Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
B4GALT1 VARIANTS AND USES THEREOF
Document Type and Number:
WIPO Patent Application WO/2018/226560
Kind Code:
A1
Abstract:
Variant B4GALT1 genomic, mRNA, and cDNA nucleic acid molecules, and polypeptides, methods of detecting the presence of these molecules, methods of modulating endogenous B4GALT1 genomic, mRNA, and cDNA nucleic acid molecules, and polypeptides, methods of ascertaining the risk of developing cardiovascular conditions by detecting the presence or absence of the variant B4GALT1 genomic, mRNA, and cDNA nucleic acid molecules, and polypeptides, and methods of treating cardiovascular conditions are provided herein.

Inventors:
MONTASSER MAY (US)
VAN HOUT CRISTOPHER (US)
SHULDINER ALAN (US)
GATTA GIUSY (US)
HEALY MATTHEW (US)
PUURUNEN MARJA (US)
Application Number:
PCT/US2018/035806
Publication Date:
December 13, 2018
Filing Date:
June 04, 2018
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
REGENERON PHARMA (US)
UNIV MARYLAND (US)
International Classes:
C12N9/10
Domestic Patent References:
WO2009025645A12009-02-26
WO2013176772A12013-11-28
WO2014089290A12014-06-12
WO2011145121A12011-11-24
WO2014131833A12014-09-04
WO2014165825A22014-10-09
WO2014065596A12014-05-01
Foreign References:
US5135917A1992-08-04
US5294533A1994-03-15
US5627158A1997-05-06
US5641754A1997-06-24
US5691317A1997-11-25
US5780607A1998-07-14
US5786138A1998-07-28
US5849903A1998-12-15
US5856103A1999-01-05
US5919772A1999-07-06
US5955590A1999-09-21
US5990088A1999-11-23
US5994320A1999-11-30
US5998602A1999-12-07
US6005095A1999-12-21
US6007995A1999-12-28
US6013522A2000-01-11
US6017898A2000-01-25
US6018042A2000-01-25
US6025198A2000-02-15
US6033910A2000-03-07
US6040296A2000-03-21
US6046004A2000-04-04
US6046319A2000-04-04
US6057437A2000-05-02
US4399216A1983-08-16
US4634665A1987-01-06
US5179017A1993-01-12
US4935233A1990-06-19
US4751180A1988-06-14
US20110239315A12011-09-29
US20110269234A12011-11-03
US20110145940A12011-06-16
US20030232410A12003-12-18
US20050208489A12005-09-22
US20050026157A12005-02-03
US20050064474A12005-03-24
US20060188987A12006-08-24
US20060063231A12006-03-23
US20160237456A12016-08-18
EP3045537A12016-07-20
US20160024523A12016-01-28
Other References:
ROBERT E HUMPHREYS ET AL: "ISOLATION AND IMMUNOLOGIC CHARACTERIZATION OF A HUMAN, B-LYMPHOCYTE-SPECIFIC, CELL SURFACE ANTIGEN", THE JOURNAL OF EXPERIMENTAL MEDICINE, 1 January 1976 (1976-01-01), pages 98 - 112, XP055505099, Retrieved from the Internet [retrieved on 20180906]
DATABASE Geneseq [online] 5 April 1993 (1993-04-05), "Encodes a HeLa cell galactosyltransferase enzyme.", XP002784507, retrieved from EBI accession no. GSN:AAQ31434 Database accession no. AAQ31434
DATABASE EMBL [online] 16 March 2000 (2000-03-16), "Human DNA sequence from clone RP11-326F20 on chromosome 9", XP002784508, retrieved from EBI accession no. EM_STD:AL161445 Database accession no. AL161445
