The present invention relates to the use of an Autonomously Replicating Sequence (ARS) to modulate gene amplification in a eukaryotic cell. Preferably, an ARS sequence is introduced adjacent to a gene of interest, and the cells are grown under selective conditions, requiring a high expression of the gene of interest. Alternatively, an existing ARS sequence is deleted to increase the genetic stability of a certain DNA region.

Microbial evolutionary experiments have received considerable attention in recent years for various reasons. First they allow in depth understanding of the fundamental process of evolution in a rapid and rigorously controlled way (Barrick and Lenski 2009). Second, microbial evolution raises great interest in various fields such as in medicine and industrial applications (Sauer 2001 ; Cakar et al. 2012; Frank 2013). Using nature's evolutionary principle of variation and selection, microbial evolution has been used for development and optimization of several production host organisms in industrial applications. The strategy, called evolutionary engineering, typically employs one or a combination of multiple methods that include random mutagenesis, genome shuffling, which recombines the natural genetic variation and the variation created by mutagenesis, followed by evolutionary adaptation for several generations in a selectable environment. The mutant strains that are better adapted to the new environment with respect to survival and reproductive success will be selected during the evolution process. The speed of fitness gain in the new environment depends on the rate of genetic changes as well as their advantage (Elena and Lenski 2003). Genetic changes that occur during evolution include point mutations, gene deletions or amplifications, and often gene rearrangements involving transposable elements, which in turn might generate deletions or amplifications.

In a broader context, gene duplications and amplifications have played a crucial role in the evolution and genetic diversity of species, in particular for adaptation to restrictive environmental conditions (Kondrashov 2012; Katju and Bergthorsson 2013). Segmental duplications and amplifications are common in eukaryotes. In the yeast Saccharomyces cerevisiae genome, about 1 out of 5 genes have been identified as duplicates (Ames et al. 2010). Moreover, nearly 2% of the coding sequences in S. cerevisiae are tandem gene arrays (Despons et al. 2010). Tandem repetitive DNA sequences that include ribosomal DNA (rDNA) and the telomeric loci are very prone to copy number alterations as a consequence of homologous recombination (HR). Such regions play a significant role in the plasticity of the genome. Other repetitive elements like Ty elements and solo Long Tandem Repeats (LTRs) that are widely dispersed in the yeast genome are potential substrates for HR between the short repeats flanking a DNA segment. In spite of the major contribution of repetitive DNA sequences in elevated rates of genome plasticity, segmental amplifications are not restricted to regions with repetitive sequences. However, the generation of tandem gene amplifications from originally single copy sequences is not well understood. The creation of extrachromosomal circular DNA (eccDNA) has been proposed as a possible mechanism for the origin and plasticity of tandem gene repeats (Cohen and Segal 2009). The formation of eccDNA has been attributed to the circularization of a DNA segment from a chromosome during HR between preexisting closely located homologous sequences such as long terminal repeats (LTRs), resulting in the excision of the DNA segment (Gresham et al. 2010). To the best of our knowledge, no experimental evidence exists for the formation of eccDNA in the absence of repeat sequences.

The yeast S. cerevisiae has a very long proven record of industrial application, due to its efficient conversion of glucose into ethanol with high productivity, and its substantial tolerance to various inhibitory compounds, including ethanol (Olsson et al. 1992; Lau et al. 2010). However, it is unable to efficiently metabolize D-xylose into ethanol. Typically, D-xylose accounts for about one-third of the sugars in lignocellulosic biomass (Limayem and Ricke 2012; de Souza et al. 2013). Due to the recent interest in biofuel production with biomass from waste streams and bioenergy crops, engineering S. cerevisiae for efficient D-xylose to ethanol conversion has become an important research focus (Alper and Stephanopoulos 2009). Expression of the heterologous structural genes responsible for D-xylose to ethanol conversion in S. cerevisiae did not lead by itself to sufficient productivity for industrial scale application (Brat et al. 2009).

Recently, using a combination of metabolic and evolutionary engineering strategies, we have developed a robust industrial yeast strain that displayed the highest D-xylose to ethanol conversion rate and yield compared to any other recombinant yeast strain reported previously (Demeke et al. 2013).

Surprisingly we found that crucial genetic changes responsible for the rapid D-xylose utilization rate in this strain. Using whole genome sequence comparison of the evolved strain with that of the parent strain, we identified a major copy number variation in the heterologous gene XylA, encoding Clostridium phytofermentans xylose isomerase (XI), that correlated with the high enzymatic activity measured in crude cell extracts. In addition, we investigated the evolutionary process that resulted in stable integration of this gene in tandem high copy number into the genome using several intermediate strains with varying xylose fermentation rate. Even more surprisingly, we confirmed the formation of self-replicating eccDNA carrying the gene XylA during adaptive evolution in the absence of any homologous sequence flanking the repeat DNA segment; during later stages of the adaptive evolution, the generated eccDNA had reintegrated into the locus of origin in the genome, generating increasing numbers of tandem repeats first in one of the chromosomes and later in the second chromosome in the diploid strain. The presence of an ARS sequence near to the gene that needs to be amplified is essential in this process: the formation of eccDNA can occur in the absence of HR and can serve as a rapid means of adjustment to selection pressure during evolutionary adaptation, especially when higher gene dosage serves as a selective advantage for proliferation or survival. The ARS element located adjacent to the amplified gene is not only required for amplification of the eccDNA but stimulates its formation.

