ATP DRIVEN DIRECT PHOTOSYNTHETIC PRODUCTION OF FUELS AND

CHEMICALS

CROSS REFERENCE TO RELATED APPLICATIONS

[ 0001 ] This application claims priority to U.S. Provisional

Application No. 61/602,273, filed February 23, 2012, the disclosure of which is incorporated herein by reference in its entirety.

BACKGROUND

[ 0002 ] According to the US Energy Information Administration

(EIA, 2007), world energy-related C0 ₂ emissions in 2004 were 26,922 million metric tons and increased 26.7% from 1990. As a result, atmospheric levels of C0 ₂ have increased by about 25% over the past 150 years. Thus, it has become increasingly important to develop new technologies to reduce C0 ₂ emissions.

[ 0003] The world is also facing costly gas and oil and limited reserves of these precious resources. Biofuels have been recognized as an alternative energy source. While efforts have been made to improve various productions, further developments are needed.

SUMMARY

[ 0004 ] Recycling C0 ₂ into 1-Butanol, an important chemical feedstock and potential fuel, is an attractive strategy for tackling energy and environmental problems. The Coenzyme A (CoA) dependent pathway for the production of 1-butanol is the most energy

efficient. The first step of the CoA pathway, condensation of two acetyl-CoA, is strongly thermodynamically unfavorable. Contrary to the conventional wisdom that energy efficiency is crucial to microbial production; the disclosure demonstrates that ATP

consumption is beneficial for the direct photosynthetic production of 1-butanol from S. elongatus PCC 7942. Energy from ATP hydrolysis was incorporated into the CoA pathway to overcome the high

thermodynamic barrier for biosynthesis of acetoacetyl-CoA, the first pathway intermediate. ATP activation of acetyl-CoA into malonyl-CoA and the subsequent decarboxylative carbon chain elongation mechanism found in fatty acid and polyketide synthesis was used to

irreversibly drive the synthesis of acetoacetyl-CoA . By designing a novel malonyl-CoA dependent 1-butanol production pathway, direct photosynthetic production of 1-butanol from C0 ₂ was obtained. In addition, the disclosure demonstrates the substitution of

bifunctional aldehyde/alcohol dehydrogenase (AdhE2) with separate butyraldehyde dehydrogenase (Bldh) and alcohol dehydrogenase (YqhD) increases the 1-butanol production by 400%.

[ 0005] The disclosure provides a novel malonyl-CoA dependent 1- butanol pathway and demonstrates the direct photosynthetic

production of 1-butanol from S. elongatus PCC 7942 under oxygenic condition. Contrary to the notion that energy efficiency is important for microbial production, the consumption of ATP is beneficial for cyanobacteria to produce 1-butanol. ATP hydrolysis was used to drive the formation of acetoacetyl-CoA . The release of free energy from ATP hydrolysis is used to overcome the

thermodynamically unfavorable condensation of two acetyl-CoA. To incorporate energy of ATP hydrolysis into the CoA 1-butanol pathway, malonyl-CoA biosynthesis was used in combination with the

decarboxylative carbon chain elongation using malonyl-CoA found in fatty acid and polyketide synthesis to irreversibly trap carbon flux into the formation of acetoacetyl-CoA . Despite the decarboxylation, condensation of malonyl-CoA and acetyl-CoA has the same carbon yield as the condensation of two acetyl-CoA catalyzed by thiolase .

Furthermore, substitution of bifunctional aldehyde/alcohol

dehydrogenase (AdhE2) with separate butyraldehyde dehydrogenase (Bldh) and alcohol dehydrogenase (YqhD) increased the 1-butanol production by 400%. While production of alcohols by CoA pathway is the most efficient pathway, it may not be suitable for all organisms under all conditions. The data demonstrate that chain elongation by at the expense of an ATP may be more favorable in cyanobacteria.

[ 0006] The disclosure provides a recombinant photoautotroph or photoheterotroph microorganism that produces 1-butanol wherein the alcohol is produced through a malonyl-CoA dependent pathway. In one embodiment, the organism comprises expression or elevated expression of an enzyme that converts acetyl-CoA to malonyl-CoA, malonyl-CoA to Acetoacetyl-CoA, and at least one enzyme that converts (a)

acetoacetyl-CoA to (R) - or (S) -3-hydroxybutyryl-CoA and (R) - or (S)- 3-hydroxybutyryl-CoA to crotonyl-CoA, crotonyl-CoA to butyryl-CoA, butyryl-CoA to butyraldehyde and butyraldehyde to 1-butanol. In another embodiment of either of the foregoing the microorganism comprises a metabolic pathway for the production of 1-butanol that is an NADPH dependent pathway. In yet another embodiment, the photoautotrophic or photoheterotrophic microorganism is engineered to express or overexpress one or more polypeptides that convert acetyl-CoA to Malonyl-CoA and malonyl-CoA to Acetoacetyl-CoA . In a further embodiment, the one or more polypeptides comprises a nphT7 polypeptide comprising at least 90% identity to SEQ ID NO: 18 and having acetoacetyl-CoA synthase activity. In yet another embodiment of any of the foregoing the recombinant microorganism is engineered to express an acetyl-CoA carboxylase. In a further embodiment, the acetyl-CoA carboxylase comprises a sequence that is at least 90% identical to SEQ ID NO : 2. In yet another embodiment of any of the foregoing the microorganism further expresses or overexpresses one or more enzymes that carries out a metabolic function selected from the group consisting of (a) converting acetoacetyl-CoA to (R) -3- hydroxybutyryl-CoA, (b) converting acetoacetyl-CoA to (S)-3- hydroxybutyryl-CoA, (c) converting (R) -3-hydroxybutyryl-CoA to crotonyl-CoA, (d) converting ( S ) -3-hydroxybutyryl-CoA to crotonyl- CoA, (e) converting crotonyl-CoA to butyryl-CoA, ( fi ) converting butyryl-CoA to butyraldehyde and butyraldehyde to 1-butanol, or (f ₂ ) butyrl-CoA to 1-butanol. In a further embodiment, the recombinant microorganism comprises an NADPH dependent metabolic pathway that converts (i) acetyl-CoA to malonyl-CoA, (ii) malonyl-CoA to acetoacetyl-CoA, (iii) acetoacetyl-CoA to (R) -3-hydroxybutyryl-CoA,

(iv) (R) -3-hydroxybutyryl-CoA to crotonyl-CoA, (v) crotonyl-CoA to butyryl-CoA, (vi) butyryl-CoA to butyraldehyde, and (vii)

butyraldehyde to 1-butanol. In another embodiment, the recombinant microorganism comprises a NADH dependent metabolic pathway that converts (i) acetyl-CoA to malonyl-CoA, (ii) malonyl-CoA to acetoacetyl-CoA, (iii) acetoacetyl-CoA to (S) -3-hydroxybutyryl-CoA,

(iv) (S) -3-hydroxybutyryl-CoA to crotonyl-CoA, (v) crotonyl-CoA to butyryl-CoA, and (vi) butyryl-CoA to 1-butanol. In yet another embodiment, the recombinant microorganism comprises an NADPH dependent metabolic pathway that converts (i) acetyl-CoA to acetoacetyl-CoA, (ii) acetoacetyl-CoA to (R) -3-hydroxybutyryl-CoA,

(iii) (R) -3-hydroxybutyryl-CoA to crotonyl-CoA, (iv) crotonyl-CoA to butyryl-CoA, (v) butyryl-CoA to butyraldehyde, and (vi) butyraldehyde to 1-butanol. In yet another embodiment, the microorganism is a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA

carboxylase and an acetoacetyl-CoA synthase. In another embodiment, the microorganism further expresses or overexpresses one or more enzymes selected from the group consisting of (a) acetoacetyl-CoA reductase, (b) enoyl-CoA hydratase, (c) crotonyl-CoA reductase, and (d) an alcohol/aldehyde dehydrogenase. In another embodiment, the microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase and further expresses or overexpresses one or more enzymes selected from the group consisting of (a) acetoacetyl-CoA reductase, (b) enoyl-CoA hydratase, (c) trans-2-enoyl-CoA reductase, and (d) an alcohol/aldehyde

dehydrogenase. In another embodiment, the microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an

acetoacetyl-CoA synthase and further expresses or overexpresses one or more enzymes selected from the group consisting of (a)

acetoacetyl-CoA reductase, (b) enoyl-CoA hydratase, (c) trans-2- enoyl-CoA reductase, and (d) butyraldehyde dehydrogenase and 1,3- propanediol dehydrogenase. In another embodiment, the microorganism is a photoautotrophic or photoheterotrophic organism and wherein is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase and one or more enzymes selected from the group consisting of (a) hydroxybutyryl CoA dehydrogenase, (b) crotonase, (c) crotonyl-CoA reductase, and (d) an alcohol/aldehyde dehydrogenase. In another embodiment, the microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an

acetoacetyl-CoA synthase and one or more enzymes selected from the group consisting of (a) hydroxybutyryl CoA dehydrogenase, (b) crotonase, (c) trans-2-enoyl-CoA reductase, and (d) an

alcohol/aldehyde dehydrogenase. In yet another embodiment, the microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase and one or more enzymes selected from the group consisting of (a) hydroxybutyryl CoA dehydrogenase, (b) crotonase, (c) trans-2-enoyl-CoA reductase, and (d) butyraldehyde dehydrogenase and 1, 3-propanediol dehydrogenase. In one embodiment, the microorganism comprises a photoautotrophic or photoheterotrophic organism and includes the expression of at least one heterologous, or the over expression of at least one

endogenous, target enzyme from the group consisting of an enzyme that converts (i) acetyl-CoA to malonyl-CoA, (ii) malonyl-CoA to Acetoacetyl-CoA, (iii) acetoacetyl-CoA to (R) - or (S)-3- hydroxybutyryl-CoA, (iv) (R) - or ( S ) -3-hydroxybutyryl-CoA to crotonyl-CoA, (v) crotonyl-CoA to butyryl-CoA, (vi) butyryl-CoA to butyraldehyde and (vi) butyraldehyde to 1-butanol. In another embodiment of any of the foregoing, the microorganism comprises a photoautotrophic or photoheterotrophic organism that comprises a reduction, disruption or knockout of at least one gene encoding an enzyme that competes with a metabolite necessary for the production of a desired higher alcohol product or which produces an unwanted product. In one embodiment, the microorganism comprises a

photoautotrophic or photoheterotrophic organism that is engineered to disrupt, delete or knockout one or more genes encoding a polypeptide or protein selected from the group consisting of: (i) an enzyme that catalyzes the NADH-dependent conversion of pyruvate to D-lactate (e.g., ldhA) ; (ii) an enzyme that promotes catalysis of fumarate and succinate interconversion (e.g., frdBC) ; (iii) an oxygen transcription regulator; and (iv) an enzyme that catalyzes the conversion of acetyl-coA to acetyl-phosphate (e.g., pta) . In a further embodiment, a disruption, deletion or knockout of a combination of an alcohol/acetoaldehyde dehydrogenase and one or more of (i)-(iv) . In another embodiment of any of the foregoing the microorganism is recombinantly engineered to express one or more subunits of acetyl-coA carboxylase (AccABCD) that converts acetyl- CoA to malonyl-CoA. In yet another embodiment of any of the foregoing the microorganism is engineered to express of over express one or more genes selected from the group consisting of nphT7, phaB, phaJ, ter, bldh, and yqhD, and wherein the microorganism produces 1- butanol . In another embodiment, the microorganism is engineered to express of over express AccABCD. In a further embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO: 2 (AccABCD) . In yet another embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO: 18 (nphT7) . In yet another embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO: 30 (phaB) . In yet another embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO: 28 (phaJ) . In yet another embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO:23, 24, 25, or 26 (ter) . In yet another embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO:34 (Bldh) . In yet another embodiment, the microorganism expresses a polypeptide having at least 90-100% identity to SEQ ID NO:32 (yqhD) . In yet another embodiment, the microorganism comprises an expression profile selected from the group consisting of:

(a) AccABCD, nphT7, PhaB, PhaJ, Ter, BldH, and YqhD;

(b) nphT7, PhaB, PhaJ, Ter, BldH, and YqhD;

(c) AccABCD, nphT7, PhaB, PhaJ, Ter, and AdhE2;

(d) nphT7, PhaB, PhaJ, Ter, and AdhE2;

(e) AccABCD, nphT7, PhaB, PhaJ, ccr, BldH, and YqhD;

(f) nphT7, PhaB, PhaJ, ccr, BldH, and YqhD;

(g) AccABCD, nphT7, PhaB, PhaJ, ccr, and AdhE2;

(h) nphT7, PhaB, PhaJ, ccr, and AdhE2;

(i) AccABCD, nphT7, hbd, crt, Ter, BldH, and YqhD;

(j) nphT7, hbd, crt, Ter, BldH, and YqhD;

(k) AccABCD, nphT7, hbd, crt, Ter, and AdhE2; and

(1) nphT7, hbd, crt, Ter, and AdhE2.

[ 0007 ] The disclosure also provides a method for producing an alcohol, such as 1-butanol, the method comprising providing a recombinant photoautotroph or photoheterotrophic microorganism of any of the foregoing, culturing the microorganism ( s ) in the presence of C0 ₂ under conditions suitable for the conversion of the substrate to an alcohol; and purifying the alcohol.

[ 0008 ] The details of one or more embodiments of the disclosure are set forth in the accompanying drawings and the description below. Other features, objects, and advantages will be apparent from the description and drawings, and from the claims.

BRIEF DESCRIPTION OF THE DRAWINGS

[0009] The accompanying drawings, which are incorporated into and constitute a part of this specification, illustrate one or more embodiments of the disclosure and, together with the detailed description, serve to explain the principles and implementations of the invention.

[0010] Figure 1 is a schematic representation of variations of the CoA 1-butanol pathway. Enzymes of different cofactor preference are shown as different routes. The original CoA 1-butanol pathway is in black. Alternative routes to 1-butanol are depicted as dotted lines. AtoB, thiolase; AccABCD, acetyl-CoA carboxylase, NphT7, acetoacetyl-CoA; PhaB, acetoacetyl-CoA reductase; PhaJ, (R) -specific enoyl-CoA hydratase; Hbd, 3-hydroxybutyryl-CoA; Crt, crotonase;

Eg.Ter, Euglena gracilis Trans-2-enoyl-CoA reductase; Td.Ter,

Treponema denticola; Ccr, crotonyl-CoA reductase; Bldh,

butyraldehyde dehydrogenase; YqhD, NADP-dependent alcohol

dehydrogenase; AdhE2, bifunctional alcohol/ aldehyde dehydrogenase. EC, E. coli; RE, R. eutropha; CA, C. acetobutylicum; AC, A. caviae; TD, T. denticola; CS, C. saccharoperbutylacetonicum; CL190,

Streptomyces sp . strain CL190; EG, Euglena gracilis; GP, guinea pig. SC, Streptomyces coelicolor .

[0011] Figure 2A-B shows ATP driven synthesis of acetoacetyl-

CoA. (A) Thiolase (AtoB) catalyzed formation and thiolysis of acetoacetyl-CoA . Equilibrium constant for two acetyl-CoA

condensation is very low. (B) Malonyl-CoA driven formation of acetoacetyl-CoA by Acetoacetyl-CoA synthase (NphT7) .

[0012] Figure 3A-B shows engineered S. elongatus PCC 7942 strains displaying (A) ability and inability to synthesize

acetoacetyl-CoA from malonyl-CoA and acetyl-CoA by the expression of NphT7 and AtoB, respectively. (B) Negligible and favored thiolysis of acetoacetyl-CoA by expression of NphT7 and AtoB, respectively.

[0013] Figure 4A-C shows production of 1-butanol under oxygenic condition enabled by expression of NphT7. (A) growth rate between strains EL20 (nphT7. hbd . crt . ter . adhE2) and EL14

(atoB . hbd . crt . ter . adhE2) is nearly identical. (B) 1-Butanol production time course by strain EL20. (C) GC chromatogram

demonstrating the production of 1-butanol by EL20 while EL14 produced only trace amount.

[0014] Figure 5 shows production of 1-butanol and ethanol by recombinant E. coli strains JCL299 expressing CoA 1-butanol pathway with YqhD and Bldh from different organisms. In all strains, AtoB, PaaHl, Crt, and Ter were expressed. Strain expressing C.

saccharoperbutylacetonicum NI-4 Bldh produced the highest amount of 1-butanol exceeding that of the strain expressing AdhE2 by nearly 3- fold. Sample was measured after 48 hours of anaerobic incubation in TB with 20 g/L glucose.

[0015] Figure 6A-B shows data related to butanol production. (A)

1-Butanol production by strains expressing different enzymes.