WILLER CRISTEN J ET AL: "Newly identified loci that influence lipid concentrations and risk of coronary artery disease", NATURE GENETICS, NATURE PUBLISHING GROUP, NEW YORK, US, vol. 40, no. 2, 1 February 2008 (2008-02-01), pages 161 - 169, XP002516888, ISSN: 1061-4036, DOI: 10.1038/NG.76
DATABASE Geneseq [online] 4 June 2015 (2015-06-04), "LNCap cells/CL1 cells expressed protein, SEQ ID 1153.", XP002784509, retrieved from EBI accession no. GSP:BBX91845 Database accession no. BBX91845
DATABASE Geneseq [online] 15 October 2009 (2009-10-15), "Beta-1,4 galactosyltransferase (beta 4Gal-T1) CDS, SEQ ID:1.", XP002784510, retrieved from EBI accession no. GSN:AXQ25940 Database accession no. AXQ25940
P K QASBA ET AL: "Structure and function of beta-1,4-galactosyltransferase 1", CURR DRUG TARGETS., vol. 9, no. 4, 2 May 2008 (2008-05-02), pages 292 - 309, XP055505214
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410
ZHANG; MADDEN, GENOME RES., vol. 7, 1997, pages 649 - 656
SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482 - 489
"UniProt", Database accession no. P15291
MARATEA ET AL., GENE, vol. 40, 1985, pages 39 - 46
MURPHY ET AL., PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 8258 - 8262
RIZO; GIERASCH, ANN. REV. BIOCHEM., vol. 61, 1992, pages 387
ABRAHMSEN ET AL., BIOCHEMISTRY, vol. 30, 1991, pages 4151
DAWSON ET AL., SCIENCE, vol. 266, 1994, pages 776 - 779
SCHNOLZER ET AL., SCIENCE, vol. 256, 1992, pages 221
SAMBROOK ET AL.,: "Molecular Cloning: A Laboratory Manual, 2nd Ed.,", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS
AUSUBEL ET AL.,: "Current Protocols in Molecular Biology", 1992, GREENE PUBLISHING AND WILEY-INTERSCIENCE
INNIS ET AL.: "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS
"Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS, pages: 6.3.1 - 6.3.6
MEINKOTH; WAHL, ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284
KASPAREK; HUMPHREY, SEMINARS IN CELL & DEV. BIOL., vol. 22, 2011, pages 886 - 897
RAN ET AL., CELL, vol. 154, 2013, pages 1380 - 1389
MALI ET AL., NAT. BIOTECH., vol. 213, no. 31, pages 833 - 838
SHEN ET AL., NAT. METHODS, vol. 11, 2014, pages 399 - 404
FRENDEWEY ET AL., METHODS IN ENZYMOLOGY, vol. 476, 2010, pages 295 - 307
"UniProt", Database accession no. J7RUA5
"UniProt", Database accession no. AOQ7Q2
KONERMANN ET AL., NATURE, vol. 517, 2015, pages 583 - 588
SHEN ET AL., ARCH INTERN. MED., vol. 170, 2010, pages 1850 - 1855
LI; DURBIN, BIOINFORMATICS, vol. 25, 2009, pages 1754 - 1760
VAN DER AUWERA, CUR. PROTOCOLS IN BIOINFORMATICS, vol. 11, 2013, pages 11 - 33
MCKENNA, GENOME RES., vol. 20, 2010, pages 1297 - 1303
WANG ET AL., NUC. ACIDS RES., vol. 38, 2010, pages e164
MACHINGO ET AL., DEV. BIOL., vol. 297, 2006, pages 471 - 482
ROBU ET AL., PLOS GENET., vol. 3, 2007, pages e78
O'HARE ET AL., J. LIPID RES., vol. 55, 2014, pages 2242 - 2253
O'HARE ET AL., HEPATOLOGY, vol. 65, 2017, pages 1526 - 1542
Attorney, Agent or Firm:
LEGAARD, Paul, K. (US)
Download PDF:
Claims:
What is Claimed is:

