Field of the Invention

The invention relates to the detection of Candida glabrata in a sample either alone or in conjunction with a test for a different or any fungal species. Methods and kits are also provided for testing for the presence or absence of Candida glabrata fungus in a sample either alone or in conjunction with a test for a different or any fungal species

Background of the Invention

Candidaemia is a serious infection, occurring primarily in hospitalised patients, with a mortality of 35-55%. The most common infecting species is Candida albicans, followed by Candida glabrata, Candida parapsilosis, Candida tropicalis and Candida, krusei, the five species together causing ~99% of all human cases (Pfaller & Diekema, 2007, Clin Microbiol Rev 20: 133-63). Several other species of fungi can also cause fungaemia, including other Candida species as well as Cryptococcus spp., Saccharomyces cerevisiae, Histoplasma capsulatum and Rhodatonda spp {e.g., Pfaller et al. , 2007, 1997- 2005. J. Clin. Microbiol. 45, 1735-1745). Identification of the fungus or fungi responsible for an infection is important for the selection of antifungal therapy, as species differ in their susceptibility to antifungals; in particular, Candida glabrata is frequently resistant to fluconazole and itraconazole, with rates of 33-37% and 5-9% respectively having been reported (Pfaller et al, 2000, Antimicrob Agents Chemother 44, 747-751 ).

It has been established that a decrease in the time before diagnosis of fungal infection improves patient outcome. For example, Garey et al. showed that an patients for whom fluconazole therapy commenced on the same day that yeast was identified in their blood sample had a 15% mortality rate, whereas patients for whom there was a three day or more lag between identification and the start of therapy showed a 41 % mortality rate (Garey et al. , 2006, Clin Infect Dis. 43:25-31 ). Comparable findings have alse been reported by Aisner et al. , 1 77, Ann Intern Med 86:539-43; Caillot et al, 1997, J Clin Oncol. 15: 139-47; Morrell et al , 2005, Antimicrob Agents Chemother 49:3640-5; and von Eiff et al , 1995, Respiration 62:341 -7.

The ability to rapidly identify a fungal species, in particular Candida glabrata, is therefore important for improved patient treatment and survival. A number of procedures are currently available for the identification of yeast species: These include a germ tube test that allows differentiation of Candida albicans (and Candida dubliniensis) from all other yeasts and the plating of positive blood cultures on to ChromAgar or other chromogenic media which yields a presumptive identification, based primarily on colony colour, after 24 hours (Ellepola & Morrison 2005, Laboratory diagnosis of invasive candidiasis. J Microbiol 43:65-84). Specific methods to formally identify Candida species and other yeasts include the API32C system, the VITEK system and PNA FISH system. Most of these identification methods rely on growth and therefore take a minimum of 24 hours, but typically 48 hours. Although PNA FISH is a rapid system, employing fluorescent detection, only five species are identified, and of these Candida glabrata and Candida krusei are not distinguished, and neither are Candida albicans and Candida. parapsilosis. Thus a rapid test for the identification of Candida glabrata is still not available.

Summary of the Invention

The inventors have surprisingly shown that is possible to rapidly detect Candida glabrata by identifying a region of D A characteristic of Candida glabrata. The inventors have also developed novel primers and probes for the rapid detection of Candida glabrata. The invention therefore concerns the rapid detection of C. glabrata in a sample. The invention means that DNA analysis can be used to rapidly and reliably determine the presence of C. glabrata in a sample. Accordingly, the invention provides a kit for the rapid detection of the presence or absence of Candida glabrata in a sample, comprising (a) a probe comprising SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 and (b) a pair of primers comprising the sequences shown in SEQ ID NOs: 18 and 19.

The invention also provides:

- a kit for the rapid detection of the presence or absence of fungi of two or more species, genera or groups including Candida glabrata in a sample, comprising the probes and primers necessary to simultaneously carry out on the sample two or more assays for the rapid detection of fungi of two or more species, genera or groups either in the same or different reaction vessels, wherein the kit comprises (a) a probe comprising SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 2 l or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 and (b) a pair of primers comprising the sequences shown in SEQ ID NOs: 18 and 19;

- a method for the rapid detection of the presence or absence of a fungus belonging to the species Candida glabrata in a sample, comprising detecting the presence or absence in the sample of a region of fungal DNA characteristic of Candida glabrata using a probe comprising the sequence shown in SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 ; and

- a method for the rapid detection of the presence or absence of fungi of two or more species, genera or groups including Candida glabrata in a sample, comprising

simultaneously carrying out on the sample two or more assays for the rapid detection of fungi of two or more species, genera or groups either in the same or different reaction vessels, wherein one assay comprises detecting the presence or absence in the sample of a region of fungal DNA characteristic of Candida glabrata using a probe comprising the sequence shown in SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21.

The invention further provides:

- a method for the rapid detection of the presence or absence of C. glabrata in a sample, comprising detecting the presence or absence in the sample of at least one region of fungal DNA characteristic of Candida glabrata;

- a method for the rapid detection of the presence or absence of a fungus belonging to the species C. glabrata in a sample, comprising detecting the presence or absence in the sample of a region of fungal DNA characteristic of C. glabrata using a probe comprising (a) SEQ ID NO: 3, a reverse complement of SEQ ID NO: 3, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or (b) SEQ ID NO: 8, a reverse complement of SEQ ID NO: 8, a sequence having at least

80% homology based on sequence identity to SEQ ID NO: 8 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8;

- a kit for the rapid detection of the presence or absence of Candida glabrata in a sample, comprising (a) a probe comprising (i) SEQ ID NO: 3, a reverse complement of SEQ ID NO: 3, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3, or (ii) SEQ ID NO: 8, a reverse complement of SEQ ID NO: 8, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8; and (b) a pair of primers comprising the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7;