A first aspect of the invention is the use of an ARS sequence to modulate gene amplification in a eukaryotic cell. Preferably, said eukaryotic cell is a yeast cell, preferably, said yeast is selected from the group consisting of Saccharomyces sp., Candida sp., Picha sp., Kluyveromyces sp., Dekkera sp., Zygosaccharomyces sp. and Schizosaccharomyces sp.; even more preferably it is a Saccharomyces sp., most preferably it is a Saccharomyces cerevisiae. In one preferred embodiment, an ARS sequence is fused to a DNA fragment comprising a gene of interest. A "gene of interest" as used here is a gene that one wants to amplify, preferably to increase the expression of the gene product. "Gene" as used here, comprises the promoter region, the coding sequence and the terminator region. In one embodiment, the ARS sequence is integrated in the genome, adjacent to the gene of interest. Adjacent may be upstream or downstream the gene, or overlapping with the gene, preferably with the 3' end. "Adjacent" as used here is less than 10 000 bp removed from the gene, preferably less than 7 500 bp, even more preferably less than 5 000 bp, more preferably less than 2 500 bp, most preferably less than 1 000 bp. An ARS sequence is known to the person skilled in the art; preferably, said ARS sequence comprises the consensus sequence T/A TTTAYRTTT T/A; even more preferably, said ARS sequence comprises the consensus sequence TTATTTATATTTTTCT, preferably consists of SEQ ID No.1 (ARS1529, given here below) or a variant thereof, as shown in Figure 9 (GS1 .1 1 -26). Both the ARS sequence and the gene of interest may be either a homologous or a heterologous sequence, as referred to the host cell. The fusion can be realized by inserting the ARS sequence near to the gene of interest in the genome, of by inserting a gene of interest near to an ARS sequence in the genome, or by inserting a construct comprising a gene of interest linked to an ARS sequence into the genome. In a preferred embodiment, an ARS is inserted adjacent to a gene of interest.

SEQ ID No.1 (ARS 1529)

GCAAATTACTCATCACATTTATTGACTACGAACTTGCTGATGTCCTTTTTTTATTTA TATTTT TCTTCAGTGAAGCGATTTTTTTTTTACACAGACCAAGACGGAAAAAAGTAGCTAAGGAAG A AAACAAAATCATGAAAAAAATGTGAAGTGATCATGCACATCGCATCAACTTAAACATTGG C TTAG AG ATATATAG AGTTAG AGTTTAC G G C AAC CTTTAAG C AC C AATAC CT

In another preferred embodiment, an ARS sequence is inactivated or deleted in a chromosomal region that one wants to stabilize by avoiding amplification. Mutations that inactivate the ARS activity are known to the person skilled in the art; preferably said mutation is a mutation in the consensus sequence. Preferably, said chromosomal region comprises a gene of which high expression is unwanted.

Another aspect of the invention is a method to induce gene amplification of a gene of interest in a eukaryotic cell, comprising (1 ) combining an ARS sequence and a gene of interest in the genome of said eukaryotic cell (2) growing said cell under conditions that are selective for a high expression of the gene of interest (referred as "selective growth conditions") and (3) isolating cells that show a better growth performance under the selective growth conditions. "Combining an ARS sequence and a gene of interest", as used here, is carried out as described above, either by integrating an ARS adjacent to a gene of interest in the chromosome the eukaryotic cells, or by integrating a gene of interest adjacent to an ARS in the chromosome of the eukaryotic cell, of by integrating a construct comprising an ARS adjacent to a gene of interest in the chromosome of the eukaryotic cell. "Adjacent" as used here is less than 10 000 bp removed from the gene, preferably less than 7 500 bp, even more preferably less than 5 000 bp, more preferably less than 2 500 bp, most preferably less than 1 000 bp. "Growing said cell under conditions that are selective for high expression of the gene of interest" can be in one cycle, or in several cycles, as is usual done in directed and/or adaptive evolution experiments. The growth can be in batch culture, or in fed batch or continuous culture. "Methods to select cells that show a better growth performance" are known to the person skilled in the art, and include, but are not limited to the analysis of the growth by analysis of the optical density in batch culture, or the increase of the dilution factor in continuous culture.

Preferably, said eukaryotic cell is a yeast cell, preferably, said yeast is selected from the group consisting of Saccharomyces sp., Candida sp., Picha sp., Kluyveromyces sp., Dekkera sp., Zygosaccharomyces sp. and Schizosaccharomyces sp.; even more preferably it is a Saccharomyces sp., most preferably it is a Saccharomyces cerevisiae.

As mentioned above, both the ARS sequence and the gene of interest may be either a homologous or a heterologous sequence, as referred to the host strain. An ARS sequence is known to the person skilled in the art; preferably, said ARS sequence comprises the consensus sequence T/A TTTAYRTTT T/A; even more preferably, said ARS sequence comprises, preferably consists of SEQ ID No.1 (ARS1529) or a variant thereof. The ARS sequence is important for the formation of eccDNA during growth under selective conditions. In a preferred embodiment, an ARS binding protein such as, but not limited to ABFI is overexpressed during selective growth; overexpression can be realized by transformation of the host with a multicopy plasmid carrying a functional gene encoding an ARS binding protein, or by placing an open reading frame encoding an ARS binding protein under control of a strong promoter, preferably an inducible strong promoter that is active under the selective growth conditions. This further increases efficacy of the approach.

Still another aspect of the invention is a method of stabilizing a chromosomal region in a eukaryotic cell, when said cell is grown under stress conditions, by deleting or inactivating an ARS sequence adjacent to said chromosomal region.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1. Comparison of the genome sequence coverage between the parent strain HDY.GUF5 and evolved strain GS1.11 -26.

Log2 ratio depicted from whole genome sequence coverage between the parental and the evolved strain is presented for each of the 16 chromosomes. Each grey circle represents the value of the log2 ratio obtained from the sequence coverage calculated for averaged sliding windows of 500 nucleotide positions. The dark line indicates the smoother trend calculated by moving average values of 10,000 bp.

Figure 2. Comparison of the xylose cassette sequence coverage between the parent strain HDY.GUF5 and evolved strain GS1.11 -26.

(A) Log2 ratio of sequence coverage between the evolved and parent strain in the locus of chromosome XV, where the D-xylose and arabinose gene cassette has been integrated. Annotations present in the locus are indicated by bars at the top of the figure. Bars shaded in gray correspond to the heterologous genes that were inserted into the chromosome, while the unshaded bars represent genes present in part of the original yeast chromosome. The coverage was computed at for average of 500 base pair level. (B) Comparison of XI activity measured in cell extracts of the parent HDY.GUF5, the mutant M315 and the evolved GS1 .1 1 - 26 strain (Demeke et al. 2013).