1. An isolated nucleic acid molecule comprising a nucleic acid sequence at least about 90% at least about 95% at least about 98°% or at least about 99% identical to SEQ ID NO:l, provided that the nucleic acid sequence comprises a codon corresponding to positions 53575 to 53577 of SEQ I D NO:l that encodes a serine, or the complement thereof.

2. The isolated nucleic acid molecule according to claim 1, wherein the nucleic acid sequence comprises the nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:2.

3. The isolated nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid sequence is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to a portion of SEQ ID NO:2 comprising exons 1 to 6 of the B4GALT1 gene.

4. The isolated nucleic acid molecule according to claim 1 or 2, wherein the nucleic acid sequence comprises SEQ I D NO:2.

5. A vector, comprising the isolated nucleic acid molecule according to any one of claims l to 4.

6. The vector according to claim 5, fu rther comprising an exogenous donor sequence.

7. The vector according to claim 5 or 6, wherein the vector comprises a plasmid.

8. The vector according to claim 5 or 6, wherein the vector comprises a virus.

9. A composition, comprising the isolated nucleic acid molecu le according to any one of claims 1 to 4 and a carrier.

10. A composition, comprising the vector according to any one of claims 5 to 8 and a carrier.

11. A host cell comprising the isolated nucleic acid molecule according to any one of claims l to 4.

12. A host cell comprising the vector according to any one of claims 5 to 8.

13. The host cell according to claim 11 or 12, wherein the isolated nucleic acid molecule is operably linked to a promoter active in the host cell.

14. The host cell according to claim 13, wherein the promoter is an inducible promoter.

15. The host cell according to any one of claims 11 to 14, wherein the host cel l is a bacterial cel l, a yeast cel l, or an insect cell.

16. The host cell according to any one of claims 11 to 14, wherein the host cel l is a mammalian cel l.

17. A nucleic acid probe, comprising at least about 15 nucleotides and which hybridizes to the nucleic acid molecu le according to any one of claims 1 to 4, provided that the probe hybridizes to positions 53575 to 53577 of SEQ ID NO:l or SEQ ID NO:2, or the complement thereof.

18. An isolated nucleic acid molecule, comprising a nucleic acid sequence at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:4, provided that the nucleic acid sequence comprises a codon encoding a serine at the position corresponding to position 352 of the full length/mature B4GALT1 polypeptide, or the complement thereof.

19. The isolated nucleic acid molecule according to claim 18, wherein the nucleic acid sequence is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to a portion of SEQ ID NO:4 comprising exons 1 to 6 of the B4GALT1 gene.

20. The isolated nucleic acid molecule according to claim 18 or 19, wherein the nucleic acid sequence comprises SEQ ID NO:4.

21. A vector, comprising the isolated nucleic acid molecule according to any one of claims 18 to 20.

22. The vector according to claim 21, further comprising an exogenous donor sequence.

23. The vector according to claim 21 or 22, wherein the vector comprises a plasmid.

24. The vector according to claim 21 or 22, wherein the vector comprises a virus.

25. A composition, comprising the isolated nucleic acid molecu le according to any one of claims 18 to 20 and a carrier.

26. A composition, comprising the vector according to any one of claims 21 to 24 and a carrier.

27. A host cell comprising the isolated nucleic acid molecule according to any one of claims 18 to 20.

28. A host cell comprising the vector according to any one of claims 21 to 24.

29. The host cell according to claim 27 or 28, wherein the isolated nucleic acid molecu le is operably linked to a promoter active in the host cell.

30. The host cell according to claim 29, wherein the promoter is an inducible promoter. 31. The host cell according to any one of claims 27 to 30, wherein the host cel l is a bacterial cel l, a yeast cel l, or an insect cell.

32. The host cell according to any one of claims 27 to 30, wherein the host cel l is a mammalian cel l.

33. A nucleic acid probe, comprising at least about 15 nucleotides and which hybridizes to the nucleic acid molecu le according to any one of claims 18 to 28, provided that the probe hybridizes to positions 1243 to 1245 of SEQ ID NO:4, or the complement thereof.

34. An isolated nucleic acid molecule, comprising a nucleic acid sequence encoding a polypeptide at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ I D NO:8, provided that the polypeptide comprises a serine at position 352, or the complement thereof.

35. The isolated nucleic acid molecule according to claim 34, wherein the nucleic acid sequence encodes the polypeptide sequence of SEQ ID NO:8.

36. A vector, comprising the isolated nucleic acid molecule according to claim 34 or 35.

37. The vector according to claim 36, further comprising an exogenous donor sequence.

38. The vector according to claim 36 or 37, wherein the vector comprises a plasmid. 39. The vector according to claim 36 or 37, wherein the vector comprises a virus.

40. A composition, comprising the isolated nucleic acid molecu le according to claim 34 or 35 and a carrier.

41. A composition, comprising the vector according to any one of claims 36 to 39 and a carrier.

42. A host cell comprising the isolated nucleic acid molecule according to claim 34 or 35.

43. A host cell comprising the vector according to any one of claims 36 to 39.

44. The host cell according to claim 42 or 43, wherein the isolated nucleic acid molecu le is operably linked to a promoter active in the host cell.

45. The host cell according to claim 44, wherein the promoter is an inducible promoter. 46. The host cell according to any one of claims 42 to 45, wherein the host cel l is a bacterial cel l, a yeast cel l, or an insect cell.

