FIELD OF THE INVENTION

The present invention pertains to novel artificially designed plant receptors and artificially designed ligands binding thereto. Based on the molecular architecture of plant leucine rich repeat receptor kinases (LRR-RK), new functional receptor-ligand pairs were designed by using the sequences of elongation factor Tu receptor (EFR) and its ligand epitope peptide elf 18. Thus, the present invention describes the new artificial receptors and ligands, as well as genetic constructs expressing same, and plants, plant tissues and plant cells transformed therewith. Furthermore provided are processes for the design and expression of the inventive artificial plant receptors and artificial protein ligands, and the use of the inventive constructs for improving resistance of a plant against phytopathogens, or for promoting growth, cell death and/or development of plants. Also provided are methods for the specific isolation and enrichment of plant cells comprising the use of the herein described novel artificial plant receptor and ligand pairs.

DESCRIPTION

Due to the constantly-increasing human population, and the declining area of land available for agriculture, it remains a major goal to improve the efficiency of agriculture and to increase the range of exploitable plants in agriculture. Conventional approaches for crop and horticultural improvements utilise classical plant breeding techniques in order to identify new plant varieties having desirable characteristics, like higher yield, resistance to pests and unfavourable weather conditions, root development, nutrient uptake and stress tolerance in general. However, such classical breeding techniques have several negative aspects, namely that these techniques are typically labour intensive and often include alteration of multiple traits.

Genetic engineering of plants entails the isolation and manipulation of the genetic and epige- netic material (typically in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Genetic engineering of plants at the industrial and laboratory scale is well established and has led to the development of plants having various improved economic, agronomic or horticultural traits. These technological advances have yielded crops that reduce food production costs through resistance to pests, herbicide, drought, and flood or generally enhance the growth and resistance of plants. Furthermore crops were engineered to produce substances such as vitamins that could improve human health. These approaches could help treat health issues in countries where people suffer from malnutrition such as vitamin A deficiency in countries where available foods do not provide the necessary nutrients necessary for people.

Traits of particular economic interest are growth characteristics such as high yield of plant material such as fruits. Yield is normally defined as the measurable produce of economic value from a crop. This may be defined in terms of quantity and/or quality. Yield is directly dependent on several factors, for example, the number and size of the organs, plant architecture (for example, the number of branches), seed production and more. Root development, nutrient uptake and stress tolerance may also be important factors in determining yield.

Cellular signalling upon environmental or developmental signals in plants and animals alike are coordinated to a tremendous extend by membrane associated proteins - receptors - which provide an extracellular binding domain to which a signal-molecule can attach, for example pathogenic structures of pests or growth factors, and intracellular signalling domains, specifically kinase domains, which can transmit the extracellular signal intra-cellular by initiating a signalling cascade. In the plant kingdom many of such membrane-bound receptor kinases were identified in the past decade, e.g. in the genomes of rice or Arabidopsis are about 600 to 1000 genes that encode for these proteins.

In plants leucine-rich-repeat receptor kinases (LRR-R ) are key in the recognition and transmittal of exogenic as well as endogenic signals. LRR-R s are involved in developmental processes, immune reactions upon pathogenic attacks, growth, cell death, abscission and ripening. Each LRR-RK is involved in one specific biological process, and binds through the extracellular portion only to one specific signal-molecule, the specific ligand. Yet, amongst the 600 to 1000 genes encoding for LRR-RKs in Arabidopsis, specific ligand molecules or biological function could be attributed only to a minor fraction of these receptors.

LRR-RKs are composed of a multi-domain architecture in which each domain provides a specific function for the receptor. The extracellular part of the receptor contains a leucine rich repeat (LRR) domain. The domain is named according to a series of repeating sequence mo- tifs comprising about 20 to 30 amino acids with a high content of leucine. Leucine-rich repeats are frequently involved in the formation of protein-protein interactions, and not only found in plant receptors but also in a large variety of functionally unrelated proteins. Examples comprise the ribonuclease inhibitor, tropomodulin and toll-like receptors. Toll-like receptors are involved in innate immunity and developmental (Toll) processes. The LRR domain mediates the binding of the receptor to a ligand molecule, and hence can be classified as the input domain of the LRR-RK.

On the intracellular side the LRR-RK has a protein kinase domain, that enzymatically catalyses the transfer of a phosphate group to a substrate protein. Usually the addition of phosphate groups to intracellular substrates results in the initiation of a signal cascade that eventually induces into a cellular response, for example the induction of immune related genes in order to fight off a pathogenic attack. Thus, the kinase domain could be classified as the output domain of the LRR-RK. Kinase and LRR domains are interconnected by the juxtamembrane and transmembrane domains, the latter spanning the cellular membrane, which allow the receptor to be membrane bound.