Figure 3. Sequence analysis at the borders of the amplified XylA-locus, and verification of the presence of circular or tandem repeats.

(A) lllumina sequence reads mapped to the reference sequence at both ends of the amplified XylA-locus. Part of the reads that match to the reference sequence are shown in bold, while sub-reads that do not match to the reference sequence are indicated in faded grey. The reference sequence is shown in black at the top of the reads. Microhomologies located on either ends of the amplified locus are shown in black rectangular boxes. (B) Chromatogram from Sanger sequencing of the amplified locus, showing continuous reads through the break point of the lllumina sequence reads alignment. The Sanger sequencing was performed using a PCR product obtained by amplification with primers that anneal outwards from both ends of the locus. The same result was obtained when the plasmid isolated from strain GS1.2-6 was sequenced. (C) Schematic representation of the amplified XylA-locus and PCR primer sets used. Horizontal arrows stand for annealing sites and direction of the PCR primers used to verify circular or tandem repeat formation (primer set P1 ), the presence of the XylA locus at the right position (primer set P2) and the possibility of deletion or single copy of the XylA-locus (P3). The size of the expected PCR product is given in kb. (D) Agarose gel electrophoresis picture of the PCR products obtained using the three sets of primers (P1 , P2 and P3) with DNA samples from different strains. ER stands for Ethanol Red, the original industrial strain before the xylose/arabinose gene cassette has been inserted into the genome.

Figure 4. Evaluation of the amplified XylA-locus by southern blot analysis.

(A) and (C) show a schematic representation of the amplified XylA-locus in GS1 .1 1 -26. Vertical arrows represent cutting sites of the restriction enzymes; red horizontal bar indicates the locus of the unique site for probe hybridization. The amplified locus is shown once in the upper part and twice in the lower part. (B) Image of the southern blot analysis after Hindi 11 digestion. Two bands of expected size 4.3 kb and 7.4 kb were detected in GS1 .1 1 -26 and in cultures obtained from the second step of evolutionary adaptation onwards (GS1 .2 to GS1 .5). The parent strain HDY.GUF5, the mutant M315 and the culture from GS1.0 and GS1 .1 showed only one band representing a single copy of the locus. The negative control Ethanol Red (ER), which does not have the gene cassette, showed no band. (D) Southern blot image after digestion with Sacll, that cuts only outside the amplified XylA-locus. Two single cell isolates from GS1.2 (GS1.2-2 and GS1.2-6) and two from GS1.4 (GS1.4-14 and GS1.4-17) were evaluated. The band of about 1 1 kb represents a single copy of the XylA locus, and is present in all the tested strains except the final evolved strain GS1 .1 1 -26, which showed only a high molecular weight band. GS1.4-14 showed both the 1 1 kb and a higher molecular weight band indicating the presence of multiple copies of the locus in one allele and a single copy in the other allele.

Figure 5. The course of fermentation performance during subsequent evolutionary adaptation steps in D-xylose medium.

The C02 production corresponding to D-xylose to ethanol conversion was estimated from the weight loss during fermentation. The parent strain HDY.GUF5 before the mutagenesis was not able to ferment xylose but the mutant M315 shows very slow fermentation. The last digit in the names shown in blue stands for the steps during the evolutionary adaptation. Though the first step GS1 .1 shows slightly better fermentation than M315, the second culture GS1.2 initially also showed no fermentation, but a sudden rise in C02 production was observed after about 120h. Transfer of this culture to the next step GS1 .3 show rapid fermentation with almost no lag phase. The profile for steps 8 to 1 1 are not shown for clarity since the evolution was done at a higher D-xylose concentration.

Figure 6. Evaluation of the XylA-locus in cultures and single cell clones obtained from the various stages of the evolutionary adaptation process. Agarose gel electrophoresis of PCR products obtained using primer sets P1 and P2 are shown (see Figure 5.2 C for the primer sets). DNA was isolated from a sample of the whole culture obtained just after the genome shuffling step (GS1 .0) and after each batch of the first 5 cultures of the evolutionary adaptation process (GS1 .1 to GS1 .5). GS1.2-2 and GS1.2-6 are single cell isolates from the culture GS1 .2, while GS1.4-14 and GS1.4-17 are single cell isolates from the culture GS1 .4. The strains M315, HDY.GUF5, Ethanol Red (ER) and GS1 .1 1 - 26 have been included for comparison.

Figure 7. Evaluation of the stability of the XylA-carrying circular DNA in GS1.2-6.

(A) The whole culture of GS1.2-6 was grown in YPD medium for about 25 generations and spread for single colonies on YPD. Forty-three isolates from the serially transferred culture were tested for growth performance in YPX medium. For comparison, the original GS1.2-6 before serial transfer in YPD, the parent HDY.GUF5 and the mutant M315 were included. The cells were inoculated into YPX medium at an initial OD600 of 0.5. Optical density was measured after 48 h at 30°C. From the 43 colonies tested, only colony 5 displayed efficient growth and is shown separately. The average OD value of the remaining 42 is shown as 'GS1.2-6 after'. Error bars represent standard deviation from an average of 42 colonies for GS1.2-6 after, and at least triplicate values for the other strains. (B) Agarose gel electrophoresis picture of the PCR assay using primer set P1. The results for 10 colonies out of the 43, and for the control strains are shown. No band was detected for the remaining colonies not shown. The bands in colony 5 and the control GS1.2-6 indicate the presence of the XylA carrying circular DNA.

Figure 8. Plasmid DNA isolated from strain GS1.2-6.

Plasmid DNA was isolated from a sample of the strains GS1.2-6, GS1.4-14 and GS1 .1 1 -26. Separation was done using 0.8% agarose gel electrophoresis. The letter P stands for plasmid DNA while G stands for genomic DNA, which was used for comparison. Two bands in the GS1.2-6 (P) lane might represent different structural forms of the plasmid, probably supercoiled (lower band) and nicked (upper band). The result for GS1 .4-14 and GS1.1 1 -26 is inconclusive. Figure 9. ARS1529 sequence comparison between the evolved strain GS1.11 -26 and the sequence in the reference strain S288c.