Expression of nphT7 enables direct photosynthetic production of 1- butanol under oxygenic condition. Strains EL21 and EL22 expressing bldh and yqhD achieved the highest production. (B) Enzymatic activities of CoA 1-butanol pathway enzymes in the corresponding engineered S. elongatus PCC7942 strains.

[0016] Figure 7A-C shows a schematic representation of

recombination to integrate (A) ter at NSI, (B) atoB, adhE2, crt, and hbd at NSII in the genome of S. elongatus. Different combinations of alternative genes nphT7, bldh, yqhD, phaJ, and phaB can replace their counterpart enzymes to recombine into NSII. (C) List of strains with different combinations of overexpressed genes used in this study.

[0017] Like reference symbols in the various drawings indicate like elements.

DETAILED DESCRIPTION

[0018] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a microorganism" includes a plurality of such microorganisms and reference to "the polypeptide" includes reference to one or more polypeptides and equivalents thereof, and so forth.

[0019] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although any methods and reagents similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods and materials are now described.

[ 0020] Also, the use of "or" means "and/or" unless stated otherwise. Similarly, "comprise," "comprises," "comprising"

"include," "includes," and "including" are interchangeable and not intended to be limiting.

[ 0021] It is to be further understood that where descriptions of various embodiments use the term "comprising, " those skilled in the art would understand that in some specific instances, an embodiment can be alternatively described using language "consisting

essentially of" or "consisting of."

[ 0022] All publications mentioned herein are incorporated herein by reference in full for the purpose of describing and disclosing the methodologies, which are described in the publications, which might be used in connection with the description herein. The publications discussed above and throughout the text are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior disclosure.

[ 0023] Butanol is hydrophobic and less volatile than ethanol .

1-Butanol has an energy density closer to gasoline. Butanol at 85 percent strength can be used in cars without any change to the engine (unlike ethanol) and it produces more power than ethanol and almost as much power as gasoline. Butanol is also used as a solvent in chemical and textile processes, organic synthesis and as a chemical intermediate. Butanol also is used as a component of hydraulic and brake fluids and as a base for perfumes.

[ 0024] Biological production of chemical and fuel is an attractive direction towards sustainable future. In particular, 1- butanol has received increasing attention as it is a potential fuel substitute and a chemical feedstock. 1-Butanol can be produced by two distinctive pathways: 2-ketoacid pathway and Coenzyme A (CoA) dependent pathway. The 2-ketoacid pathway utilizes either threonine synthetic pathway or citramalate pathway for producing 2- ketobutyrate . Leucine biosynthesis then elongates 2-ketobutyrate into 2-ketovalarate . 2-Ketovalarate is then decarboxylated and reduced into 1-butanol. On the other hand, the CoA pathway follows the chemistry of β-oxidation in reverse. Acetyl-CoA is condensed into acetoacetyl-CoA which is then further reduced to 1-butanol. Furthermore, using this reversed β-oxidation, 1-butanol can be elongated to 1-hexanol and other long even-numbered chain primary alcohols. A comparison of these 1-butanol synthesis pathways reveals that CoA pathway is the most carbon energy efficient pathway for producing 1-butanol. Citramalate pathway requires an additional acetyl-CoA and threonine pathway requires two ATP.

[ 0025] The CoA pathway is a natural fermentation pathway used by

Clostridium species. However CoA pathway is not expressed well in recombinant chemoheterotrophs, resulting in low titer 1-butanol production ranging from 2.5 mg/L to 1,200 mg/L with sugar as the substrate. The hypothesized limiting step is the reduction of crotonyl-CoA by the butyryl-CoA dehydrogenase/electron transferring flavoprotein (Bcd/EtfAB) complex. Bcd/EtfAB complex is difficult to use in recombinant systems because of its poor expression,

instability, and potential requirement for ferredoxin. This problem was overcome by replacing Bcd/EtfAB complex with trans-2-enoyl-CoA reductase (Ter) . Ter expresses well and directly reduces crotonyl- CoA with NADH. This modified CoA 1-butanol pathway (Fig.l; outlined in black) is catalyzed by five enzymes: thiolase (AtoB) , 3- hydroxybutyryl-CoA dehydrogenase (Hbd) , crotonase (Crt) , Ter, and bifunctional aldehyde/alcohol dehydrogenase (AdhE2) . In combination of expressing these enzymes and engineering NADH and acetyl-CoA accumulation as driving forces, successful recombinant 1-butanol production has been demonstrated in E. coli with high titer (15 - 30 g/L) and yield (70% - 88% of theoretical) . This result demonstrated the efficiency of the CoA pathway for 1-butanol fermentation.

[ 0026] The disclosure provides methods and compositions for the production of higher alcohols using a culture of microorganisms that utilizes C0 ₂ as a carbon source. Examples of such microorganisms that utilize C0 ₂ as a carbon source include photoautotrophs . In some embodiments the methods and compositions comprise a co-culture of photoautotrophs and a photoheterotroph or a photoautotroph and a microorganism that cannot utilize C0 ₂ as a carbon source.

[ 0027 ] The disclosure provides microorganisms that comprise an artificially engineered ATP consumption pathway to produce biofuels and other chemicals. The disclosure shows that artificially engineered ATP consumption through a pathway modification can drive the reaction of acetyl-CoA to acetoacetyl-CoA (a thermodynamically unfavorable reaction) forward and enables for the direct

photosynthetic production of 1-butanol and other chemicals and biofuels from photoautotrophs such as the cyanobacteria

Synechococcus elongates PCC 7942. In addition, the disclosure demonstrates that substitution of bifunctional aldehyde/alcohol dehydrogenase (AdhE2) with separate butyraldehyde dehydrogenase

(Bldh) and NADPH-dependent alcohol dehydrogenase (YqhD) increased 1- butanol production by 4-fold. These results demonstrated the importance of ATP and cofactor driving forces as a design principle to alter metabolic flux.

[ 0028 ] The CoA-dependent reverse β-oxidation is a natural fermentation pathway used by Clostridium species and has been transferred to various recombinant heterotrophs , resulting in 1- butanol titers ranging from 2.5 mg/L to 1.2 g/L with glucose as the substrate. One of the challenges in transferring this pathway to other organisms lies in the hydrogenation of crotonyl-CoA to butyryl-CoA catalyzed by the butyryl-CoA dehydrogenase/electron transferring flavoprotein (Bcd/EtfAB) complex. Bcd/EtfAB complex although used effectively is presumably oxygen sensitive, and possibly requires reduced ferredoxin as the electron donor. This difficulty was overcome by expressing trans-2-enoyl-CoA reductase

(Ter) , which is readily expressed in Escherichia coli and directly reduces crotonyl-CoA using NADH . This modified 1-butanol pathway

(Fig. 1) is catalyzed by five enzymes: thiolase (e.g., AtoB) , 3- hydroxybutyryl-CoA dehydrogenase (e.g., Hbd) , crotonase (e.g., Crt) , Ter, and bifunctional aldehyde/alcohol dehydrogenase (e.g., AdhE2) . Simultaneously expressing these enzymes and engineering NADH and acetyl-CoA accumulation as driving forces, 1-butanol production with a high titer of 15 g/L and 88% of theoretical yield has been achieved using E. coli in flasks without product removal. This result demonstrates the feasibility of transferring the CoA- dependent pathway to non-native organisms for high-titer 1-butanol fermentation from glucose, (see also, International Application No. PCT/US08/59291 and PCT/US12/21679, the disclosures of which are incorporated herein in their entirety) .

[ 0029] The success of the CoA-dependent pathway in E. coli was not as effective in photoautotrophs . By expressing the same enzymes in cyanobacteria Synechococcus elongatus PCC 7942, photosynthetic 1- butanol production from C0 ₂ was substantially lower. 1-Butanol production was achieved by this strain when internal carbon storage made by C0 ₂ fixation in light conditions was fermented under anoxic conditions .

[ 0030] This could be due to the fact that Acetyl-CoA is the precursor for fermentation pathway and the TCA cycle, both of which are not active in light conditions. Furthermore, photosynthesis generates NADPH, but not NADH, and the interconversion between the two may not be efficient. Without a significant driving force against the unfavorable thermodynamic gradient, 1-butanol production cannot reach the levels seen in other organisms. The difficulty of direct photosynthetic production of 1-butanol is in sharp contrast to the production of isobutanol (450 mg/L) and isobutyraldehyde (100 mg/L) by S. elongatus PCC 7942, which has an irreversible

decarboxylation step as the first committed reaction to drive the flux toward the products .

[ 0031] Considering the NADH and NADPH flux a metabolic pathway was designed. Instead of using an excess of acetyl-CoA to drive production, the disclosure demonstrates that ATP can be used to drive the thermodynamically unfavorable condensation of two acetyl- coA molecules under photosynthetic conditions. Thus, the disclosure engineers into a microorganism the ATP-driven malonyl-CoA synthesis and decarboxylative carbon chain elongation used in fatty acid synthesis to drive the carbon flux into the formation of

acetoacetyl-CoA, which then undergoes the reverse β-oxidation to synthesize 1-butanol. In addition, to further optimize that synthesis the subsequent NADH-dependent enzymes were replaced with NADPH-dependent enzymes to achieve 1-butanol synthesis under photosynthetic conditions . [ 0032] In theory, the excess ATP consumption in the cell may cause a decrease in biomass. Thus, with notable exceptions, most metabolic engineering designs do not choose to increase ATP consumption. Although many natural examples of microbes using ATP to drive reactions, most of them are highly regulated. Therefore, the results presented herein are unexpected.

[ 0033] In view of the foregoing, the disclosure provides organisms comprising metabolically engineered biosynthetic pathways that utilize an organism's CoA pathway with increased ATP

consumption to drive biofuel production. Biofuel production utilizing the organism's CoA pathway offers several advantages. Not only does it avoid the difficulty of expressing a large set of foreign genes but it also minimizes the possible accumulation of toxic intermediates.

[ 0034] As used herein, the term "metabolically engineered" or

"metabolic engineering" involves rational pathway design and assembly of biosynthetic genes, genes associated with operons, and control elements of such polynucleotides, for the production of a desired metabolite, such as an acetoacetyl-CoA or higher alcohol, in a microorganism. "Metabolically engineered" can further include optimization of metabolic flux by regulation and optimization of transcription, translation, protein stability, reducing agents and protein functionality using genetic engineering and appropriate culture condition including the reduction of, disruption, or knocking out of, a competing metabolic pathway that competes with an intermediate or use of a cofactor or energy source, leading to a desired pathway. A biosynthetic gene can be heterologous to the host microorganism, either by virtue of being foreign to the host, or being modified by mutagenesis, recombination, and/or association with a heterologous expression control sequence in an endogenous host cell. In one embodiment, where the polynucleotide is

xenogenetic to the host organism, the polynucleotide can be codon optimized .

[ 0035] The term "biosynthetic pathway", also referred to as

"metabolic pathway", refers to a set of anabolic or catabolic biochemical reactions for converting (transmuting) one chemical species into another. Gene products belong to the same "metabolic pathway" if they, in parallel or in series, act on the same substrate, produce the same product, or act on or produce a metabolic intermediate (i.e., metabolite) between the same substrate and metabolite end product.

[ 0036] The term "substrate" or "suitable substrate" refers to any substance or compound that is converted or meant to be converted into another compound by the action of an enzyme. The term includes not only a single compound, but also combinations of compounds, such as solutions, mixtures and other materials which contain at least one substrate, or derivatives thereof. Further, the term

"substrate" encompasses not only compounds that provide a carbon source suitable for use as a starting material, such as C0 ₂ , or any biomass derived sugar, but also intermediate and end product metabolites used in a pathway associated with a metabolically engineered microorganism as described herein.

[ 0037 ] The term "1-butanol" or "n-butanol" generally refers to a straight chain isomer with the alcohol functional group at the terminal carbon. The straight chain isomer with the alcohol at an internal carbon is sec-butanol or 2-butanol. The branched isomer with the alcohol at a terminal carbon is isobutanol, and the branched isomer with the alcohol at the internal carbon is tert- butanol .

[ 0038 ] Recombinant microorganisms provided herein can express a plurality of target enzymes involved in pathways for the production of 1-butanol from a suitable carbon substrate.

[ 0039] Accordingly, metabolically "engineered" or "modified" microorganisms are produced via the introduction of genetic material into a host or parental microorganism of choice thereby modifying or altering the cellular physiology and biochemistry of the

microorganism. Through the introduction of genetic material the parental microorganism acquires new properties, e.g. the ability to produce a new, or greater quantities of, a metabolite. In an illustrative embodiment, the introduction of genetic material into a parental microorganism results in a new or modified ability to produce 1-butanol, isobutanol or other desirable alcohols (e.g., 3- methyl-l-butanol, 2-methyl-l-butanol, propanol and others as well as intermediates thereof) . The genetic material introduced into the parental microorganism contains gene (s) , or parts of genes, coding for one or more of the enzymes involved in a biosynthetic pathway for the production of an alcohol or chemical (e.g., 1-butanol) and may also include additional elements for the expression and/or regulation of expression of these genes, e.g. promoter sequences.

[ 0040 ] In general, the recombinant microorganisms comprises at least one recombinant metabolic pathway that comprises a target enzyme and may further include a reduction in activity or reduction in expression of an enzyme in a competitive biosynthetic pathway. The pathway acts to modify a substrate or metabolic intermediate in the production of an alcohol such as 1-butanol. The target enzyme is encoded by, and expressed from, a polynucleotide derived from a suitable biological source. In some embodiments, the polynucleotide comprises a gene derived from a bacterial or yeast source and recombinantly engineered into the microorganism of the disclosure. In one embodiment, the disclosure provides a recombinant

microorganism comprising elevated expression of at least one target enzyme as compared to a parental microorganism or encodes an enzyme not found in the parental organism. For example, in one embodiment, a photoautotrophic or photoheterotrophic organism is engineered to express or overexpress one or more polypeptides that convert acetyl- CoA to Malonyl-CoA and malonyl-CoA to Acetoacetyl-CoA . In a further embodiment, the recombinant microorganism is engineered to express an acetyl-CoA carboxylase. In yet a further embodiment, the microorganism further expresses or overexpresses one or more enzymes that carries out a metabolic function selected from the group consisting of (a) converting acetoacetyl-CoA to (R) -3- hydroxybutyryl-CoA, (b) converting acetoacetyl-CoA to (S)-3- hydroxybutyryl-CoA, (c) converting (R) -3-hydroxybutyryl-CoA to crotonyl-CoA, (d) converting ( S ) -3-hydroxybutyryl-CoA to crotonyl- CoA, (e) converting crotonyl-CoA to butyryl-CoA, ( fi ) converting butyryl-CoA to butyraldehyde and butyraldehyde to 1-butanol, or (f ₂ ) butyrl-CoA to 1-butanol. In one embodiment, the recombinant microorganism comprises an NADPH dependent metabolic pathway that converts (i) acetyl-CoA to malonyl-CoA, (ii) malonyl-CoA to acetoacetyl-CoA, (iii) acetoacetyl-CoA to (R) -3-hydroxybutyryl-CoA,

(iv) (R) -3-hydroxybutyryl-CoA to crotonyl-CoA, (v) crotonyl-CoA to butyryl-CoA, (vi) butyryl-CoA to butyraldehyde , and (vii)

butyraldehyde to 1-butanol. In another embodiment, the recombinant microorganism comprises a NADH dependent metabolic pathway that converts (i) acetyl-CoA to malonyl-CoA, (ii) malonyl-CoA to acetoacetyl-CoA, (iii) acetoacetyl-CoA to (S) -3-hydroxybutyryl-CoA,

(iv) (S) -3-hydroxybutyryl-CoA to crotonyl-CoA, (v) crotonyl-CoA to butyryl-CoA, and (vi) butyryl-CoA to 1-butanol. In yet another embodiment, the recombinant microorganism comprises an NADPH dependent metabolic pathway that converts (i) acetyl-CoA to acetoacetyl-CoA, (ii) acetoacetyl-CoA to (R) -3-hydroxybutyryl-CoA,

(iii) (R) -3-hydroxybutyryl-CoA to crotonyl-CoA, (iv) crotonyl-CoA to butyryl-CoA, (v) butyryl-CoA to butyraldehyde, and (vi)

butyraldehyde to 1-butanol.

