light will be emitted and detected by the light sensor 10. The integrated microprocessor unit 14 digitalizes the detection signal T and enables automated or manual extraction of the detected target DNA fragment from the analysis well 8. Thus, specific target DNA fragments can be purified from all background DNA.

In one aspect, the invention relates to a method for electrophoretic separation of ions in a sample. The method is preferably performed on a device or system as described herein. The device or system is also preferably adapted to the method.

The method according to this aspect comprises the steps

- placing said first sample in an upper position close to a first end of a separation matrix, said separation matrix having said first end and a second end in fluid contact with electrophoresis buffer;

- applying an electric potential between said first end and said second end of said separation matrix, causing charged molecules or molecule-dye-complexes to move towards said second end of said ion separation matrix at a speed dependent on the charge and size of said ions, thereby separating the molecules or molecule-dye-complexes in said sample based on charge and size;

- detecting the passage of molecules or molecule-dye-complexes at a position between said first and said second end of said separation matrix, by means of a light emitting device arranged in connection with said separation matrix, and a light detecting device arranged so as to detect light emitted from molecules or molecule-dye-complexes in said separation matrix over time, by means of a light emitting device 9 arranged in the analysis well 8, and a light detecting device 10 arranged in the analysis well 8 detecting light intensity from molecules or molecule-dye-complexes in said separation matrix 2 over time, thereby generating a time-resolved signal (T).

It is suitable to place the sample in that well before applying the electric potential. It is possible to collect a molecule or molecule-dye-complex from said analysis well 8 triggered by said time-resolved signal T from said light detecting device 10. The detected molecule or complex can be any one of: DNA, RNA, fragments thereof or dye-complexes thereof.

According to an embodiment, there is also provided a method for identifying the

composition of a first sample of unknown composition comprising the steps of:

- generating a sample specific pattern Psampie n based on time-resolved signal T obtained by the method above;

comparing the pattern P _sa mpie n of the first sample to a set of previously obtained time-resolved signal patterns P _sa mpie i ...n obtained from samples of known compositions;

wherein a match between the pattern of the first sample and a pattern obtained from a sample of known composition indicates that the composition of the first sample is the same as the composition of the sample from which said previously obtained pattern was obtained. Or how close the composition of the first sample is to the sample from which said previously obtained pattern was obtained. This method is provided by the processor unit 14 as explained above with reference to

Figure 1.

Now is referred to Figure 3, showing a schematic drawing of the electrophoresis device shown in Figure 1 configured to perform a so-called "loop back PCR work flow 30" according to another embodiment of the present invention, wherein at least one primary PCR amplification cycle PCR1 is performed initially on a sample, and a purified sample containing target molecules or molecule-dye-complexes is extracted after electrophoresis, which can also define the term "loop back PCR". This is followed by a second PCR cycle PCR2 on the purified sample, which is shown in the figure as a PCR machine 32 configured to perform a first and a second PCR PCR1 and PCR2. It can also be different machines performing the primary PCR PCR1 , and the secondary PCR, PCR2

respectively. Also this embodiment (not shown) is included in the term "loop back PCR" as used in this context. To perform a loop back PCR work flow, at least one primary PCR amplification cycle PCR 1 is performed. Basically, the PCR amplification may include controlling temperature only. Since PCR per se, such as RT-PCR, dPCR, is known to the skilled person, this will not be further described herein. As an example, if quantitative measurements are needed, the primary PCR should not reach the levelling off stage of the reaction. Then, the sample is applied to the loading well 7, the electrophoresis, as described above with reference to Figure 1 for instance, is turned on and a purified sample containing the target molecule such as a DNA fragment is extracted from the analysis well 8 as described above. In this way, the background, or at least most of the background signal, is physically removed.

Herein, the term "purified" means picking desired fragments from the analysis well 8.

Then, a secondary PCR amplification cycle PCR 2, is used directly on the purified sample using known PCR methods such as RT-PCR, dPCR. Also direct sequencing is possible to perform. This is called "loop back PCR work flow". Following the secondary PCR cycle PCR 2, the sample can be used for sequencing or for other purposes where it is important, or an advantage to have a "pure" fragment, typically a PCR fragment. By means of the invention, conventional PCR methods can be more sensitive. As an example, it is possible to include the invention into a RT-PCR or dPCR system.

Alternatively, in a second PCR cycle PCR 2, the purified sample is once again applied 32 to the loading well 7, the electrophoresis is turned on and the target molecule such as a DNA fragment is separated, detected and extracted from the analysis well 8 as described above after the secondary PCR cycle PCR 2. This embodiment is particularly useful for providing fragment profiles that can be used for automatic diagnostics and multiplexing. According to an embodiment, it is possible to purify the desired fragments once more by extracting the desired target fragments from the analysis well 8.

