APTAMER LIGANDS AND SELECTION PROTOCOL FOR IMPROVED

TRANSPORT

BACKGROUND OF THE INVENTION [0001] This application claims the benefit of United States Provisional Patent

Application No. 62/257,518, filed November 19, 2015, the entirety of which is incorporated herein by reference.

[0002] The sequence listing that is contained in the file named "UTFBP1079WO_ST25.txt", which is 3 KB (as measured in Microsoft Windows®) and was created on November 18, 2016, is filed herewith by electronic submission and is incorporated by reference herein.

[0003] This invention was made with government support under Grant no. R01 EB000246 awarded by the National Institutes of Health. The government has certain rights in the invention. 1. Field of the Invention

[0004] The present invention relates generally to the field of molecular biology and medicine. More particularly, it concerns methods for designing aptamers, e.g., that display improved intestinal transport.

2. Description of Related Art

[0005] The intestinal absorption of protein therapeutics into the bloodstream presents a significant remaining obstacle to effective oral delivery of protein therapeutics. Typical protein absorption has been observed in the range of 0-5%, severely limiting the bioavailability of protein therapeutics even with complete release of protein in the small intestine (Artursson and Karlsson, 1991 ; Yee, 1997). The presence of PEG can enhance apparent permeability observed in Caco-2 models by orders of magnitude, raising the expected absorption of salmon calcitonin into a more functional range of 20-75%. Nonetheless, challenges remain for promoting absorption of therapeutic proteins via, into, or past epithelial cells of the small intestine. [0006] Although techniques such as transferrin conjugation may be used to increase the achievable bioavailability of orally delivered proteins, the size of the transferrin molecule presents drawbacks. For example, the increased size of the conjugate compared to the unmodified therapeutic can inhibit the protein loading and release capability using matrix- based drug delivery vehicles. Increased size can have a significant impact on the delivery capability of a particular hydrogel formulation, e.g. , because the rate of diffusion is reduced for a larger solute and the mesh size of the hydrogel must be large enough to accommodate.

[0007] Furthermore, conjugation of a large protein (transferrin) to a smaller protein (e.g., insulin, salmon calcitonin) may inhibit the activity of the therapeutic protein due to steric hindrance (Wu, et al. , 2011). This effect may in some instances be negated by choice of crosslinking chemistry: crosslinks made to degrade at some point after endocytosis, such as an acid labile crosslink triggered by the acidic pH shift to pH 5.5 inside the vesicle, can release the protein once active transport has been successfully initiated, leaving the original protein with full functionality. Nonetheless, this approach may not be viable for all protein therapeutics.

[0008] Other challenges with attempts to use transferrin to improve intestinal absorption have also been observed. For example, it has been shown that transferrin receptors on cell surfaces can saturate, placing an upper limit on the transport rate of protein across the small intestine regardless of the apical dose (Brewer and Lowman, 2012; Brewer and Lowman, 2014). Although this rate remains significantly faster than the rate of paracellular transport of proteins, there may be other receptors present in the epithelium that achieve a faster rate of delivery, enabling higher bioavailability and higher doses. Furthermore, should receptor saturation occur, having a smaller conjugate that can simultaneously undergo paracellular transport would also be desirable. Thus, paracellular transport through the tight junctions is a size-selective process (Balda, et al. , 1998; Matter and Balda, 2003; Steed, et al. , 2010), meaning that absorption of larger molecules such as antibodies may remain too insignificant for oral delivery to be financially feasible as a therapeutic delivery option. Clearly, there is a need for improved methods for enhancing intestinal absorption of therapeutic proteins. SUMMARY OF THE INVENTION

[0009] The present invention provides, in some aspects, methods for generating aptamers that may display improved transport across cells, such as improved intestinal transport. In some embodiments, the methods utilize a monolayer of cells (e.g. , epithelial cells or intestinal cells) in combination with a modified SELEX method in order to identify and generate aptamers with improved transport into or across cells. In some embodiments, a therapeutic protein may be administered in a composition comprising the aptamers, or the therapeutic protein may be covalently bound to the aptamers, to improve absorption of the therapeutic protein (e.g. , in the small intestine). In some aspects, select aptamers are provided.

[0010] An aspect of the present invention relates to A method for identifying a first nucleic acid from a mixture of nucleic acids comprising: (a) contacting a mixture of nucleic acids with a monolayer of target cells on a selective or semi-permeable barrier or membrane; (b) allowing sufficient time for the first nucleic acid to pass through the monolayer; (c) separating or recovering the first nucleic acid; and (d) amplifying the first nucleic acid.. The method may further comprise sequencing the first nucleic acid (e.g., using next-generation sequencing). The method may further comprise repeating steps (a), (b), and (c) one, two, three, four, five, or more times prior to step (d). In some embodiments, the first nucleic acid is further defined as a nucleic acid ligand, wherein the nucleic acid ligand can promote transport through the cell membrane of the target cells. The mixture of nucleic acids may comprise single- or double-stranded RNA. The mixture of nucleic acids may comprise single- or double-stranded DNA. In some embodiments, at least some of the nucleic acids in the nucleic acid mixture are 2'-fluoro modified (e.g., 2'-fluorine modifications on pyrimidines). In some embodiments, at least some of the nucleic acids in the nucleic acid mixture are labeled. The target cells may be mammalian cells such as, e.g., human cells, primate cells, cat cells, dog cells, or rodent cells. In some embodiments, the target cells are epithelial cells such as, e.g., intestinal epithelial cells. In some embodiments, the target cells are insect cells or bacterial cells. In some embodiments, the cells are cultured in a well comprising at least two compartments separated by the selective or semi-permeable barrier or membrane. In some embodiments, the cells are cultured in a well comprising two compartments, wherein the two compartments are a first chamber and a second chamber, wherein the first chamber is positioned above the second chamber, and wherein the first chamber and the second chamber are separated by a selective or semi-permeable barrier or membrane. The mixture of nucleic acids may be added to the first chamber. The first nucleic acid may be recovered from the second chamber. In some embodiments, the mixture of nucleic acids is added to the first chamber, and the first nucleic acid is recovered from the second chamber. In some embodiments, the selective or semi-permeable barrier or membrane is a transwell insert.

[0011] Another aspect of the present invention relates to a nucleic acid identified according to the method of the present invention or as described above, wherein the nucleic acid can be transported through or promote transport through a cell membrane. The nucleic acid may be covalently bound to a therapeutic agent. The therapeutic agent may be a protein (e.g. , an antibody, and antibody fragment, an scFv, or an antigen), a peptide, or a therapeutic nucleic acid (e.g., an antisense, a siRNA, an antisense, or a gene therapy). The therapeutic agent may be a small molecule therapeutic. The nucleic acid may be covalently bound to a nanoparticle or comprised in or on the surface of a liposome or a micelle. In some embodiments, the nucleic acid is comprised in a pharmaceutical preparation comprising an excipient. The pharmaceutical preparation may be formulated for oral, intravenous, intraarticular, parenteral, enteral, topical, subcutaneous, intramuscular, buccal, sublingual, rectal, intravaginal, intrapenile, intraocular, epidural, intracranial, or inhalational administration. [0012] Yet another aspect of the present invention relates to a pharmaceutical preparation comprising a nucleic acid identified according to a method of the present invention or as described above, a therapeutic agent, and an excipient. The pharmaceutical preparation may be formulated for oral, intravenous, intraarticular, parenteral, enteral, topical, subcutaneous, intramuscular, buccal, sublingual, rectal, intravaginal, intrapenile, intraocular, epidural, intracranial, or inhalational administration. In some embodiments, the therapeutic agent is a protein, an antibody, an antigenic protein, a therapeutic nucleic acid, a gene therapy, an immunotherapy, a chemotherapeutic, a small molecule therapeutic, an antiinflammatory agent, an agonist, or an inhibitor.

[0013] Another aspect of the present invention relates to a method of treating a disease in a subject comprising administering a therapeutically effective amount of a pharmaceutical composition of the present invention or as described above to the subject. The subject may be a mammal such as, e.g., a human. In some embodiments, the disease is inflammatory bowel disease, Crohn's disease, cancer, osteoporosis, diabetes, rheumatoid arthritis, growth deficiency, multiple sclerosis, Alzheimer's, dementia, macular degeneration, psoriasis, lymphoma, leukemia, heart disease, infertility, or embolism.

[0014] As used herein the specification, "a" or "an" may mean one or more. As used herein in the claim(s), when used in conjunction with the word "comprising", the words "a" or "an" may mean one or more than one.

[0015] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or." As used herein "another" may mean at least a second or more.

[0016] Throughout this application, the term "about" is used to indicate that a value includes the inherent variation of error for the device, the method being employed to determine the value, or the variation that exists among the study subjects.

[0017] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0019] FIG. 1: Steps of a Typical SELEX Aptamer Selection Protocol A random library of DNA or RNA molecules (S I) is incubated with a target molecule, and bound complexes are separated from unbound sequences (S2). Bound aptamers are eluted (S3) and amplified by PCR (S4), forming a new library for further evolutionary selection. Following multiple selection cycles, the optimal aptamer sequence(s) are determined by cloning and Sanger sequencing (reprinted from Blind and Blank, 2015).