[ 0041 ] For example, in one embodiment, a photoautotrophic or photoheterotrophic organism is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase. In yet a further embodiment, the microorganism further expresses or

overexpresses one or more enzymes selected from the group consisting of (a) acetoacetyl-CoA reductase, (b) enoyl-CoA hydratase, (c) crotonyl-CoA reductase, and (d) an alcohol/aldehyde dehydrogenase. In another example, the microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase and further expresses or overexpresses one or more enzymes selected from the group consisting of (a) acetoacetyl-CoA reductase,

(b) enoyl-CoA hydratase, (c) trans-2-enoyl-CoA reductase, and (d) an alcohol/aldehyde dehydrogenase. In another example, the

microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase and further expresses or overexpresses one or more enzymes selected from the group consisting of (a) acetoacetyl-CoA reductase, (b) enoyl-CoA hydratase, (c) trans-2-enoyl-CoA reductase, and (d) butyraldehyde dehydrogenase and 1 , 3-propanediol dehydrogenase.

[ 0042 ] In another embodiment, a photoautotrophic or

photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase. In yet a further embodiment, the microorganism further expresses or overexpresses one or more enzymes selected from the group consisting of (a) hydroxybutyryl CoA dehydrogenase, (b) crotonase, (c) crotonyl-CoA reductase, and (d) an alcohol/aldehyde dehydrogenase. In another example, the microorganism comprises a photoautotrophic or photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an

acetoacetyl-CoA synthase and further expresses or overexpresses one or more enzymes selected from the group consisting of (a)

hydroxybutyryl CoA dehydrogenase, (b) crotonase, (c) trans-2-enoyl- CoA reductase, and (d) an alcohol/aldehyde dehydrogenase. In another example, the microorganism comprises a photoautotrophic or

photoheterotrophic organism that is engineered to express or overexpress an acetyl-CoA carboxylase and an acetoacetyl-CoA synthase and further expresses or overexpresses one or more enzymes selected from the group consisting of (a) hydroxybutyryl CoA dehydrogenase, (b) crotonase, (c) trans-2-enoyl-CoA reductase, and

(d) butyraldehyde dehydrogenase and 1, 3-propanediol dehydrogenase.

[ 0043] Accordingly, a recombinant microorganism provided herein includes the elevated expression of at least one target enzyme such as an enzyme that converts acetyl-CoA to malonyl-CoA, malonyl-CoA to Acetoacetyl-CoA, acetoacetyl-CoA to (R) - or (S) -3-hydroxybutyryl- CoA, (R) - or (S) -3-hydroxybutyryl-CoA to crotonyl-CoA, crotonyl-CoA to butyryl-CoA, butyryl-CoA to butyraldehyde and butyraldehyde to 1- butanol . In other embodiments, a recombinant microorganism can express a plurality of target enzymes involved in pathway to produce n-butanol as depicted in Figure 1. The plurality of enzymes can include one or more subunits of acetyl-coA carboxylase (AccABCD, for example accession number AAC73296 AAN73296, EC 6.4.1.2),

Acetoacetyl-CoA reductase (phaB, e.g., from R. eutropha) (EC

1.1.1.36) that generates 3-hydroxybutyryl-CoA from acetoacetyl-CoA and NADPH, (R) -specific enoyl-CoA hydratase (PhaJ) derived from, for example, Aeromonas caviae and Pseudomonas aeruginosa (Fukui et al . , J. Bacteriol. 180:667, 1998; Tsage et al . , FEMS Microbiol. Lett. 184:193, 2000), butyraldehyde dehydrogenase (Bldh) or alcohol dehydrogenase (AdhE2), Ter, Ccr, or any combination thereof. [ 0044 ] In another or further embodiment, the microorganism comprises a reduction, disruption or knockout of at least one gene encoding an enzyme that competes with a metabolite necessary for the production of a desired higher alcohol product or which produces an unwanted product. For example, the recombinant microorganism may include a disruption, deletion or knockout of expression of an alcohol/acetoaldehyde dehydrogenase that preferentially uses acetyl- coA as a substrate (e.g., adhE gene), as compared to a parental microorganism. Other disruptions, deletions or knockouts can include one or more genes encoding a polypeptide or protein selected from the group consisting of: (i) an enzyme that catalyzes the NADH- dependent conversion of pyruvate to D-lactate (e.g., ldhA) ; (ii) an enzyme that promotes catalysis of fumarate and succinate

interconversion (e.g., frdBC) ; (iii) an oxygen transcription regulator; and (iv) an enzyme that catalyzes the conversion of acetyl-coA to acetyl-phosphate (e.g., pta) . In one embodiment, the microorganism comprises a disruption, deletion or knockout of a combination of an alcohol/acetoaldehyde dehydrogenase and one or more of (i)-(iv) above. Through the reduction, disruption or knocking out of a gene or polynucleotide the microorganism acquires new or improved properties (e.g., the ability to produce a new or greater quantity of an interacellular metabolite, improve the flux of a metabolite down a desired pathway, and/or reduce the production of undesirable by-products) .

[ 0045] Microorganisms provided herein are modified to produce metabolites in quantities not available in the parental

microorganism. A "metabolite" refers to any substance produced by metabolism or a substance necessary for or taking part in a particular metabolic process. A metabolite can be an organic compound that is a starting material (e.g., glucose or pyruvate), an intermediate (e.g., acetyl-coA) in, or an end product (e.g., 1- butanol) , of metabolism. Metabolites can be used to construct more complex molecules, or they can be broken down into simpler ones. Intermediate metabolites may be synthesized from other metabolites, perhaps used to make more complex substances, or broken down into simpler compounds, often with the release of chemical energy. [ 0046] As described above, a recombinant microorganism of the disclosure comprise expression of a heterologous acetyl-CoA

carboxylase or elevated expression of an endogenous acetyl-CoA carboxylase. The acetyl-CoA carboxylase (accABCD, EC 6.4.1.2) comprises an operon of multiple subunits, e.g., accA, accB, accC, accD. Acetyl-CoA carboxylase (Acc) is a multisubunit enzyme encoded by four separate genes, accABCD (accession numbers: accA, accB, accC, and accD, Accessions: NP414727, NP417721, NP417722, NP416819). As used herein, the term "acetyl-CoA carboxylase carboxytransferase" means the enzyme that catalyzes the carboxylation of acetyl-CoA to malonyl-CoA and forms a tetramer composed of two alpha and two beta subunits. One of the subunits corresponds to the acetyl-CoA

carboxylase carboxytransferase subunit alpha, encoded by the accA gene. In one embodiment, the acetyl-CoA carboxylase

carboxytransferase subunit alpha expressed from the expression vector in accordance with the disclosure is derived from E. coli or P. aeruginosa and includes homologs thereof. For example, the acetyl-CoA carboxylase carboxytransferase subunit alpha can have the nucleotide sequence of SEQ ID NO: 1, encoded by the amino acid sequence of SEQ ID NO: 2 and polypeptides having at least 70%, 80%, 90%, 95%, 98%, or 99% identity thereto and having acetyl-CoA carboxylase activity.

[ 0047 ] In yet another embodiment, a recombinant microorganism provided herein includes expression or elevated expression of a crotonyl-CoA reductase as compared to a parental microorganism. The microorganism produces a metabolite that includes butyryl-CoA from a substrate that includes crotonyl-CoA . The crotonyl-CoA reductase can be encoded by a ccr gene, polynucleotide or homolog thereof. The ccr gene or polynucleotide can be derived from the genus

Streptomyces .

[ 0048 ] Crotonyl-coA reductase catalyzes the reduction of crotonyl-CoA to butyryl-CoA. Depending upon the organism used a heterologous Crotonyl-coA reductase can be engineered for expression in the organism. Alternatively, a native Crotonyl-coA reductase can be overexpressed . Crotonyl-coA reductase is encoded in S.coelicolor by ccr. CCR homologs and variants are known. For examples, such homologs and variants include, for example, crotonyl CoA reductase (Streptomyces coelicolor A3 (2) )

gi I 21224777 I ref I NP_630556.1 I (21224777) ; crotonyl CoA reductase (Streptomyces coelicolor A3 (2) ) gi | 4154068 | em | CAA22721.1 | (4154068); crotonyl-CoA reductase (Methylobacterium sp. 4-46)

gi I 168192678 I g I ACA14625.1 I (168192678) ; crotonyl-CoA reductase (Dinoroseobacter shibae DFL 12)

gi I 159045393 I ref I YP_001534187.1 | (159045393) crotonyl-CoA reductase (Salinispora arenicola CNS-205)

gi I 159039522 I ref I YP_001538775.1 | (159039522) crotonyl-CoA reductase (Methylobacterium extorquens PAl)

gi I 163849740 I ref I YP_001637783.1 | (163849740) crotonyl-CoA reductase (Methylobacterium extorquens PAl)

gi I 163661345 I gb I ABY28712.1 I (163661345) ; crotonyl-CoA reductase (Burkholderia ambifaria AMMD)

gi|115360962|ref| YP_778099.1 | (115360962); crotonyl-CoA reductase (Parvibaculum lavamentivorans DS-1)

gi I 154252073 I ref I YP_001412897.1 I (154252073); Crotonyl-CoA reductase (Silicibacter sp. TM1040) gi | 99078082 | ref | YP_611340.1 | ( 99078082 ) ; crotonyl-CoA reductase (Xanthobacter autotrophicus Py2)

gi I 154245143 I ref I YP_001416101.1 I (154245143); crotonyl-CoA reductase (Nocardioides sp. JS614) gi | 119716029 | ref | YP_922994.1 | (119716029) ; crotonyl-CoA reductase (Nocardioides sp. JS614)

gi I 119536690 I gb I ABL81307.1 I (119536690) ; crotonyl-CoA reductase (Salinispora arenicola CNS-205)

gi I 157918357 | gb | ABV99784.1 | (157918357) crotonyl-CoA reductase (Dinoroseobacter shibae DFL 12)

gi I 157913153 I gb | ABV94586.1 | (157913153) crotonyl-CoA reductase (Burkholderia ambifaria AMMD)

gi |115286290|gb I ABI91765.1| (115286290) crotonyl-CoA reductase (Xanthobacter autotrophicus Py2)

gi|154159228| gb | ABS66444.1 | (154159228) crotonyl-CoA reductase (Parvibaculum lavamentivorans DS-1)

gi |1541560231 gb | ABS 63240.1 | (154156023) crotonyl-CoA reductase (Methylobacterium radiotolerans JCM 2831)

gi I 170654059 I gb I ACB23114.1 I (170654059) ; crotonyl-CoA reductase (Burkholderia graminis C4D1M)

gi I 170140183 I gb I EDT08361.1 I (170140183) ; crotonyl-CoA reductase (Methylobacterium sp. 4-46) gi | 168198006 | gb | ACA19953.1 | ( 168198006 ) ; crotonyl-CoA reductase (Frankia sp . EANlpec)

gi 158315836 ref YP_001508344.1 (158315836) , each sequence

associated with the accession number is incorporated herein by reference in its entirety. For example, the disclosure provides the polypeptide sequences of a number of ccr polypeptides of the disclosure (e.g., see SEQ ID Nos : 4, 6, 8, 10, 12, 14, or 16). In addition, the disclosure includes modified ccr polypeptides and homologs thereof having at least 90%, 95%, 98%, or 99% identity to SEQ ID NO:4, 6, 8, 10, 12, 14, or 16 and having crotonyl-CoA reductase activity.

[ 0049] In one aspect, any of the microorganisms of the

disclosure can comprise one or more heterologous nucleic acid(s) encoding an acetoacetyl-CoA synthase polypeptide. The acetoacetyl- CoA synthase enzyme can be encoded by a gene nphT7. NphT7 is a gene encoding an enzyme having the activity of synthesizing acetoacetyl- CoA from malonyl-CoA and acetyl-CoA and having minimal to no activity synthesizing acetoacetyl-CoA from two acetyl-CoA molecules. An acetoacetyl-CoA synthase gene from an actinomycete of the genus Streptomyces CL190 strain is described in U.S. Patent Application Publication No. 2010/0285549, the disclosure of each of which is incorporated by reference herein. Acetoacetyl-CoA synthase can also be referred to as acetyl CoA:malonyl CoA acyltransferase . A

representative acetoacetyl-CoA synthase (or acetyl CoA:malonyl CoA acyltransferase) that can be used is Genbank AB540131.1.

[ 0050 ] In one aspect, acetoacetyl-CoA synthase of the disclosure synthesizes acetoacetyl-CoA from malonyl-CoA and acetyl-CoA via an irreversible reaction. The use of acetoacetyl-CoA synthase to generate acetyl-CoA provides an additional advantage in that this reaction is irreversible while acetoacetyl-CoA thiolase enzyme's action of synthesizing acetoacetyl-CoA from two acetyl-CoA molecules is reversible. Consequently, the use of acetoacetyl-CoA synthase to synthesize acetoacetyl-CoA from malonyl-CoA and acetyl-CoA drives the reaction and production of biofuels and chemicals that use acetoacetyl-CoA as a metabolite forward (e.g., the production of 1- butanol) . [ 0051] An example of such an acetoacetyl-CoA synthase is set forth in SEQ ID NO: 18. Such a protein having the amino acid sequence of SEQ ID NO: 18 corresponds to an acetoacetyl-CoA synthase capable of producing acetoacetyl-CoA from malonyl-CoA and acetyl-CoA and having little or no activity of synthesizing acetoacetyl-CoA from two acetyl-CoA molecules. In one embodiment, the polynucleotide encoding a polypeptide having the amino acid sequence of SEQ ID NO: 18 can be obtained by a nucleic acid amplification method (e.g., PCR) with the use of genomic DNA obtained from an actinomycete of the Streptomyces sp . CL190 strain. As described herein, an acetoacetyl-CoA synthase is not limited to a polypeptide having the amino acid sequence of SEQ ID NO: 18 from an actinomycete of the Streptomyces sp . CL190 strain. Any polypeptide having the ability to synthesize acetoacetyl-CoA from malonyl-CoA and acetyl-CoA and which does not synthesize acetoacetyl-CoA from two acetyl-CoA molecules can be used in the presently described methods. In certain

embodiments, the acetoacetyl-CoA synthase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 18 and having the function of synthesizing

acetoacetyl-CoA from malonyl-CoA and acetyl-CoA. For example, the disclosure includes polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 18 and having acetoacetyl- CoA synthase activity. In other embodiments, the acetoacetyl-CoA synthase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 18 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having the function of synthesizing acetoacetyl-CoA from malonyl-CoA and acetyl-CoA .

[ 0052] The recombinant microorganism produces a metabolite that includes a 3-hydroxybutyryl-CoA from a substrate that includes acetoacetyl-CoA . The hydroxybutyryl CoA dehydrogenase can be encoded by an hbd gene or homolog thereof. The hbd gene can be derived from various microorganisms including Clostridium

acetobutylicum, Clostridium difficile, Dastricha ruminatium, Butyrivibrio fibrisolvens , Treponema phagedemes , Acidaminococcus fermentans , Clostridium kluyveri , Syntrophospora bryanti, and

Thermoanaerobacteri urn thermosaccharolyticum .

[ 0053] 3 hydroxy-butyryl-coA-dehydrogenase catalyzes the conversion of acetoacetyl-coA to 3-hydroxybutyryl-CoA. Depending upon the organism used a heterologous 3-hydroxy-butyryl-coA- dehydrogenase can be engineered for expression in the organism.

Alternatively a native 3-hydroxy-butyryl-coA-dehydrogenase can be overexpressed . 3-hydroxy-butyryl-coA-dehydrogenase is encoded in C. acetobuylicum by hbd. HBD homologs and variants are known. For examples, such homologs and variants include, for example, 3- hydroxybutyryl-CoA dehydrogenase {Clostridium acetobutylicum ATCC 824) gi I 15895965 I ref |NP_349314.1 I (15895965); 3-hydroxybutyryl-CoA dehydrogenase (Bordetella pertussis Tohama I)

gi I 33571103 | emb | CAE40597.1 | (33571103) ; 3-hydroxybutyryl-CoA dehydrogenase (Streptomyces coelicolor A3 (2))

gi I 21223745 I ref |NP_629524.1 I (21223745); 3-hydroxybutyryl-CoA dehydrogenase gi | 1055222 | gb | AAA95971.1 | (1055222); 3-hydroxybutyryl- CoA dehydrogenase (Clostridium perfringens str. 13)

gi I 18311280 I ref |NP_563214.1 I (18311280); 3-hydroxybutyryl-CoA dehydrogenase (Clostridium perfringens str. 13)

gi I 18145963 I dbj I BAB82004.1 I (18145963) each sequence associated with the accession number is incorporated herein by reference in its entirety. SEQ ID NO:20 sets forth an exemplary hbd polypeptide sequence. In certain embodiments, the 3 hydroxy-butyryl-coA- dehydrogenase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 20 and having 3 hydroxy-butyryl-coA-dehydrogenase activity. For example, the disclosure includes polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 20 and having 3 hydroxy- butyryl-coA-dehydrogenase . In other embodiments, the 3 hydroxy- butyryl-coA-dehydrogenase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 20 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having 3 hydroxy-butyryl-coA-dehydrogenase activity.