Although the function of many LRR-RKs remains elusive, examples of LRR-RKs that recognize exogenous signals are Flagellin Sensing 2 (FLS2) and Elongation Factor Tu Receptor (EFR) of Arabidopsis. The corresponding ligands of the receptors are bacterial flagellin (fig) and the elongation factor Tu (EF-Tu) respectively. The specific binding epitope with which EF-Tu binds to the EFR is a small 18 amino acid long peptide motif called elf 18 (SEQ ID No. 1). The EFR and FLS2 receptors function as immune receptors recognising the presence of their ligands as "non self and initiating a defense response in the plant cell. Other defense response related receptors include XA21 from rice, CERKl and AtPEPRl, the latter recognizing endogenous danger signals related to wound healing processes.

A known LRR-RK that binds endogenous signals of a plant is the brassinosteroid receptor BRI1 (brassinosteroid insensitive 1) that is an essential component of a membrane bound multi-receptor complex recognizing the steroid brassinolide. This steroid hormone in plants is important for physiological and developmental regulation. He Z and colleagues showed in a study with chimeric receptors composed of extracellular BRI1 domains and intracellular kinase domain of XA21, a rice defense response receptor, that artificial produced receptor chimeras could initiate a defense response in rice upon treatment with brassino steroids. This study therefore shows that LRR-RKs constitute an interesting starting point for the rational design of new receptor proteins in plants.

More novel chimeric receptors were constructed in Arabidopsis thaliana consisting of the complete ectodomain of EFR and the intracellular FLS2 kinase. These chimeras were shown to be sensitive towards the elf 18 peptide, the natural ligand of EFR (Albert et al 2010; J Biol Chem; Vol 285, pp 19035-19042). The study shows that both LRR-RKs EFR and FLS2 although they recognize different ligand molecules, still share all functional aspects for initiating the intracellular signal output of LRR-RKs. A similar chimeric receptor approach was used in the elucidation of the function of wall associated kinases (WAK), which are involved in the detection of oligogalacturonides, molecular signals of cell wall damages, growth and development. Swapping of the ecto- or endo-domains of WAK and EFR resulted in a substitution of receptor function. EFR ectodomain WAK1 kinase domain receptors sense elfl8 but display a signal output typical for native WAK1 and vice versa (Brutus A et al, 2010; Proc Natl Acad Sci USA, Vol 107, pp 9452-9457).

Chimeric receptors based on the LRR-RKs domain structure, in which the ectodomain and the intracellular kinase domain are derived from different receptors can be used for the controlled activation of cellular responses like immune response reactions in transgenic. A chimeric receptor that exploits the peculiarities of two receptors associated with plant defense, like FLS2, EFR or WAK1 receptors, was designed with the intend to increase plant resistance to phyto- pathogenic organisms (WO 2010/139790). However, state of the art approaches exploit only natural occurring and known ligand-receptor interactions which may induce unwanted side effects due to uncontrolled activation of the chimeric constructs by their naturally occurring signal molecules in the field.

In view of the above, it is an object of the present invention to provide novel approaches for the rational design of artificial chimeric plant receptors and their ligands which are not restricted to only naturally occurring receptor-ligand interactions. It is further the intent of the present invention to provide novel receptor-ligand pairs which allow for the controlled, exclusive and specific activation of specific cellular responses in plants.

In a first aspect of the present invention, the above object is solved by an artificial plant receptor comprising an extracellular Leucine Rich Repeat (LRR)-domain, a transmembrane domain and an intracellular kinase domain, characterized in that said LRR-domain of said artificial plant receptor comprises at least one portion of an LRR-domain of a plant receptor Rl that is able to bind a protein ligand LI, and said LRR-domain of said artificial plant receptor comprises at least one portion of an LRR-domain of a plant receptor R2 that is not able to bind said protein ligand LI . Preferably wherein Rl and R2 are different.

As also mentioned herein below, the artificial receptor provided by the present invention in one preferred embodiment does not bind to the ligand LI . The artificial receptor therefore due to the domain chimerization of Rl and R2 loses the ability to bind the ligand of Rl . Thus, the artificial plant receptor of the invention for example when transformed into a plant does not interfere with the intrinsic receptor activity of Rl .