The region 51 -66 represents the ARS consensus sequence (Nieduszynski et al. 2006). A gap of 5 base pairs in GS1 .1 1 -26 from bp 84 till 88 is indicated with dashed lines. Other SNPs are situated at position 1 10 and 128. The sequence from GS1.1 1 -26 was confirmed by Sanger sequencing and was similar to the sequence obtained by lllumina sequencing.

Figure 10. D-xylose fermentation performance of the mutant strain M315 expressing the plasmid pXI-ARS.

Batch fermentation was performed in synthetic medium containing 4% xylose using standing fermentation bottles. The C02 production was estimated from the weight loss due to conversion of xylose to ethanol and C02. Error bars represent standard deviation from the mean values of triplicate experiments.

EXAMPLES

Materials and methods to the examples

Strains and growth conditions The S. cerevisiae strains used in this study are listed in Table 1 . Yeast cells were propagated in yeast extract peptone (YP) medium (10 g/L yeast extract, 20 g/L bacteriological peptone) supplemented with either 20 g/L D-xylose (YPX) or 20 g/L D-glucose (YPD). For solid plates, 15 g/L Bacto agar was added. For batch fermentation, either YP medium or synthetic complete medium (1 .7 g/L Difco yeast nitrogen base without amino acids and without ammonium sulfate, 5 g/L ammonium sulfate, 740 mg/L CSM-Trp and 100 mg/L L-tryptophan) supplemented with 40 g/L D-xylose was used. For selection of strains expressing the KanMX resistance marker, 200 mg/L geneticin was added to the medium. Yeast strains were maintained at -80 °C in stock medium composed of YP and 26% glycerol. Table 1. S. cerevisiae strains used in this study.

Yeast strain Main characteristics Source/reference

Ethanol Red Industrial bioethanol production strain, MA Ta/ct Fermentis, a division of S. I. Lesaffre, Lille, France

HDY.GUF5 Ethanol Red background; py 2::XylA; XKS1; TAL1; (Demeke et al. 2013)

TKL 1; RPE1; RKI1; HXT7;AraT; AraA; AraB;AraD;

TAL2; TKL2

M315 HDY.GUF5 background; obtained by mutagenesis (Demeke et al. 2013) with 3% Ethylmethanesulfonate and selection by

growth in D-xylose medium; ΜΑ Τα/α

GS1 .1 1 -26 Ethanol Red background; obtained by mutagenesis, (Demeke et al. 2013) genome shuffling and evolutionary adaptation in D- xylose medium; ΜΑ Τα/α

Small-scale fermentations

Semi-anaerobic batch fermentations were performed in 100 mL YP medium containing 40 g/L D-xylose as carbon source, in cylindrical tubes with cotton plugged rubber stopper. The strains were pre-grown for 24 hours in 5ml YPD medium. For strains carrying plasmid pXI-ARS, geneticin (200 g L) was added to the YPD to maintain the plasmid in the strains. The pre- culture was transferred to 50 ml YPD (+ geneticin) and grown to early stationary phase. Cells were harvested and fermentation was started by inoculating the pellet to an initial OD600 value of 5 into 100 ml YP + 4% xylose. The fermentation cultures were continuously stirred magnetically at 120 rpm and incubated at 35°C. The profile of the fermentation was followed based on the rate of C02 production at different time intervals during the fermentation period. The C02 production rate was estimated by measuring the weight loss of the fermentation tubes due to C02 release. Molecular biology methods

Yeast cells were transformed with the LiAc/SS-DNA/PEG method (Gietz et al. 1995) or by electroporation (Thompson et al. 1998). Genomic DNA from yeast was extracted using the PCI [phenol/chloroform/isoamyl-alcohol (25:24: 1 )] method (Hoffman and Winston 1987). PCR was performed with Phusion DNA polymerase (New England Biolabs) for construction of the vectors and sequencing purposes, and ExTaq polymerase (Takara) for diagnostic purposes. Sanger sequencing was performed by the Genetic Service Facility of the VIB, Belgium.

Genomic DNA isolation and whole genome sequencing

The genomic DNA was extracted using a standard protocol (Johnston and Aust, 1994). About 6 μg high quality DNA samples were sent for sequencing to BGI (Hong Kong). The sequencing was conducted by the facility using high-throughput lllumina sequencing technology. A paired end sequence library of 500 bp was constructed and sequence reads of 90 bp were generated. The sequencing reads provided from BGI were aligned to the reference S288c genome sequence using CLC Genomics Workbench5. Out of the 6 million reads with average length of 89.2 bp, 99% matched to the reference sequence when a 93% sequence similarity parameter was used. Additionally, 98% of the reference sequence has been covered with an average coverage depth of 44. The coverage depth per nucleotide position was extracted from the alignment and plotted using GraphPad prism software.

Southern blot analysis Genomic DNA digested with the appropriate restriction enzyme was run on 0.8% agarose gel overnight at 50 V. A specific probe was prepared by PCR amplification from genomic DNA. The probe was labeled using Amersham Gene ImagesTM AlkPhos DirectTM labeling and detection system (GE Healthcare). The labeled probe was immediately used to hybridize the DNA that was blotted on a nylon membrane. Chemifluorescent signal was generated and detected using CDP-StarTM as a substrate in conjugation with LAS-4000 luminescent image analyzer.