- a kit for the rapid detection of the presence or absence of fungi of two or more fungal species, genera or groups including Candida glabrata in a sample, comprising (a) a probe comprising (i) SEQ ID NO: 3, a reverse complement of SEQ ID NO: 3, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3, or (ii) SEQ ID NO: 8, a reverse complement of SEQ ID NO: 8, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8; (b) a pair of primers comprising the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7; and (c) probes and primers for the detection of at least one different fungal species, genus or group, wherein the two or more assays are capable of being carried out simultaneously either in the same or different reaction vessels; - a kit for the rapid detection of the presence or absence of Candida glabrata in a sample as described above, where an amplification control is incorporated. The amplification control comprises (a) a probe comprising the sequence shown in SEQ ID NO: 12 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 12 and (b) a pair of primers comprising the sequences shown in SEQ ID NOs: 1 1 and 14;

- a method for the rapid detection of the presence or absence of a fungus belonging to the species C. glabrata in a sample, comprising detecting the presence or absence in the sample of a region of fungal DNA characteristic of C. glabrata using a molecular beacon probe comprising the sequence shown in SEQ ID NOs: 4, 5, 9 or 10, a reverse complement of SEQ ID NOs: 4, 5, 9 or 10, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or 10 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or 10;

- a kit for the rapid detection of the presence or absence of Candida glabrata in a sample, comprising (a) a molecular beacon probe comprising the sequence shown in SEQ ID NO: 4, 5, 9 or 10, a reverse complement of SEQ ID NO: 4, 5, 9 or 10, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or 10 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or ] 0 and (b) a pair of primers having the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7;

- a kit for the rapid detection of the presence or absence of fungi of two or more Candida species including Candida glabrata in a sample, comprising (a) a molecular beacon probe having comprising the sequence shown in SEQ ID NO: 4, 5, 9 or 10, the reverse complement of SEQ ID NO: 4, 5, 9 or 10, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or 10 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or 10; (b) a pair of primers comprising the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7; and (c) molecular beacon probes and primers for the detection of at least one different fungal species genus or group, wherein the two or more assays are capable of being carried out simultaneously either in the same or different reaction vessels; and - a kit for the rapid detection of the presence or absence of Candida glabrata in a sample as described above, where an amplification control is incorporated. The amplification control comprising (a) a molecular beacon probe comprising the sequence shown in SEQ ID NO: ] 3 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 13 and (b) a pair of primers comprising the sequences shown in SEQ ID NOs: 1 1 and 14.

In one aspect, methods of testing for the presence or absence of Candida glabrata in a sample are provided. Such methods may comprise obtaining a sample suspected of containing fungal nucleic acid including at least one region of fungal nucleic acid characteristic of Candida glabrata, and testing for the presence or absence in the sample of the at least one region of fungal nucleic acid characteristic of the species. The methods may further comprise amplifying the at least one region of fungal nucleic acid

characteristic of the species by contacting the sample with a pair of primers.

In some embodied methods the testing step includes contacting the sample with an oligonucleotide probe comprising a nucleic acid capable of hybridizing to the at least on region of fungal nucleic acid characteristic of Candida glabrata under stringent conditions. In some embodiments, the methods further comprise amplifying the at least one region of fungal nucleic acid characteristic of Candida glabrata. In methods in which the nucleic acid is amplified, the amplifying step may be carried out in the presence of one or more internal PCR amplification controls to ensure appropriate amplification of any fungal nucleic acid present in the sample. In such methods the one or more internal PCR amplification controls may comprise a non-fungal sequence.

In another aspect, the methods further comprise testing for the presence or absence of other fungi: Such methods may comprise testing for one or more fungal species, genera or groups other than Candida glabrata. For instance, such methods may comprise testing for one or more particular species belong the the Candida genus, such as Candida albicans and/or Candida krusei or for other yeasts such as Rhodotorula mucilaginosa or

Saccharomyces cerevisiae, or for filamentous fungi such as Aspergillus fumigatus.

Alternatively, such methods may comprise testing for any species belonging to the

Candida genus in parallel with testing for Candida glabrata. Such methods may comprise obtaining a sample suspected of containing fungal nucleic acid, including at least one region of fungal nucleic acid characteristic of the species, genus or group of interest, and testing for the presence or absence in the sample of the at least one region of fungal nucleic acid characteristic of the that species, genus or group. The testing step may include contacting the sample with a probe. Such methods may further comprise amplifying the at least one region of fungal nucleic acid characteristic of the genus species by contacting the sample with a pair of primers.

In another aspect, testing kits are provided for a number of fungal nucleic acids. In some embodiments, kits are provided for testing for the presence or absence of at least one region of a fungal nucleic acid characteristic of the species Candida glabrata. In another embodiment, kits are provided for testing for the presence or absence of (a) at least one region of a fungal nucleic acid characteristic of the genus Candida and (b) at least one region of fungal nucleic acid characteristic of the species of Candida glabrata. Such kits may further comprise one or more internal PCR amplification controls. In a further embodiment, kits are provided for testing for the presence or absence of (a) at least one region of a fungal nucleic acid characteristic of a fungal species, genus or group different from Candida glabrata and (b) at least one region of fungal nucleic acid characteristic of the species Candida glabrata. Such kits may further comprise one or more internal PCR amplification controls.

Description of the Sequences

SEQ ID NOs: 1 and 2 are the primers used in the Examples to amplify one of the regions of nucleic acid characteristic for Candida glabrata (SEQ ID NO: 3). SEQ ID NO: 2 is identical to SEQ ID NO: 19 below. SEQ ID NO: 3 is one of the regions of nucleic acid characteristic for Candida glabrata amplified in the Examples.