The LRR domain of said artificial plant receptor of the invention in one first embodiment is an artificial LRR domain which is still functional, and which does not result in a miss-folded non- functional receptor protein. The term "artificial" in the context of the present invention shall denote such constructs or compounds which are made by human intervention and in that form do not occur in nature. For peptides/proteins or nucleic acid constructs, the term "artificial" in preferred aspects relates to the such peptides/proteins or nucleic acid constructs that have a mutated or altered sequence compared to compounds found in nature.

The inventors surprisingly found that by rationally exchanging parts of the leucine rich repeat domains of plant LRR-R s novel plant receptors are created with new receptor-ligand binding functions. In one preferred embodiment of the above invention Rl and R2 are different plant receptors selected out of the LRR-RK family of proteins. Most preferred is that Rl and R2 have a maximum of 80% sequence identity in the amino acid sequence of the extracellular LRR domain; more preferably Rl and R2 have a maximum of 70%, 60% and most preferably a maximum of 50% sequence identity in the amino acid sequence of the extracellular LRR domain.

In another embodiment of the invention the Rl and R2 share an amino acid sequence identity in their LRR domains of at least 30%, preferably 35%, more preferably 40%, 45 or 50%. Or, alternatively or cumulatively, a minimum sequence identity of the solvent exposed amino acids of the LRR domains of at least 15%, preferably 20%, more preferably 25 or 30%. In one other embodiment of the present invention, an artificial receptor is preferred wherein Rl and R2 have an LRR-domain consisting of nearly the same number of LR repeats, or wherein the difference of the numbers of LR repeats in the LRR domains of Rl and R2 does not exceed 4, or 3 or preferably 2, or 1.

In one embodiment of the invention Rl is not FLS2 from Arabidopsis thaliana.

In another embodiment of the invention R2 is not FLS2 from Arabidopsis thaliana.

In yet another embodiment of the present invention an artificial plant receptor is provided wherein additionally a point mutation is introduced into said LRR-domain of said artificial receptor. A point mutation might be any mutation selected from deletion, substitution, addition, insertion or chemical modification of at least one amino acid residue.

In another embodiment of the present invention the artificial plant receptor comprises a transmembrane domain and/or intracellular kinase domain which is derived from the plant receptor Rl or R2, or, in one further embodiment, from a third plant receptor R3. By intermixing the extracellular LRR domain of two plant receptors Rl and R2, the inventors created a new receptor binding function; In the here described embodiment exchanging the output domain - such as the juxta-membrane, transmembrane and/or intracellular kinase domain - with portions of a third receptor R3 allows for the integration of a new output function into the artificial plant receptor of the present invention.

Thus, preferred is that the receptor R3 is a receptor that is involved in any plant cellular process other than Rl and/or R2, for example when Rl and R2 are associated to plant pathogen- specific responses, it is preferred in one embodiment that R3 is involved or associated to processes like growth, cell death and/or development; and vice versa. R3 therefore has in a preferred embodiment a different - not identical - output domain, or juxta-membrane, transmembrane and/or intracellular kinase domain compared to the respective domains of Rl and R2. In a most preferred embodiment at least one, or two or all three domains of the juxta-membrane, transmembrane and/or intracellular kinase domain share a sequence similarity between Rl and/or R2 with R3 of maximal 90%, 80%, 70%>, 60%>, and most preferably 50%> sequence identity in their amino acid sequence. In one specific embodiment of the present invention R3 is brassinosteroid-insensitive 1 (BRI1), BRI like 1 (BRL1), BRI like 2 (BRL2) or BRI like 3 (BRL3).

In one further embodiment of the present invention the artificial plant receptor comprises further mutations compared to the sequences derived from Rl, R2 or R3, wherein said mutations are selected from the group consisting of deletion, addition, insertion, chemical modification or substitution of at least one amino acid, preferably of a maximum of 50 or 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1, 10, 9, 8, 7, 6, 5, 4, 3, 2 amino acids. Most preferred is that the artificial plant receptor does not contain more than 10 modified amino acid residues compared to the corresponding sequence of either Rl, R2 or R3.

Still another embodiment of the present invention pertains to the artificial plant receptor wherein LI is a protein ligand. Preferably LI comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and most preferably 100% identity to the amino acid sequence of elfl8 (SEQ ID No. 1). Depending on the selected Rl and R2, LI can also be a different ligand, for example LI in certain embodiments comprises an amino acid sequence having at least 50%>, 55%, 60%>, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity, and most preferably 100% identity to the amino acid sequence of bacterial flagellin, preferably of the peptide epitope flg22 (ligand to FLS2). In other embodiments LI comprises an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identity, and most preferably 100% identity to the amino acid sequence of the Avr21 peptide (ligand to XA21). Or any other known protein ligand of a plant LRR-RK known to the person of skill in the art.