Isolation of eccDNA from intermediate strain GS1.2-6

Plasmid DNA isolation was performed from the strain GS1.2-6, GS1.4-14 and GS1 .1 1 -26, using a modified protocol from (Singh and Weil 2002). Cells were pre-grown in 100 ml YPX medium for 24 h to enrich for the plasmid. The pellet from the 100 ml culture was divided into two and each pellet was resuspended in 5 ml buffer P1 from the QIAGEN plasmid purification kit. Freshly prepared lyticase solution (1 .2 M sorbitol, 0.1 M Na3P04 buffer pH 7.4 and 5 mg/ml lyticase) was added to the mixture and incubated for 45 min at 37°C. Once the cell lysate was obtained at this step, the protocol from the QIAGEN plasmid Maxi kit was followed. Data access

All sequence data have been deposited in the Sequence Read Archive (SRA) at the National Center for Biotechnology Information (NCBI) and can be accessed with references SRX651886 for Samplen56 (HDY-GUF5) and SRX647780 for Samplen57 (GS1 .1 1 -26). Example 1 : Whole genome sequence analysis

Recently, we reported the development of an industrial D-xylose utilizing strain of S. cerevisiae, GS1.1 1 -26, using a combination of metabolic engineering, genome shuffling and evolutionary adaptation (Demeke et al. 2013). Briefly, we integrated the gene XylA coding for XI from the bacterium Clostridium phytofermentans together with all the known genes important for D-xylose and L-arabinose metabolism into an industrial bioethanol production strain, Ethanol Red (ER). However, the recombinant strain named HDY.GUF5 was unable to utilize any D-xylose. We then mutagenized this strain by EMS and selected a mutant isolate M315 that was able to grow slowly on D-xylose but had poor D-xylose fermentation capacity. Genome shuffling of this mutant with its parent HDY.GUF5, followed by selection for faster D- xylose growth resulted in little improvement. Subsequently, we performed evolutionary engineering in serial batch cultures containing D-xylose as main carbon source. A striking observation during this adaptation process was a drastic gain in D-xylose fermentation capacity at the second serial batch culture. We proposed that a crucial genetic change had happened at that step, which resulted in a rapid gain in performance. To elucidate this change, we sequenced the genome of the original parent strain HDY.GUF5 and the final evolved strain GS1 .1 1 -26 and performed a global genome sequence comparison.

Example 2: Detection and evaluation of copy-number variations (CNVs)

Since the coverage depth of the sequence reads reveals CNVs among genomes of different strains (Araya et al. 2010), the chromosomal CNVs were estimated from the depth of the whole genome sequence coverage data. At chromosomal level, the average coverage of most of the chromosomes was similar in both the evolved and the parent strains. However, chromosome IX and XVI showed 50% higher coverage in the evolved strain compared to the parent strain, while the coverage for chromosome XII was significantly lower in the evolved strain. To distinguish between whole chromosome duplication and segmental amplifications or deletions, the sequence coverage of all 16 nuclear chromosomes was analyzed at the nucleotide level with an average window of 500 bp. The log2 ratio of the read depth between the evolved and the parent strains was then calculated (Fig. 1 ). Accordingly, we obtained a uniform coverage throughout the whole chromosome IX and chromosome XVI, at 50% higher than average in the evolved strain compared to the parent strain. The log2 ratio of 0.5 along the two chromosomes also indicated duplication of both chromosomes.

In chromosome XII, the coverage at the ribosomal DNA locus was reduced in the evolved strain by about 50% relative to the parent strain, indicating the loss of several copies of the ribosomal DNA (rDNA) genes. rDNA genes are present in about 150 to 200 tandem copies in the S. cerevisiae genome (Petes 1980). The possible effect of the reduction of the rDNA copies in our evolved strain was not investigated further. However, large deletions of multiple rDNA copies are common spontaneous phenomena in the yeast genome. Strains with up to 50% reduction in the number of rDNA copies compared to wild type laboratory strains were shown not to have any detectable defect neither in mitotic growth nor in meiotic reproduction (Michel et al. 2005).

The most prominent CNV occurred in a region at the right arm of chromosome XV. This was the region where the D-xylose and L-arabinose metabolism gene cassette had been integrated in the genome of the parent strain HDY.GUF5 (Demeke et al. 2013). Part of the integrated gene cassette, containing the XylA gene, and a sequence upstream of the integrated cassette, that includes the gene REV1 , the tRNA gene tP(UUG)03 and the autonomously replicating sequence ARS1529, were amplified about 9 times (estimated from the log2 ratio) in the evolved strain compared to the parent strain (Fig. 2A). XylA encodes xylose isomerase that converts D-xylose to D-xylulose, the rate limiting step in D-xylose metabolism. We previously showed that the evolved strain GS1 .1 1 -26 displayed significantly higher (about 17 times) XI activity than the parent strain, which displayed only moderate activity (Fig. 2B). The high copy number of XylA in the evolved strain is therefore consistent with the high XI activity, though the fold increase in the XI activity was higher than that of the copy number.

Example 3: Amplification of the XylA-locus as tandem repeat in GS1.11 -26 We sought to understand the structural arrangement of the amplification of the XylA-locus. The presence of the autonomous replication sequence ARS1529 in the amplified XylA-locus made us consider the possibility that this region got amplified as a self-replicating eccDNA. This idea was supported by the observation of break points on either ends of the amplified region when the lllumina sequence reads were mapped to the reference genome (Fig. 3A). The sequence reads at one end of the break point contained partially unmatched sequences that matched with the sequence of the opposite end. This condition implies either circular DNA or tandem repeat formation.

To validate this assumption, we performed PCR using a primer set P1 , which consisted of a pair of primers inside the amplified region that project outwards in opposite direction (Fig. 3C). A PCR product of 1 .7kb was expected if a circular or tandem repeat sequence had been generated. The evolved strain GS1.1 1 -26 gave a PCR product of the expected size, while no PCR product was obtained from the parent strain HDY.GUF5, the mutant M315 and the original industrial strain Ethanol Red that does not have the cassette (Fig. 3D). The PCR product obtained was then sequenced using conventional Sanger sequencing. The resulting contigs were shown to read through the break point that was obtained from the alignment of lllumina sequence reads at either ends of the amplified region (Fig. 3B), indicating a continuous DNA sequence, which in turn points to either a circular form or a tandem repeat.