SEQ ID NOs: 4 and 5 are the probes used in the Examples to detect one of the regions of nucleic acid characteristic for Candida glabrata (SEQ ID NO: 3).

SEQ ID NOs: 6 and 7 are the primers used in the Examples to amplify the other one region of nucleic acid characteristic for Candida glabrata (SEQ ID NO: 8).

SEQ ID NO: 8 is the other region of nucleic acid characteristic for Candida glabrata amplified in the Examples.

SEQ ID NOs: 9 and 10 are the probes used in the Examples to detect the other region of nucleic acid characteristic for Candida glabrata (i.e. SEQ ID NO: 8).

SEQ ID NOs: 1 1 and 14 are the internal control primers used in the Examples.

SEQ ID NO: 12 is one of the regions of nucleic acid amplified for the internal amplification control in the Examples.

SEQ ID NO: 13 is the probe used in the Examples to detect one of the regions of nucleic acid for the internal amplification control in the Examples.

SEQ ID NO: 15 is the MA01 1 probe used in the Myconostica yeast array

(MycArray Yeast ID™, Myconostica Ltd., UK).

SEQID NO: 16 is the MA047 probe used in the Myconostica yeast array.

SEQ ID NO: 17 is the MA048 probe used in the Myconostica yeast array.

SEQ ID NOs: 18 and 19 are the primers used in the invention to amplify one of the regions of nucleic acid characteristic for Candida glabrata. SEQ ID NO: 19 is identical to SEQ ID NO: 2 above.

SEQ ID NO: 20 is one of the regions of nucleic acid characteristic for Candida glabrata amplified in the Examples

SEQ ID NO: 21 is the molecular beacon probe used in the invention to detect the region of nucleic acid characteristic for Candida glabrata amplified by the primers shown in SEQ ID NOs: 18 and 19.

Detailed Description of the Invention

It is to be understood that different applications of the disclosed methods may be tailored to the specific needs in the art. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. In addition, as used in this specification and the appended claims, the singular forms "a", "an", and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "a method" includes "methods", reference to "a probe" includes two or more such probes, reference to "a label" includes two or more such labels, reference to "fungus" includes two or more fungi, and the like.

All publications, patents and patent applications cited herein are hereby

incorporated by reference in their entirety.

The invention generally concerns the rapid detection and identification of Candida glabrata in a sample. In one aspect, a method of testing for the presence or absence of Candida glabrata in a sample is provided, comprising obtaining a sample suspected of containing Candida glabrata nucleic acid and testing for the presence or absence in the sample of at least one region of fungal nucleic acid that is characteristic of or specific for Candida glabrata. In some embodiements, the nucleic acid comprises DNA, and in other embodiments, the nucleic acid comprises RNA.

The presence in a sample of at least one region of fungal DNA that is characteristic of or specific for Candida glabrata is indicative of the presence of a fungus belonging to that species in the sample. The absence from the sample of at least one region of fungal DNA that is characteristic of (or specific for) Candida glabrata is indicative of the absence of a fungus belonging to that species from the sample.

A region of DNA that is characteristic of or specific for a species is a region of

DNA that is only present in that species of fungi. Hence, a region of fungal DNA that is characteristic of or specific for Candida glabrata is present in the genomes of that species but is not present in the genomes of any other species of Candida or species of other fungal genera. A region of fungal DNA that is specific for Candida glabrata is not present in the genome of any other organism, particularly micro-organisms such as a bacteria or viruses.

Samples may be obtained from biological sources. For example the biological source samples can include, but are not limited to, a biological fluid, tissue, or a combination of any two or more thereof.

In some embodied methods, the at least one region of nucleic acid characteristic of Candida glabrata comprises SEQ ID NO: 3 or 8, a reverse complement or a transcript thereof, a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 3 or 8, or a reverse complement or a transcript of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 3 or 8. In other embodiments, the at least one region of nucleic acid characteristic of Candida glabrata comprises SEQ ID NO: 3 or 8, a reverse complement or a transcript thereof, a sequence having at least 90% homology based on sequence identity with SEQ ID NO: 3 or 8, or the reverse complement or a transcript of a sequence having at least 90% homology based on sequence identity with SEQ ID NO: 3 or 8.

In some embodied methods the testing step includes contacting the sample with an oligonucleotide probe comprising a nucleic acid capable of hybridizing to the at least one region of nucleic acid characteristic of Candida glabrata under stringent conditions. The testing step may also include contacting the sample with an oligonucleotide probe comprising a nucleic acid capable of hybridizing to the at least one region of nucleic acid characteristic of Candida glabrata under non-stringent conditions. In such methods, the oligonucleotide probe may further include a detectable label. In other such methods, the probe comprises SEQ ID NO: 20 or 21 , a reverse complement or transcript thereof, a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 20 or 21 , or a reverse complement or a transcript of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 20 or 21. In other such methods, the probe comprises SEQ ID NOs: 3 or 8, a reverse complement or transcript thereof, a sequence having at least 80% homology based on sequence identity with SEQ ID NOs: 3 or 8, or a reverse complement or a transcript of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 3 or 8.

Methods embodied herein may further comprise amplifying the at least one region of fungal nucleic acid. For example, the amplifying step may include, but is not limited to, contacting the sample with a pair of primers comprising the sequences shown in SEQ ID NOs: 18 and 19 or 1 or SEQ ID NOs: 2 or 6 and 7.