[ 0054 ] Crotonase catalyzes the conversion of 3-hydroxybutyryl-

CoA to crotonyl-CoA . Depending upon the organism used a

heterologous Crotonase can be engineered for expression in the organism. Alternatively a native Crotonase can be overexpressed . Crotonase is encoded in C. acetobuylicum by crt . CRT homologs and variants are known. For examples, such homologs and variants include, for example, crotonase (butyrate-producing bacterium L2-50) gi I 119370267 I gb I ABL68062.1 I (119370267); crotonase

gi I 1055218 I gb I AAA95967.1 I (1055218) ; crotonase [Clostridium

perfringens NCTC 8239) gi | 168218170 | ref | ZP_02643795.1 | (168218170) ; crotonase (Clostridium perfringens CPE str. F4969)

gi I 168215036 I ref I ZP_02640661.1 I (168215036); crotonase (Clostridium perfringens E str. JGS1987)

gi I 168207716 I ref I ZP_02633721.1 I (168207716) ; crotonase (Azoarcus sp. EbNl) gi I 56476648 I ref I YP_158237.1 I (56476648) ; crotonase (Roseovarius sp. TM1035) gi I 149203066 I ref I ZP_01880037.1 I (149203066) ; crotonase

(Roseovarius sp. TM1035) gi | 149143612 | gb | EDM31648.1 | (149143612) ; crotonase; 3-hydroxbutyryl-CoA dehydratase (Mesorhizobium loti MAFF303099) gi | 14027492 | dbj | BAB53761.1 | (14027492) ; crotonase

(Roseobacter sp. SK209-2-6) gi | 126738922 | ref | ZP_01754618.1 |

(126738922); crotonase (Roseobacter sp. SK209-2-6)

gi I 126720103 I gb I EBA16810.1 I (126720103) ; crotonase (Marinobacter sp. ELB17) gi I 126665001 I ref I ZP_01735984.1 I (126665001) ; crotonase

(Marinobacter sp. ELB17) gi | 126630371 | gb | EBA00986.1 | (126630371) ; crotonase (Azoarcus sp. EbNl) gi | 56312691 | emb | CAI07336.1 | (56312691) ; crotonase (Marinomonas sp. MED121) gi | 86166463 | gb | EAQ67729.1 |

(86166463) ; crotonase (Marinomonas sp. MED121)

gi I 87118829 I ref I ZP_01074728.1 I (87118829) ; crotonase (Roseovarius sp. 217) gi I 85705898 I ref I ZP_01036994.1 I (85705898) ; crotonase

(Roseovarius sp. 217) gi | 85669486 | gb | EAQ24351.1 | (85669486) ;

crotonase gi | 1055218 | gb | AAA95967.1 | (1055218); 3-hydroxybutyryl-CoA dehydratase (Crotonase) gi | 1706153 | sp | P52046.1 | CRT_CLOAB (1706153) ; Crotonase (3-hydroxybutyryl-COA dehydratase) (Clostridium

acetobutylicum ATCC 824) gi | 15025745 | gb | AAK80658.1 | AE007768_12

(15025745) each sequence associated with the accession number is incorporated herein by reference in its entirety. SEQ ID NO: 22 sets forth an exemplary crt polypeptide sequence. In certain

embodiments, the crotonase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 22 and having crotonase activity. For example, the disclosure includes polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 22 and having crotonase. In other embodiments, the crotonase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 22 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having crotonase activity.

[ 0055] In one embodiment, the microorganism comprises a heterologous trans-2-enoyl-CoA reductase (ter) . Trans-2-enoyl-CoA reductase or TER is a protein that is capable of catalyzing the conversion of crotonyl-CoA to butyryl-CoA. In certain embodiments, the recombinant microorganism expresses a TER which catalyzes the same reaction as Bcd/EtfA/EtfB from Clostridia and other bacterial species. Mitochondrial TER from E. gracilis has been described, and many TER proteins and proteins with TER activity derived from a number of species have been identified forming a TER protein family

(U.S. Pat. Appl. 2007/0022497 to Cirpus et al . ; Hoffmeister et al . , J. Biol. Chem., 280:4329-4338, 2005, both of which are incorporated herein by reference in their entirety) . Trans-2-enoyl-CoA reductase is encoded in T. denticola F. succinogens, T. vincentii or F.

johnsoniae ter gene. In T. denticoloa TER has the accession number Q73Q47. In one embodiment the F. succinogens TER comprises the sequence set forth in SEQ ID NO: 23, 24, 25 or 26 and has a MetllLys mutation. In addition, TER proteins can also be identified by generally well known bioinformatics methods, such as BLAST. A truncated cDNA of the E. gracilis gene has been functionally expressed in E. coli. This cDNA or the genes of homologues from other microorganisms can be expressed together with the n-butanol pathway genes described herein to produce n-butanol in E. coli, S. cerevisiae or other hosts. [ 0056] TER proteins can also be identified by generally well known bioinformatics methods, such as BLAST. Examples of TER proteins include, but are not limited to, TERs from species such as: Euglena spp. including, but not limited to, E. gracilis, Aeromonas spp. including, but not limited, to A. hydrophila, Psychromonas spp. including, but not limited to, P. ingrahamii, Photobacterium spp. including, but not limited, to P. profundum, Vibrio spp. including, but not limited, to V angustum, V. cholerae, V alginolyticus, V parahaemolyticus , V vulnificus , V fischeri , V splendidus , Shewanella spp. including, but not limited to, S. amazonensis, S. woodyi _r S. frigidimarina , S. paeleana , S. baltica, S. denitrificans,

Oceanospirillum spp. , Xanthomonas spp. including, but not limited to, X oryzae, X campestris , Chromohalobacter spp. including, but not limited, to C. salexigens , Idiomarina spp. including, but not limited, to I. baltica, Pseudoalteromonas spp. including, but not limited to, P. atlantica, Alteromonas spp., Saccharophagus spp.

including, but not limited to, S. degradans , S. marine gamma proteobacterium, S. alpha proteobacterium, Pseudomonas spp.

including, but not limited to, P. aeruginosa, P. putida, P.

fluorescens , Burkholderia spp. including, but not limited to, B. phytofirmans , B. cenocepacia, B. cepacia, B. ambifaria, B.

vietnamensis , B. multivorans, B. dolosa, Methylbacillus spp.

including, but not limited to, M. flageliatus, Stenotrophomonas spp. including, but not limited to, S. maltophilia , Congregibacter spp. including, but not limited to, C. litoralis, Serratia spp.

including, but not limited to, S. proteamaculans , Marinomonas spp. , Xytella spp. including, but not limited to, X fastidiosa, Reinekea spp. , Colweffia spp. including, but not limited to, C.

psychrerythraea , Yersinia spp. including, but not limited to, Y. pestis , Y. pseudotuberculosis, Methylobacillus spp. including, but not limited to, M. flageliatus , Cytophaga spp. including, but not limited to, C. hutchinsonii , Flavobacterium spp. including, but not limited to, F. j ohnsoniae, Microscilla spp. including, but not limited to, M marina, Polaribacter spp. including, but not limited to, P. irgensii, Clostridium spp. including, but not limited to, C. acetobutylicum, C. beijerenckii , C. cellulolyticum, Coxiella spp. including, but not limited to, C. burnetii. In a further embodiment, the ter is derived from a Treponema denticola or F. succinogenes . In yet another embodiment, the ter is a mutant ter comprising an M11K substitution in SEQ ID NO: 23, 24, 25 or 26. SEQ ID NO: 23, 24, 25 or 26 sets forth an exemplary Ter polypeptide sequence. In certain embodiments, the trans-2-enoyl-CoA reductase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 23, 24, 25 or 26 and having trans-2-enoyl-CoA reductase activity. For example, the disclosure includes

polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 23, 24, 26, or 26 and having trans-2-enoyl-CoA reductase. In other embodiments, the trans-2-enoyl-CoA reductase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 23, 24, 25, or 26 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having trans- 2-enoyl-CoA reductase activity.

[ 0057 ] The phaJ gene encodes an enzyme the converts (R) -3- hydroxybutyryl-CoA to crotonyl-CoA . In some embodiments, the enoyl- CoA hydratase gene is an Aeromonas caviae enoyl-CoA hydratase gene or a Pseudomonas aeruginosa enoyl-CoA hydratase gene. In some embodiments, the Pseudomonas aeruginosa enoyl-CoA hydratase gene is a Pseudomonas aeruginosa phaJl gene (gene PA3302) or a Pseudomonas aeruginosa phaJ2 gene (gene PA1018) . The phaJ gene can be derived from a number of microorganisms including, but not limited to, Aeromonas caviae. In certain embodiments, the enoyl-CoA hydratase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 28 and having enoyl-CoA hydratase activity. For example, the disclosure includes

polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 28 and having enoyl-CoA hydratase activity. In other embodiments, the enoyl-CoA hydratase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 28 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having enoyl-CoA hydratase activity.

[ 0058 ] Acetoacetyl-CoA reductase (R. eutropha phaB) (EC

1.1.1.36) generates 3-hydroxybutyryl-CoA from acetoacetyl-CoA and NADPH. In certain embodiments, the Acetoacetyl-CoA reductase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 30 and having Acetoacetyl-CoA reductase activity. For example, the disclosure includes

polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 30 and having Acetoacetyl-CoA reductase activity. In other embodiments, the Acetoacetyl-CoA reductase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 30 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having Acetoacetyl-CoA reductase activity.

[ 0059] E. coli contains a native gene (yqhD) that was identified as a 1 , 3-propanediol dehydrogenase (U.S. Pat. No. 6,514,733). The yqhD gene, given as SEQ ID NO: 31, has 40% identity to the gene adhB in Clostridium, a probable NADH-dependent butanol dehydrogenase . In certain embodiments, the 1 , 3-propanediol dehydrogenase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 32 and having 1 , 3-propanediol

dehydrogenase activity. For example, the disclosure includes polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 32 and having 1 , 3-propanediol dehydrogenase activity. In other embodiments, the 1 , 3-propanediol dehydrogenase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO:32 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having 1 , 3-propanediol dehydrogenase activity. [ 0060 ] Butyraldehyde dehydrogenase (Bldh) generates

butyraldehyde from butyryl-CoA and NADPH. In certain embodiments, the Butyraldehyde dehydrogenase can have an amino acid sequence that is substantially identical to the amino acid sequence of SEQ ID NO: 34 and having Butyraldehyde dehydrogenase activity. For example, the disclosure includes polypeptides having at least about 80% identity, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, and at least about 99% identity to SEQ ID NO: 34 and having Butyraldehyde dehydrogenase activity. In other embodiments, the Butyraldehyde dehydrogenase can have an amino acid sequence derived from the amino acid sequence of SEQ ID NO: 34 by substitution, deletion, addition, or insertion of 1 or more amino acid(s) (e.g., 1-10) and having Butyraldehyde dehydrogenase activity.

[ 0061 ] In yet another embodiment, a recombinant microorganism provided herein includes expression or elevated expression of an alcohol dehydrogenase (ADHE2) as compared to a parental

microorganism. The recombinant microorganism produces a metabolite that includes butanol from a substrate that includes butyryl-CoA. The alcohol dehydrogenase can be encoded by bdhA/bdhB polynucleotide or homolog thereof, an aad gene, polynucleotide or homolog thereof, or an adhE2 gene, polynucleotide or homolog thereof. The aad gene or adhE2 gene or polynucleotide can be derived from Clostridium acetobutylicum . Aldehyde/alcohol dehydrogenase catalyzes the conversion of butyryl-CoA to butyraldehyde and butyraldehyde to 1- butanol . In one embodiment, the aldehyde/alcohol dehydrogenase preferentially catalyzes the conversion of butyryl-CoA to

butyraldehyde and butyraldehyde to 1-butanol. Depending upon the organism used a heterologous aldehyde/alcohol dehydrogenase can be engineered for expression in the organism. Alternatively, a native aldehyde/alcohol dehydrogenase can be overexpressed .

aldehyde/alcohol dehydrogenase is encoded in C. acetobuylicum by adhE (e.g., an adhE2) . ADHE (e.g., ADHE2) homologs and variants are known. For examples, such homologs and variants include, for example, aldehyde-alcohol dehydrogenase {Clostridium acetobutylicum) gi I 3790107 I gb I AAD04638.1 I (3790107); aldehyde-alcohol dehydrogenase (Clostridium botulinum A str. ATCC 3502)

gi I 148378348 I ref I YP_001252889.1 I (148378348); Aldehyde-alcohol dehydrogenase (Includes: Alcohol dehydrogenase (ADH) Acetaldehyde dehydrogenase (acetylating) (ACDH)

gi I 19858620 | sp | P33744.3 | ADHE_CLOAB (19858620) ; Aldehyde dehydrogenase (NAD+) (Clostridium acetobutylicum ATCC 824)

gi I 15004865 I ref I NP_149325.1 I (15004865) ; alcohol dehydrogenase E (Clostridium acetobutylicum) gi | 298083 | emb | CAA51344.1 | (298083) ;

Aldehyde dehydrogenase (NAD+) (Clostridium acetobutylicum ATCC 824) gi I 14994477 | gb | AAK76907.1 | AE001438_160 (14994477) ; aldehyde/alcohol dehydrogenase (Clostridium acetobutylicum)

gi I 12958626 | gb | AAK09379.1 | AF321779_1 (12958626); Aldehyde-alcohol dehydrogenase, ADHE1 (Clostridium acetobutylicum ATCC 824)

gi I 15004739 I ref |NP_149199.1 I (15004739); Aldehyde-alcohol

dehydrogenase, ADHE1 (Clostridium acetobutylicum ATCC 824)

gi I 14994351 | gb | AAK76781.1 | AE001438_34 (14994351) ; aldehyde-alcohol dehydrogenase E (Clostridium perfringens str. 13)

gi I 18311513 I ref |NP_563447.1 I (18311513); aldehyde-alcohol

dehydrogenase E (Clostridium perfringens str. 13)

gi I 18146197 I dbj I BAB82237.1 I (18146197) , each sequence associated with the accession number is incorporated herein by reference in its entirety .

[ 0062 ] In another embodiment, microorganisms are described that are capable of metabolizing a carbon source for producing n-butanol at a yield of at least 4% of theoretical, and, in some cases, a yield of over 50% of theoretical. As used herein, the term "yield" refers to the molar yield. For example, the yield equals 100% when one mole of glucose is converted to one mole of n-butanol. In particular, the term "yield" is defined as the mole of product obtained per mole of carbon source monomer and may be expressed as percent. Unless otherwise noted, yield is expressed as a percentage of the theoretical yield. "Theoretical yield" is defined as the maximum moles of product that can be generated per a given mole of substrate as dictated by the stoichiometry of the metabolic pathway used to make the product. In one embodiment, the yield is at least 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11% or more. In another example, the yield of a recombinant microorganism can be from 5% to 90%. [ 0063] In another embodiment, a culture comprises a population microorganism that is substantially homogenous (e.g., from about 70- 100% homogenous) . In another embodiment, a culture can comprise a combination of microorganism each having distinct biosynthetic pathways that produced metabolites that can be used by at least one other microorganism in culture leading to the production of n- butanol .

[ 0064 ] The disclosure provides accession numbers for various genes, homologs and variants useful in the generation of recombinant microorganism described herein. It is to be understood that homologs and variants described herein are exemplary and non- limiting. Additional homologs, variants and sequences are available to those of skill in the art using various databases including, for example, the National Center for Biotechnology Information (NCBI) access to which is available on the World-Wide-Web. Furthermore, the disclosure demonstrates that by reducing oxidation of NADH by competitive pathways, effective n-butanol production and/or coupling NADH utilization more closely to the n-butanol production pathway described herein provides an increase in n-butanol production.

Identifying competing (oxidative) pathways in various organism is within the skill in the art and various enzymes in such pathways can be reduced by knocking out the polynucleotide encoding such enzyme or reducing expression. Accordingly, exemplary genes and sequences are provided herein, however, one will recognize the ability to identify homologs in various species as well as enzymes having similar synthetic or catabolic activity based on the teachings herein .

[ 0065] In yet another embodiment, the microorganism comprises expression or over expression or one or more or all of the following AccABCD, npHT7, phaB, PhaJ, Ter or Ccr, Bldh, and/or yqhD . In yet other embodiments, the microorganism comprises one or more knockouts selected from the group consisting of frdBc, ldhA, adhE and pta .

[ 0066] The disclosure identifies genes useful in the methods, compositions and organisms of the disclosure; however it will be recognized that absolute identity to such genes is not necessary. For example, changes in a particular gene or polynucleotide comprising a sequence encoding a polypeptide or enzyme can be performed and screened for activity. Typically such changes comprise conservative mutation and silent mutations. Such modified or mutated polynucleotides and polypeptides can be screened for expression of a functional enzyme activity using methods known in the art .