Yet another embodiment of the artificial plant receptor according to the invention is an artificial plant receptor wherein said at least one portion of an LRR-domain of a plant receptor R2 is flanked by at least two portions of said LRR-domain of said plant receptor Rl . Thus, in this embodiment plant artificial receptors are excluded wherein only the N-terminal or C-terminal part of an LRR domain of Rl is fused to the N-terminal or C-terminal portion of an LRR domain of R2. In this preferred embodiment of the present invention the artificial plant receptor comprises an LRR domain which is not only a fusion between two domain parts but contains at least one insertion of a sequence of one receptor LRR domain into another receptor LRR domain. A further embodiment of the present invention is the artificial plant receptor, wherein said portion of said LRR-domain of said plant receptor Rl and/or R2 is a consecutive stretch of at least 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 19 or 20 amino acids of the sequence of the LRR-domain of the respective receptor, or, alternatively, at least one single leucine rich repeat of the respective receptor, or a consecutive sequence of 2, 3, 4, 5 or more single leucine rich repeats of the respective receptor.

In another embodiment of the invention the artificial plant receptor does not bind to LI, and in certain specifically preferred embodiments the artificial plant receptor binds to a protein ligand comprising an amino acid sequence having at least 50%, 55%>, 60%>, 65%>, 70%>, 75%>, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of LI , preferably wherein LI is elfl8 (SEQ ID No. 1) and/or EF-Tu. Or any of the other above mentioned known protein ligands of plant LRR-R s.

Preferably the artificial plant receptor according to the invention binds to an artificial protein ligand comprising a mutated sequence of LI, or a mutated sequence of a protein ligand comprising an amino acid sequence having at least 50%>, 55%>, 60%>, 65%>, 70%>, 75%>, 80%>, 85%>, 90%, 95%, 96%, 97%, 98%, 99%, and most preferably 100% of the amino acid sequence of LI, wherein preferably LI is elf 18 (SEQ ID No. 1). Further preferred is that the artificial plant receptor according to the aforementioned embodiment is obtained by substitution, addition, deletion, insertion or chemical modification of at least one residue in the amino acid sequence of LI, preferably of elfl8 (SEQ ID No. 1).

Yet one additional embodiment of the present invention relates to the artificial plant receptor, wherein said plant receptor Rl that is able to bind a protein ligand LI comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, more preferably 100% identity to the sequence of EF-Tu Receptor (EFR), most preferably to a protein encoded by the gene with the accession No. At5g20480, which is Arabidopsis thaliana EFR

Yet one additional embodiment of the present invention relates to the artificial plant receptor, wherein said plant receptor R2 that is not able to bind a protein ligand LI comprises a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, more prefer- ably 100% identity to the sequence of EFR- like (L), most preferably to a protein encoded by the gene with the accession No. At3g47110, Arabidopsis thaliana EFR- like (L).

In certain very specific embodiments of the invention, which are most preferred, the artificial plant receptor is a receptor as depicted in Figure 1, according to the description of the examples section.

The examples of the present invention show four artificial plant receptors that were generated based on Arabidopsis EFR and EFR-like receptors. The construct EFR-S298P (SEQ ID No. 4) has the sequence of EFR but contains a point mutation at nucleic acid residue 892 (the mutated sequence is depicted in SEQ ID No. 4).

Construct E6/L9/E (SEQ ID No. 5) comprises at positions 1 to 699 the sequence of EFR, then at position 700 to 918 sequences derived from the EFR-like receptor. The remaining nucleic acid residues are again from EFR.

Construct L9/E (SEQ ID No. 6)contains in positions 1 to 942 sequences derived from EFR- like, and the remaining sequence from EFR.

Construct L9/E R231Q (SEQ ID No. 7) also contains in positions 1 to 942 sequences derived from the EFR-like receptor, and the remaining sequence from EFR. This construct also contains one point mutation at position 692.

Also preferred is an artificial plant receptor according to the invention, wherein said artificial protein ligand comprises a sequence selected from SEQ ID No. 2 (elfAVNV) or SEQ ID No. 3 (elf 14).

In order to allow for an easy isolation or purification of the artificial plant receptors of the present invention, said artificial plant receptor is in preferred embodiments conjugated to a tag, for example a poly histidine tag or to a detectable tag, like for example a fluorescent or luminescent protein, preferably to GFP. Also any other fusion protein derived from the artificial plant receptors and/or ligands of the invention are comprised by the present invention. Preferred is also the artificial plant receptor according to the invention that when expressed in a plant cell induces, upon binding to a ligand, intracellular signalling in said plant cell, preferably yielding into an immune response of said plant cell, such as ethylene synthesis, expression of immune genes or production of reactive oxygen species (oxidative burst).