[0020] FIG. 2: Modified Cellular SELEX Protocol A random library of DNA molecules is transcribed to 2 '-fluorine-modified RNA. RNA is incubated in the apical chamber of a Transwell plate with Caco-2 monolayer for 1.5 h and transported sequences are isolated from unabsorbed sequences. The absorbed aptamers are reverse transcribed to DNA and amplified by PCR, forming a new library for further evolutionary selection. Following only 3 selection cycles, the optimal aptamer sequences are determined using high throughput sequencing. [0021] FIG. 3: Aptamer Absorption in Caco-2 Transwell Model. Percent aptamer absorption was determined after each selection step for n = 4 parallel selection libraries using UV-Vis spectrometry. Reported as average ± standard deviation.

DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0022] The present invention provides, in some aspects, methods for generating aptamers, e.g. , that display improved absorption by cells such as epithelial cells in the small intestine. Thus, in various aspects, the aptamers may be administered with or covalently attached to a therapeutic protein (e.g. , an orally administered therapeutic protein) to enhance absorption in a subject, such as a mammalian subject or a human, in vivo. In some embodiments, select aptamers are provided that may be used to improve absorption of an orally administered therapeutic protein. For example a candidate mixture of aptamers may be provided to a media in a first chamber that is separated from media in a second chamber by a semi-permeable membrane and a monolayer of cells (e.g. , intestinal cells such as, for example, Caco-2 cells). After the candidate mixture is added to the first chamber, solution or media may be obtained from the second chamber, and any aptamers present in the solution or media from the second chamber may be amplified; in this way, aptamers may be selectively amplified that exhibit an improved ability to pass through the semi-permeable membrane and the monolayer of cells. This process may be repeated to further select for aptamers that can pass through the semi-permeable membrane and monolayer of cells.

[0023] In some embodiments, methods are provided for the generation of aptamers that display cellular or transcellular transport. In some embodiments, a modified cellular SELEX method, e.g. , involving use of a monolayer of cells, may be used to generate aptamers that can facilitate transcellular uptake of a protein therapeutic. In some embodiments, the modified cellular SELEX method provided may provide advantages over current SELEX methods including, e.g., prior knowledge of the target is not required and aptamers may be generated based on their function or may be selected against targets in their native conformation and physiological environment (e.g. , transporters on cells present in a monolayer, or in a particular cell type such as endothelial cells or submucosal cells). In some embodiments, the methods are used to select for one or more aptamers (e.g. , from a candidate mixture) that display an ability or an increased affinity for transporting into or through a target barrier such as a cell membrane.

I. Definitions

[0024] "Nucleic Acid" refers herein to either DNA, RNA, single-stranded or double- stranded and any chemical modifications thereof. Modifications include, but are not limited to, those which provide other chemical groups that incorporate additional charge, polarizability, hydrogen bonding, electrostatic interaction, and fluxionality to the nucleic acid ligand bases or the nucleic acid ligand as a whole. Such modifications include, but are not limited to, 2'-position sugar modifications, 5-position pyrimidine modifications, 8-position purine modifications, modifications at exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modifications, methylations, unusual base-pairing combinations such as the isobases isocytidine and isoguanidine and the like. Modifications can also include 3' and 5' modifications such as capping.

[0025] As used herein, "nucleic acid ligand" is a non-naturally occurring nucleic acid having a desirable action on a target. Nucleic acid ligands are often referred to as "aptamers". The term aptamer is used interchangeably with nucleic acid ligand throughout this application. A desirable action includes, but is not limited to, binding of the target, catalytically changing the target, reacting with the target in a way which modifies/alters the target or the functional activity of the target, covalently attaching to the target as in a suicide inhibitor, facilitating the reaction between the target and another molecule. In the preferred embodiment, the action is ability to pass through a target barrier such as a cell membrane or intestinal mucosa.

[0026] "Candidate Mixture" is defined as a mixture of nucleic acids of differing sequence from which to select a desired ligand. The source of a candidate mixture can be from naturally-occurring nucleic acids or fragments thereof, chemically synthesized nucleic acids, enzymatically synthesized nucleic acids or nucleic acids made by a combination of the foregoing techniques. In a preferred embodiment, each nucleic acid has fixed sequences to facilitate the amplification process surrounding a randomized region of sequences.

[0027] "SELEX" methodology refers to the combination of selection of nucleic acid ligands which interact with a target in a desirable manner, for example binding to a protein, with amplification of those selected nucleic acids, e.g. , as described in detail herein and in references cited herein. Iterative cycling of the selection/amplification steps allows selection of one or a small number of nucleic acids which interact most strongly with the target from a pool which contains a very large number of nucleic acids. Cycling of the selecti on/amplificati on procedure may be continued until a selected goal is achieved. [0028] "SELEX target" or "target" refers to any compound or molecule of interest for which a ligand is desired. A target can be a protein, peptide, carbohydrate, polysaccharide, glycoprotein, hormone, receptor, antigen, antibody, virus, substrate, metabolite, transition state analog, cofactor, inhibitor, drug, dye, nutrient, growth factor, etc. without limitation. [0029] As used herein, "intestinal epithelial barrier" cells refers to eptithelial cells that line the intestine (e.g., the small intestine or large intestine) of an animal. Intestinal eptithelial barrier cells can be provided in vitro or in situ, or may be obtained from the intestines of an animal. Non-limiting examples of an intestinal epithelial barrier cells include Caco-2 cells, HT29, IEC-6, IEC-18, Ca Ski, STC-1, HuTu 80, FHs 74, and IA-XsSBR cell lines. In some embodiments, a monolayer of Caco-2 cells in a solid support, such as a petri dish, may be used in various embodiments of the present invention.

[0030] "Amplifying" means any process or combination of process steps that increases the amount or number of copies of a molecule or class of molecules, typically a nucleic acid or group of nucleic acids. Any reaction or combination of reactions known in the art can be used as appropriate, including direct DNA replication, direct RNA amplification and the like, as will be recognized by those skilled in the art. The amplification method may result in selective amplification of aptamer sequences.

II. Aptamers

[0031] Aptamers are single-stranded oligonucleotide (e.g., RNA or DNA) sequences that may form tertiary structures based on complementary base-pair hybridization which allow the resulting molecule to bind to and interact with a broad variety of target molecules with high specificity and affinity (Jayasena, 1999). They have been analogized to antibodies, which have been utilized for over four decades for molecular recognition, with the difference that aptamers comprise nucleotides instead of amino acids. [0032] Aptamers may specifically bind a target and modulating the target's activity, e.g., through binding aptamers may block their target's ability to function. Created by an in vitro selection process from pools of random sequence oligonucleotides, aptamers have been generated for over 100 proteins including growth factors, transcription factors, enzymes, immunoglobulins, and receptors. Aptamers may be about 10-15 kDa in size (30-45 nucleotides), bind a target with high affinity (e.g., at a micromolar, nanomolar, or sub- nanomolar concentration), and may discriminate against related targets. In some instances, aptamers may exhibit similar binding interactions (e.g., hydrogen bonding, electrostatic complementarity, hydrophobic contacts, steric exclusion) that drive affinity and/or specificity in antibody-antigen complexes.

[0033] In some embodiments, polymerase chain reaction (PCR) is used for rapid, exponential amplification of oligonucleotides. The process of generating an aptamer may be significantly simpler than the process for generating an antibody (Nimjee et al , 2005). In some instances, aptamers may exhibit a high specificity and binding on the order exhibited by antibodies (Dressman and Berardi, 1990; Rodriguez et al , 2007). Aptamers are typically somewhat smaller in size than antibodies. In some instances, aptamers may be selected by using 15 to 40 random nucleotides, thus ranging in molecular weight from only 5 to 40 kDa (Nimjee et al , 2005). The reduced size may be useful for oral delivery of a therapeutic; for example, it may benefit one or more of the loading and release properties, the rate of diffusion, the probability of paracellular transport, or the activity of the therapeutic following conjugation. Aptamers may also display an extended shelf-life and reduced immunogenicity, as compared to antibodies (Nimj ee et al , 2005).

[0034] Non-limiting examples of the aptamers include DNA aptamers, RNA aptamers, XNA (nucleic acid analogs or artificial nucleic acids) aptamers, and peptide aptamers. Examples of XNA include, but are not limited to, peptide nucleic acid (PNA), Morpholmo and locked nucleic acid (LNA), glycol nucleic acid (GNA), and threose nucleic acid (TNA). In some embodiments, an aptamer generated via methods of the present invention may selectively bind Sgc8, TD05, sgc3b, Sgd5, KH2B05, KH1A02, KH1C12, TLS1 la, PP3, TV02, HCH07, KDED2a-3, KCHA10, SI le, DOV4, aptTOVl, KMF2-la, EJ2, CSCOl, SYL3C, EGFR, or Anti-PSMA. For example, in some embodiments, a therapeutic molecule (e.g. , a protein, small molecule therapeutic, peptide, or nucleic acid) may be covalently bound to, co-delivered with, or expressed with an aptamer sequence generated via a method of the present invention (e.g., that can promote absorption into the body of a subject through cells of the intestine). In some embodiments, an aptamer generated via a method of the present invention may be covalently bound to an antibody, such as, e.g. , an antibody that can selectively bind protein tyrosine kinase (PTK-7), epithelial cell adhesion molecule (EpCAM), E-cadherin, cytokeratin, zona occludens, laminin-1 , entactin, syndecan, mucin- 1 , desmoplakin, collagen, CD-31 , CD-34, CD-I 17, N-cadherin, vimentin, fibronectin, beta- catenin, integrin, Snail, Slug, forkhead box C2, epidermal growth factor receptor (EGFR), G- protein coupled receptors (GPCR), or prostate- specific membrane antigen (PSMA). In some embodiments, an aptamer of the present invention may selectively bind a biomolecule present on the surface of a target cell (e.g., an epithelial cell in the small intestine), e.g., to facilitate endocytosis or transcytosis. In other embodiments, an aptamer of the present invention may diffuse into or through cells (e.g., epithelial cells of the intestine) via a non-specific method.