[ 0067 ] Due to the inherent degeneracy of the genetic code, other polynucleotides which encode substantially the same or a

functionally equivalent polypeptide can also be used to clone and express the polynucleotides encoding such enzymes.

[ 0068 ] As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Codons can be substituted to reflect the preferred codon usage of the host, a process

sometimes called "codon optimization" or "controlling for species codon bias . "

[ 0069] Optimized coding sequences containing codons preferred by a particular prokaryotic or eukaryotic host (see also, Murray et al .

(1989) Nucl . Acids Res. 17:477-508) can be prepared, for example, to increase the rate of translation or to produce recombinant RNA transcripts having desirable properties, such as a longer half-life, as compared with transcripts produced from a non-optimized sequence. Translation stop codons can also be modified to reflect host preference. For example, typical stop codons for S. cerevisiae and mammals are UAA and UGA, respectively. The typical stop codon for monocotyledonous plants is UGA, whereas insects and E. coli commonly use UAA as the stop codon (Dalphin et al . (1996) Nucl. Acids Res. 24: 216-218) . Methodology for optimizing a nucleotide sequence for expression in a plant is provided, for example, in U.S. Pat. No. 6,015,891, and the references cited therein.

[ 0070 ] Those of skill in the art will recognize that, due to the degenerate nature of the genetic code, a variety of DNA compounds differing in their nucleotide sequences can be used to encode a given enzyme of the disclosure. The native DNA sequence encoding the biosynthetic enzymes described above are referenced herein merely to illustrate an embodiment of the disclosure, and the disclosure includes DNA compounds of any sequence that encode the amino acid sequences of the polypeptides and proteins of the enzymes utilized in the methods of the disclosure. In similar fashion, a polypeptide can typically tolerate one or more amino acid

substitutions, deletions, and insertions in its amino acid sequence without loss or significant loss of a desired activity. The disclosure includes such polypeptides with different amino acid sequences than the specific proteins described herein so long as they modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. Furthermore, the amino acid sequences encoded by the DNA sequences shown herein merely illustrate embodiments of the disclosure.

[ 0071] In addition, homologs of enzymes useful for generating metabolites are encompassed by the microorganisms and methods provided herein. The term "homologs" used with respect to an original enzyme or gene of a first family or species refers to distinct enzymes or genes of a second family or species which are determined by functional, structural or genomic analyses to be an enzyme or gene of the second family or species which corresponds to the original enzyme or gene of the first family or species. Most often, homologs will have functional, structural or genomic similarities. Techniques are known by which homologs of an enzyme or gene can readily be cloned using genetic probes and PCR. Identity of cloned sequences as homolog can be confirmed using functional assays and/or by genomic mapping of the genes.

[ 0072] A protein has "homology" or is "homologous" to a second protein if the nucleic acid sequence that encodes the protein has a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has homology to a second protein if the two proteins have "similar" amino acid sequences. (Thus, the term "homologous proteins" is defined to mean that the two proteins have similar amino acid sequences) .

[ 0073] As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences have at least about 30%, 40%, 50% 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity. To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes) . In one embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, typically at least 40%, more typically at least 50%, even more typically at least 60%, and even more typically at least 70%, 80%, 90%, 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid

"homology") . The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

[ 0074 ] When "homologous" is used in reference to proteins or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions. A "conservative amino acid substitution" is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity) . In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art (see, e.g., Pearson et al . , 1994, hereby incorporated herein by

reference) . [ 0075] A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) . The following six groups each contain amino acids that are conservative substitutions for one another: 1) Serine (S) , Threonine (T) ; 2) Aspartic Acid (D) ,

Glutamic Acid (E) ; 3) Asparagine (N) , Glutamine (Q) ; 4) Arginine

(R) , Lysine (K) ; 5) Isoleucine (I) , Leucine (L) , Methionine (M) , Alanine (A) , Valine (V) , and 6) Phenylalanine (F) , Tyrosine (Y) , Tryptophan (W) .

[ 0076] Sequence homology for polypeptides, which can also be referred to as percent sequence identity, is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG) , University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wis. 53705. Protein analysis software matches similar sequences using measure of homology assigned to various substitutions, deletions and other modifications, including conservative amino acid

substitutions. For instance, GCG contains programs such as "Gap" and "Bestfit" which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild type protein and a mutein thereof. See, e.g., GCG Version 6.1.

[ 0077 ] A typical algorithm used comparing a molecule sequence to a database containing a large number of sequences from different organisms is the computer program BLAST (Altschul, 1990; Gish, 1993; Madden, 1996; Altschul, 1997; Zhang, 1997), especially blastp or tblastn (Altschul, 1997) . Typical parameters for BLASTp are: Expectation value: 10 (default); Filter: seg (default); Cost to open a gap: 11 (default); Cost to extend a gap: 1 (default); Max.

alignments: 100 (default); Word size: 11 (default); No. of

descriptions: 100 (default); Penalty Matrix: BLOWSUM62.

[ 0078 ] When searching a database containing sequences from a large number of different organisms, it is typical to compare amino acid sequences. Database searching using amino acid sequences can be measured by algorithms other than blastp known in the art. For instance, polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences (Pearson, 1990, hereby incorporated herein by reference) . For example, percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix) , as provided in GCG Version 6.1, hereby incorporated herein by

reference .

[ 0079] It is understood that a range of microorganisms can be modified to include a recombinant metabolic pathway suitable for the production of e.g., 1-propanol, isobutanol, 1-butanol, 2-methyl 1- butanol, 3-methyl 1-butanol or 2-phenylethanol . It is also understood that various microorganisms can act as "sources" for genetic material encoding target enzymes suitable for use in a recombinant microorganism provided herein. The term "microorganism" includes prokaryotic and eukaryotic photosynthetic microbial species. The terms "microbial cells" and "microbes" are used interchangeably with the term microorganism.

[ 0080 ] "Bacteria", or "eubacteria" , refers to a domain of prokaryotic organisms. Bacteria include at least 11 distinct groups as follows: (1) Gram-positive (gram+) bacteria, of which there are two major subdivisions: (1) high G+C group (Actinomycetes ,

Mycobacteria, Micrococcus, others) (2) low G+C group (Bacillus, Clostridia, Lactobacillus, Staphylococci, Streptococci,

Mycoplasmas); (2) Proteobacteria, e.g., Purple photosynthetic +non- photosynthetic Gram-negative bacteria (includes most "common" Gram- negative bacteria); (3) Cyanobacteria, e.g., oxygenic phototrophs;

(4) Spirochetes and related species; (5) Planctomyces ; (6) Bacteroides, Flavobacteria; (7) Chlamydia; (8) Green sulfur bacteria; (9) Green non-sulfur bacteria (also anaerobic

phototrophs) ; (10) Radioresistant micrococci and relatives; (11) Thermotoga and Thermosipho thermophiles .

[ 0081 ] "Gram-negative bacteria" include cocci, nonenteric rods, and enteric rods. The genera of Gram-negative bacteria include, for example, Neisseria, Spirillum, Pasteurella, Brucella, Yersinia, Francisella, Haemophilus, Bordetella, Escherichia, Salmonella, Shigella, Klebsiella, Proteus, Vibrio, Pseudomonas, Bacteroides, Acetobacter, Aerobacter, Agrobacterium, Azotobacter, Spirilla, Serratia, Vibrio, Rhizobium, Chlamydia, Rickettsia, Treponema, and Fusobacterium .

[ 0082 ] "Gram positive bacteria" include cocci, nonsporulating rods, and sporulating rods. The genera of gram positive bacteria include, for example, Actinomyces, Bacillus, Clostridium,

Corynebacterium, Erysipelothrix, Lactobacillus, Listeria,

Mycobacterium, Myxococcus, Nocardia, Staphylococcus, Streptococcus, and Streptomyces .

[ 0083] Photoautotrophic bacteria are typically Gram-negative rods which obtain their energy from sunlight through the processes of photosynthesis. In this process, sunlight energy is used in the synthesis of carbohydrates, which in recombinant photoautotrophs can be further used as intermediates in the synthesis of biofuels. In other embodiment, the photoautotrophs serve as a source of

carbohydrates for use by non-photosynthetic microorganism (e.g., recombinant E.coli) to produce biofuels by a metabolically

engineered microorganism. Certain photoautotrophs called anoxygenic photoautotrophs grow only under anaerobic conditions and neither use water as a source of hydrogen nor produce oxygen from

photosynthesis. Other photoautotrophic bacteria are oxygenic photoautotrophs. These bacteria are typically cyanobacteria . They use chlorophyll pigments and photosynthesis in photosynthetic processes resembling those in algae and complex plants. During the process, they use water as a source of hydrogen and produce oxygen as a product of photosynthesis.

[ 0084 ] Cyanobacteria include various types of bacterial rods and cocci, as well as certain filamentous forms. The cells contain thylakoids, which are cytoplasmic, platelike membranes containing chlorophyll. The organisms produce heterocysts, which are

specialized cells believed to function in the fixation of nitrogen compounds .

[ 0085] The term "recombinant microorganism" and "recombinant host cell" are used interchangeably herein and refer to

microorganisms that have been genetically modified to express or over-express endogenous nucleic acid sequences, or to express non- endogenous sequences, such as those included in a vector. The nucleic acid sequence generally encodes a target enzyme involved in a metabolic pathway for producing a desired metabolite as described above. Accordingly, recombinant microorganisms described herein have been genetically engineered to express or over-express target enzymes not previously expressed or over-expressed by a parental microorganism. It is understood that the terms "recombinant microorganism" and "recombinant host cell" refer not only to the particular recombinant microorganism but to the progeny or potential progeny of such a microorganism.

[ 0086] A "parental microorganism" refers to a cell used to generate a recombinant microorganism. The term "parental

microorganism" describes a cell that occurs in nature, i.e. a "wild- type" cell that has not been genetically modified. The term

"parental microorganism" also describes a cell that has been genetically modified but which does not express or over-express a target enzyme e.g., an enzyme involved in the biosynthetic pathway for the production of a desired metabolite such as 1-propanol, isobutanol, 1-butanol, 2-methyl 1-butanol, 3-methyl 1-butanol or 2- phenylethanol . For example, a wild-type microorganism can be genetically modified to express or over express a first target enzyme such as thiolase . This microorganism can act as a parental microorganism in the generation of a microorganism modified to express or over-express a second target enzyme e.g., hydroxybutyryl CoA dehydrogenase. In turn, the microorganism modified to express or over express e.g., thiolase and hydroxybutyryl CoA dehydrogenase can be modified to express or over express a third target enzyme e.g., crotonase . Accordingly, a parental microorganism functions as a reference cell for successive genetic modification events. Each modification event can be accomplished by introducing a nucleic acid molecule in to the reference cell. The introduction facilitates the expression or over-expression of a target enzyme. It is understood that the term "facilitates" encompasses the activation of endogenous nucleic acid sequences encoding a target enzyme through genetic modification of e.g., a promoter sequence in a parental

microorganism. It is further understood that the term "facilitates" encompasses the introduction of exogenous nucleic acid sequences encoding a target enzyme in to a parental microorganism.

[ 0087 ] In another embodiment a method of producing a recombinant microorganism that converts a suitable carbon substrate to e.g., 1- propanol, isobutanol, 1-butanol, 2-methyl 1-butanol, 3-methyl 1- butanol or 2-phenylethanol is provided. The method includes transforming a microorganism with one or more recombinant nucleic acid sequences as described above and elsewhere herein. Nucleic acid sequences that encode enzymes useful for generating metabolites including homologs, variants, fragments, related fusion proteins, or functional equivalents thereof, are used in recombinant nucleic acid molecules that direct the expression of such polypeptides in appropriate host cells, such as bacterial or yeast cells. It is understood that the addition of sequences which do not alter the encoded activity of a nucleic acid molecule, such as the addition of a non-functional or non-coding sequence, is a conservative variation of the basic nucleic acid. The "activity" of an enzyme is a measure of its ability to catalyze a reaction resulting in a metabolite, i.e., to "function", and may be expressed as the rate at which the metabolite of the reaction is produced. For example, enzyme activity can be represented as the amount of metabolite produced per unit of time or per unit of enzyme (e.g., concentration or weight), or in terms of affinity or dissociation constants.

[ 0088 ] A "protein" or "polypeptide", which terms are used interchangeably herein, comprises one or more chains of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds. An "enzyme" means any substance, composed wholly or largely of protein, that catalyzes or promotes, more or less specifically, one or more chemical or biochemical reactions. The term "enzyme" can also refer to a catalytic polynucleotide (e.g., RNA or DNA) . A "native" or "wild- type" protein, enzyme, polynucleotide, gene, or cell, means a protein, enzyme, polynucleotide, gene, or cell that occurs in nature .

[ 0089] It is understood that the nucleic acid sequences

described above include "genes" and that the nucleic acid molecules described above include "vectors" or "plasmids . " For example, a nucleic acid sequence encoding a keto thiolase can be encoded by an atoB gene or homolog thereof, or an fadA gene or homolog thereof. Accordingly, the term "gene", also called a "structural gene" refers to a nucleic acid sequence that codes for a particular sequence of amino acids, which comprise all or part of one or more proteins or enzymes, and may include regulatory (non-transcribed) DNA sequences, such as promoter sequences, which determine for example the

conditions under which the gene is expressed. The transcribed region of the gene may include untranslated regions, including introns, 5'- untranslated region (UTR) , and 3 ' -UTR, as well as the coding sequence. The term "nucleic acid" or "recombinant nucleic acid" refers to polynucleotides such as deoxyribonucleic acid (DNA) , and, where appropriate, ribonucleic acid (RNA) . The term "expression" with respect to a gene sequence refers to transcription of the gene and, as appropriate, translation of the resulting mRNA transcript to a protein. Thus, as will be clear from the context, expression of a protein results from transcription and translation of the open reading frame sequence .

[ 0090 ] The term "operon" refers two or more genes which are transcribed as a single transcriptional unit from a common promoter. In some embodiments, the genes comprising the operon are contiguous genes. It is understood that transcription of an entire operon can be modified (i.e., increased, decreased, or eliminated) by modifying the common promoter. Alternatively, any gene or combination of genes in an operon can be modified to alter the function or activity of the encoded polypeptide. The modification can result in an increase in the activity of the encoded polypeptide. Further, the modification can impart new activities on the encoded polypeptide. Exemplary new activities include the use of alternative substrates and/or the ability to function in alternative environmental conditions .

[ 0091 ] A "vector" is any means by which a nucleic acid can be propagated and/or transferred between organisms, cells, or cellular components. Vectors include viruses, bacteriophage, pro-viruses, plasmids, phagemids, transposons, and artificial chromosomes such as YACs (yeast artificial chromosomes) , BACs (bacterial artificial chromosomes) , and PLACs (plant artificial chromosomes) , and the like, that are "episomes, " that is, that replicate autonomously or can integrate into a chromosome of a host cell. A vector can also be a naked RNA polynucleotide, a naked DNA polynucleotide, a

polynucleotide composed of both DNA and RNA within the same strand, a poly-lysine -conjugated DNA or RNA, a peptide-conjugated DNA or RNA, a liposome-conj ugated DNA, or the like, that are not episomal in nature, or it can be an organism which comprises one or more of the above polynucleotide constructs such as an agrobacterium or a bacterium .

[ 0092 ] "Transformation" refers to the process by which a vector is introduced into a host cell. Transformation (or transduction, or transfection) , can be achieved by any one of a number of means including electroporation, microinjection, biolistics (or particle bombardment-mediated delivery) , or agrobacterium mediated

transformation .

[ 0093] The disclosure provides nucleic acid molecules in the form of recombinant DNA expression vectors or plasmids, as described in more detail below, that encode one or more target enzymes.

Generally, such vectors can either replicate in the cytoplasm of the host microorganism or integrate into the chromosomal DNA of the host microorganism. In either case, the vector can be a stable vector

(i.e., the vector remains present over many cell divisions, even if only with selective pressure) or a transient vector (i.e., the vector is gradually lost by host microorganisms with increasing numbers of cell divisions) . The disclosure provides DNA molecules in isolated (i.e., not pure, but existing in a preparation in an abundance and/or concentration not found in nature) and purified

(i.e., substantially free of contaminating materials or substantially free of materials with which the corresponding DNA would be found in nature) forms.