To differentiate between circular DNA and tandem repeat, we first evaluated if the chromosomal copy of the amplified region had been deleted in the evolved strain. Deletion of the locus would contradict the possibility of tandem amplification of the locus. For this purpose, two sets of primers were used (Fig. 3C). The primer set P2 contained a forward primer annealing upstream of the amplified locus and a reverse primer annealing inside the amplified locus, and detects the presence of the XylA-locus at the right position in the chromosome. The primer set P3, contained a forward primer upstream of the amplified locus and a reverse primer downstream of the amplified locus, and was expected to give a PCR product only upon deletion of the XylA locus since the locus is too large to be amplified with the PCR conditions used (2 min extension time). A band of the expected 1 .1 kb size with the PCR set P2 (Fig. 3D) and a negative result with the PCR set P3 with the 2 min extension time (data not shown) was obtained for both the parent HDY.GUF5 and the evolved strain GS1 .1 1 -26. The positive band with PCR set P2 was expected since the whole genome sequencing data indicated that at least one of the alleles was present in the locus. However, the absence of a PCR product using primer set P3 indicated that neither of the two alleles of the chromosomal XylA-locus was deleted. Therefore, neither tandem amplification nor eccDNA could be excluded on the basis of this PCR analysis.

We then performed PCR using the primer set P3 under conditions that allow amplification of the whole amplified XylA-locus (long extension time). A single copy of the XylA-locus in the genome was expected to produce a 9.4kb PCR product while chromosomal duplication or amplification of the locus should not produce any PCR product since it would be too large to be amplified. The parent HDY.GUF5 and the mutant M315 strains gave rise to a PCR product with the correct size of 9.4 kb but the evolved strain GS1 .1 1 -26 did not give rise to any band after several attempts (Fig. 3D). The HDY.GUF5 positive control gave rise to the expected band in all repetitions. This indicates that only one copy of the XylA locus is present in each of the two alleles in the parent strain, but that the evolved strain might have multiple copies in both alleles. To confirm this assumption, southern blot analysis was performed with genomic DNA digested with two different restriction enzymes. First, the DNA was digested with Hindlll that cuts only once inside the amplified XylA-locus. A unique probe that hybridizes in the XylA sequence was used to visualize the band. In the presence of only a single copy of the XylA-locus, a single band of 4.3 kb was expected while a circular or tandem repeat sequence should give two bands of 4.3 kb and 7.4 kb (Fig. 4A). Two bands of the expected size were detected for the evolved strain, GS1.1 1 -26, while only the 4.3 kb band was detected for the parent HDY.GUF5 and the mutant M315 (Fig. 4B). No band was detected in the control strain Ethanol Red, which does not contain the gene cassette in the genome. We then digested the genomic DNA with Sacll, which cuts only outside the amplified XylA- locus, and hybridized with two different probes annealing either inside (same as the previous probe, Fig. 4C), or outside the amplified locus (between the left Sacll restriction site and the amplified locus). An 1 1 kb band was expected if a single copy of the XylA-locus was present in the chromosomal locus. Accordingly, the presence of the expected 1 1 kb fragment in the strains HDY.GUF5 and M315 using both probes hybridizing inside (Fig. 4D) or outside the amplified XylA-locus (data not shown) confirmed the existence of a single copy of the XylA- locus in both alleles. On the other hand, the evolved strain showed only a higher molecular weight band, both with the inside (Fig. 4D) and outside probes (data not shown) confirming the presence of multiple copies of the XylA-locus in both chromosomal alleles. This result together with the PCR amplification using PCR set P1 (primers directed outwards on either side of the amplified locus) clearly indicates that the amplification of the locus in GS1.1 1 -26 had occurred in the form of a tandem repeat.

Example 4: Amplification of the XylA-locus during evolutionary adaptation with eccDNA intermediate As described in our previous report (Demeke et al. 2013), the evolutionary adaptation step used to obtain the strain GS1 .1 1 -26 involved a series of 1 1 batch cultures in D-xylose medium (Fig. 5). To verify at which stage of the evolutionary adaptation process the amplification of the XylA-locus had occurred, selected cultures that were isolated and kept frozen from each step of the evolutionary adaptation process were analyzed using the primer set P1 , which was used to amplify the circular/tandemly repeated DNA. A sample from the cultures before the evolutionary adaption (GS1 .0), and samples at the end of the first 5 serial transfers during the evolutionary adaptation (GS1 .1 , GS1.2, GS1 .3, GS1 .4 and GS1 .5) were tested by PCR for the presence of the tandem amplification or circular DNA formation using PCR primer set P1 . Interestingly, a positive PCR result was obtained in all the samples derived from the second culture (GS1 .2) onwards, whereas isolates from GS1.0, GS1 .1 , as well as the original strains used for the genome shuffling step (HDY.GUF5 and M315) did not give rise to the PCR product (Fig. 6). Southern blot analysis of the same samples after Hindi 11 digestion also confirmed the presence of either circular or multiple copies of the locus in the samples obtained from GS1 .2 onwards (Fig. 4B). This strongly suggests that the amplification of the XylA-locus had occurred at the second step of the evolutionary adaptation process (GS1 .2). As we anticipated, the sharp rise in the rate of D-xylose fermentation during the second culture (Fig. 5) correlated with amplification of the XylA-locus. Although XylA was expressed from a strong promoter in the parent strain HDY.GUF5, the level of expression was not high enough to confer strong D-xylose fermentation capacity. Amplification of the gene likely increased the expression of XI, which in turn alleviated the rate limiting bottleneck for fermentation of D- xylose.