[0035] In some embodiments, the aptamer is a nucleic acid aptamer. Aptamers with binding affinities in nanomolar range may be utilized for diagnostic or therapeutic applications (Zhou and Rossi 2009). Moreover, aptamers that target specific cell surface proteins may be employed as delivery molecules to target a distinct cell type, hence reducing off-target effects or other unwanted side effects (Zhou et al 2008; McNamara et al 2006). In some embodiments, an aptamer may be used to deliver a therapeutic agent to cells of the small intestine or into the bloodstream after transport through the small intestine. The therapeutic agent may treat one or more symptom associated with a disease such as, e.g. , inflammatory bowel disease (IBD), Crohn's disease, osteoporosis, diabetes, rheumatoid arthritis, growth deficiency, multiple sclerosis, or various forms of cancer.

[0036] The nucleic acid that forms a nucleic acid aptamer may comprise naturally occurring nucleosides, modified nucleosides, naturally occurring nucleosides with a hydrocarbon linker (e.g., an alkylene) or a poly ether linker (e.g., a PEG linker) inserted between one or more nucleosides, modified nucleosides with hydrocarbon or PEG linkers inserted between one or more nucleosides, or a combination of thereof. In some embodiments, one or more nucleotide or modified nucleotide of the nucleic acid aptamer may be replaced with a hydrocarbon linker or a poly ether linker.

A. Modified Aptamers

[0037] In some embodiments, one or more chemical modification may be included in an aptamer to reduce the rate of degradation of the aptamer in the body. Unmodified nucleic acids may be relatively rapidly degraded in vivo by RNases and DNases. An unmodified RNA aptamer, for example, has a half-life of a mere 8 s in vivo, far too short for many therapeutic uses (Ulrich et al , 2004). Thus, in certain embodiments, the aptamers are modified for enhanced in vivo half-life. Approaches known in the art can be used to improve the longevity of aptamers in a living system. For example, a common modification is to use nucleotides containing either amine (2'-NH ₂ ), alkyl (2'-CH3), or fluoride (2'-F) substitutions at the 2' -OH site of the pyrimidines (Lin et al , 1994; Pagratis et al , 1997). Using 2'-F- RNAs has been shown to extend the half-life of the RNA in vivo by up to 38,700 times to 86 h, which is more than sufficient for many therapeutic uses (Ulrich et al, 2004). In some embodiments, aptamers may be modified with 2'-fluoride for improved longevity. Nonetheless, in some embodiments where it is desirable to transport a therapeutic into the body via the intestine, an unmodified nucleic acid aptamer may be used so that at least part or all the aptamer may be relatively quickly degraded or substantially from the therapeutic after it is absorbed into the body.

[0038] Other methods may be used to increase the half-life of an aptamer. For example, an aptamer may include chiral enantiomers of the nucleotides to avoid degradation by nucleases. Naturally occurring nucleases are all made of L-amino acids which only recognize D-nucleotides. As such, L-nucleotides will escape degradation by nucleases present in vivo. Aptamers taking advantage of this are termed Spiegelmers, and can display half-lives in vivo upwards of 24 h (Eulberg and Klussmann, 2003). Selecting the proper enantiomeric L-nucleotide is performed not with L-nucleotides, but with D-nucleotides binding the enantiomer of the desired target protein. In other words, since PCR works with D-nucleotides alone, the amplification step would be impossible with the Spiegelmer; however, by targeting the mirror image of the desired target, the selected aptamer's mirror image will bind the actual target (KluBmann et al , 1996; Nolte et al, 1996).

[0039] Nucleic acids in accordance with the embodiments described herein may include nucleotides entirely of the types found in naturally occurring nucleic acids, or may instead include one or more nucleotide analogs or have a structure that otherwise differs from that of a naturally occurring nucleic acid. U.S. Pat. Nos. 6,403,779, 6,399,754, 6,225,460, 6,127,533, 6,031,086, 6,005,087, 5,977,089, disclose a wide variety of specific nucleotide analogs and modifications that may be used, and are incorporated by reference herein. Also see Crooke, S. (ed.) Antisense Drug Technology: Principles, Strategies, and Applications (1st ed.), Marcel Dekker; ISBN: 0824705661 ; 1st edition (2001), which is also hereby incorporated by reference. For example, 2'-modifications include halo, alkoxy and allyloxy groups. In some embodiments, the 2'-OH group is replaced by a group selected from H, OR, R, halo, SH, SR, NH ₂ , NHR, NR ₂ or CN, wherein R is Ci-Ce alkyl, alkenyl, or alkynyl, and halo is F, CI, Br, or I. Examples of modified linkages include phosphorothioate and 5'-N- phosphoramidite linkages. B. Labeled Aptamers

[0040] An aptamer can be conjugated to a detectable entity or label. Appropriate labels include without limitation a magnetic label, a fluorescent moiety, an enzyme, a chemiluminescent probe, a metal particle, a non-metal colloidal particle, a polymeric dye particle, a pigment molecule, a pigment particle, an electrochemically active species, semiconductor nanocrystal or other nanoparticles including quantum dots or gold particles, fluorophores, quantum dots, or radioactive labels. Protein labels include green fluorescent protein (GFP) and variants thereof (e.g., cyan fluorescent protein and yellow fluorescent protein); and luminescent proteins such as luciferase, as described below. Radioactive labels include without limitation radioisotopes (radionuclides), such as H, ^U C, ¹⁴ C, ¹⁸ F, ² P, ⁵ S, ⁶⁴ Cu, ⁶⁸ Ga, ⁸⁶ Y, "Tc, ^ul In, ¹² 1, ¹²⁴ I, ¹²⁵ 1, ¹ *1, ¹ Xe, ¹⁷⁷ Lu, ²¹¹ At, or ²¹ Bi. Fluorescent labels include without limitation a rare earth chelate (e.g. , europium chelate), rhodamine; fluorescein types including without limitation FITC, 5- carboxyfluorescein, 6- carboxy fluorescein; a rhodamine type including without limitation TAMRA; dansyl; Lissamine; cyanines; phycoerythrins; Texas Red; Cy3, Cy5, dapoxyl, NBD, Cascade Yellow, dansyl, PyMPO, pyrene, 7-diethylaminocoumarin-3-carboxylic acid and other coumarin derivatives, Marina Blue™, Pacific Blue™, Cascade Blue™, 2-anthracenesulfonyl, PyMPO, 3,4,9, 10-perylene-tetracarboxy lie acid, 2,7- difluoro fluorescein (Oregon Green™ 488-X), 5- carboxyfluorescein, Texas Red™-X, Alexa Fluor 430, 5- carboxytetramethylrhodamine (5- TAMRA), 6-carboxytetramethylrhodamine (6-TAMRA), BODIPY FL, bimane, and Alexa Fluor 350, 405, 488, 500, 514, 532, 546, 555, 568, 594, 610, 633, 647, 660, 680, 700, and 750, and derivatives thereof, among many others. See, e.g., "The Handbook— A Guide to Fluorescent Probes and Labeling Technologies," Tenth Edition, available on the internet at probes (dot) invitrogen (dot) com/handbook. The fluorescent label can be one or more of FAM, dRHO, 5-FAM, 6FAM, dR6G, JOE, HEX, VIC, TET, dTAMRA, TAMRA, NED, dROX, PET, BHQ, Gold540 and LIZ.

[0041] Using conventional techniques, an aptamer can be directly or indirectly labeled, e.g., the label is attached to the aptamer through biotin-streptavidin (e.g., synthesize a biotinylated aptamer, which is then capable of binding a streptavidin molecule that is itself conjugated to a detectable label; non-limiting example is streptavidm, phycoerythrin conjugated (SAPE)). Methods for chemical coupling using multiple step procedures include, e.g., biotinylation, coupling of trinitrophenol (TNP) or digoxigenin using for example succinimide esters of these compounds. Biotinylation can be accomplished by, for example, the use of D-biotinyl-N- hydroxy succinimide. Succinimide groups react effectively with amino groups at pH values above 7, and preferentially between about pH 8.0 and about pH 8.5. Alternatively, an aptamer is not labeled, but is later contacted with a second antibody that is labeled after the first antibody is bound to an antigen of interest. C. Aptamers for Absorption Enhancement

[0042] Epithelial and endothelial sheets act as barriers to maintain distinct compartments within a multicellular organism, or subject. This is achieved by intercellular junctions that restrict the movement of large macromolecules, as well as to a lesser degree small molecules, between the epithelial cells or through the paracellular pathways. Even ion movement across the epithelium is attenuated, thus creating transepithelial electrical resistance (TEER). Paracellular leakage of macromolecules from one compartment to another is prevented by the formation of tight junctions (Diamond, J., 1977).

[0043] The barrier function of the tight junction is, however, not stagnant. For example, many hydrophilic nutrients easily cross the epithelium through the paracellular pathway (Ballard et al, , 1995). Therefore, the tight junction controls paracellular permeability in a dynamic fashion, suggesting that the epithelial cells have ability to regulate the function of the tight junction.