47. The host cell according to any one of claims 42 to 45, wherein the host cel l is a mammalian cel l.

48. A nucleic acid probe, comprising at least about 15 nucleotides and which hybridizes to the nucleic acid molecu le according to claim 34 or 35, provided that the probe hybridizes to the portion of the nucleic acid sequence encoding a serine at position 352, or the complement thereof.

49. A cDNA encoding a hu man beta-l,4-galactosyltransferase 1 (B4GALT1) protein, comprising a nucleic acid sequence at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:6, provided that the nucleic acid sequence encodes a serine at the position corresponding to position 352 of the full length/mature B4GALT1 polypeptide, or the complement thereof.

50. The cDNA according to claim 49, wherein the nucleic acid sequence comprises SEQ I D NO:6.

51. A vector, comprising the cDNA according to claim 49 or 50.

52. The vector according to claim 51, further comprising an exogenous donor sequence.

53. The vector according to claim 51 or 52, wherein the vector comprises a plasmid.

54. The vector according to claim 51 or 52, wherein the vector comprises a virus.

55. A composition, comprising the cDNA according to claim 49 or 50 and a carrier.

56. A composition, comprising the vector according to any one of claims 51 to 54 and a carrier.

57. A host cell comprising the cDNA according to claim 49 or 50.

58. A host cell comprising the vector according to any one of claims 51 to 54.

59. The host cell according to claim 57 or 58, wherein the cDNA is operably lin ked to a promoter active in the host cell.

60. The host cell according to claim 59, wherein the promoter is an inducible promoter.

61. The host cell according to any one of claims 57 to 60, wherein the host cel l is a bacterial cel l, a yeast cel l, or an insect cell.

62. The host cell according to any one of claims 57 to 60, wherein the host cel l is a mammalian cel l.

63. A nucleic acid probe, comprising at least about 15 nucleotides and which hybridizes to the cDNA according to claim 49 or 50, provided that the probe hybridizes to positions 1054 to 1056 of SEQ ID NO:6, or the complement thereof.

64. An isolated polypeptide, comprising an amino acid sequence at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to a B4GALT1 variant polypeptide having SEQ ID NO:8, provided that the polypeptide comprises a serine

corresponding to position 352 of SEQ ID NO:8.

65. The polypeptide according to claim 64, wherein the B4GALT1 variant polypeptide comprises SEQ ID NO:8.

66. The polypeptide according to claim 64 or 65, wherein the polypeptide is further fused to a heterologous peptide.

67. The polypeptide according to claim 66, wherein the heterologous molecule comprises an immunoglobulin Fc domain, a peptide tag, fluorescent protein, or a transduction domain. 68. The polypeptide according to any one of claims 64 to 67, wherein the polypeptide is fu rther linked to label.

69. The polypeptide according to claim 68, wherein the label comprises polyethylene glycol, polysialic acid, or glycolic acid.

70. The polypeptide according to claim 68, wherein the label comprises a detectable fluorescent label or a radiolabel.

71. A composition, comprising the polypeptide according to any one of claims 64 to 70 and a carrier or excipient.

72. A host cell expressing the polypeptide according to any one of claims 64 to 70.

73. A method of producing the polypeptide according to any one of claims 64 to 70, comprising culturing a host cell comprising a nucleic acid molecu le encoding the polypeptide, whereby the cell expresses the polypeptide, and recovering the expressed polypeptide.

74. The method according to claim 73, wherein the nucleic acid molecule is under control of a heterologous promoter.

75. The method according to claim 73 or 74, wherein the nucleic acid molecule is under control of an inducible promoter.

76. A method of detecting a B4GALT1 variant nucleic acid molecu le in a hu man subject, comprising assaying a sample obtained from the subject to determine whether a nucleic acid molecule in the sample comprises a nucleic acid sequence that encodes a serine at the position corresponding to position 352 of the full length/mature B4GALT1 polypeptide.

77. The method according to claim 76, wherein the assay comprises:

sequencing a portion of the B4GALT1 genomic sequence of a nucleic acid molecule in the sample, wherein the portion sequenced includes positions corresponding to positions 53575 to 53577 of SEQ ID NO:2;

sequencing a portion of the B4GALT1 mRNA sequence of a nucleic acid molecu le in the sample, wherein the portion sequenced includes positions corresponding to positions 1243 to 1245 of SEQ ID NO:4; or sequencing a portion of the B4GALT1 cDNA sequence of a nucleic acid molecule in the sample, wherein the portion sequenced includes positions corresponding to positions 1054 to 1056 of SEQ ID NO:6.