Remarkably, the chromosomal tandem amplification of the XylA locus in GS1 .1 1 -26 was not detected in two D-xylose fermenting single cell clones obtained from GS1 .2 (second culture) that showed a positive PCR using the primer set P1 . When the southern blot was performed after Sacll digestion on these single cell isolates, called GS1.2-2 and GS1.2-6, only the 1 1 kb band was obtained for both strains, indicating that only a single copy of the gene was present in the chromosomal locus (Fig. 4D). This was supported by the result of the PCR amplification of the whole amplified XylA-locus using primer set P3, which gave the expected 9.4kb band (Fig. 6). Since no smaller PCR band was obtained when this primer set was used (indicating that the XylA-locus was not deleted), and only a single band was obtained with the southern blot assay, both chromosomes should have a single copy of the XylA-locus in these two strains. These results, together with the positive PCR result obtained using primer set P1 (Fig. 6) in all the cultures obtained from GS1.2 onwards, clearly indicate that an eccDNA was generated at the second stage (GS1 .2) of the evolutionary adaptation process. We also performed the southern blot assay with Sacll digested DNA using genomic DNA of two other single cell isolates from GS1 .4 (4th culture) to test for the presence of the eccDNA. The first isolate GS1.4-14 had the highest D-xylose fermentation rate among all the isolates obtained from the culture GS1 .4. Another isolate GS1.4-17 (with only moderate D-xylose fermentation capacity) was also used for comparison. Accordingly, GS1 .4-14 showed both the 1 1 kb and a higher molecular weight band. Together with the result of the PCR assay shown in Fig. 6, this result clearly indicates the presence of multiple copies of the locus in one of the alleles and a single copy in the other allele in strain GS1.4-14. The strain GS1.4-17 showed only the 1 1 kb band in the southern blot assay, which was also consistent with the PCR amplification of the whole XylA-locus using primer set P3 (Fig. 6), indicating the presence of a single copy of the XylA-locus in both alleles. Similar to GS1.2-6, strain GS1.4-17 gave a positive PCR result using primer set P1 , indicating the presence of a circular DNA in this strain. This result also suggested a correlation between the multiple integration of the XylA-locus in the genome and the faster D-xylose fermentation.

Eventually, we had obtained clear indications that amplification of the XylA-locus had arisen through a circular intermediate in an early stage of the evolutionary adaptation process, and subsequently recombined in tandem array at the same locus in one of the chromosomes. Later, unequal crossover or other mechanisms might have led the tandem array to be copied into the second chromosome, since GS1 .1 1 -26 carried the amplified locus in both alleles.

Example 5: Stability of eccDNA in intermediate strain GS1.2-6

Next, we evaluated the stability of the high xylose fermentation capacity phenotype in GS1.2-6. If the strain GS1.2-6 carried only the circular plasmid and not the genomic XylA amplification, the loss of the plasmid should cause loss of its high D-xylose growth capacity. To allow for loss of the plasmid, GS1.2-6 was grown in rich medium with glucose (YPD) for about 25 generations. The culture was spread for single colonies and 43 single cell isolates were tested for growth in liquid YPX medium. All isolates except one colony lost the ability to efficiently grow in D-xylose medium, consistent with loss of the XylA carrying circular DNA from GS1.2-6 (Fig. 7A). All the 43 colonies were further tested by PCR for the presence or absence of the eccDNA using primer set P1 . Accordingly, the eccDNA could be detected in none of the colonies that lost the D-xylose growth capacity except in the one colony that kept the high growth efficiency in D-xylose (Fig. 7B). This indicates that the GS1 .2-6 carried only the circular DNA and not the chromosomal amplification of XylA. The rapid D-xylose fermentation capacity by the final strain GS1 .1 1 -26 was previously shown to be stable for more than 50 generations (Demeke et al. 2013). Consequently, we concluded that the stability of the phenotype in GS1 .1 1 -26 is due to the integration of the circular DNA into the genome.

Example 6: Isolation of eccDNA from intermediate strain GS1.2-6 To further confirm the presence of the eccDNA, plasmid DNA isolation was performed from the strain GS1.2-6, GS1.4-14 and GS1 .1 1 -26, using a protocol modified from Singh and Weil (2002). Cells were pre-grown in 100 ml YPX medium for 24 h to enrich the plasmid content in the cells. The whole 100 ml culture was used for plasmid isolation (see material and methods). As a result, a substantial amount of plasmid DNA (more than 1 μg) was obtained from GS1.2-6 (Fig. 8). On the other hand, the amount of plasmid DNA obtained from GS1 .1 1 -26 and GS1 .4- 14 was so low as to be inconclusive. This is probably due to the loss of the plasmid in the later steps of the evolutionary engineering, since there was no need for the strain to maintain the plasmid when enough copies of the essential gene XylA had been integrated in the genome sustaining rapid D-xylose utilization. When the plasmid isolated from GS1 .2-6 was sequenced, a 7483 bp circular sequence was obtained, matching the size of the amplified XylA-locus. Though there were several polymorphisms compared to the corresponding sequences in the reference S288c genome, the plasmid sequence was identical to that of the original parent strain obtained by lllumina sequencing. Example 7: ARS1529 is a functional origin of replication in S. cerevisiae

ARS1529 was previously shown to be a functional replication site in yeast (Nieduszynski et al. 2006). However, compared to the reference S288c genomic sequence, the ARS1529 sequence in the industrial parent as well as in the evolved strains contained a 5 bp deletion just 13bp downstream of the ARS consensus sequence (ACS) and also 5 SNPs in an AT-rich region downstream of the ACS (Fig. 9). In order to validate the functionality of the modified ARS1529 version in the eccDNA intermediate, we assessed the ability of this sequence to confer self-replication. We first amplified the region containing ARS1529 together with the tRNA coding sequence and the XylA gene from the genomic DNA of the evolved strain GS1 .1 1 -26. The PCR product was then cloned into a yeast integrative vector containing kanMx as a selection marker. After transformation of this construct (pXI-ARS) into the mutant yeast strain M315, we obtained several transformants with similar transformation efficiency as that of the 2μ-based plasmid, showing that the plasmid was able to propagate using ARS1529. The mutant strain M315 was shown previously to display a much higher rate of D-xylose fermentation capacity upon introduction of a multi-copy plasmid with XI overexpression. We then tested three independent M315 + pXI-ARS transformants for D-xylose fermentation. As expected, transformants expressing pXI-ARS showed a higher rate of D-xylose fermentation compared to the control strain without the pXI-ARS plasmid (Fig. 10). This plasmid was also lost after some generations of growth in non-selective conditions indicating that the plasmid had not yet integrated into the genome. These results confirmed that the ARS1529 sequence is functional as a replication origin in S. cerevisiae.