On the other hand another preferred embodiment of the invention is the artificial plant receptor that when expressed in a plant cell, induces upon binding to a ligand intracellular signalling, preferably yielding into plant growth, plant cell death or a promotion of plant development or any other plant cellular response besides pathogen-specific responses.

In certain embodiments of the invention the artificial plant receptor is preferred, wherein the ligand is an artificial ligand.

In a second aspect, the object of the present invention is also solved by providing an artificial protein ligand which is able to bind to the LR -Domain of the artificial plant receptor as described herein before.

In one preferred embodiment of the second aspect of the invention the artificial protein ligand comprises a mutated sequence of LI, or a protein ligand comprising an amino acid sequence having at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, and most preferably 100% identity to the amino acid sequence of LI, wherein preferably LI is elfl8 (SEQ ID No. 1) or alternatively any of the aforementioned protein ligands in plants. Further preferred is the artificial protein ligand according to the aforementioned embodiment wherein said mutated sequence is obtained by substitution, addition, deletion, insertion or chemical modification of at least one residue in the amino acid sequence of elf 18 (SEQ ID No. 1).

In specifically preferred embodiments of the second aspect of the invention the artificial protein ligand comprises a sequence selected from SEQ ID No. 2 (elfAVNV) or SEQ ID No. 3 (elf 14).

In a third aspect of the present invention the above object is solved by providing a construct - preferably a genetic construct - comprising a nucleotide sequence encoding for an artificial plant receptor as described herein before, or a nucleotide sequence encoding for an artificial protein ligand as described herein before.

One embodiment of the above third aspect of the invention relates to a construct which allows for the expression of said nucleotide sequences in a plant, plant cell or plant tissue. It is specifically preferred that said construct is usable for stably or transiently transforming a plant, a plant cell or plant tissue with said construct.

The expression constructs of the invention comprise preferably gene regulatory sequences that direct the expression of the genes under their control. Gene regulatory sequences can be selected from regulatory sequences for constitutive expression, which maintain gene expression at a relative level of activity (basal level), or can be inducible regulatory sequences. Regulatory sequence for constitutive expression can be used in any cell type, or can be tissue specific, cell type or phase specific. The latter direct expression only during particular developmental or growth stages of a plant cell, or the like. A regulatory sequence such as a tissue specific or phase specific regulatory sequences or an inducible regulatory sequence useful in constructing a recombinant polynucleotide or in practicing a method of the invention can be a regulatory sequence that is found in nature in a plant genome. However, the regulatory sequence also can be from an organism other than a plant, including, for example, from a plant virus, an animal virus, or a cell from an animal or other multicellular organism.

A preferred regulatory sequence useful for expression of polynucleotides of the invention is a promoter element. Useful promoters include, but are not limited to, constitutive, inducible, temporally regulated, developmentally regulated, spatially-regulated, chemically regulated, stress-responsive, tissue-specific, viral and synthetic promoters. Promoter sequences are known to be strong or weak. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that provides for the turning on and off of gene expression in response to an exogenous ly added agent, or to an environmental or developmental stimulus. A bacterial promoter can be induced to varying levels of gene expression depending on the level of isothiopropyl galactoside added to the transformed bacterial cells. An isolated promoter sequence that is a strong promoter for heterologous nucleic acid is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells and provides for a high level of gene expression when desired. The choice of promoter will vary depending on the temporal and spatial requirements for expression, and also depending on the target species. In some cases, expression in multiple tissues is desirable. While in others, tissue-specific, e.g., leaf-specific, seed-specific, petal- specific, anther-specific, or pith-specific, expression is desirable. Although many promoters from dicotyledons have been shown to be operational in monocotyledons and vice versa, ideally dicotyledonous promoters are selected for expression in dicotyledons, and monocotyle- donous promoters for expression in monocotyledons. There is, however, no restriction to the origin or source of a selected promoter. It is sufficient that the promoters are operational in driving the expression of a desired nucleotide sequence in the particular cell.