In methods in which the Candida glabrata nucleic acid is amplified, the amplifying step may be carried out in the presence of one or more internal PCR amplification controls to ensure appropriate amplification of any fungal nucleic acid present in the sample. In such methods the one or more internal PCR amplification controls may comprise a non- fungal sequence. In other such methods, the amplifying step may be carried out in the presence of a cloned or synthesized tRNA-LEU intron region, which is added to the amplification mixture in a predetermined amount to control for the presence of inhibitors or other defective amplification steps. tRNA-LEU intron regions used in the embodied methods may comprise a portion of the Maize (Zea mays) tRNA-LEU intron region, for example, including but not limited to, SEQ ID NO: 12. In some such embodied methods, the method further comprises detecting the presence of a nucleic acid including SEQ ID NO: 12. In other such embodied methods, the detecting step comprises contacting the sample with a pair of oligonucleotides primers including SEQ ID NO: 1 1 and SEQ ID NO: ] 4 and a molecular beacon probe including SEQ ID NO: 13.

In another aspect, a method of testing for the presence or absence of a fungus belonging to the species Candida glabrata in a sample is provided, comprising obtaining a sample suspected of containing fungal nucleic acid, including at least one region of fungal nucleic acid characteristic of the species Candida glabrata, and testing for the presence or absence in the sample of the at least one region of fungal nucleic acid characteristic of the species Candida glabrata. In some embodied methods, the at least one region of fungal nucleic acid characteristic of the species Candida glabrata includes SEQ ID NOs: 3 or 8, a reverse complement or transcript thereof, a sequence having at least 80% homology based on sequence identity with SEQ ID NOs: 3 or 8, or a reverse complement or a transcript of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 3 or 8. The testing step may include contacting the sample with a probe comprising SEQ ID NO: 4 5, 9 or 10, a reverse complement thereof, a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 4, 5, 9 or 10 or a reverse complement of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 4, 5, 9 or 10.

In some such embodiments the methods further comprise amplifying the at least one region of nucleic acid characteristic of Candida glabrata by contacting the sample with a pair of primers comprising the sequences shown in SEQ ID NOs: 1 and 2 or 6 and 7.

In other aspects, the inventive methods can be employed in multiplex reactions (i.e. in the same reaction vessel) to simultaneously test for the presence or absence of a variety of fungi. The Candida glabrata detection methods described above can be carried out simultaneously in a multiplex reaction with methods for the detection of other fungi including, but not limited to; any fungi of the genera Absidia, Acremoni m, Aspergillus, Aureobasidium, Basidiobolus, Blastomyces, Blastoschizomyces, Candida, Cladosporium, Coccidioides, Cryptococcus, Cunninghamella, Curvularia, Debaryomyces, Exophiala, Exserohilum, Fonsecea, Fusarium, Geotrich m, Histoplasma, Issatchenkia,

Kluyveromyces, Malezzesia, Mucor, Paracoccidioides, Paecilomyces, Penicillium, Pichia, Pneumocystis, Rhizomucor, Rhizopus, Rhodotorula, Saccharomyces, Scedosporium, Schizophyllum, Scopulariopsis, Sporothrix, Trichoderma; Trichophyton and Trichosporon.

In further aspects, the inventive methods can be employed in multiplex reactions to simultaneously test for the presence or absence of a variety of fungi. The Candida glabrata detection methods described above can be carried out simultaneously in a multiplex reaction with methods for the detection of other fungi including, but not limited to; any fungi of the following species; C. albicans, C. caribbica (C. fermentati), C.

dubliniensis, C. famata (Debaryomyces hansenii), C. fukuyamaensis (C. xestobii or C. carpophila), C. fukuyamaensis (C. xestobii or C. carpophila), C. guilliermondii, C. kefyr (Kluyveromyces marxianus), C. krusei (Issatchenkia orientalis), C. metapsilosis, C.

orthopsilosis, C. parapsilosis, C. parapsilosis group, C. pelliculosa, C. psychrophila, C. rugosa, C. smithsonii, C. tropicalis, C. utilis, Coccidioides immitis , Cryptococcus bacillisporus; Cryptococcus gattii; Cryptococcus grubii; Cryptococcus neoformans, Debaryomyces coudertii, D. maramus, D. nepalensis, D. prosopidis, D. robertsiae, D. udenii, Histoplasma capsulatum, Kluyveromyces lactis, Pichia cecembensis, Rhodotorula araucariae, R. babjevae, R. dairensis, R. diobovatum, R. glutinis, R. kratochvilovae, R. paludigenum, R. sphaerocarpum, R. toruloides, R. mucliaginosa, Saccharomyces 'sensu stricto ', S, bayanus, S. boulardii, S. cariocanus, S. kudiavzevii, S. mikatae, S. paradioxus, 5. pastorianus, S. uvarum, S. cerevisiae and Tsuchiyaea wingfieldii. These reactions may or may not include an internal control.

In a further embodiment of the invention, the method of the invention may be used in an assay where testing for multiple organisms and or genera is carried out

simultaneously in separate reaction vessels. For example, the method of the invention may be carried out in one reaction vessel while a test for other species or genera is carried out in another in parallel. The other fungi being chosen from (i) any of the following genera; Absidia, Acremonium, Aspergillus, Aureobasidium, Basidiobolus, Blastomyces,

Blastoschizomyces, Candida, Cladosporium, Coccidioides, Cryptococcus,

Cunninghamella, Curvularia, Debaryomyces, Exophiala, Exserohilum, Fonsecea, Fusarium, Geotrichum, Histoplasma, Issatchenkia, Kluyveromyces, Malezzesia, Mucor, Paracoccidioides, Paecilomyces, Penicillium, Pichia, Pneumocystis, Rhizomucor, Rhizopus, Rhodotorula, Saccharomyces, Scedosporium, Schizophyllum, Scopulariopsis, Sporothrix, T ichoderma; Trichophyton and Trichosporon; or (ii) any of the following species; C. albicans, C caribbica (C. fermentati), C. dubliniensis, C. famata