[ 0094 ] Provided herein are methods for the heterologous expression of one or more of the biosynthetic genes involved in 1- propanol, isobutanol, 1-butanol, 2-methyl 1-butanol, 3-methyl 1- butanol, and/or 2-phenylethanol biosynthesis and recombinant DNA expression vectors useful in the method. Thus, included within the scope of the disclosure are recombinant expression vectors that include such nucleic acids. The term expression vector refers to a nucleic acid that can be introduced into a host microorganism or cell-free transcription and translation system. An expression vector can be maintained permanently or transiently in a

microorganism, whether as part of the chromosomal or other DNA in the microorganism or in any cellular compartment, such as a replicating vector in the cytoplasm. An expression vector also comprises a promoter that drives expression of an RNA, which typically is translated into a polypeptide in the microorganism or cell extract. For efficient translation of RNA into protein, the expression vector also typically contains a ribosome-binding site sequence positioned upstream of the start codon of the coding sequence of the gene to be expressed. Other elements, such as enhancers, secretion signal sequences, transcription termination sequences, and one or more marker genes by which host microorganisms containing the vector can be identified and/or selected, may also be present in an expression vector. Selectable markers, i.e., genes that confer antibiotic resistance or sensitivity, are used and confer a selectable phenotype on transformed cells when the cells are grown in an appropriate selective medium.

[ 0095] The various components of an expression vector can vary widely, depending on the intended use of the vector and the host cell (s) in which the vector is intended to replicate or drive expression. Expression vector components suitable for the expression of genes and maintenance of vectors in E. coli, yeast, Streptomyces, and other commonly used cells are widely known and commercially available. For example, suitable promoters for inclusion in the expression vectors of the disclosure include those that function in eukaryotic or prokaryotic host microorganisms. Promoters can comprise regulatory sequences that allow for regulation of

expression relative to the growth of the host microorganism or that cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus. For E. coli and certain other bacterial host cells, promoters derived from genes for biosynthetic enzymes, antibiotic-resistance conferring enzymes, and phage proteins can be used and include, for example, the galactose, lactose (lac), maltose, tryptophan ( trp) , beta-lactamase (bla) , bacteriophage lambda PL, and T5 promoters. In addition, synthetic promoters, such as the tac promoter (U.S. Pat. No. 4,551,433), can also be used. For E. coli expression vectors, it is useful to include an E. coli origin of replication, such as from pUC, plP, pi, and pBR.

[ 0096] Thus, recombinant expression vectors contain at least one expression system, which, in turn, is composed of at least a portion of a biosynthetic gene coding sequences operably linked to a promoter and optionally termination sequences that operate to effect expression of the coding sequence in compatible host cells. The host cells are modified by transformation with the recombinant DNA expression vectors of the disclosure to contain the expression system sequences either as extrachromosomal elements or integrated into the chromosome .

[ 0097 ] Due to the inherent degeneracy of the genetic code, other nucleic acid sequences which encode substantially the same or a functionally equivalent amino acid sequence can also be used to clone and express the polynucleotides encoding such enzymes. As previously noted, the term "host cell" is used interchangeably with the term "recombinant microorganism" and includes any cell type which is suitable for producing e.g., 1-propanol, isobutanol, 1- butanol, 2-methyl 1-butanol, 3-methyl 1-butanol and/or 2- phenylethanol and susceptible to transformation with a nucleic acid construct such as a vector or plasmid.

[ 0098 ] As will be understood by those of skill in the art, it can be advantageous to modify a coding sequence to enhance its expression in a particular host. The genetic code is redundant with 64 possible codons, but most organisms typically use a subset of these codons. The codons that are utilized most often in a species are called optimal codons, and those not utilized very often are classified as rare or low-usage codons. Codons can be substituted to reflect the preferred codon usage of the host, a process sometimes called "codon optimization" or "controlling for species codon bias . "

[ 0099] A nucleic acid of the disclosure can be amplified using cDNA, mRNA or alternatively, genomic DNA, as a template and appropriate oligonucleotide primers according to standard PCR amplification techniques and those procedures described in the Examples section below. The nucleic acid so amplified can be cloned into an appropriate vector and characterized by DNA sequence analysis. Furthermore, oligonucleotides corresponding to nucleotide sequences can be prepared by standard synthetic techniques, e.g., using an automated DNA synthesizer.

[ 00100 ] It is also understood that an isolated nucleic acid molecule encoding a polypeptide homologous to the enzymes described herein can be created by introducing one or more nucleotide substitutions, additions or deletions into the nucleotide sequence encoding the particular polypeptide, such that one or more amino acid substitutions, additions or deletions are introduced into the encoded protein. Mutations can be introduced into the nucleic acid sequence by standard techniques, such as site-directed mutagenesis and PCR-mediated mutagenesis. In contrast to those positions where it may be desirable to make a non-conservative amino acid

substitutions (see above) , in some positions it is preferable to make conservative amino acid substitutions. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine) , acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan) , beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine) .

[ 00101 ] In another embodiment a method for producing e.g., 1- propanol, isobutanol, 1-butanol, 2-methyl 1-butanol, 3-methyl 1- butanol or 2-phenylethanol is provided. The method includes culturing a recombinant photoautotroph or photoheterotroph

microorganism ( s ) or culture comprising a photoautotroph or

photoheterotroph and a recombinant non-photosynthetic or

photoheterotroph microorganism as provided herein in the presence of a suitable substrate (e.g., C0 ₂ ) and under conditions suitable for the conversion of the substrate to 1-propanol, isobutanol, 1- butanol, 2-methyl 1-butanol, 3-methyl 1-butanol or 2-phenylethanol. The alcohol produced by a microorganism or culture provided herein can be detected by any method known to the skilled artisan. Culture conditions suitable for the growth and maintenance of a recombinant microorganism provided herein are described in the Examples below. The skilled artisan will recognize that such conditions can be modified to accommodate the requirements of each microorganism.

[ 00102 ] As previously discussed, general texts which describe molecular biological techniques useful herein, including the use of vectors, promoters and many other relevant topics, include Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in

Enzymology Volume 152, (Academic Press, Inc., San Diego, Calif.)

("Berger"); Sambrook et al . , Molecular Cloning--A Laboratory Manual, 2d ed., Vol. 1-3, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., 1989 ("Sambrook") and Current Protocols in Molecular Biology, F. M. Ausubel et al . , eds . , Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc., (supplemented through 1999) ("Ausubel"). Examples of protocols sufficient to direct persons of skill through in vitro amplification methods, including the polymerase chain reaction (PCR) , the ligase chain reaction (LCR) , Q -replicase amplification and other RNA polymerase mediated techniques (e.g., NASBA) , e.g., for the production of the homologous nucleic acids of the disclosure are found in Berger, Sambrook, and Ausubel, as well as in Mullis et al .

(1987) U.S. Pat. No. 4, 683, 202; Innis et al . , eds. (1990) PCR

Protocols: A Guide to Methods and Applications (Academic Press Inc. San Diego, Calif.) ("Innis"); Arnheim & Levinson (Oct. 1, 1990) C&EN 36-47; The Journal Of NIH Research (1991) 3: 81-94; Kwoh et al.

(1989) Proc. Natl. Acad. Sci . USA 86: 1173; Guatelli et al. (1990) Proc. Nat'l. Acad. Sci. USA 87: 1874; Lomell et al. (1989) J. Clin. Chem 35: 1826; Landegren et al . (1988) Science 241: 1077-1080; Van Brunt (1990) Biotechnology 8: 291-294; Wu and Wallace (1989) Gene 4:560; Barringer et al . (1990) Gene 89:117; and Sooknanan and Malek

(1995) Biotechnology 13: 563-564. Improved methods for cloning in vitro amplified nucleic acids are described in Wallace et al . , U.S. Pat. No. 5,426,039. Improved methods for amplifying large nucleic acids by PCR are summarized in Cheng et al . (1994) Nature 369: 684- 685 and the references cited therein, in which PCR amplicons of up to 40 kb are generated. One of skill will appreciate that

essentially any RNA can be converted into a double stranded DNA suitable for restriction digestion, PCR expansion and sequencing using reverse transcriptase and a polymerase. See, e.g., Ausubel, Sambrook and Berger, all supra.

EXAMPLES

Materials and methods

[ 00103] Chemicals and reagents. All chemicals were purchased from Sigma-Aldrich (St. Louis, MO) or Fisher Scientifics (Pittsburgh, PA) unless otherwise specified. iProof high-fidelity DNA polymerase was purchased from Bio-Rad (Hercules, CA) . Restriction enzymes, Phusion DNA polymerase, and ligases were purchased from New England Biolabs

(Ipswich, MA). T5-Exonuclease was purchased from Epicentre

Biotechnologies (Madison, WI) . KOD and KOD xtreme DNA polymerases were purchased from EMD biosciences (Gibbstown, NJ) .

[ 00104 ] Culture medium and condition. All S. elongatus 7942 strains were grown on modified BG-11 (1.5 g/L NaN0 ₃ , 0.0272 g/L CaCl ₂ -2H ₂ 0, 0.012 g/L ferric ammonium citrate, 0.001 g/L Na ₂ EDTA, 0.040 g/L K ₂ HP0 ₄ , 0.0361 g/L MgS0 ₄ ·7Η ₂ 0, 0.020 g/L Na ₂ C0 ₃ , lOOOx trace mineral (1.43 g H ₃ B0 ₃ , 0.905 g/L MnCl ₂ -4H ₂ 0, 0.111 g/L ZnS0 ₄ ·7Η ₂ 0, 0.195 g/L Na ₂ Mo0 ₄ ·2Η ₂ 0, 0.0395 g CuS0 ₄ -5H ₂ 0, 0.0245 g Co (N0 ₃ ) 2 · 6H ₂ 0) , 0.00882 g/L sodium citrate dihydrate) agar (1.5% w/v) plates. All S. elongatus 7942 strains were cultured in BG-11 medium containing 50 mM NaHC0 ₃ in 250 mL screw-capped flasks. Cultures were grown under 100 μΕ/s/m ² light condition at 30°C. Cell growth was monitored by measuring OD ₇₃₀ with Beckman Coulter DU800 spectrophotometer.

[ 00105 ] DNA manipulations . All chromosomal manipulations were carried out by recombination of plasmid DNA into S. elongatus 7942 genome at neutral site I (NSI) and II (NSII) . All plasmid were constructed using the isothermal DNA assembly method. Plasmids were constructed in E. coli XL-1 strain for propagation and storage

(Table 1) .

[00106] TABLE 1. Strain and plasmid list

Strain Relevant genotypes Reference

Cyanobacteria Strains

PCC 7942 Wild-type Synechococcus elongatus PCC 7942 S.S. Golden

EL9 His-tagged T. denticoia ter integrated at NSI in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and atoB, adhE2, crt, hbd

EL14

integrated at NSII in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and atoB, bldh, yqhD, crt, hbd __. . . EL18 . ⁵⁵ , ^{5 /} This work integrated at NSII in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and nphT7, adhE2, crt, hbd

EL20 . ^&& This work integrated at NSII in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and nphT7, bldh, yqhD, crt, hbd _., . EL21 . ^&& , „ _^ „ _n „ _^ This work integrated at NSII in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and nphT7, bldh, yqhD, phaJ,

EL22 , . . _{N N} ,^ ,ΥΊ , , This work phaB integrated at NSII in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and atoB, bldh, yqhD, phaJ, phaB _., . EL23 . ^&& , „ _^ „ _n „ _^ This work integrated at NSII in PCC7942 genome

His-tagged T. denticoia ter integrated at NSI and nphT7, adhE2, phaJ, phaB

EL24 . ^&& , „ _^ „ _n „ _^ This work integrated at NSII in PCC7942 genome

E. coli strains

BW25113 rrnB u MacZ _WJ16 hsdRSIA AaraBAD _A¥lii ArhaBAD _LD7S

„, , , , recAl endAl gyrA96 thi-1 hsdR17 supE44 relAl lac [F proAB lacfZ MlS TnlO„

XL-1 blue i _ei ^R )] Stratagene

JCL299 BW25113 MdhA adhE A/rc/BC Apta / F' \traD36, proAB+, lacf ΖΔΜ15 (Tet ^R )]

Plasmid genotypes Reference pCDFDuet Spec ^R ; CDF ori; pT7::MCS Novagen pCDF-nphT7 Spec ^R ; CDF ori; pT7::nphT7 (his tagged) This work pCDF-atoB Spec ^R ; CDF ori; pT7::atoB (his tagged) This work pCS27 Kan ^R ; P15A ori; pUac01::MCS (1)

Yasumasa pDK26 Amp ^R ; ColEl ori; pUac01::bktB.adhE2.crt.paaHl

Dekishima pELll Amp ^R ; ColEl ori; pl\ac01::atoB.adhE2.crt.hbd (1) pEL29 Kan ^R ; pUC ori; ccr-phaJ-phaB This work pEL37 Kan ^R ; NSII targeting; pL\ac01::atoB.adhE2.crt.hbd (17) pEL52 Amp ^R ; pUC ori; PT5 nphT7 This work pEL53 Amp ^R ; ColEl ori; pL\ac01::nphT7.adhE2.crt.hbd This work pEL54 Amp ; ColEl ori; pL\ac01::atoB.bldh.yqhD.crt.hbd This work pEL56 Kan ^R ; NSII targeting; pL\ac01::nphT7.adhE2.crt.hbd This work pEL57 Kan ^R ; NSII targeting; pl\ac01::atoB.bldh.yqhD.crt.hbd This work pEL59 Kan ^R ; NSII targeting; pl\ac01::nphT7.bldh.yqhD.crt.hbd This work pEL70 Kan ^R ; NSII targeting; pl\ac01::nphT7.bldh.yqhD.phaJ.phaB This work pEL71 Kan ^R ; NSII targeting; pl\ac01::atoB.bldh.yqhD.phaJ.phaB This work pEL73 Kan ^R ; NSII targeting; pl\ac01::nphT7.adhE2.phaJ.phaB This work pEL75 Amp ^R ; ColEl ori; pL\ac01::bktB.bldh.yqhD.crt.paaHl This work pEL76 Amp ^R ; ColEl ori; pL\ac01::bktB.aldh(CK).yqhD.crt.paaHl This work pEL77 Amp ^R ; ColEl ori; pL\ac01::bktB.aldh(GT).yqhD.crt.paaHl This work pEL78 Amp ^R ; ColEl ori; pl\ac01::bktB.eutE.yqhD.crt.paaHl This work pEL79 Amp ^R ; ColEl ori; pL\ac01::bktB.aldh(CB).crt.paaHl This work pEL80 Amp ^R ; ColEl ori; pL\ac01::bktB.aldh(BAA117).yqhD.crt.paaHl This work pEL90 Kan ^R ; P15A ori; pUac01::bamb6224 (his-tagged) This work pEL91 Kan ^R ; P15A ori; pl\acOl::gox0115 (his-tagged) This work pEL92 Kan ^R ; P15A ori; pLIacOl::/) p0202 (his-tagged) This work pEL93 Kan ^R ; P15A ori; pUacOl::lmo2202 (his-tagged) This work pEL94 Kan ^R ; P15A ori; pl\ac01::pae-fabH2 (his-tagged) This work pEL95 Kan ^R ; P15A ori; pl\ac01::sav-fabH4 (his-tagged) This work pEL96 Kan ^R ; P15A ori; pl\ac01::sco5888 (his-tagged) This work

[ 00107 ] Kan ^R , kanamycin resistance; Amp ^R , ampicillin resistance.

[ 00108 ] atoB (E. coli) , thiolase; nphT7 (Streptomyces sp. strain

CL190), acetoacetyl-CoA synthase; phaB (R. Eutropha) , acetoacetyl-CoA reductase; phaJ (A. caviae) , (R) -specific enoyl-CoA hydratase; hbd (C. acetobutylicum) , 3-hydroxybutyryl-CoA dehydrogenase; crt (C.

acetobutylicum) , crotonase; ter (T. denticola) , Trans-2-enoyl-CoA reductase; bldh (C. saccharoperbutylacetonicum) , butyraldehyde

dehydrogenase; paaHl (R. eutropha) , 3-hydroxybutyryl-CoA dehydrogenase; yqhD (E . coli), NADP-dependent alcohol dehydrogenase; adhE2 (C.

acetobutylicum) , bifunctional alcohol/aldehyde dehydrogenase, bktb (R. Eutropha) , thiolase; aldh (C. kluyveri, C. beij erinckii , C.

saccharobutylicum, or G. thermoglucosidasius) , aldehyde dehydrogenase; eutE (E. coli), aldehyde dehydrogenase; KASIII like enzymes: bamb6224

(Burkholderia ambifaria) , gox0115 (Gluconobacter oxydans) , hp0202

(Helicobacter pylori), lmo2202 (Listeria monocytogenes) , pae-fabH2

(Pseudomonas aeruginosa) , sav-fabH4 (Streptomyces avermitilis) , sco5888 (Streptomyces coelicolor) .