[0044] Molecules typically cross the intestinal epithelium into the blood in primarily three pathways. First, molecules can cross by passive diffusion across the cell membranes (transcellular pathway); second by passive diffusion between adjacent cells (paracellular pathway); or third by carrier-mediated transport (carrier-mediated pathway). Lipophilic molecules easily cross the cell membrane via the transcellular route. On the other hand, hydrophilic molecules that are not recognized by a carrier cannot partition into the hydrophobic membrane, and thus must traverse the epithelial barrier via the paracellular pathway. The transport of hydrophilic molecules via the paracellular pathway, however, is severely restricted by the presence of the tight junctions.

[0045] Studies with insulin and salmon calcitonin have suggested that the primary method of transport of intestinal proteins across the small intestine is via the paracellular route (Drugs.com. Top 100 Drugs for Q4 2013 by Sales - U.S. Pharmaceutical Statistics; Leader et al , 2008). Transport across the epithelium through the paracellular route is driven by diffusion through the tight junctions. Diffusive processes operate on a relatively slow timescale compared to active transport within the body. Therefore, even with the use of (potentially dangerous) permeation enhancers, the rate of intestinal absorption will be limited by diffusion kinetics. Utilizing one of the many cellular mechanisms for achieving active, transcellular transport of proteins across the epithelium could greatly enhance both the rate and overall magnitude of intestinal absorption.

[0046] Because aptamers can exhibit these widely varying functions, embodiments of the present disclosure provide methods for designing aptamers for improving transport capabilities of protein therapeutics across the intestinal epithelium. Transport of antigens across the intestinal epithelium is accomplished naturally by IgA antibodies (Lamm, 1998), and studies have shown that transferrin (a protein for iron transport) may be used to improve protein transport by up to 15 times (Kavimandan et al , 2006), so it is expected that an aptamer analog of antibodies/proteins can be designed to have similar transcytosis-initiating capabilities to significantly enhance transport into the bloodstream. Choosing a known transporter like transferrin targets only a single receptor which can rapidly become saturated, limiting transport (Brewer and Lowman, 2012), despite there being many different potential transcytosis-initiating binding receptors on a cell. Therefore, aptamer selection using a cellular-based modification of the SELEX process will utilize the multiple potential cellular receptors and systematically select the optimal receptor to target for the greatest improvement in transport capability without requiring detailed understanding of each available receptor. III. SELEX Method

A. The SELEX Process Methodology

[0047] SELEX, standing for "systematic evolution of ligands by exponential enrichment," is a powerful tool for designing aptamers tailored for specific targets or specific functions. It is essentially a directed evolution process for chemicals rather than organisms. A large library of DNA or RNA strands, each containing a random sequence in between primer sequences, may be generated. Typically, the library may then be screened by placing the library in the presence of the target molecule, allowing the small fraction of aptamers that will bind the target molecule to bind, and isolating the bound nucleic acids from the nonfunctioning nucleic acids by washing or some other process. In embodiments of the present invention, the library may be screened for the ability of nucleic acids to pass through a layer of cells (e.g. , a monolayer of cells on a semi-permeable membrane). The aptamers that have passed through the layer of cells (e.g., from a first chamber, through the layer of cells, to a second chamber) are then amplified by PCR. The process may be repeated (e.g. , from 1, 2, 3, 4, 5 to 15 or more times). Because PCR exponentially amplifies the nucleic acids isolated by the selection step, it can widen the gap in moles of aptamers binding with high affinity and those binding with low affinity such that after repeated cycles, the most suitable nucleic acid sequence is almost exclusively selected (Klug and Famulok, 1994; Stoltenburg et al., 2007; Shamah et al , 2008). This process has been used for selection of many high affinity detection molecules with dissociation constants in the low picomolar to low nanomolar range (Nimjee et al , 2005).

[0048] The SELEX method involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method may include steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have bound specifically to target molecules, dissociating the nucleic acid-target complexes, amplifying the nucleic acids dissociated from the nucleic acid- target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific, high affinity nucleic acid ligands to the target molecule. [0049] The SELEX process is a method for the in vitro evolution of nucleic acid molecules with highly specific binding to target molecules and is described in U.S. patent application Ser. No. 07/536,428, filed Jun. 11, 1990, entitled "Systematic Evolution of Ligands by Exponential Enrichment," now abandoned, U.S. Pat. No. 5,475,096 entitled "Nucleic Acid Ligands", U.S. Pat. No. 5,270,163 (see also WO 91/19813) entitled "Nucleic Acid Ligands" each of which is specifically incorporated by reference herein. Each of these patents and applications, collectively referred to herein as the SELEX Patent Applications, describes methods for making a nucleic acid ligand to any desired target molecule. It is anticipated that variations in the SELEX method may be used in various embodiments of the present invention. [0050] The SELEX process may be used to identify nucleic acid ligands or aptamers, each having a unique sequence, which may display the ability to be adsorbed into cells or to facilitate transport through cells (e.g., epithelial cells of the intestine). Each SELEX- identified nucleic acid ligand is a specific ligand of a given target compound or molecule. Nucleic acids generated via the SELEX process may have a capacity for forming a variety of two- and three-dimensional structures and sufficient chemical versatility available within their monomers to act as ligands (i.e., form specific binding pairs) with a chemical compound or cell. The SELEX method applied to the application of high affinity binding involves selection from a mixture of candidate oligonucleotides and step-wise iterations of binding, partitioning and amplification, using the same general selection scheme, to achieve virtually any desired criterion of binding affinity and selectivity. Starting from a mixture of nucleic acids, preferably comprising a segment of randomized sequence, the SELEX method includes steps of contacting the mixture with the target under conditions favorable for binding, partitioning unbound nucleic acids from those nucleic acids which have passed through a layer of cells, and amplifying the nucleic acids dissociated from the nucleic acid-target complexes to yield a ligand-enriched mixture of nucleic acids, then reiterating the steps of binding, partitioning, dissociating and amplifying through as many cycles as desired to yield highly specific high affinity nucleic acid ligands to the target molecule.

[0051] The SELEX process may utilize the following series of steps:

1) A candidate mixture of nucleic acids of differing sequence is prepared. The candidate mixture generally includes regions of fixed sequences (i.e., each of the members of the candidate mixture contains the same sequences in the same location) and regions of randomized sequences. The fixed sequence regions are selected either:

(a) to assist in the amplification steps described below, (b) to mimic a sequence known to bind to the target, or (c) to enhance the concentration of a given structural arrangement of the nucleic acids in the candidate mixture. The randomized sequences can be totally randomized (i.e., the probability of finding a base at any position being one in four) or only partially randomized (e.g., the probability of finding a base at any location can be selected at any level between 0 and 100 percent).

2) The candidate mixture is administered to the solution in a first chamber that is separated from the solution in a second chamber by a layer of cells (e.g., a layer of intestinal or epithelial cells on a semi-permeable membrane). The second chamber may be located above the first chamber. This modified step is in contrast to the traditional SELEX method, which requires binding of aptamers to a specific target molecule and separation and purification of the aptamers bound to the target molecule.

3) The nucleic acids that have moved from the first chamber to the second chamber over a period of time (e.g. , about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55 minutes, or 1, 2, 3, 4, 5 hours or more, or any range derivable therein) may be removed and amplified to selectively amplify the nucleic acids that have migrated through the monolayer of cells.

4) By repeating the partitioning (2) and amplifying (3) steps above, the newly formed candidate mixture may contain fewer and fewer unique sequences, and the average degree of the ability of the nucleic acids to pass through the cells may increase.

[0052] The basic SELEX method may include one or more modifications, e.g. , as follows. For example, U.S. patent application Ser. No. 07/960,093, filed Oct. 14, 1992, entitled "Method for Selecting Nucleic Acids on the Basis of Structure", describes the use of SELEX in conjunction with gel electrophoresis to select nucleic acid molecules with specific structural characteristics, such as bent DNA. U.S. patent application Ser. No. 08/123,935, filed Sep. 17, 1993, entitled "Photoselection of Nucleic Acid Ligands" describes a SELEX based method for selecting nucleic acid ligands containing photoreactive groups capable of binding and/or photocrosslinking to and/or photoinactivating a target molecule. U.S. patent application Ser. No. 08/134,028, filed Oct. 7, 1993, entitled "High-Affinity Nucleic Acid Ligands That Discriminate Between Theophylline and Caffeine", describes a method for identifying highly specific nucleic acid ligands able to discriminate between closely related molecules, termed Counter-SELEX. U.S. patent application Ser. No. 08/143,564, filed Oct. 25, 1993, entitled "Systematic Evolution of Ligands by Exponential Enrichment: Solution SELEX" now issued as U.S. Pat. No. 5,567,588, describes a SELEX- based method which achieves highly efficient partitioning between oligonucleotides having high and low affinity for a target molecule. U.S. patent application Ser. No. 07/964,624, filed Oct. 21, 1992, entitled "Nucleic Acid Ligands" to HIV-RT and HIV-I Rev (now U.S. Pat. No. 5,496,938) describes methods for obtaining improved nucleic acid ligands after SELEX has been performed. U.S. patent application Ser. No. 08/400,440, filed Mar. 8, 1995, entitled "Systematic Evolution of Ligands by Exponential Enrichment: Chemi-SELEX", describes methods for covalently linking a ligand to its target. B. Cellular Transport of Aptamers Using a Modified SELEX method

[0053] As noted above, embodiments of the present disclosure provide methods for a modified cellular SELEX protocol in which the second step is modified to select for members of the candidate mixture capable of passing through a target barrier or a layer of target cells. Thus, there are no nucleic acid-target pairs identified as in the basic SELEX protocol.