Other sequences that have been found to enhance gene expression in transgenic plants include intron sequences (e. g., from Adh 1, bronze 1, actin 1 , actin 2 (WO 00/760067), or the sucrose synthase intron), poly adenylation signals in the 3' prime UTR and viral leader sequences (e.g., from TMV, MCMV and AMV). For example, a number of non-translated leader sequences derived from viruses are known to enhance expression. Specifically, leader sequences from tobacco mosaic virus (TMV), maize chlorotic mottle virus (MCMV), and alfalfa mosaic virus (AMV) have been shown to be effective in enhancing expression (e.g., Gallie et al, 1987; Skuzeski et al, 1990). Other leaders known in the art include but are not limited topi- cornavirus leaders, for example, EMCV leader (encephalomyocarditis virus 5 '-non-coding region; Elroy-Stein et al, 1989); potyvirus leaders, for example, TEV leader (tobacco etch virus); MDMV leader (maize dwarf mosaic virus); human immunoglobulin heavy chain binding protein (BiP) leader, (Macejak et al, 1991); untranslated leader from the coat protein mRNA of AMV (AMV RNA 4; Jobling et al, 1987), TMV (Gallie et al.,1989), and MCMV (Lommel et al, 1991; see also, della Cioppa et al, 1987).

A preferred expression construct is a recombinant vector according to the present invention, which is an expression vector, optionally, comprising one or more genes to be expressed. Preferably, said expression is driven by a regulatory sequence (or sequences) as describe herein before. The recombinant vector of the invention comprises a sequence encoding for any of the inventive receptors/ligand as described herein before. Also additional genes can be expressed through the recombinant vector, such as selection markers. A regulatory sequence can be isolated from a naturally occurring genomic DNA sequence or can be synthetic, for example, a synthetic promoter. Such promoters are well known in art. For the expression of any constructs or vectors as described herein in a plant, plant tissue or plant cell, the invention preferably embodies that the described polynucleotides are operable linked to a promoter and to a polyadenylation site, wherein said promoter is characterized in that it is functional in said cell of said plant. As a promoter in this context, any sequence element is sufficient that induces transcription of the downstream sequence. The minimal requirements of promoters are very well known in the art and many of such promoters are conventionally used for gene expression in plants.

In this respect, in a further aspect of the present invention a plant cell or plant is provided comprising an artificial plant receptor as described herein before, or an artificial protein ligand as described herein before, preferably wherein said plant cell is transformed with a construct as described herein before.

Accordingly, yet another aspect of the invention is the use of an artificial plant receptor according as described herein before, and/or an artificial protein ligand as described herein before, in a plant or plant cell or plant tissue.

One embodiment of the above use according to the invention is preferred, wherein said artificial protein ligand is able to bind to said artificial plant receptor and wherein the binding of said ligand to said receptor induces intracellular signalling. In certain specific embodiments it is preferred that the binding of said ligand to said receptor induces an immune response in said plant, plant cell or plant tissue. Said immune response is in a preferred embodiment characterized by the differential expression of immune genes, release of ethylene and/or the production of reactive oxygen species.

In one embodiment the use according to the invention is preferably a use for priming a plant against infections. In plant defense, priming is a process by which a plant is brought into first contact with a pathogen (priming) whereupon on subsequent contacts with the pathogen the plant is able to muster a more quickly and more aggressive response, the so called hypersensitive response. Because priming initiates a state of readiness that does not confer resistance per se but rather allows for accelerated induced defense reaction when an attack occurs, priming is beneficial in agriculture to increase resistance of a crop in advance. Still another aspect of the present invention relates to a method for screening new receptor ligands, comprising the steps of

i. Expressing in a plant cell an artificial plant receptor as described herein before, ii. Contacting said plant cell with a candidate ligand molecule, and

iii. Determining the binding of said candidate ligand molecule to said artificial plant receptor,

wherein, when said candidate ligand molecule binds to said artificial plant receptor, said candidate ligand molecule is a ligand of said artificial plant receptor.

Also included in the present invention is method as above, wherein in step i. an artificial plant receptor as described herein before is provided outside the context of a plant cell, e.g. bound to a matrix surface, and wherein in step ii, said artificial plant receptor as described herein before is brought into contact with a candidate ligand molecule.

In one embodiment of the invention the above method is preferred, wherein when said candidate ligand molecule is not a ligand of Rl and/or R2. Said candidate ligand molecule is an artificial ligand that does not occur in nature, for example a proteinaceous ligand that is obtained by altering via human induced mutagenesis the amino acid sequence of a naturally occurring ligand.

The invention also relates to the use of a LRR-R in the screening of novel artificial ligands.