(Debaryomyces hansenii), C. fukuyamaensis (C. xestobii or- C. carpophila), C.

fukuyamaensis (C. xestobii or C. carpophila), C. guilliermondii, C. kefyr (Kluyveromyces marxianus), C. krusei (Issatchenkia orientalis), C. metapsilosis, C. orthopsilosis, C.

parapsilosis, C. parapsilosis group, C. pelliculosa, C. psychrophila, C. rugosa, C.

smithsonii, C. tropicalis, C. utilis, Coccidioides immitis , Cryptococcus bacillisporus; Cryptococcus gattii; Cryptococcus grubii; Cryptococcus neoformans, Debaryomyces coudertii, D. maramus, D. nepalensis, D. prosopidis, D. robertsiae, D. udenii, Histoplasma capsulatum, Kluyveromyces lactis, Pichia cecembensis, Rhodotorula araucariae, R.

babjevae, R. dairensis, R. diobovatwn, R. glutinis, R. kratochvilovae, R. paludigenum, R. sphaerocarpum, R. toruloides, R. mucliaginosa, Saccharomyces 'sensu stricto ', S.

bayanus, S. boulardii, S. cariocanus, S. kudiavzevii, S. mikatae, S. paradioxus, S.

pastorianus, S. uvarum, S. cerevisiae and Tsuchiyaea wingfieldii. Such tests may further comprise one or more internal PCR amplification controls.

In another aspect, testing kits are provided for testing for the presence or absence of at least one region of nucleic acid characteristic of Candida glabrata in a sample comprising (a) a probe comprising SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 and (b) a pair of primers comprising the sequences shown in SEQ ID NOs: 18 and 19. In another aspect, testing kits are provided for testing for the presence or absence of at least one region of nucleic acid characteristic of Candida glabrata in a sample comprising (a) a probe comprising (i) SEQ ID NO: 3 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or (ii) SEQ ID NO: 3 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 and (b) a pair of primers comprising the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7. In other embodiments, the probes may be molecular beacon probes comprising the sequence shown in SEQ ID NOs: 4, 5, 9 10 or 21 , a reverse complement thereof, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9, 10 or 21 , or a reverse complement of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 4, 5, 9, 10 or 21. Such kits may further comprise one or more internal PCR amplification controls.

In further aspects, testing kits are provided for testing for the presence or absence of at least one region of nucleic acid characteristic of Candida glabrata and also for fungi of other species or for fungal genera (which may or may not include Candida) in a sample by means of a multiplex, in which the Candida glabrata detection assay comprises (a) a probe comprising SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 or a reverse complement of a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 20 or 21 and (b) a pair of primers comprising the sequences shown in SEQ ID NOs: 18 and 19. In another embodiment, the Candida glabrata detection assay comprises (a) a probe comprising (i) SEQ ID NO: 3 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or (ii) SEQ ID NO: 8 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8 and (b) a pair of primers comprising the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7. In other embodiments, the probes may be molecular beacon probes comprising the sequence shown in SEQ ID NOs: 4, 5, 9, 10 or 21 , a reverse complement thereof, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9, 10 or 21 , or a reverse complement of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 4, 5, 9, 10 or 21. Such kits may further comprise one or more internal PCR amplification controls.

In yet further aspects, testing kits are provided for testing for the presence or absence of at least one region of nucleic acid characteristic of Candida glabrata and also for fungi of other species or for fungal genera (which may or may not include Candida) in a sample by means of tests carried out in separate reaction vessels, in which the Candida glabrata detection assay comprises (a) a probe comprising (i) SEQ ID NO: 3 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 3 or (ii) SEQ ID NO: 8 or a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 8 and (b) a pair of primers comprising the sequences shown in (i) SEQ ID NOs: 1 and 2 or (ii) SEQ ID NOs: 6 and 7, and is carried out in one vessel, and the detection of group, genus or other species occurs in a second reaction vessel. The probes may be molecular beacon probes comprising the sequence shown in SEQ ID NOs: 4, 5, 9 or 10, a reverse complement thereof, a sequence having at least 80% homology based on sequence identity to SEQ ID NO: 4, 5, 9 or 10 or a reverse complement of a sequence having at least 80% homology based on sequence identity with SEQ ID NO: 4, 5, 9 or 10. Such kits may further comprise one or more internal PCR amplification controls.

The nucleic acid sample to be tested or the RNA transcribed therefrom is typically extracted from fungal cells present in the sample before it is detected. The nucleic acid can be extracted using routine methods known in the art. For instance, commercially available extraction kits may be used such as MycXtra (Myconostica, UK), QIAamp Blood mini kit (Qiagen, Germany), QIAamp DNA mini kit (Qiagen, Germany) and BiOstic Bacteremia DNA Isolation kit (MoBio, USA). Suitable methods of extracting fungal RNA are disclosed in the art such as the commercially available RNeasy mini kit (Qiagen,

Germany).

A nucleic acid region characteristic of Candida glabrata can be detected using any method known in the art. The region is preferably detected using a probe that specifically hybridizes to this region. Typically, the detecting comprises contacting the probe with the sample under conditions in which the probe specifically hybridizes to the region, if present, and determining the presence or absence of the hybridization product. The presence of the hybridization product indicates the presence of the Candida glabrata-specific region. Conversely, the absence of the hybridization product indicates the absence of the Candida glabrata-specific region.

Probes

The probe is typically a nucleic acid, such as DNA, RNA, PNA or a synthetic nucleic acid. A probe specifically hybridizes to the at least one region of fungal nucleic acid characteristic of Candida glabrata if it preferentially or selectively hybridizes to the at least one region but does not hybridize to other DNA or RNA sequences.