[0054] In addition, the basic SELEX protocol uses in vitro targets such as immobilized proteins while the modified cellular SELEX protocol described herein involves whole cells in a culture system. Cellular SELEX has several advantages including the fact that it is not necessary to have prior knowledge of the target and that aptamers are selected against targets in their native conformation and physiological environment. A novel feature of the cellular SELEX is the selection of aptamers which enter inside a cell.

[0055] The most convenient route of drug administration is the oral route in which the intestinal mucosa represents the major barrier to absorption of orally administered drugs. Thus, models of intestinal absorption known in the art can be used as the target barrier in the methods provided herein. For example, a monolayer of cells can model a target barrier.

[0056] While any type of cell able to form a cell monolayer on a tissue culture insert can be used as described herein, the most common cell types used are epithelial cells, mammalian cells, mammalian epithelial cells, polarized cells, and, most preferably, polarized mammalian epithelial cells. The cells described herein can be cultured as a collection of single cells, a culture in the form of a cell monolayer, or a mixture of both. Mammalian epithelial cells can be derived from a variety of sources, such as humans, apes, cattle, rodents, canines, felines, etc. Furthermore, mammalian epithelial cells can be derived from a variety of organs, such as kidney, colon, intestine, and lung. For example, the target cells are mammalian epithelial cells such as MDCK cells, LLC PK1 porcine kidney cells, Caco-2 cells, CEBBel cells, HT-29 cells, T84 cells, SK-CO 15 cells, IEC-6 cells, IEC-18 cells, Ca Ski cells, STC-1 cells, HuTu 80 cells, FHs 74 cells, or IA-XsSBR cells, as well as co-cultures of such cell lines. In particular, the cells are intestinal epithelial cells such as Caco-2, HT-29, and T-84 cell lines. Alternatively, the cells may be primary intestinal epithelial cells such as human primary intestinal epithelial cells or iPSC-derived intestinal epithelial cells. [0057] In some embodiments, candidate mixture of nucleic acids such as an aptamer library is contacted with the target barrier and aptamers that enter or pass through the target barrier are selected. The selected aptamers can enter a target cell and/or exit a cell by passing through the cell membrane. Thus, aptamers that enter a cell can be selected by isolating the aptamers contained in the whole cells. The target cell can be lysed and the cytosolic content can be isolated by methods known in the art. Partitioning of labeled aptamers from the cytosolic content can be achieved using a combination of centrifugation and fluorescence automated cell sorting. Partitioning could be done by other means as well, such as using filtration devices, nitrocellulose membrane to immobilize the labeled aptamers or using other solid affinity supports such as magnetic beads, affinity titer plates and agarose beads. Alternatively, aptamers that pass through the cellular barrier can be selected by isolating the nucleic acid sequences found in the second chamber after selection using methods as described herein.

[0058] The candidate mixture of nucleic acids includes any nucleic acid or nucleic acid derivative, from which a complementary strand can be synthesized. The individual test nucleic acids can contain a randomized region flanked by conserved regions in all nucleic acids in the mixture. The conserved regions are preferably provided to facilitate amplification of selected nucleic acids. Since there are many such sequences known in the art, the choice of sequence is one which those of ordinary skill in the art can make, having in mind the desired method of amplification.

[0059] In some embodiments, the cells are in culture in the form of a monolayer, a cell suspension, as ex vivo tissue, or as embryoid bodies. A culture vessel used for culturing the cell(s) can include, but is particularly not limited to: flask, flask for tissue culture, dish, petri dish, dish for tissue culture, multi dish, micro plate, micro-well plate, multi plate, multi- well plate, micro slide, chamber slide, tube, tray, CELLSTACK® Chambers, culture bag, and roller bottle, as long as it is capable of culturing the cells therein. [0060] In particular embodiments, the cells are in cultured in a well with two compartments separated by a selective barrier to separate the apical and basolateral chambers of the tissue culture well. Target cells are grown in a tissue culture plate having a permeable tissue culture plate insert therein, where the permeable tissue culture plate insert provides the tissue culture plate with an apical chamber and a basolateral chamber and the permeable tissue culture insert has cells deposited thereon, where the apical chamber is essentially free of tissue culture medium and the basolateral chamber contains a solidifiable form of tissue culture medium. For example, the cells may be cultured as a monolayer on a transwell permeable support (U.S. Patent Application Publication No. 20100047907; incorporated herein by reference). In some embodiments, the cells are washed to remove culture media prior to the addition of the nucleic acid library. The nucleic acid library may be added to the apical (i.e., top) compartment and a wash buffer is added to the basolateral (i.e., bottom) compartment. The cells are preferably incubated with the nucleic acid library for a period of time sufficient to allow transport across the target barrier. In some embodiments, the suspension in the bottom compartment containing the nucleic acids transported across the barrier is collected, and the suspension in the upper compartment is discarded. The nucleic acids in the apical compartment suspension are sequenced to identify candidate aptamers. Alternatively, the isolated nucleic acids can be subjected to additional rounds of selection.

[0061] Sequencing, including DNA sequencing and RNA sequencing, may be used to identify the candidate aptamers. Methods of nucleic acid sequencing, including high throughput sequencing, are known in the art. In some embodiments, the nucleic acid library is a RNA library and the isolated RNA is reverse transcribed to cDNA before sequencing. IV. Therapeutic Agents

[0062] In some embodiments, the candidate aptamers identified by the methods provided herein are conjugated to therapeutic drugs. Accordingly, pharmaceutical compositions comprising aptamer-drug conjugates are provided herein. For example, the aptamer-drug conjugates are apatamer-protein, apatamer-siRNA, or apatamer-nanoparticle conjugates. Methods of producing aptamer-drug conjugates are known in the art (Bruno, Pharmaceuticals, 6: 340-357, 2003; incorporated herein by reference).

[0063] Therapeutic agents may be bound to the aptamer ligand of the present invention by known methods in the art (e.g., by covalent bond, noncovalent interactions, or expressed as a fusion or chimeric protein). A therapeutic agent or multiple therapeutic agents may be bound to a carrier, as well as multiple types of therapeutic agents. In a further embodiment, a therapeutic agent may be bound to a carrier using a linker. For example, BIOCONJUGATE TECHNIQUES (Academic Press; 1st edition, Greg T. Hermanson, 1996) describes techniques for modifying or crosslinking of biomolecules. For example, a diagnostic agent and a pharmaceutically active agent may be bound to a peptide ligand of the present invention. In another example, multiple types of agents may be bound to a carrier, such as at least one pharmaceutically active agent, at least one biologic agent, at least one diagnostic agent and at least one targeting agent, or various combinations thereof. [0064] In some aspects, the present invention provides a pharmaceutical composition comprising the aptamer ligands of the present invention and a therapeutic agent, and may include a pharmaceutically acceptable carrier for gastrointestinal administration, suitable for administration to a mammal, preferably a human. To administer the pharmaceutical composition to humans or animals, it is preferable to formulate the molecules in a composition comprising one or more pharmaceutically acceptable carriers. The phrase "pharmaceutically or pharmacologically acceptable" refers to molecular entities and compositions that do not produce allergic, or other adverse reactions when administered using routes well-known in the art. "Pharmaceutically acceptable carriers" include any and all clinically useful solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like.

[0065] The compounds of the invention, as well as the pharmaceutically acceptable salts thereof, may be incorporated into convenient dosage forms, such as capsules, impregnated wafers, tablets or preferably, injectable preparations. Solid or liquid pharmaceutically acceptable carriers may be employed.

[0066] Solid carriers include starch, lactose, calcium sulfate dihydrate, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate and stearic acid. Liquid carriers include syrup, peanut oil, olive oil, saline, water, dextrose, glycerol and the like. Similarly, the carrier or diluent may include any prolonged release material, such as glyceryl monostearate or glyceryl distearate, alone or with a wax. When a liquid carrier is used, the preparation may be in the form of a syrup, elixir, emulsion, soft gelatin capsule, sterile injectable liquid (e.g. , a solution), such as an ampoule, or an aqueous or nonaqueous liquid suspension. A summary of such pharmaceutical compositions may be found, for example, in Gennaro, AR, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins Publishers; 21 ^st Ed, 2005.

[0067] The pharmaceutical preparations are made following conventional techniques of pharmaceutical chemistry involving such steps as mixing, granulating and compressing, when necessary for tablet forms, or mixing, filling and dissolving the ingredients, as appropriate, to give the desired products for oral, parenteral, topical, transdermal, intravaginal, intrapenile, intranasal, intrabronchial, intracranial, intraocular, intraaural and rectal administration. The pharmaceutical compositions may also contain minor amounts of nontoxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents and so forth.

[0068] Examples of pharmaceutically acceptable carriers or additives include water, a pharmaceutical acceptable organic solvent, collagen, polyvinyl alcohol, polyvinyl- pyrrolidone, a carboxyvinyl polymer, carboxymethylcellulose sodium, polyacrylic sodium, sodium alginate, water-soluble dextran, carboxymethyl starch sodium, pectin, methyl cellulose, ethyl cellulose, xanthan gum, gum Arabic, casein, gelatin, agar, diglycerin, glycerin, propylene glycol, polyethylene glycol, Vaseline, paraffin, stearyl alcohol, stearic acid, human serum albumin (HSA), mannitol, sorbitol, lactose, a pharmaceutically acceptable surfactant and the like. Additives used are chosen from, but not limited to, the above or combinations thereof, as appropriate, depending on the dosage form of the present invention.