REFERENCES

Alper H, Stephanopoulos G. 2009. Engineering for biofuels: exploiting innate microbial capacity or importing biosynthetic potential? Nat Rev Microbiol 7(10): 715-723.

Ames RM, Rash BM, Hentges KE, Robertson DL, Delneri D, Lovell SC. 2010. Gene

duplication and environmental adaptation within yeast populations. Genome Biol Evol 2: 591 - 601 .

Araya CL, Payen C, Dunham MJ, Fields S. 2010. Whole-genome sequencing of a laboratory- evolved yeast strain. BMC Genomics 1 1 : 88.

Barrick JE, Lenski RE. 2009. Genome-wide mutational diversity in an evolving population of Escherichia coli. Cold Spring Harb Symp Quant Biol 74: 1 19-129.

Brat D, Boles E, Wiedemann B. 2009. Functional expression of a bacterial xylose isomerase in Saccharomyces cerevisiae. Applied and environmental microbiology 75(8): 2304-231 1 .

Cakar ZP, Turanli-Yildiz B, Alkim C, Yilmaz U. 2012. Evolutionary engineering of

Saccharomyces cerevisiae for improved industrially important properties. FEMS yeast research 12(2): 171 -182.

Cohen S, Segal D. 2009. Extrachromosomal circular DNA in eukaryotes: possible involvement in the plasticity of tandem repeats. Cytogenet Genome Res 124(3-4): 327-338. de Souza AP, Leite DCC, Pattathil S, Hahn MG, Buckeridge MS. 2013. Composition and structure of sugarcane cell wall polysaccharides: implications for second-generation bioethanol production. BioEnergy Res 6: 564-579.

Demeke MM, Dietz H, Li Y, Foulquie-Moreno MR, Mutturi S, Deprez S, Den Abt T, Bonini BM, Liden G, Dumortier F et al. 2013. Development of a D-xylose fermenting and inhibitor tolerant industrial Saccharomyces cerevisiae strain with high performance in lignocellulose

hydrolysates using metabolic and evolutionary engineering. Biotechnology for biofuels 6(1 ): 89. Despons L, Baret PV, Frangeul L, Louis VL, Durrens P, Souciet JL. 2010. Genome-wide computational prediction of tandem gene arrays: application in yeasts. BMC Genomics 1 1 : 56.

Elena SF, Lenski RE. 2003. Evolution experiments with microorganisms: the dynamics and genetic bases of adaptation. Nature reviews Genetics 4(6): 457-469.

Natl Acad Sci U S A 79(17): 5342-5346. Frank SA. 2013. Microbial evolution: regulatory design prevents cancer-like overgrowths. Curr Biol 23(9): R343-346.

Gietz RD, Schiestl RH, Willems AR, Woods RA. 1995. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 1 1 (4): 355-360. Gresham D, Desai MM, Tucker CM, Jenq HT, Pai DA, Ward A, DeSevo CG, Botstein D, Dunham MJ. 2008. The repertoire and dynamics of evolutionary adaptations to controlled nutrient-limited environments in yeast. PLoS genetics 4(12): e1000303.

Gresham D, Usaite R, Germann SM, Lisby M, Botstein D, Regenberg B. 2010. Adaptation to diverse nitrogen-limited environments by deletion or extrachromosomal element formation of the GAP1 locus. Proc Natl Acad Sci U S A 107(43): 18551 -18556.

Hoffman CS, Winston F. 1987. A ten-minute DNA preparation from yeast efficiently releases autonomous plasmids for transformation of Escherichia coli. Gene 57(2-3): 267-272.

Johnston CG, Aust SD. 1994. Detection of Phanerochaete chrysosporum in soil by PCR and restriction enzyme analysis. AppI Environ Microbiol 60: 2350-2354. Katju V, Bergthorsson U. 2013. Copy-number changes in evolution: rates, fitness effects and adaptive significance. Front Genet 4: 273.

Kondrashov FA. 2012. Gene duplication as a mechanism of genomic adaptation to a changing environment. Proc Biol Sci 279: 5048-5057.

Lau MW, Gunawan C, Balan V, Dale BE. 2010. Comparing the fermentation performance of Escherichia coli K01 1 , Saccharomyces cerevisiae 424A(LNH-ST) and Zymomonas mobilis AX101 for cellulosic ethanol production. Biotechnology for biofuels 3: 1 1 .

Limayem A, Ricke SC. 2012. Lignocellulosic biomass for bioethanol production: current perspectives, potential issues and future prospects. Prog Energ Combust 38: 449-467.

Michel AH, Kornmann B, Dubrana K, Shore D. 2005. Spontaneous rDNA copy number variation modulates Sir2 levels and epigenetic gene silencing. Genes Dev 19(10): 1 199-1210.

Nieduszynski CA, Knox Y, Donaldson AD. 2006. Genome-wide identification of replication origins in yeast by comparative genomics. Genes Dev 20(14): 1874-1879.

Olsson L, Linden T, Hahn-Hagerdal B. 1992. Performance of microorganisms in spent sulfite liquor and enzymatic hydrolysate of steam-pretreated salix. AppI Biochem Biotech 34-35: 359- 368. Petes TD. 1980. Molecular genetics of yeast. Annu Rev Biochem 49: 845-876.

Sauer U. 2001 . Evolutionary engineering of industrially important microbial phenotypes. Advances in biochemical engineering/biotechnology 73: 129-169.

Singh MV, Weil PA. 2002. A method for plasmid purification directly from yeast. Anal Biochem 307(1 ): 13-17.

Thompson JR, Register E, Curotto J, Kurtz M, Kelly R. 1998. An improved protocol for the preparation of yeast cells for transformation by electroporation. Yeast 14(6): 565-571 .