Preferably the probe specifically hybridizes to the region under stringent conditions. Conditions that permit the hybridization are well-known in the art (for example, Sambrook et al., 2001, Molecular Cloning: a laboratory manual, 3rd edition, Cold Spring Harbour Laboratory Press; and Current Protocols in Molecular Biology, Chapter 2, Ausubel et al , Eds., Greene Publishing and Wiley-lnterscience, New York (1995)). The method of the invention can be carried out under low stringency conditions, for example in the presence of a buffered solution of 30 to 35% formamide, 1 M NaCl and 1 % SDS (sodium dodecyl sulfate) at 37°C followed by a wash in from IX (0.1650 M NaCl) to 2X (0.33 M NaCl) SSC (salt sodium citrate) at 50°C. The method of the invention can be carried out under moderate stringency conditions, for example in the presence of a buffer solution of 40 to 45% formamide, 1 M NaCl, and 1 % SDS at 37°C, followed by a wash in from 0.5X (0.0825 M NaCl) to I X (0.1650 M NaCl) SSC at 55°C. The method of the invention can be carried out under high stringency conditions, for example in the presence of a buffered solution of 50% formamide, 1 M NaCl, 1 % SDS at 37°C, followed by a wash in 0.1X (0.0165 M NaCl) SSC at 60°C.

The probe can be the same length as, shorter than or longer than the amplified region. The probe is typically at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 45, at least 50, at least 75 or at least 100 nucleotides in length. For example, the probe can be from 5 to 200, from 7 to 100, from 10 to 50 nucleotides in length. The probe is preferably 5, 10, 15, 20, 25, 30, 35, 40, 45 or 50 nucleotides in length. More preferably, the probe is 33, 35, 47 or 49 nucleotides in length. The probe preferably comprises (i.e. includes) a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% homology based on sequence identity with the region characteristic of species or genus.

The probe used in the invention comprises SEQ ID NO: 20 or 21 , a reverse complement of SEQ ID NO: 20 or 21 , a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% homology based on sequence identity to SEQ ID NO: 20 or 21 or a reverse complement of a sequence having at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or 100% homology based on sequence identity to SEQ ID NO: 20 or 21.

Calculation of percentage identities between different polynucleotide sequences may be carried out as follows. A multiple alignment is first generated by the ClustalX program (pairwise parameters: gap opening 10.0, gap extension 0.1 , DNA matrix IUB; multiple parameters: gap opening 10.0, gap extension 0.2, delay divergent sequences 30%, DNA transition weight 0.5, negative matrix off, DNA weight IUB, gap separation distance 4, end gap separation off). The percentage identity is then calcluated from the multiple alignment as (N/T) * 100, where N is the number of positions at which the two sequences share an identical residue, and T is the total number of positions compared. Alternatively, percentage identity can be calculated as (N/S) * 100 where S is the length of the shorter sequence being compared.

Preferably, the probe is detectably-labelled. The detectable label allows the presence or absence of the hybridization product formed by specific hybridization between the probe and the characteristic region (and thereby the presence or absence of the characteristic region) to be determined. Any label can be used: Suitable labels include, but are not limited to, fluorescent molecules, radioisotopes, e.g. ¹²⁵ 1 , ³⁵ S, enzymes, antibodies and linkers such as biotin.

The probe can be a molecular beacon probe comprising a fluroescent label at one end and a quenching molecule at the other. In the absence of the region to be detected, the probe forms a hairpin loop and the quenching molecule is brought into close proximity with the fluorescent label so that no signal can be detected. Upon hybridization of the probe to the region to be detected, the loop unzips and the fluorescent molecule is separated from the quencher such that a signal can be detected. Suitable fluorescent molecules and quencher for use in molecular beacons are known in the art. These include, but are not limited to, the fluorophores carboxyfluorsecein (FA ) and HEX and the quenchers dabcyl, DDQ1 and DDQ2. The probe is preferably chosen from the molecular beacons shown in SEQ ID NO: 21 and SEQ ID NOs: 4, 5, 9 or 10.

The probe can be a scorpion probe, which is a probe linked to primer. The primer part of the probe can be designed to amplify the region of fungal DNA to be detected and the probe part can be designed to detect the amplified region. Scorpion probes are well- known in the art. They are described in, for example, Whitcombe et al. (Nat. Biotechnol., 1994; 17: 804- 807).

The region of fungal DNA can be detected using TaqMan PCR. This technique is well-known in the art.

If more than one of the methods are carried out simultaneously, the different probes used to detect the different regions of fungal DNA (which indicate the presence or absence of a fungus or the different genera or species) are typically labelled with different labels. Probes having different labels are preferable when the different regions of fungal DNA are being detected simultaneously in the same volume of sample. When the two or more fungi are being detected in the same volume of sample, it must be possible to distinguish between the different labels and hence detect the different regions of fungal DNA. For instance, fluorescent molecules that emit different wavelengths of light can be used. A suitable group of fluorescent labels, each of which can be simultaneously detected, is HEX hexachloro fluorescein phosphoramidite (HEX), carboxyfluorescein (FAM), Cy(R)5 and Texas Red(R). Other suitable groups of labels are known in the art.

The probe may be immobilised on a support using any technology which is known in the art. Suitable solid supports are well-known in the art and include plates, such as multi-well plates, filters, membranes, beads, chips, pins, dipsticks, nanoparticles and porous carriers. The probe may be used as part of an array-based detection method.

The detecting of the Candida glabrata-specific region preferably comprises the step of amplifying the characteristic region or RNA transcribed therefrom. In one embodiment, the region is amplified before its presence is determined. In another embodiment, the region is detected in real time as its presence is determined. Real-time methods are disclosed in the Examples and have been described in the art.