[0069] In some aspects, the present invention provides a method to deliver a therapeutic agent across the intestinal epithelial barrier in vivo. For example, an aptamer ligand of the present invention can be conjugated to a therapeutic agent. Accordingly, one with ordinary skill in the art can bind the aptamer ligands of the present invention to a therapeutic agent of interest, and introduce the conjugate in vivo. One with ordinary skill in the art can introduce the aptamer ligand of the present invention bound to a therapeutic agent and/or carrier to an animal by gastrointestinal administration. Gastrointestinal embodiments include embodiments in which the aptamer ligand of the present invention bound to a therapeutic agent and/or carrier and formulated for introduction to an animal in accordance with known methods for gastrointestinal delivery, such as by oral administration, rectal administration, and the like.

IV. Examples

[0070] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention. Example 1 - Materials and Methods

[0071] Initial Aptamer Library Preparation. A library of DNA sequences consisting of a twenty-nucleotide random sequence (N20) flanked by forward promoter and reverse promoter sequences was used for the selection process (TriLink Biotechnologies, San Diego, CA). A T7-promoter forward primer was incorporated in the sequence at the 5' end by PCR amplification. Three volumes of CleanAmp PCR master mix (TriLink Biotechnologies) were mixed with one volume each of 20 μΜ T7-promoter forward primer, 20 μΜ reverse primer, and 10 μΜ N20-library. The solution underwent PCR amplification in an Applied Biosystems 2720 thermocycler (Life Technologies, Carlsbad, CA), consisting of: heating at 95 °C for 5 min; 40 thermal cycles of 30 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C; and finally 10 min at 72 °C. The final reaction mixture was purified of unreacted components using a MinElute PCR purification kit (Qiagen, Valencia, CA). The resulting library, termed the "naive library," was used as the starting point for selection cycles.

[0072] In Vitro Transcription. The amplified dsDNA library for each selection round was transcribed into 2' -fluorine-modified RNA using the DuraScribe T7 transcription kit (Epicentre, Madison, WI). In brief, 3 volumes of dsDNA, 3 volumes of nuclease-free water, and 2 volumes of each reagent (DuraScribe T7 reaction buffer, 50 mM ATP, 50 mM GTP, 50 mM 2'-F-dCTP, 50 mM 2'-F-dUTP, 100 mM dithiothreitol (DTT), and DuraScribe T7 enzyme mix) were combined and incubated for 4 h at 37 °C. After incubation, DNA was digested by adding 1 volume of DNase I and incubating for 15 min. The resulting RNA library was purified using a miRNeasy purification kit (Qiagen).

[0073] Caco-2 Cell Culture. Caco-2 human colorectal adenocarcinoma cells (ATCC, Manassas, VA) were cultured normally using Dulbecco's Modified Eagle's Medium (DMEM) (Sigma- Aldrich, St. Louis, MO) with 10% v/v fetal bovine serum (Hy clone Laboratories, Logan, UT), 1% v/v penicillin-streptomycin (Fisher Scientific, Waltham, MA), and 1% v/v L-glutamine (Mediatech, Manassas, VA) added. Cells were cultured in 75 cm ² flasks (Fisher Scientific) at 37 °C with 5% CC . The cells were passaged once the cells reached 80-90% confluence, involving removal of cells from the flask surface by addition of trypsin in ethylenediaminetetraacetic acid (Sigma- Aldrich) and transfer to a new flask at 3.0 x 10 ³ cells/cm ² seeding density. At passage number 55, Caco-2 cells were seeded into Transwell plates (Corning, Tewksbury, MA). All wells contained a 1.12 cm ² polycarbonate membrane with 0.4 μιτι mesh size. Cells were seeded on this membrane at a density of 1.0 x 10 ⁵ cells/well, using 0.5 mL of DMEM in each apical chamber and 1.5 mL in each basolateral chamber. Cells were initially allowed to grow for 3 days before the media was changed. Media was then changed every 2 days for a total of 21 days.

[0074] Cellular Selection. Cellular selection was performed using a Caco-2 Transwell model. Caco-2 cells were seeded and grown in 12-well Transwell plates. After at least 21 days of culture in the Transwell plate, the culture media was removed from the transport wells and the wells were washed with Hank's Balanced Salt Solution (HBSS) (Life Technologies). The basolateral chamber was filled with 1.5 HBSS while the apical chamber received 0.5 mL HBSS with the RNA library added at a concentration of 5 μg/mL or greater, uniform across all wells. The wells were incubated for 1.5 h at 37 °C, after which the basolateral solution was collected for quantification and purification using a miRNeasy purification kit.

[0075] In Vitro Reverse Transcription. The selected RNA was reverse transcribed to complementary DNA using Superscript III reverse transcriptase (Life Technologies). A mixture of 1 volume of 20 μΜ T7-promoter forward primer, 1 volume of 20 μΜ reverse primer, 10 volumes of purified RNA, and 1 volume of dNTP mixture (Life Technologies) was heated to 65 °C for 5 min and placed on ice for 1 min. Following this, 4 volumes of Superscript First-Strand Buffer, 1 volume 0.1 M DTT, and 1 volume of Superscript III reverse transcriptase were added. The reaction mixture was incubated at 55 °C for 1 h, followed by incubation at 70 °C for 15 min to stop the reaction. The resulting cDNA was purified using a MinElute PCR purification kit.

[0076] Nucleic Acid Quantification. Following each step in the selection process— PCR amplification, transcription, selection, or reverse transcription— the DNA or RNA was quantified using 2 μΐ. of sample in a Nanodrop 1000 UV-Vis spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). The amount of DNA or RNA was quantified by UV absorbance measurement at 260 nm. Purity was ensured using ratios of absorbances at different characteristic wavelengths, namely the 260/230 and 260/280 ratios.

[0077] Cycle Repetition. Following reverse transcription and purification, the resulting DNA library functioned as a new starting library for another selection round. The new library was amplified using the PCR reaction described above and carried through the entire selection protocol 3 times. A flowchart summarizing the process is shown in FIG. 2. The selection protocol was carried out in 4 parallel samples (n = 4).

[0078] Sequencing Procedure. After the final selection step, the selected RNA sequences were reverse transcribed to dsDNA and PCR amplified for sequencing. Library preparation and sequencing was performed by the Genomic Sequencing and Analysis Facility at The University of Texas at Austin using standard Illumina library preparation kits and a 2 x 150 MiSeq sequencer (Illumina, San Diego, CA). Selected aptamer libraries and the naive library were sequenced.

[0079] Data Analysis. Sequencing data were analyzed using Galaxy (usegalaxy.org) (Appel 1986; Kavimandan et al., 2006; Jones and Waldmann, 1972). The FastQ files containing sequence reads were analyzed using the following workflow. Data quality was ensured using the FastQC quality report tool (Kavimandan and Peppas, 2008). Sequence reads containing the expected T7 primer were selected and trimmed to isolate the N20 random sequence. The data was converted from FastQ to tabular format (Artursson and Karlsson, 1991), to enable counting of the number of occurrences of each sequence. Finally, the data was sorted to identify the most numerous N20 sequence reads. This analysis was performed on the individual selected libraries, the naive library, and the combined data from all selected aptamer libraries.

Example 2 - Modified Cellular SELEX Protocol [0080] The in vitro selection process was designed to enable the cellular selection of transcellular transport-initiating aptamers with minimal experimentation needed to determine optimal targets. Although many aptamer design studies have been performed, these have used isolated binding targets that are easily separable, such as by immobilization on magnetic beads to enable magnetic separation of bound aptamers from unbound nucleic acids (Yee, 1997). Using isolated targets has been necessary largely due to the poor stability of nucleic acids in biological systems, thus necessitating a selection environment completely free of nucleases, but requires the researcher to know a priori what the desired target is.

[0081] By using nucleotides with 2'-fluorine modifications on the pyrimidines, the in vivo half-life can be greatly extended (Blanchette et al, 2004), allowing selection to occur directly in a cellular environment without nuclease digestion destroying the aptamers. Similar selection protocols have previously been reported, demonstrating successful use of cellular aptamer selection (Lowman et al , 1999; Carr et al , 2010). Applying the systematic evolution protocol within the Caco-2 cellular model should therefore enable discovery of the optimal aptamer sequences for enhancing intestinal absorption, without requiring prior knowledge of the optimal transport receptors for the aptamer to bind. Therefore, the modifications incorporated into this protocol should enable a rapid, yet robust aptamer discovery process that mimics the full complexity of the system.

[0082] Furthermore, the use of high throughput sequencing rather than traditional Sanger sequencing greatly benefits the aptamer selection process. Traditionally, SELEX protocols require 10 or more rounds of selection followed by cloning of a small number of sequences to isolate and amplify individual sequences before Sanger sequencing can accurately identify the sequence. However, use of next-generation sequencing (NGS) enables tens of millions of unique sequences to be identified simultaneously, allowing the researcher to analyze the distribution of an entire library within a far faster time frame. As such, applying NGS to the traditional SELEX protocol allows for optimal aptamer sequences to be determined within a few selection rounds rather than 10 or more, greatly reducing the experimental time frame, reducing the chances of identifying sequences most present due to PCR amplification bias rather than optimal binding, and increasing the accuracy with which the library's sequence distribution can be determined (Yee, 1997; Carr and Peppas, 2010; Foss and Peppas, 2004; Kamei et al , 2009; Brannon-Peppas and Peppas, 1991; Lopez and Peppas, 2004; Morishita et al. , 2006; Tuesca et al. ,. 2008; Knox et al, 2011 ; Wu et al, 2006; Torres-Lugo and Peppas, 1999).