[00109] Plasmid constructions. The plasmids used and constructed in this work are listed in Table 1 and briefly described below. The sequences of primers used are listed in Table 2. Plasmid pEL29 was synthesized by Genewiz Inc. Plasmid pEL52 was synthesized by DNA 2.0.

[00110] Plasmid pEL53 was constructed by assembling a nphT7 fragment and a pELll without atoB fragment. nphT7 fragment was amplified by PCR with primers rEL-335 and rEL-336 with pEL52 as template. pELll without atoB fragment was amplified by PCR with primers rEL-333 and rEL-334 with pELll as template. [ 00111 ] Plasmid pEL54 was constructed by assembling a bldh fragment, a yqhD fragment, and a pELll without adhE2 fragment, bldh fragment was amplified by PCR with primers rEL-329 and rEL-330 with Clostridium saccharoperbutylacetonicum NI-4 genome as template. yqhD fragment was amplified by PCR with primers rEL-331 and rEL-332 with E. coli genome as template. pELll without adhE2 fragment was amplified by PCR with primers rEL-327 and rEL-328 with pELll as template .

[ 00112 ] Plasmid pEL56 was constructed by assembling a NSII vector fragment and a pEL53 coding sequence fragment. NSII vector fragment was amplified by PCR with primers rEL-217 and rEL-253 with pEL37 as template. pEL53 coding sequence fragment was amplified by PCR with primers rEL-254 and rEL-255 with pEL53 as template.

[ 00113] Plasmid pEL57 was constructed by assembling a NSII vector fragment and a pEL54 coding sequence fragment. NSII vector fragment was amplified by PCR with primers rEL-217 and rEL-253 with pEL37 as template. pEL54 coding sequence fragment was amplified by PCR with primers rEL-254 and rEL-255 with pEL54 as template.

[ 00114 ] Plasmid pEL59 was constructed by assembling a NSII vector fragment, a pEL54 coding sequence without atoB fragment, and a nphT7 fragment. NSII vector fragment was amplified by PCR with primers rEL-217 and rEL-253 with pEL37 as template. pEL54 coding sequence without atoB fragment was amplified by PCR with primers rEL-352 and rEL-255 with pEL54 as template. nphT7 fragment was amplified by PCR with primers rEL-254 and rEL-351.

[ 00115] Plasmid pEL70 was constructed by assembling a pEL59 without crt.hbd fragment and a phaJ.phaB fragment. pEL59 without crt.hbd fragment was amplified by PCR with primers rEL-390 and rEL- 391 with pEL59 as template. phaJ.phaB fragment was amplified by PCR with primers rEL-392 and rEL-393 with pEL29 as template.

[ 00116] Plasmid pEL71 was constructed by assembling a pEL57 without crt.hbd fragment and a phaJ.phaB fragment. pEL57 without crt.hbd fragment was amplified by PCR with primers rEL-390 and rEL- 391 with pEL57 as template. phaJ.phaB fragment was amplified by PCR with primers rEL-392 and rEL-393 with pEL29 as template.

[ 00117 ] Plasmid pEL73 was constructed by assembling a pEL56 without crt.hbd fragment and a phaJ.phaB fragment. pEL56 without crt.hbd fragment was amplified by PCR with primers rEL-390 and rEL- 398 with pEL56 as template. phaJ.phaB fragment was amplified by PCR with primers rEL-399 and rEL-393 with pEL70 as template.

[ 00118 ] Plasmids pEL75, pEL76, pEL77, pEL78, pEL79, and pEL80 were constructed by assembling a pDK26 without adhE2 fragment and an aldehyde dehydrogenase gene from Clostridium

saccharoperbutylacetonicum NI-4, Clostridium Kluyveri , Geobacillus thermoglucosidasius , Escherichia coli, Clostridium beijerinckii NCIMB 8052, and Clostridium saccharobutylicum ATCC BAA-117, respectively. pDK26 without adhE2 fragment was amplified by PCR using primers rEL-403 and rEL-404 with pDK26 as template. C.

saccharoperbutylacetonicum NI-4 bldh fragment was amplified by primers rEL-332 and rEL-394 with C. saccharoperbutylacetonicum NI-4 genome as template. C. Kluyveri bldh fragment was amplified by primers rEL-405 and rEL-406 with C. kluyveri genome as template. G. thermoglucosidasius bldh fragment was amplified by primers rEL-407 and rEL-408 with G. thermoglucosidasius genome as template. E. coli EutE fragment was amplified by primers rEL-409 and rEL-410 with E. coli genome as template. C. beijerinckii NCIMB 8052 bldh fragment was amplified by primers rEL-411 and rEL-412 with C. beijerinckii NCIMB 8052 genome as template. C. saccharobutylicum ATCC BAA-117 bldh fragment was amplified by primers rEL-413 and rEL-414 with C. saccharobutylicum ATCC BAA-117 genome as template.

[ 00119] Plasmids pEL90 to pEL96 were constructed by assembling the KASIII-like genes with a vector fragment. Vector fragment was amplified with primers rEL-455 and rEL-456 with pCS27 as the template. bamb6224 was amplified with primers rEL-457 and rEL-458 with Burkholderia ambifaria gDNA as template. gox0115 was amplified with primers rEL-459 and rEL-460 with Gluconobacter oxydans gDNA as template. hp0202 was amplified with primers rEL-461 and rEL-462 with Helicobacter pylori gDNA as template. Imo2202 was amplified with primers rEL-463 and rEL-464 with Listeria monocytogenes gDNA as template. pae-fabH2 was amplified with primers rEL-467 and rEL-468 with Pseudomonas aeruginosa gDNA as template. sav-fabH4 was amplified with primers rEL-469 and rEL-470 with Streptomyces avermitilis gDNA as template. sco5888 was amplified with primers rEL-471 and rEL-472 with Streptomyces coelicolor gDNA as template. [00120] Strain construction. The strains used and constructed are listed in Table 1. Briefly, strain EL18 was constructed by

recombination of plasmids pEL57 NSII of Strain EL9 (SI Table 1 for relevant genotypes) . Strain EL20 was constructed by recombination of plasmids pEL56 into NSII of strain EL9. Strain EL21 was constructed by recombination of plasmids pEL59 into NSII of strain EL9. Strain EL22 was constructed by recombination of plasmids pEL70 into NSII of strain EL9. Strain EL23 was constructed by recombination of plasmids pEL71 into NSII of strain EL9. Strain EL24 was constructed by recombination of plasmids pEL73 into NSII of strain EL9.

[00121] Plasmid transformation. S. elongatus 7942 strains were transformed by incubating cells at mid-log phase (OD ₇₃₀ of 0.4 to 0.6) with 2 g of plasmid DNA overnight in dark. The culture was then spread on BG-11 plates with appropriate antibiotics for selection of successful recombination. For selection and culture maintenance, 20 g/ml spectinomycin and 10 g/ml kanamycin were added into BG-11 agar plates and BG-11 medium where appropriate. Colonies grown on BG-11 agar plates were grown in liquid culture. Genomic DNA was then prepared from the liquid culture and analyzed by PCR using gene-specific primers (SI Table 2) to verify

integration of inserted genes into the recombinant strain. In all cases, four individual colonies were analyzed and propagated for downstream tests .

[ 00122 ] TABLE 2 . Primer Sequence s

Primers Sequence (5' -> 3') (SEQ ID NOs are in parens) Used for plasmid

rEL-333 TTGCGCTGATCGAGTGGTAAGCATGCAGGAGAAAGGTACCATGAAAG( 100) pEL53

rEL-334 ATGCGGAAGCGGACGTCGGTCATGGTACCTTTCTCCTCTTTAATGAATTCGGTC(36) pEL53

rEL-335 CCGAATTCATTAAAGAGGAGAAAGGTACCATGACCGACGTCCGCTTCCGCATCA(37) pEL53; nphTl gene specific

rEL-327 AGGAGATATACCATGGAACTAAACAATGTCATCC(38) pEL54

rEL-328 TTAATTCAACCGTTCAATCACCATCGC(39) pEL54

rEL-329 GGTTGAATTAAGCATGCAGGAGAAAGGTACCATGATTAAAGACACGCTAGTTTCTATAAC (40) pEL54

rEL-330 GTTGTTCATGGTATATCTCCTTTAACCGGCGAGTACACATCTTCTTTGTC(41 ) pEL54

rEL-331 GTACTCGCCGGTTAAAGGAGATATACCATGAACAACTTTAATCTGCACACCCC(42) pEL54; yqhD specific

rEL-332 TTGTTTAGTTCCATGGTATATCTCCTTCTAGATTAGCGGGCGGCTTCGTATATACGGCGG (43) pEL54; yqhD specific

rEL-217 CTTTAATGAATTCGGTCAGTGCGTCCT(44) pEL56, pEL57, pEL59

rEL-253 ACGCGTGCTAGAGGCATCAAATAAA(45) pEL56, pEL57, pEL59

rEL-254 AGGACGCACTGACCGAATTCATTAAAG(46) pEL56, pEL57, pEL59

rEL-255 TTTATTTGATGCCTCTAGCACGCGTTTATTTTGAATAATCGTAGAAACCTTTTCCTG(47 ) pEL56, pEL57, pEL59

rEL-351 CATGGTACCTTTCTCCTGCATGCTTACCACTCGATCAGCGCAAAGCTCGC(48) pEL59

rEL-352 TAAGCATGCAGGAGAAAGGTACCATGATTAAAGACACGCTAGTTTC(49) pEL59

rEL-390 TAAACGCGTGCTAGAGGCATCAAATA(50) pEL70, pEL71, pEL73

rEL-391 GCAGACATGGTATATCTCCTTTAGCGGGCGGCTTCGTATATACGGC(51 ) pEL70, pEL71

rEL-392 ACGAAGCCGCCCGCTAAAGGAGATATACCATGTCTGCGCAATC(52) pEL70, pEL71

rEL-393 TTGATGCCTCTAGCACGCGTTTAACCCATGTGCAGACCACCGTTC(53 ) pEL70, pEL71, pEL73

rEL-398 CATGGTATATCTCCTTTAAAATGATTTTATATAGATATCCTTAAGTTCAC(54) pEL73

rEL-399 ATATCTATATAAAATCATTTTAAAGGAGATATACCATGTCTGCGC(55) pEL73

rEL-403 TAAAGGAGATATACCATGAACAACTTTAATCTGC(56) pEL75, pEL76, pEL77, pEL78, pEL79, pEL80 rEL-404 CTTTCTCCTGCATGCTTAGATACGC(57) pEL75, pEL76, pEL77, pEL78, pEL79, pEL80 rEL-332 TTGTTTAGTTCCATGGTATATCTCCTTCTAGATTAGCGGGCGGCTTCGTATATACGGCGG (58) pEL75

rEL-394 ATGCAGGAGAAAGGTACCATGATTAAAGACACGCTAGTTTCTATAAC(59) pEL75

rEL- -405 AGCGTATCTAAGCATGCAGGAGAAAGGTACCATGGAGATAATGGATAAGGACTTACAGTC (60) pEL76

rEL- -406 TAAAGTTGTTCATGGTATATCTCCTTTAAAGATTTAATTTAGCCATTATAGCTTTTAC(6 1 ) pEL76

rEL- -407 GTATCTAAGCATGCAGGAGAAAGGTACCATGGATGCACAAAAAATTGAGAAACTTG(62) pEL77

rEL- -408 AGTTGTTCATGGTATATCTCCTTTATCTTATCGACAAAGCATCCACTAGG(63) pEL77

rEL- -409 CGTATCTAAGCATGCAGGAGAAAGGTACCATGAATCAACAGGATATTGAACAGGTG(64) pEL78

rEL- -410 TTGTTCATGGTATATCTCCTTTAAACAATGCGAAACGCATCGACTA(65) pEL78

rEL- -411 TCTAAGCATGCAGGAGAAAGGTACCATGAATAAAGACACACTAATACCTACAACTAAAG( 66) pEL79

rEL- -412 TAAAGTTGTTCATGGTATATCTCCTTTAGCCGGCAAGTACACATCTTCTTTG(67) pEL79

rEL- -413 GTATCTAAGCATGCAGGAGAAAGGTACCATGAATAATAATTTATTCGTGTCACCAGAAAC (68) pEL80

rEL- -414 TAAAGTTGTTCATGGTATATCTCCTTTAGCCTACGAACACACACCTTCTTTGTC(69) pEL80

rEL- -455 GCTGTGGTGATGATGGTGATGGCTGCTGCCCATGGTACCTTTCTCCTCTTTAATGAATTC (70) pEL90 - 96 rEL- -456 CGCGTGCTAGAGGCATCAAATAAAAC(71 ) pEL90 - 96 rEL- -457 ATCACCATCATCACCACAGCATGGCGGAAATCACCGGCGCGGGGA(72) pEL90

rEL- -458 TTTGATGCCTCTAGCACGCGCTACCAGCGAATCAACGCCGCCCCCCA(73) pEL90

rEL- -459 ATCACCATCATCACCACAGCATGTCCGATCCCATTCGTGTCCGCCT(74) pEL91

rEL- -460 TTTGATGCCTCTAGCACGCGTTACATCCGGATAAGGGCGGATCCCCA(75) pEL91

rEL- -461 ATCACCATCATCACCACAGCATGGAATTTTACGCCTCTCTTAAATCCATT(76) pEL92

rEL- -462 TTTGATGCCTCTAGCACGCGCTAACTTCCTCCAAAATACACCAACGCT(77) pEL92

rEL- -463 ATCACCATCATCACCACAGCATGAACGCAGGAATTTTAGGAGTAGGTAAA(78) pEL93

rEL- -464 TTTGATGCCTCTAGCACGCGTTACTTACCCCAACGAATGATTAGGGC(79) pEL93

rEL- -467 ATCACCATCATCACCACAGCATGCCGCGCGCCGCCGTGGTCT(80) pEL94

rEL- -468 TTTGATGCCTCTAGCACGCGTCAGTCCATTGTCGGAACGATCTTC(81 ) pEL94

rEL- -469 ATCACCATCATCACCACAGCATGTCCCCTACCGCCGCCGGTTCTT(82) pEL95

rEL- -470 TTTGATGCCTCTAGCACGCGTCATGACGTCGTCCGTTCTCCTTGG(83) pEL95

rEL- -471 ATCACCATCATCACCACAGCATGACCCGGGCGTCCGTGCTGACCG(84) pEL96

rEL- -472 TTTGATGCCTCTAGCACGCGTCAGACCGGATCGACGGCGGGCCAG(85) pEL96

rEL- -148 GGGAAAGGATCCATGAAAAATTGTGTCATCGTCAGTGCGG(86) N/A; atoB gene specific

rEL-149 GGGAAAGCGGCCGCATTAATTCAACCGTTCAATCACCATCGC(87) N/A; atoB gene specific rEL-157 GGGAAAGCGGCCGCATTATTTTGAATAATCGTAGAAACCTTTTCCTG(88) N/A; crt.hbd fragment specific rEL-158 GGGAAAGGATCCATGGAACTAAACAATGTCATCCTTGAAAAGGA(89) N/A; crt.hbd fragment specific rEL-160 GGGAAAGGATCCATGATTGTAAAACCAATGGTTAGGAACAAT(90) N/A; Ί.ά-ter gene specific rEL-161 GGGAAAGCGGCCGCATTAAATCCTGTCGAACCTTTCTACCTCG(91 ) N/A; Ί.ά-ter gene specific rEL-162 GGGAAAGGATCCATGAAAGTTACAAATCAAAAAGAACTAAAACAAAAGC(92) N/A; adhE2 gene specific rEL-163 GGGAAAGCGGCCGCATTAAAATGATTTTATATAGATATCCTTAAGTTCAC(93) N/A; adhE2 gene specific rEL-323 GGGAAAGGATCCGATGTCTGCGCAATCTCTCGAAGTTG(94) N/A; phaJ.phaB fragment specific rEL-326 GGGAAAAAGCTTTTAACCCATGTGCAGACCACCGTTC(95) N/A; phaJ.phaB fragment specific rEL-349 GGGAAAGAATTCGATGATTAAAGACACGCTAGTTTCTATAAC(96) A%4; bldh gene specific rEL-350 GGGAAAAAGCTTTTAACCGGCGAGTACACATCTTCTTTGTC(97) A%4; &W/z gene specific rEL-192 AACAATTTCACACAGGAGATATACCATGGGCAGCAGCCATCACCATCATC(98) N/A; E.g.ter gene specific rEL-203 GTTTACAAGCATACTAGAGGATCGTTATTGTTGAGCGGCAGAAGGCAGATCC(99) N/A; E.g.ter gene specific

[00123] Enzyme assays. Enzyme assays were conducted by using Bio- Tek PowerWave XS microplate spectrophotometer. Thiolase activity was measured via both condensation and thiolysis direction. The

enzymatic reaction was monitored by the increase or decrease of absorbance at 303 nm which corresponded to the result of Mg ²⁺ coordination with the diketo moiety of acetoacetyl-CoA . The enzymatic reaction was initiated by the addition of the enzyme. For purified enzyme reaction, the reaction mixture contained 100 mM Tris-HCl (pH 8.0), 20 mM MgCl ₂ , equimolar acetoacetyl-CoA and CoA. For the crude cyanobacteria extract assay, same buffer was used with 200 μΜ acetoacetyl-CoA and 300 μΜ CoA. Crude extract of strains EL22

(2.7 g) , EL14 (5.0 g) , and Wild-type (2.4 g) were used for assay. Concentration of acetoacetyl-CoA was calculated based on a

constructed standard curve .