In one embodiment of the above method according to the invention, it is preferred that the binding in step iii. is determined by monitoring the immune response of said plant cell, preferably by monitoring the expression of immune related genes or suitable reporter genes, release of ethylene and/or the production of reactive oxygen species. Reporter gene assays

Also preferred in the context of the above method is to determine the binding of said artificial plant receptor to said candidate ligand molecule by binding assays, such as described in Albert et al. 2010, or via competition assays.

Furthermore provided is a use of an artificial plant receptor as described herein before, and/or an artificial protein ligand as described herein before, in a plant or plant cell or plant tissue to stimulate and/or promote plant growth, development or cell death. In another aspect the invention provides a method for the isolation of a plant cell, comprising the steps of

a. Transforming a plant or plant tissue or plant cell with an expression construct comprising an artificial plant receptor as described herein before, b. Bringing into contact a population of cells derived from said transformed plant, plant tissue or plant cell, with an artificial ligand as described herein before, wherein said artificial protein ligand specifically binds to said artificial plant receptor,

c. Removing any non-bound cell, and

d. Isolating cells which are bound to said artificial protein ligand coupled to a matrix.

Since the herein described novel receptor-ligand interactions are unique, the constructs of the invention allow for a specific isolation of plant cells, like plant protoplasts. This isolation method will be preferably used in tissue engineering.

Particularly preferred is the method as described above, wherein said expression constructs allows for a plant cell type-specific or plant tissue-specific expression of said artificial plant receptor. In this way it is possible to specifically flag certain plant cells of choice which then, by using the above method for isolation can be isolated/enriched and/or purified. In this respect it is preferred that said expression construct allows for a constitutive expression or a inducible expression after the transformation of the construct.

The matrix of choice in the above methods is selected from the group comprising tissue culture plates and dishes, beads or membranes.

Plants for use in the above methods of the invention and in the context of the other aspects and embodiments of the present invention as described herein before are pepper, rice, citrus, cotton, tomato, soybeans, tobacco. Further plants for use in context with all aspects and embodiments of the present invention are corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), alfalfa (Medicago sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Trit- icum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tu- berosum), peanuts (Rachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatus), cassava (Manihot esculenta), coffee (Cofea spp.), coconut (Cocos nucifera), pineapple (Ananas comosus), citrus trees (Citrus spp.), cocoa (Theobroma cacao), tea (Camellia sinensis), banana (Musa spp.), avocado (Perseaultilane), fig (Ficuscasi- ca), guava (Psidium guava), mango (Mangifera indica), olive (Olea europaea), papaya (Carica papaya), cashew(Anacardium occidentale), macadamia (Macadamia integrifolia),ahnond (Prunus amygdalus), sugar beets (Beta vulgaris), sugarcane (Saccharum spp.), oats, duckweed (Lemna), barley, tomatoes (Lycopersicon esculentum), lettuce (e. g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseoluslimensis), peas (Latfiyrus spp.), and members of the genus Cucumis such as cucumber (C sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo). Ornamentals such as azalea (Rhododendron spp.), hydrangea (Macro- phylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum are also included. Additional ornamentals within the scope of the invention include impatiens, Begonia, Pelargonium, Viola, Cyclamen, Verbena, Vinca, Tagetes, Primula, Saint Paulia, Agertum, Amaranthus, Antihir- rhinum, Aquilegia, Cineraria, Clover, Cosmo, Cowpea, Dahlia, Datura, Delphinium, Gerbera, Gladiolus, Gloxinia, Hippeastrum, Mesembryanthemum, Salpiglossos, and Zinnia. Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsugaultilane); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata), and Alaska yellow-cedar (Chamaecy- paris nootkatensis).

The present invention will now be further described in the following examples with reference to the accompanying figures and sequences, nevertheless, without being limited thereto. For the purposes of the present invention, all references as cited herein are incorporated by reference in their entireties. In the Figures and Sequences,

Figure 1 : Schematic representation of novel artificial plant receptors. These receptors possess a kinase domain of EFR which triggers the plant's pathogen- or stress related signalling cascades. The kinase part is exchangeable by any kinase of any receptor, feeding in a plant signalling pathway of interest.

Figure 2: Oxidative burst induced by natural or artificial ligands via newly designed artificial receptors. Shown is the responsiveness to original EFR ligand elfl 8.

Figure 3 : Oxidative burst induced by natural or artificial ligands via newly designed artificial receptors. Shown is the responsiveness to original EFR ligand elfAVNV.

Oxidative burst induced by natural or artificial ligands via newly designed artificial receptors. Shown is the responsiveness to original EFR ligand elfK14.