[0083] The protocol was successfully performed as described, with 4 aptamer libraries undergoing the selection protocol in parallel. Only 3 of the aptamer libraries successfully formed sequencing libraries upon sample preparation; all analysis was carried out using these 3 libraries.

Example 3 - Aptamer Sequencing

[0084] The aptamer libraries were successfully sequenced and analyzed as described in Example 1. Table 1 shows the total number of sequence reads for each of the individual libraries studied. Each library had over 4 million sequence reads. However, with a 20 nucleotide random sequence, the potential number of sequences is 4 ²⁰ sequences, or approximately 1.1 trillion possibilities. Therefore, 4 million reads can only cover at most 3.6 x 10 ^"4 % of all possible sequences, meaning the expected number of each sequence actually observed in the naive library is only 1 because the odds of observing that sequence are so low. This is reflected in the samples, as the number of unique sequences is 0.93x as many as the total observed, indicating an average observed copy number of only 1.07. As such, sequences observed more than once in the native library are likely benefitting from PCR bias, where the PCR process amplifies a particular sequence to a greater degree than others due to one of numerous potential factors (e.g., preferable primer or enzyme binding). In an effort to control for PCR bias in the final aptamer libraries, the observed number of aptamers will be compared to the observed number of the same aptamer in the naive library.

Table 1 : Overview of MiSeq High Throughput Aptamer Sequencing Results.

Table 2: Top 10 Most Commonly Sequenced N20 Aptamer Sequences.

Number of Sequences Observed

RNA N20 Sequence

(5'-3 ') Total, All Aptamer, Aptamer, Aptamer, Naive

Aptamers #1 #2 #3 Library

CCGAUCUUUCAGGUAAUACU

100 65 14 21 5 (SEQ ID NO: 1)

AAGUGGUCAUGUACUAGUCA

80 36 17 27 12 (SEQ ID NO: 2)

UCCGAUCUUUCAGGUAAUAC

64 42 10 12 2 (SEQ ID NO: 3)

CCGAUCUUUCAGGUAAUACA

59 39 10 10 2 (SEQ ID NO: 4)

ACACGACGCUCUUCCGAUCU

37 33 3 1 5 (SEQ ID NO: 5)

CUGAACAGGUAAUACGACUC

35 9 9 17 1 (SEQ ID NO: 6)

CGAUCUUUCAGGUAAUACGU 33 16 6 11 0 (SEQ ID NO: 7)

AGCAGAAGACGGCAUACGAG

32 7 12 13 9 (SEQ ID NO: 8)

GAUCUUUCAGGUAAUACAAC

26 15 5 6 0 (SEQ ID NO: 9)

CCUGAAUUCAGGUAAUACGA

26 5 6 15 5 (SEQ ID NO: 10)

RNA aptamer sequences were read on the MiSeq platform (using the complementary DNA reverse-transcripts). Number of sequence reads are listed as the total occurrences across all three sequenced aptamer libraries, the occurrences within individual libraries, and the occurrences in the naive DNA library. [0085] As with the naive library, the expected number of times a particular sequence would be observed in the combined aptamer sequencing data based purely on probability is 0.000015 times. However, despite sheer probability suggesting a particular sequence would not even be observed, the most frequently observed sequence was sequenced 100 times, indicating a significant degree of selection pressure making this sequence so prevalent compared to random chance.

Table 3: Selection Ratios of Sequenced Aptamers.

AAGUGGUCAUGUACUAGUCA 80 12 2.00 27

(SEQ ID NO: 2)

CCUGAAUUCAGGUAAUACGA 26 5 1.56 37

(SEQ ID NO: 10)

AGCAGAAGACGGCAUACGAG 32 9 1.07 55

(SEQ ID NO: 8)

CGAUCUUUCAGGUAAUACGU 33 0 Undefined N/A

(SEQ ID NO: 7)

GAUCUUUCAGGUAAUACAAC 26 0 Undefined N/A

(SEQ ID NO: 9)

RNA aptamer sequences were read on the MiSeq platform (using the complementary DNA reverse-transcripts) Selection ratio is defined as number of occurrences of aptamer in selected libraries divided by the number of occurrences expected based on the number of occurrences in the naive library. Selection ratio rank is numerical rank of sequence by selection ratio as compared to all observed sequences with a defined selection ratio.

[0086] The selection pressure could be due to one of several factors, including improved Caco-2 permeability (as desired), PCR bias, or sequencing bias Dressman and Kramer, 2005; Roberts et al , 2012). Unfortunately, sequencing bias cannot be easily controlled because it is inherent to the identification method at the current time. PCR bias is also inherent to the selection process, but can be partially controlled for by comparing the relative number of sequence reads between the selected and naive libraries. Interestingly, all of the 6 most commonly observed sequences in the aptamer library (and 8 of the top 10) were also observed in the naive library. Given the low probability of observing a specific sequence in the naive library, it is likely that these sequences benefitted from either PCR or sequencing bias to make them all appear in the naive library sequences, most at more than one read.

[0087] Nevertheless, the degree to which these sequences are overexpressed is quite significant. After dividing the number of sequences observed in the selected libraries by the count in the naive library and accounting for the difference in number of total reads, the degree to which these sequences were upregulated was determined. This ratio of the number of observed reads in the aptamer libraries to the number of expected reads based on the naive library is defined as the "selection ratio." The 6 sequences with the highest selection ratios are shown in Table 3, along with the 4 remaining sequences from the 10 most prevalent (Table 2) that either were not in the top 6 sequences or did not appear in the naive library sequence reads.

[0088] After correcting for the prevalence in the naive library, several sequences emerge as potential ligands for further study, such as the sequence CUGAACAGGUAAUACGACUC (SEQ ID NO: 6) with a selection ratio indicating 10-fold upregulation over the course of the selection protocol. Furthermore, the two sequences that were not observed in the naive library reads that were in the top 10 most prevalent sequences CGAUCUUUCAGGUAAUACGU (SEQ ID NO: 7) and GAUCUUUCAGGUAAUACAAC (SEQ ID NO: 9)— are especially interesting. The fact that they were not observed in the naive library could indicate that they are becoming more prevalent in the sample due entirely to the selection process rather than PCR or sequencing bias, which would have likely shown in the naive library. Finally, the most prevalent sequence in the aptamer libraries, CCGAUCUUUCAGGUAAUACU (SEQ ID NO: 1), remains in the top 5 sequences with the highest selection ratio, indicating strong selection preference, despite potential PCR bias. These few sequences are worth studying individually to see if they do in fact aid in intestinal absorption, to what extent, and by what mechanism they achieve selective absorption.

Example 4 - Caco-2 Intestinal Absorption

[0089] The nucleic acids were quantified before and after selection in the Caco-2 Transwell model to determine the percent absorption across the cellular monolayer. The percent recovery after each selection round is shown in FIG. 3. It is interesting to note that each subsequent step in the selection process shows a greater percentage of the aptamer library applied to the apical chamber being absorbed across the Caco-2 monolayer into the basolateral chamber. Furthermore, the increase in absorption is statistically significant (p < 0.05) for each subsequent selection round. This trend provides further support for the fundamental hypothesis that the selection process is driving the aptamer library toward a distribution of sequences that are more adept at transport across the intestinal epithelium by eliminating poorly absorbed sequences.

[0090] Given this data, the selection and sequencing processes were quite successful. An initial library containing 1.1 trillion potential sequences was narrowed down to 5-10 sequences that appear to be strong candidates for enabling high bioavailability across the intestinal epithelium. The selection protocol required a minimal number of selection steps and little a priori knowledge of the optimal binding targets, yet demonstrated significant improvements in transport across a Caco-2 monolayer over subsequent selection rounds.

[0091] Further studies would be needed to fully characterize the identified RNA aptamers. Caco-2 studies using isolated sequences, both with free protein therapeutic and with protein-aptamer conjugates, could better determine if and to what extent these aptamers increase protein absorption, as well as the mechanism for the enhancement. Nevertheless, this work has successfully identified several promising candidate sequences for further study that could provide a relatively low molecular weight (6.6 - 21.3 kDa, depending on if primers are necessary for activity) alternative to transferrin that enables similar or improved levels of protein absorption across the intestinal epithelium.

* * *

[0092] All of the methods disclosed and claimed herein can be made and executed without undue experimentation in light of the present disclosure. While the compositions and methods of this invention have been described in terms of preferred embodiments, it will be apparent to those of skill in the art that variations may be applied to the methods and in the steps or in the sequence of steps of the method described herein without departing from the concept, spirit and scope of the invention. More specifically, it will be apparent that certain agents which are both chemically and physiologically related may be substituted for the agents described herein while the same or similar results would be achieved. All such similar substitutes and modifications apparent to those skilled in the art are deemed to be within the spirit, scope and concept of the invention as defined by the appended claims.

REFERENCES

The following references, to the extent that they provide exemplar} ¹ procedural or other details supplementary to those set forth herein, are specifically incorporated herein by reference.