In one embodiment, only the region to be detected is amplified. In other embodiments, the region to be detected is amplified as part of a much larger length of fungal DNA or RNA. Sequences of DNA or RNA having at least 30, at least 50, at least 70, at least 90, at least 1 10, at least 120, at least 130, at least 140, at least 150, at least 160, at least 170, at least 180, at least 190, at least 200, at least 250, at least 300, at least 400 or at least 500 nucleotides and comprising the region to be detected can be amplified. For example, sequences having from 10 to 2000, from 20 to 1500, from 50 to 1000 or from 100 to 500 nucleotides can be amplified.

The DNA or RNA can be amplified using routine methods that are known in the art. The amplification of fungal DNA is preferably carried out using polymerase chain reaction (PCR), nucleic acid sequence based analysis (NASBA) or Loop-mediated isothermal amplification (LAMP). Fungal RNA can be amplified using routine methods in the art, such as reverse transcription-PCR. The Candida region is preferably amplified using primers chosen from SEQ ID NOs: 18 and 19 and SEQ ID NOs: 1 , 2, 6 or 7. Amplification Control

The characteristic region or regions, or RNA transcribed therefrom, is extracted from fungal cells and so may be contaminated with one or more factors that interfere with the amplification and/or detection steps. For this reason, the characteristic region is typically detected in the presence of an internal PCR amplification control, which enables the presence of interfering substances to be detected and controlled for. The internal PCR amplification control preferably comprises a non-fungal sequence. The characteristic region is preferably detected in the presence of a cloned or synthesized tRNA-LEU intron region added to the amplification mixture in a predetermined amount. The tRNA-LEU intron region preferably comprises a portion of the Maize Zea mays tRNA-LEU intron region as shown in SEQ ID NO: 12, or its reverse complement. The sequence of the Maize tRNA-LEU intron region lacks homology with any sequence present in humans or pathogenic fungal species. The internal PCR amplification control preferably involves detecting SEQ ID NO: 12, or its reverse complement, preferably using a detectably- labelled probe that specifically hybridizes to SEQ ID NO: 12 or its reverse complement. The probe preferably includes a sequence that shares at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% homology based on sequence identity with SEQ ID NO: 12 or its reverse complement. The probe more preferably comprises a sequence that is identical to SEQ ID NO: 12 or its reverse complement. The detection of SEQ ID NO: 12 is most preferably carried out using the pair of oligonucleotides primers shown in SEQ ID NOs: 1 1 and 14 and the molecular beacon probe shown in SEQ ID NO: 13. The primers are capable of amplifying a sequence within the Maize tRNA-LEU intron region that contains SEQ ID NO: 12 and the molecular beacon is capable of specifically detecting the presence of SEQ ID NO: 12.

Samples

The sample used in the invention may be any suitable sample. The invention is typically carried out on a biological sample. The invention is preferably carried out in vitro on a biological sample. The biological sample can be obtained from or extracted from any organism. The organism is typically eukaryotic and can belong the plantae kingdom or the animalia kingdom. The sample can be a colony of fungus.

The sample is preferably a fluid sample. The sample typically comprises a body fluid. The sample may be urine, lymph, saliva, cerebrospinal fluid, peritoneal fluid, pericardial fluid, vitreous or other ocular sample, plural fluid, vaginal fluid, mucus, pus or amniotic fluid but is preferably blood, plasma or serum. The sample can be a cell or tissue sample, such as lung, brain, liver, skin or nails.

Typically, the sample is human in origin, but alternatively it may be non-human. For instance, the sample can be from animals such as from commercially farmed animals such as horses, cattle, sheep or pigs or may alternatively be pets such as cats or dogs. The sample can also be from other organisms, such as insects. The sample can be from a human or non-human animal undergoing treatment with an anti-fungal agent.

The sample is typically processed or manuipulated prior to being used in the invention, for example by centrifugation or by passage through a membrane that filters out unwanted molecules or cells, such as red blood cells. Alternatively, the sample may be incubated in a culture medium before being used in the invention either with or without further processing. Examples of culture medium are the blood culture media used in blood culture systems such as BacTec (Becton Dickenson) or BacT/ALERT (BioMerieux). The sample may have undergone polymerase chain reaction before being used in the invention. The sample may be measured immediately upon being taken. The sample may also be stored prior to assay, preferably below -70°C.

Uses of the Invention

The invention concerns the detection and identification of Candida glabrata in a sample. The invention can therefore be used for the diagnosis of a Candida glabrata infection in a patient. The invention can also be used to determine the presence of

Candida glabrata in or on any non-biological product and hence the likelihood that the product will cause a fungal infection. Examples

Example 1 - Design of primers and probes for the detection of Candida slabrata

The Myconostica yeast array ( ycArray Yeast ID™, Myconostica Ltd., UK) contains three C. glabrata probes, MAOl 1

(TGTATTAGGTTTTACCAACTCGGTGTTGATCTAGG; SEQ ID NO: 15); MA047 (GGACACGAGCGCAAGCTTCTCTATT; SEQ ID NO: 16); and MA048

(TTAATCTGCTGCTCGTTTGCGCGA; SEQ ID NO: 17). Studies of the performance of these three probes in the arrays indicated that MAOl 1 consistently gave the strongest signal and was least susceptible to differences between strains or variations in the amount of DNA added to the array. Initially, probes were developed to have calculated primer and probe Tms of ~50°C; MAOl 1 was therefore trimmed to give a probe with approximately this Tm; Probel_MA01 1 ; TTTTACCAACTCGGTGTTGAT; Len 21 ; Tm 50.0; %GC 38.1 .