The embodiments described with reference to figure 3 provide more powerful PCR than conventional so-called "nested PCR" since the amplifying background is physically removed. These embodiments provides digital and automated results, which makes it an ideal solution for high throughput analysis for health care diagnostics, fast identification of microorganisms in food production and is suitable for research purposes. Other advantages provided by means of this embodiment are: identification of bacteria without culturing, which saves days in diagnostic time; high potential for PCR

multiplexing, removes the problem with complicated DNA primer design, e.g. in Chip- assays; DNA fragments extracted from the analysis well are ready for sequencing, e.g. application in next generation sequencing; allows detection of lower amounts of

DNA/RNA, e.g. finding new biomarkers in cancer or other diseases, or for genectics; and automated DNA cloning. The present invention is suitable for diagnostics, but also be useful for scientific purposes, for following different genetic materials at one and the same time etc.

In the following an experiment "Experiment 1" will be explained, wherein an

electrophoresis device 1 according to the embodiment shown and explained above with reference to Figure 1 and 3 is used. Experiment 1.

In the experimental set up GelRed was added to the separation matrix 2. Gelred binds to migrating DNA and when UV-light from the light emitting device 9 hits the DNA-GelRed complex, fluorescent light λ ₂ is emitted at the wave length of 570-650nm (orange light). To detect DNA-GelRed emitted light a photodiode 10 is used. The particular components used are as follows, wherein same reference numeral is used as in Figure 1 and not further explained:

9. UV-diode - type number: FG350-R5.5-WC015

10. Photodiode - type number: BPW34

1 1. Visible light band pass filter - Two filters are used in combination: Wratten 2A filter blocking UV-light and IR cut off filter (type number: ICF-1251) blocking wave lengths that could affect the photodiode in the IR spectra.

12. UV-light band pass filter - type number: Hoya-UV340. A sample containing Competent Coli JM109 was transformed with a pNCA plasmid, containing the genome of murine leukemia virus together with the Ampicillin resistance gene. The bacteria were then cultured overnight with antibiotic selection and the number of colony-forming units (CFU) was determined by a dilution series. For this experiment a dilution with -20 bacteria containing the pNCA plasmid were used. Plasmid DNA was isolated using a Sigma Aldrich GenElute™ plasmid miniprep kit. PCR amplification was performed in a volume of 10ΟμΙ using primers Nsil-Ds (tactccatgcatctccacca) and Afl-Us (cctctgacttgagcgtcgat) together with pfu DNA polymerase.

In figure 4A, two different PCR reactions are performed. The upper part of the figure 4A shows PCR amplification from pure samples where the pNCA plasmid is recovered from a sample containing about 20 bacteria. The picture shows detection of the target sequence (1660 base pairs). The target sequence becomes visible on the agarose gel (GelRed included) at a primary PCR cycle 20 and the fragment becomes many times stronger at cycle 25 and 30. The same experiment is performed in the lower part of figure 4A with the exception that a background plasmid is added to the reaction. This mimics the expected conditions in diagnostics of bacteria without any culturing, i.e. with a large excess of background DNA. The target sequence is hardly seen at all in a smear of randomly amplified DNA. To prove the advantage of loop back PCR, the region expected to contain the target sequence was manually extracted from the lower part of figure 4A (PCR cycle 20). This was performed using QIAquick gel extraction kit (Qiagen).

Figure 4B shows the secondary PCR cycle, wherein primers and conditions are used as before. The target sequence was identified already in PCR cycle 10 without any background contamination. This setup proves the concept of increased PCR sensitivity using the loop back PCR work flow shown and explained with reference to Figure 3.

Experiment 2.

Two different PCR fragments, size 416bp and 1243bp, were amplified to test the electrophoresis device 1 employed for DNA detection of the invention. The two PCR products were mixed and analysed using 1 % Agarose gel supplemented with 1x GelRed. A standard trans illuminators (UV table) with camera and printer were used to visualize the DNA fragments. Figure 5A, lane 1 , shows New England Bio labs 100bp DNA ladder as a standard. Lane 2 shows the two PCR fragments at 416bp and 1243bp. Note that the PCR primers are visible as well as an additional weak band below the 416bp fragment. This extra band was generated by unspecific amplification in the PCR reaction. The same amount of samples were added to the loading well of the prototype. The separation matrix 2 contained 1 % agarose and a current of 2 mA was applied to the system to start the DNA migration. Figure 5B shows the amount of light (relative light units) the detector measured over time (seconds). The DNA profile generated from the electrophoresis device 1 shows a very good match with the control gel from figure 5A and thus proves the functionality of the electrophoresis device 1 for DNA detection.

The present invention is not limited to the above-described preferred embodiments. Various alternatives, modifications and equivalents may be used. Therefore, the above embodiments should not be taken as limiting the scope of the invention, which is defined by the appending claims.