U.S.Pat. No.5,270,163

U.S. Pat. No.5,475,096

U.S. Pat. No.5,496,938

U.S. Pat. No.5,567,588

U.S. Pat. No.5,977,089

U.S. Pat. No.6,005,087

U.S. Pat. No.6,031,086

U.S. Pat. No.6,127,533

U.S. Pat. No.6,225,460

U.S. Pat. No.6,399,754

U.S. Pat. No.6,403,779

U.S. Patent App.07/536.428

U.S. Patent App.07/960.093

U.S. Patent App.08/123,935

U.S. Patent App.08/134,028

U.S. Patent App.08/143,564

U.S. Patent App.08/400,440

U.S. Pat. App. Pub. No.20100047907

WO 91/19813

"The Handbook— A Guide to Fluorescent Probes and Labeling Technologies," Tenth Edition Academic Press; 1st edition. Greg T. Hermanson.1996

Appel, W., Chymotrypsin: Molecular and Catalytic Properties. Clin. Biochem., 19, 317-322, 1986. Artursson and Karlsson, Correlation between Oral Drug Absorption in Humans and Apparent Drug Permeability Coefficients in Human Intestinal Epithelial (Caco-2) Cells.

Biochem. Biophys. Res. Commun. , 175, 880-885, 1991.

Balda ei a/., Junctions. J. Cell Sci., I l l, 541-547, 1998.

Ballard et al, Annu. Rev. Nutr. 15:35-55, 1995.

Blanchette et al., Principles of Transmucosal Delivery of Therapeutic Agents. Biomed.

Pharmacother., 58, 142-151, 2004.

Blind and Blank, Aptamer Selection Technology and Recent Advances. Mol. Ther. — Nucleic Acids, 4, e223, 2015.

Brannon-Peppas and Peppas, Equilibrium Swelling Behavior of Dilute Ionic Hydrogels in Electrolytic Solutions. J. Controlled Release, 16, 319-329, 1991.

Brewer and Lowman, A. M. Assessing the Transport of Receptor-Mediated Drug-Delivery Devices across Cellular Monolayers. J. Biomater. Sci. Polym. Ed., 25, 455-473, 2014.

Brewer and Lowman, Characterization of Drug Delivery Systems Utilizing Receptor- Mediated Transport. Bioeng. Conf. NEBEC 201238th Annu. Northeast, 105-106, 2012.

Bruno, Pharmaceuticals, 6: 340-357, 2003

Carr and Peppas, Assessment of Poly(methacrylic Acid-Co-N -Vinyl Pyrrolidone) as a Carrier for the Oral Delivery of Therapeutic Proteins Using Caco-2 and HT29-MTX Cell Lines. J. Biomed. Mater. Res. A, 92A, 504-512, 2010.

Carr et al , Complexation Hydrogels for the Oral Delivery of Growth Hormone and Salmon Calcitonin. Ind. Eng. Chem. Res., 49, 11991-11995, 2010.

Crooke, S. (ed.) Antisense Drug Technology: Principles, Strategies, and Applications (1st ed.).

Diamond, J., "The Epithelial Junction: Bridge, Gate and Fence", Physiologist 20: 10-18, 1977.

Dressman and Berardi, Dermentzoglou, L. C; Russell, T. L.; Schmaltz, S. P.; arnett, J. L.;

Jarvenpaa, K. M. Upper Gastrointestinal (GI) pH in Young, Healthy Men and Women.

Pharm. Res., 7, 756-761, 1990.

Dressman and Kramer, Pharmaceutical Dissolution Testing; Taylor & Francis: Boca Raton, FL, 2005. Drugs.com. Top 100 Drugs for Q4 2013 by Sales - U.S. Pharmaceutical Statistics www.drugs.com/stats/toplOO/sales.

Eulberg and Klussmann, Spiegelmers: Biostable Aptamers. ChemBioChem, 4, 979-983, 2003.

Foss and Peppas, Investigation of the Cytotoxicity and Insulin Transport of Acrylic-Based Copolymer Protein Delivery Systems in Contact with Caco-2 Cultures. Eur. J. Pharm. Biopharm., 57, 447-455, 2004.

Gennaro, AR, Remington: The Science and Practice of Pharmacy, Lippincott Williams & Wilkins Publishers; 21st Ed, 2005.

Giardine et al, Galaxy: A Platform for Interactive Large-Scale Genome Analysis. Genome Res., 15, 1451-1455, 2005.

Jayasena, S. D., Aptamers: An Emerging Class of Molecules That Rival Antibodies in Diagnostics. Clin. Chem. 1999, 45, 1628-1650, 1999.

Jones and Waldmann, The Mechanism of Intestinal Uptake and Transcellular Transport of IgG in the Neonatal Rat. J. Clin. Invest., 51, 2916-2927, 1972.

Kamei et al, Complexation Hydrogels for Intestinal Delivery of Interferon B and Calcitonin.

J. Controlled Release, 134, 98-102, 2009.

Kavimandan and Peppas, Confocal Microscopic Analysis of Transport Mechanisms of Insulin across the Cell Monolayer. Int. J. Pharm., 354, 143-148, 2008.

Kavimandan et al., Novel Delivery System Based on Complexation Hydrogels as Delivery Vehicles for Insulin-transferrin Conjugates. Biomaterials , 27, 3846-3854, 2006.

Klug and Famulok, M. All You Wanted to Know about SELEX. Mol. Biol. Rep., 20, 97-107, 1994.

KluBmann et al., Mirror-Image RNA That Binds D- Adenosine. Nat. Biotechnol., 14, 1112- 1115, 1996.

Knox et al., DrugBank 3.0: A Comprehensive Resource for "Omics" Research on Drugs.

Nucleic Acids Res., 39, D1035-D1041, 2011.

Lamm, M. E. Current Concepts in Mucosal Immunity. IV. How Epithelial Transport of IgA Antibodies Relates to Host Defense. Am. J. Physiol. - Gastrointest. Liver Physiol., 274, G614-G617, 1998. Leader et al, Protein Therapeutics: A Summary and Pharmacological Classification. Nat. Rev. Drug Discov., 7, 21-39, 2008.

Lin et al., Modified RNA Sequence Pools for in Vitro Selection. Nucleic Acids Res., 22, 5229-5234, 1994.

Lopez and Peppas, Effect of Poly (Ethylene Glycol) Molecular Weight and Microparticle Size on Oral Insulin Delivery from P(MAADgDEG) Microparticles. Drug Dev. Ind. Pharm., 30, 497-504, 2004.

Lowman et al., Oral Delivery of Insulin Using pH-Responsive Complexation Gels. J. Pharm.

Sci., 88, 933-937, 1999.

Marcel Dekker; ISBN: 0824705661 ; 1st edition (2001).

Matter and Balda, Signalling to and from Tight Junctions. Nat. Rev. Mol. Cell Biol., 4, 225- 237, 2003.

McNamara ei a/. 2006. Nat Biotechnol. 24(8): 1005-15, 2006.

Morishita et al, Oral Insulin Delivery Systems Based on Complexation Polymer Hydrogels.

J. Drug Deliv. Sci. Technol, 16, 19-24, 2006.

Nimjee et al, Aptamers: An Emerging Class of Therapeutics. Annu. Rev. Med., 56, 555-583, 2005.

Nolte et al, Mirror-Design of L-Oligonucleotide Ligands Binding to L-Arginine. Nat.

Biotechnol, 14, 1116-1119, 1996.

Pagratis et al, Potent 2'-Amino-, and 2'-Fluoro-2'- Deoxyribonucleotide RNA Inhibitors of Keratinocyte Growth Factor. Nat. Biotechnol, 15, 68-73, 1997.

Roberts et al, Chemistry for Peptide and Protein PEGylation. Adv. Drug Deliv. Rev., 64, Supplement, 116-127, 2012.

Rodriguez et al, Does Trypsin Cut Before Proline? J. Proteome Res., 7, 300-305, 2007.

Shamah et al, Complex Target SELEX. Acc. Chem. Res., 41, 130-138, 2008.

Steed et al, Dynamics and Functions of Tight Junctions. Trends Cell Biol, 20, 142-149, 2010.

Stoltenburg et al, SELEX— A (Revolutionary Method to Generate High- Affinity Nucleic Acid Ligands. Biomol. Eng., 24, 381-403, 2007. Torres-Lugo and Peppas, Molecular Design and in Vitro Studies of Novel pH-Sensitive Hydrogels for the Oral Delivery of Calcitonin. Macromolecules , 32, 6646-6651, 1999.

Torres-Lugo et al., pH-Sensitive Hydrogels as Gastrointestinal Tract Absorption Enhancers:

Transport Mechanisms of Salmon Calcitonin and Other Model Molecules Using the Caco-2 Cell Model. Biotechnol. Prog., 18, 612-616, 2002.

Tuesca et al., Complexation Hydrogels for Oral Insulin Delivery: Effects of Polymer Dosing on in Vivo Efficacy. J. Pharm. Sci., 97, 2607-2618, 2008.

Ulrich et al, RNA and DNA Aptamers in Cytomics Analysis. Cytometry A, 59 A, 220-231, 2004.

Wu et al., Multi-Modality of pi Distribution in Whole Proteome. Proteomics, 6, 449-455, 2006.

Wu, et al., Size-Modulated Catalytic Activity of Enzyme-nanoparticle Conjugates: A Combined Kinetic and Theoretical Study. Chem. Commun., 47, 7446-7448, 2011.

Yee, S. In Vitro Permeability Across Caco-2 Cells (Colonic) Can Predict In Vivo (Small Intestinal) Absorption in Man— Fact or Myth. Pharm. Res., 14, 763-766, 1997.

Zhou and Rossi, Curr Top Med Chem. 9(12): 1144-57, 2009.

Zhou, 2008. Chem Biol. 15(7):644-5, 2008.