Also part of the description of this application forms the enclosed sequence listing in which the following sequences are disclosed:

SEQ ID NO. 1 elfl 8 SKEKFERTKPHVNVGTIG

SEQ ID NO. 2 elfiWNV SKEKFERTKPH— GTIG

SEQ ID NO. 3 elfK14 SKEKFERTKPHVNK

SEQ ID NO. 4 DNA receptor construct EFR-S298P

SEQ ID NO. 5 DNA receptor construct E6/L9/E

SEQ ID NO. 6 DNA receptor construct L9/E

SEQ ID NO. 7 DNA receptor construct L9/E-R231Q

SEQ ID NO. 8 11 : primer sequences

EXAMPLES

Materials and Methods

Construction of novel artificial plant LRR receptor kinases

New receptors were constructed on basis of the DNA sequences via PCR with fusion primers as described in (Albert M, Jehle A , Mueller K, Eisele C, Lipschis M, Felix G.; J Biol Chem. 2010 Jun 18;285(25): 19035-42). Sequence of fusion primers for L9/E, termed as fusion primer 1 (fpl): aaccatcttactggaaagatacctttgagctttggaaagtto (SEQ ID No. 8), parts for sequence of EFRlike (L) in bold, for EFR (E) in italics. E6/L9/E has been constructed via fpl and fp2, whereas sequence of fp2 is: gaatogttttteaggtggttttcctcctccaatttacaacctg (SEQ ID No. 9) (sequence parts of EFR (E) in italics and of EFRlike (L) in bold letters). As a template for the PCRs served DNA-constructs containing EFR (At5g20480) or EFRlike (At3g47110), respectively. Pointmutations in EFR S298P or L9/E R231Q were introduced via PCR using the primers caagccttgaaaggtttgatatcCcatctaattacctgtctggtagtatc (SEQ ID No. 10) for S298P or gactgaaacagatgatctttttccAaatagcattaaacaagtttaatgg (SEQ ID No. 11) for R231Q (in bold capitals: nucleotide exchange leading to the desired aa exchange). Schematic representations of the constructed receptors are shown in Figure 1.

Transient Expression in N. benthamiana and oxidative burst measurement (Albert et al JBC, 2010)

A. tumefaciens (strain GV3101) harboring the gene constructs to be expressed were grown for 48 h in LB medium, collected by centrifugation, and transferred to induction medium 10 mM Magnesiumchloride with 150 μιη acetosyringone and 10 mm MgCl ₂ at an OD oo of 0.1. After further incubation at room temperature for 2-3 h, bacteria were pressure-infiltrated into leaves of 4-5-week-old Nicotiana benthamiana plants grown in the greenhouse (16-h day at 22 °C/8-h night at 18 °C). The next day (24-36 h after infiltration), leaves were cut in pieces of ~3 x 3 mm and floated on water in Petri dishes overnight at room temperature. Leaf pieces (-44-48 h after infiltration) were then used to study ethylene biosynthesis and oxidative burst as follows. Ethylene biosynthesis was assayed by placing leaf samples (four pieces with -25 mg fresh weight) in 6-ml tubes with 500 μΐ of water or water containing the appropriate concentration of elf 18. Tubes were sealed with rubber caps, and ethylene accumulating in the headspace within 3 h of incubation was determined by gas chromatography. For oxidative burst, leaf pieces (one piece/well) were placed in wells of 96-well plates containing 100 μΐ of water, -10 ng/ml peroxidase (horseradish peroxidase; Applichem), 20 μηι luminol, and elf 18 at the concentration to be tested. Light emission was measured as relative light units in a 96-well luminometer (Mithras LB 940; Berthold Technologies).

Results:

Oxidative burst (indicated in RLU = relative light units) in N. benthamiana leaf pieces which express the constructs for the new receptors E6/L9/E, L9/E, L9/E R231Q, EFR S298P or EFR. Samples were treated with ligand peptides elfl8 (Figure 2), elfAVNV (Figure 3) or elf 14 (Figure 4) in a dose dependent manner (x-axis: concentration in nM).

The oxidative burst is a cellular response characteristic for very early plant stress reactions related to pathogen invasion. Under laboratory conditions it serves as one of the most sensitive tools to measure the functionality of MAMP receptors and thus indicates the sensitivity of a ligand-receptor system.

Following heterologous expression in N. benthamiana, the novel designed plant LRR-RKs have been tested in the oxidative burst assay in respect to their responsiveness to elf 18, elfAVNV or elf 14 peptides. Ligands have been applied in increasing doses and the detection limits of each receptor- ligand pair (represented by the minimal active concentration) have been determined from the results represented in Figures 2 to 4.