[00124] Acetoacetyl-CoA synthase activity was measured by monitoring the increase of absorbance at 303 nm which corresponds to appearance of acetoacetyl-CoA. The reaction buffer is the same as that used for thiolase assay. Equimolar malonyl-CoA and acetyl-CoA were used for purified enzyme assay, while 400 μΜ of both malonyl- CoA and acetyl-CoA were used for crude extract assay. Crude extract of strains EL22 (27 g) , EL14 (50 g) , and Wild-type (24 g) were used for assay.

[00125] Production of 1-butanol. A loopful of S. elongatus 7942 was used to inoculate fresh 50 mL BG-11. 500 mM IPTG was used to induce the growing culture at cell density OD730 of 0.4 to 0.6 with 1 mM IPTG as final concentration. 5 mL of growing culture was sampled for cell density and 1-butanol production measurements every two days for up to day 8 after which sampling time was switched to every three days. After sampling, 5 mL of fresh BG-11 with 50 mM NaHC0 ₃ , appropriate antibiotics, and IPTG were added back to the culture .

[00126] 1-Butanol quantification. Culture samples (5 mL) were centrifuged for 20 minutes at 5,250 x g. The supernatant (900 L) was then mixed with 0.1% v/v 2-methyl-pentanol (100 L) as internal standard. The mixture was then vortexed and directly analyzed on Agilent GC 6850 system with flame ionization detector and DB-FFAP capillary column (30m, 0.32mm i.d., 0.25 film thickness) from

Agilent Technologies (Santa Clara, CA) . 1-Butanol in the sample was identified and quantified by comparing to 0.001% v/v 1-butanol standard. 1-Butanol standard of 0.001% v/v was prepared by 100-fold dilution of a 0.1% v/v solution. The GC result was analyzed by Agilent software Chem Station (Rev. B.04.01 SP1) . Amount of 1-butanol in the sample was then calculated based on the ratio of its integrated area and that of the 0.001% 1-butanol standard.

[00127] Helium gas was used as the carrier gas with 9.52 psi inlet pressure. The injector and detector temperatures were maintained at 225°C. Injection volume was 1 . The GC oven temperature was initially held at 85°C for 3 minutes and then raised to 235°C with a temperature ramp of 45°C/min. The GC oven was then maintained at 235°C for 1 minute before completion of analysis.

Column flow rate was 1.7 ml/min.

[00128] Alcohol production by E. coli expressing butyraldehyde dehydrogenase. E. coli wild type is based on strain

BW25113Transformed E. coli strain JCL299 (AadhE, MdhA, Afrd, Apta) was selected on LB plate supplemented with ampicillin (100 g/mL) and kanamycin (50 g/mL) . Three colonies were picked from the plate to make overnight pre-culture. The pre-cultures were then used to inoculate Terrific broth (TB; 12g tryptone, 24g yeast extract, 2.31g KH ₂ P0 ₄ , 12.54g K ₂ HP0 ₄ , 4 mL glycerol per liter of water) supplemented with 20 g/L glucose. Culture sample (2 mL) was centrifuged for 5 minutes at 21,130 x g. The supernatant was analyzed by GC following the same method as that described in section 2.8.

[00129] Incorporating synthetic driving force for 1-butanol biosynthetic pathway design. It was hypothesized that insufficient carbon flux into the pathway led to the difficulty to synthesize 1- butanol under aerobic photosynthetic condition. The first step of the pathway, catalyzed by thiolase, is readily reversible and strongly favors the formation of reactants . Using purified AtoB in spectrophotometric assay, it was then demonstrated that the condensation reaction is unfavorable (Fig.2A) with an equilibrium constant at pH 8.0 of (1.1 ± 0.2) xlO ^"5 , corresponding to AG° of 6.8 kcal/mol and consistent with previous literature value. Therefore, without sufficient carbon flux to acetyl-CoA or an efficient product trap, there is no driving force for the formation of acetoacetyl- CoA.

[ 00130 ] Alternative pathways were examined that drive the formation of acetoacetyl-CoA . Metabolic pathways that share similarities with the CoA 1-butanol pathway, including fatty acid synthesis, polyketide synthesis, and β-oxidation were examined. In particular, fatty acid synthetic pathway is almost identical to CoA 1-butanol pathway with two exceptions. First exception is that fatty acid synthesis utilizes acyl-carrier protein (ACP) instead of CoA as the thioester recognition moiety. Second is that fatty acid biosynthesis also requires the activation of acetyl-CoA into malonyl-CoA. Malonyl-CoA is synthesized from acetyl-CoA, HC0 ₃ ^~ , and ATP by acetyl-CoA carboxylase (Acc) . The formation of malonyl-CoA is effectively irreversible due to ATP hydrolysis. Malonyl-CoA is then converted into malonyl-ACP and acts as the carbon addition unit for fatty acid synthesis. Ketoacyl-ACP synthase III (KAS III) catalyzes the irreversible condensation of malonyl-ACP and acetyl-CoA to synthesize the four carbon intermediate 3-ketobutyryl-ACP,

equivalent in structure to acetoacetyl-CoA with different thioester recognition marker.

[ 00131 ] It was thus hypothesized that utilizing the energy release from ATP hydrolysis (AG°' of -7.3 kcal/mol) would compensate for the energy require for condensation of acetyl-CoA into

acetoacetyl-CoA . By combining the reaction catalyzed by thiolase with ATP hydrolysis, a net reaction that is thermodynamically favored (AG°' < 0) was expected. More importantly, C0 ₂ release from the decarboxylative condensation drives the formation of

acetoacetyl-CoA as gaseous C0 ₂ leaves the system, shifting the reaction towards the product. Fatty acid and polyketide chain elongation have naturally evolved this mechanism to enable this thermodynamically unfavorable reaction and elongate carbon chain length. It was reasoned that by taking advantage of this evolved mechanism, the carbon flux could be pushed into the desired CoA 1- butanol pathway. Furthermore, this mechanism may be especially useful for photoautotrophs that readily produce ATP from light energy . [00132] Bioprospecting for KASIII was performed that utilize malonyl-CoA rather than malonyl-ACP for condensation with acetyl- CoA. Since both ACP and CoA carry the phosphopantetheine moiety which forms thioester bond with the malonyl- moiety of malonyl-CoA, KASIII and KASIII-like enzymes may be able to react with malonyl- CoA. A variety of KASIII and KASIII-like enzymes were cloned from different organisms. Each was tested for their expression in E. coli and assayed their activity towards condensing malonyl-CoA with acetyl-CoA after His-tag purification (Table 3) . Of the enzymes tested, NphT7 was the most active (specific activity of 6.02 umol/min/mg) . Other enzymes such as Bamb6244, GOX0115, and PAE-FabH2 were also active while the rest showed no detectable activity. As Shown in Figure 2B, condensation reaction catalyzed by NphT7 using malonyl-CoA and acetyl-CoA is irreversible and accumulates

acetoacetyl-CoA as the product. At low starting concentration of malonyl-CoA and acetyl-CoA, conversion to acetoacetyl-CoA is higher than high starting substrate concentration. This result is most likely due to depletion of malonyl-CoA as NphT7 also catalyzes malonyl-CoA self-reaction .

[00133]

[00134] Expression of Acetoacetyl-CoA synthase enables

photosynthetic production of 1-butanol. To test the hypothesis that increasing driving force will push carbon flux into the CoA pathway, this synthetic driving force was integrated into S. elongatus PCC

7942. The gene nphT7 was synthesized and recombined into the genome of S. elongatus PCC 7942 along with the other genes of the CoA 1- butanol pathway (hbd, crt, Td. ter, and adhE2) , resulting in strain EL20. As shown in (Fig. 3A) , crude extract from strain EL20

expressing NphT7 was able to catalyze formation of acetoacetyl-CoA by condensation of malonyl-CoA and acetyl-CoA and was not capable of catalyzing the thiolysis of acetoacetyl-CoA . On the other hand, crude extract from strain EL14 expressing AtoB catalyzed thiolysis much more efficient than the condensation reaction (Fig. 3B) . The two strains EL20 and EL14 share nearly identical growth rate (Fig. 4A) . However, Strain EL20 produced 6.5 mg/L (Fig 4B) of 1-butanol while Strain EL14 produced only trace amounts of 1-butanol (Fig. 4C) . This result indicated that ATP driven acetoacetyl-CoA formation is more efficient at capturing carbon flux into the CoA 1-butanol pathway .

[ 00135] Substitution of NADPH utilizing enzymes aids 1-butanol production. Cyanobacteria produce NADPH as the direct result of photosynthesis. Intracellular NAD ⁺ and NADP ⁺ level differ by ratio of about 1:10 in S. elongatus 7942. Thus NADH utilizing pathway may be unfavorable in cyanobacteria. The CoA 1-butanol pathway requires four NADH per 1-butanol produced. Changing the cofactor preference of this pathway may aid the production of 1-butanol.

[ 00136] As depicted in Fig. 1 (outlined in red), we identified enzymes that utilize NADPH or both NADPH and NADH by bioprospecting. NADP-dependent alcohol dehydrogenase (YqhD) from E. coli has been demonstrated to aid production of higher chain alcohols. YqhD is a good replacement candidate for the alcohol dehydrogenase domain of AdhE2. To couple to YqhD, a CoA-acylating butyraldehyde

dehydrogenase was needed to replace the aldehyde dehydrogenase domain of AdhE2. Again, bioprospecting was performed for enzymes catalyzing reduction of butyryl-CoA to butyraldehyde. CoA-acylating butyraldehyde dehydrogenase (Bldh) is found in high butanol

producing Clostridium species including C. beijerinckii NCIMB 8052, C. saccharobutylicum ATCC BAA-117, and C. saccharoperbutylacetonicum NI-4. In particular, Bldh from C. beijerinckii has been purified and demonstrated activity in vitro with both NADH and NADPH as reducing cofactor. Based on sequence homology of Bldh from C. beijerinckii, additional Bldh-like enzymes were cloned from various organisms including C. saccharoperbutylacetonicum NI-4, C. saccharobutylicum ATCC BAA-117, Geobacillus thermoglucosidasius, Clostridium Kluyveri, and E. coli. The performance of these Bldh were assessed by 1- butanol production in recombinant E. coli. As shown in Fig. 5, E. coli strain expressing C. saccharoperbutylacetonicum NI-4 Bldh along with rest of the CoA 1-butanol pathway produced the highest titer of 1-butanol, exceeding the 1-butanol produced by E. coli strain expressing AdhE2 by nearly 3-fold. Therefore C.

saccharoperbutylacetonicum NI-4 bldh and E. coli yqhD were cloned and expressed in S. elongatus PCC 7942 to replace adhE2. As results shown in Fig. 6, the production of 1-butanol from strain EL21 expressing bldh and yqhD (26.5 mg/L) exceeded that from strain EL20 expressing adhE2 by around 400%. This result corresponded to the same observation seen in recombinant E. coli. The increase in 1- butanol production by expression of bldh and adhE2 may be attributed to higher activity or expression of Bldh and YqhD in comparison to AdhE2 as well as the ability to utilize NADPH.

[ 00137 ] To further investigate the effect of changing cofactor dependence from NADH to NADPH, Acetoacetyl-CoA reductase (PhaB) was used to replace Hbd. PhaB from Ralstonia eutropha is an enzyme found in the poly-hydroxyalkanoate biosynthetic pathway for reducing 3- ketobutyryl-CoA to 3-hydroxybutyryl-CoA using NADPH. However, PhaB produces the (R) -stereoisomer of 3-hydroxybutyryl-CoA instead of the

( S ) -stereoisomer produced by Hbd. As a result, Crt cannot be used for the subsequent dehydration to produce crotonyl-CoA . Upon reaction of (R) -3-hydroxybutyryl-CoA with Crt, isocrotonyl-CoA is produced and cannot be further reduced by Ter. Therefore, a different crotonase capable of reacting with (R) -3-hydroxybutyryl- CoA is necessary in order to utilize PhaB for the reduction of acetoacetyl-CoA . (R) -specific enoyl-CoA hydratase (PhaJ) is found in Aeromonas caviae and is responsible for diverging β-oxidation intermediates into production of poly-hydroxyalkanoates. PhaJ dehydrates (R) -3-hydroxybutyryl-CoA into crotonyl-CoA, and therefore it couples to PhaB for the reduction of 3-ketobutyryl-CoA . Genes phaB and phaJ were codon optimized for expression in S. elongatus 7942. The genes phaB and phaJ were integrated into S. elongatus 7942 to replace hbd and crt. As shown in Fig. 6, the effect of this replacement is minimal. 1-Butanol production from strains EL22 (29.9 mg/L) and EL24 (7.7 mg/L) expressing PhaB and PhaJ only slightly outperformed strains EL21 (26.5 mg/L) and EL20 (6.4 mg/L) expressing Hbd and Crt.

[ 00138 ] Direct 1-butanol production from cyanobacteria under oxygenic condition is desirable because it may be developed into a continuous process and reduces the number of processing steps.

Metabolic engineering of cyanobacteria has enabled the production of Isobutyraldehyde, isobutanol, 1-butanol, ethanol, ethylene, isoprene, sugars, lactic acid, fatty alcohols, and fatty acids from C0 ₂ . The pathways for the high flux production of isobutanol and ethanol naturally have decarboxylation as driving force. The loss of C0 ₂ is often considered as irreversible. In contrast, the CoA pathway utilizing thiolase does not have such significant driving force. Although this pathway enables production in E. coli under fermentative conditions, cyanobacteria are different in their metabolism. The same pathway would require additional engineering to function according to host. Under light condition, cyanobacteria readily generate ATP from photosynthesis. Therefore, consumption of ATP to enhance thermodynamic favorability of the CoA pathway is an effective approach. The nature of the CoA pathway was changed from a fermentative pathway into a biosynthetic pathway. The strategy models fatty acid and polyketide synthesis where decarboxylative condensation of malonyl-CoA with acetyl-CoA serves as an

irreversible trap for elongation of carbon chain.

[ 00139] Reducing cofactor preference is an important aspect of pathway design. Depending on the production condition and organisms' natural metabolism, changing cofactor preference is necessary to achieve high flux production. For example, changing isobutanol production pathway into utilizing NADH increases the productivity and yield under anaerobic condition in recombinant E. coli. In contrast, pathways utilizing NADPH is preferred in cyanobacteria because NADPH is more abundant. By utilizing NADPH dependent enzymes, the 1-butanol production enhanced from 6.5 mg/L to 29.9 mg/L (Fig. 6A) . Current limitation may be the synthesis of malonyl- CoA. Compared to the high flux production of isobutanol and isobutyraldehyde in cyanobacteria, the carbon flux through the 1- butanol pathway is suboptimal. Malonyl-CoA biosynthesis is

considered as the limiting step in fatty acid biosynthesis. Therefore, increasing carbon flux towards the synthesis of acetyl- CoA and malonyl-CoA may be necessary to increase 1-butanol

production. Intracellular acetyl-CoA and malonyl-CoA supply may be increased by increasing CoA biosynthesis, overexpression of Acc, phosphoglycerate kinase (Pgk) , glyceraldehyde-3-phosphate

dehydrogenase (Gapd) , and inhibition of fatty acid biosynthesis. Combining these approaches, the malonyl-CoA dependent 1-butanol pathway is expected to achieve higher production.

[ 00140 ] This is the first example of recombinant 1-butanol production utilizing Bldh. Expression of Bldh alone would enable the production of butyraldehyde . Similar to the production of

isobutyraldehyde , butyraldehyde has a lower vapor pressure and solubility compared to 1-butanol. Therefore product removal by gas stripping is faster and thereby lowering product toxicity.

Butyraldehyde is also a useful chemical with annual consumption of around 1,200,000 tons in the U.S.. Furthermore, butyraldehyde is an important intermediate in the chemical production of 2-ethylhexanol, a widely used chemical for producing plasticizer with world-wide annual production of 2,600,000 tons.

[ 00141 ] A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, other embodiments are within the scope of the following claims.