Next, primers were designed to give a fragment containing the probe sequence, the optimal size for a real-time PCR product being 100- 150 bases. The Candida glabrata- specific sequences MA047 and MA048 were used as the starting point for a 5' primer, and the length adjusted to give the correct Tm, resulting in primer Cgla_lt_f. A sequence with an appropriate TM was also chosen for the 3' primer. This resulted in the following primers, which would give a PCR product of 162 bases:

Name Sequence (5'-3 ') Ln Tm %GC

Cgla_lt_f GCGCAAGCTTCTCTATTAATC 21 49.6 42.9

Cgla_lt_r CCTACCTGATTTGAGGTCAAAC 22 50.9 45.5

Primers and probe were checked to ensure firstly that all good-quality sequence entries on Genbank were detected, and secondly that there was no cross-reactivity with species other than C. glabrata. This was done using NCBI's nucleotide blast and primer blast facilities. Primers and probe were also evaluated against a representative set of ITS sequences and the numbers of mismatches calculated (Table 1 ). This indicated that the primers and probes should specifically detect C. glabrata.

Table 1. Number of mis-matches between C. glabrata primers and probes and representative ITS sequences.

A probe and primer set was also developed to provide a real-time PCR detection method that could be used under the same conditions as the Myconostica MycAssay Aspergillus kit, i.e. with a Tm nearer to 60°C. Primers and probe were lengthened to give the required Tm, resulting in the following sequences:

Name Sequence Ln Tm %GC

Cgla_ht_f GGACACGAGCGCAAGCTTCTCTATTAATC 29 59.8 48.3

Cgla_ht_r GGGTAACCCTACCTGATTTGAGGTCAAAC 29 58.9 48.3

Probe2 MAO 1 1 TGTATTAGGTTTTACCAACTCGGTGTTGATCTAGG 35 59.7 40

The longer Candida glabrata probe and primers were checked to ensure that the good coverage of Candida glabrata sequences seen with the shorter sequences was not affected by the lengthening and that any short matches inadvertently created were not at the 5' end of primers.

Stem sequences were added to enable the probe sequences to fold into a

"magnifying-glass" structure when not annealed to target DNA. Two sets of stem sequences were chosen, with 6 bases or 7 bases, with a view to testing both and using the one that performed best. The final set of primers and probes is given in Table 2, stem sequences are shaded.

Table 2. Primers and probes

Example 2 - Detection of Candida slabrata

Fungal DNA is extracted from human blood using the MycXtra kit (Myconostica, UK). The DNA thus purified is used in real-time PCR for the detection of Candida glabrata using the primers and molecular beacon probes given in Table 2, e.g. (i) primers SEQ ID Nos: 1 and 2 and probe SEQ ID NOs: 4 or 5; or (ii) primers SEQ ID Nos: 6 and 7 and probe SEQ ID NOs: 9 or 10. An amplification control (IAC) is incorporated in the PCR to control for the presence of inhibitors; The primers and probes given in Table 3 are be used. The Candida glabrata and amplification control probes are labelled with different fluorophores, e.g., FAM for the Candida glabrata probe and HEX for the IAC, and both have the quencher DDQl . PCRs are carried out on a real-time PCR machine using either of the condition sets given in Table 4 with the generation of a signal with the Candida glabrata probe being indicative of the presence of Candida glabrata in the starting sample.

Table 3. IAC sequences

Detection of Candida glabrata is carried out simultaneously with the detection of other fungal species, genera or groups (such as the genus Candida) in the same reaction vessel (a multiplex) using primers and probes designed to enable this amplification to proceed under the same reaction conditions and using the same buffers and reaction components as that of Candida glabrata.

Detection of Candida glabrata is carried out simultaneously with the detection of other fungal species, genera or groups (such as the genus Candida) in a different reaction vessel using primers and probes designed to enable this amplification to proceed under the same cycling conditions, although different buffers may be used, and cross-reactivity of primers and probes is not an issue.

Example 3 - Detection of Candida glabrata

Fungal DNA is extracted from human serum using the QIAamp DNA mini kit (Qiagen, Germany). The DNA thus purified is used in real-time PCR for the detection of Candida glabrata using the primers and molecular beacon probe given below, e.g. (i) primers SEQ ID Nos: 18 and 1 and molecular beacon SEQ ID NO: 21. An amplification control (IAC) is incorporated in the PCR to control for the presence of inhibitors; The primers and probes given in Table 3 are be used. The Candida glabrata and amplification control probes are labelled with different fluorophores, e.g., FAM for the Candida glabrata probe and HEX for the IAC, and both have the quencher DDQl . PCRs are carried out on a real-time PCR machine using either of the condition sets given in Table 4 with the generation of a signal with the Candida glabrata probe being indicative of the presence of Candida glabrata in the starting sample.

Forward primer Cgla_ht_f2: CAG TAT GTG GGA CAC GAG CGC AAG (SEQ ID NO: 18)

Reverse primer Cgla_ht_R: GGG TAA CCC TAC CTG ATT TGA GGT CAA AC (SEQ ID NO: 19)

Probe 3: ACC A AC TCG GTG TTG ATC TAG GGA GGG ATA AGT GAGTG (SEQ ID NO: 20) Cgla_ht35_7: cgcgatcACC AAC TCG GTG TTG ATC TAG GGA GGG ATA AGT GAGTGgatcgcg (SEQ ID NO: 21)

It is understood that the present invention is not limited to the preferred embodiments and examples presented herein, which serve only to illustrate certain aspects of the invention to one of ordinary skill in the art. Other embodiments of the invention, which would be apparent to those of ordinary skill, are considered to fall within the scope and spirit of the invention.

Table 4. Parameters suitable for real-time PCR detection of C. glabratcu