78. The method according to claim 76, wherein the assay comprises:

a) contacting the sample with a primer hybridizing to: i) a portion of the B4GALT1 genomic sequence that is proximate to a position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577 of SEQ I D NO:2; ii) a portion of the B4GALT1 mRNA sequence that is proximate to a position of the B4GALT1 mRNA corresponding to positions 1243 to 1245 of SEQ ID NO:4; or iii) a portion of the B4GALT1 cDNA sequence that is proximate to a position of the B4GALT1 cDNA corresponding to positions 1054 to 1056 of SEQ ID NO:6; b) extending the primer at least th rough: i) the position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577; ii) the position of the B4GALT1 mRNA corresponding to positions 1243 to 1245; or iii) the position of the B4GALT1 cDNA

corresponding to positions 1054 to 1056; and

c) determining the whether the extension product of the primer comprises nucleotides at positions: i) corresponding to positions 53575 to 53577 of the B4GALT1 genomic sequence; ii) corresponding to positions 1243 to 1245 of the B4GALT1 mRNA; or iii) corresponding to positions 1054 to 1056 of the B4GALT1 cDNA; that encode a serine at position 352 of SEQ ID NO:8.

79. The method according to claim 76, wherein the assay comprises contacting the sample with a primer or probe that specifically hybridizes to the B4GALT1 variant genomic sequence, mRNA sequence, or cDNA sequence and not the corresponding wild-type B4GALT1 sequence u nder stringent conditions, and determining whether hybridization has occurred.

80. A method of detecting the presence of B4GALT1 Asn352Ser in a human subject, comprising performing an assay on a sample obtained from the human subject to determine whether a B4GALT1 protein in the sample comprises a serine residue at position 352.

81. A method of determining a hu man subject's susceptibility to developing a

cardiovascular condition, comprising:

a) assaying a sample obtained from the subject to determine whether a nucleic acid molecule in the sample comprises a nucleic acid sequence that encodes a serine at the position corresponding to position 352 of the full length/mature B4GALT1 polypeptide; and b) classifying the hu man su bject as being at decreased risk for developing the cardiovascular condition if the nucleic acid molecule comprises a nucleic acid sequence that encodes a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide, or classifying the human subject as being at increased risk for developing the cardiovascular condition if the nucleic acid molecule does not comprise a nucleic acid sequence that encodes a serine at the position corresponding to position 352 of the full length/mature B4GALT1 polypeptide.

82. The method according to claim 81, wherein the assay comprises:

sequencing a portion of the B4GALT1 genomic sequence of a nucleic acid molecule in the sample, wherein the portion sequenced includes positions corresponding to positions 53575 to 53577 of SEQ ID NO:2;

sequencing a portion of the B4GALT1 mRNA sequence of a nucleic acid molecu le in the sample, wherein the portion sequenced includes positions corresponding to positions 1243 to 1245 of SEQ ID NO:4; or

sequencing a portion of the B4GALT1 cDNA sequence of a nucleic acid molecule in the sample, wherein the portion sequenced includes positions corresponding to positions 1054 to 1056 of SEQ ID NO:6.

83. The method according to claim 81, wherein the assay comprises:

a) contacting the sample with a primer hybridizing to: i) a portion of the B4GALT1 genomic sequence that is proximate to a position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577 of SEQ I D NO:2; ii) a portion of the B4GALT1 mRNA sequence that is proximate to a position of the B4GALT1 mRNA corresponding to positions 1243 to 1245 of SEQ ID NO:4; or iii) a portion of the B4GALT1 cDNA sequence that is proximate to a position of the B4GALT1 cDNA corresponding to positions 1054 to 1056 of SEQ ID NO:6; b) extending the primer at least th rough: i) the position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577; ii) the position of the B4GALT1 mRNA corresponding to positions 1243 to 1245; or iii) the position of the B4GALT1 cDNA

corresponding to positions 1054 to 1056; and

c) determining the whether the extension product of the primer comprises nucleotides at positions: i) corresponding to positions 53575 to 53577 of the B4GALT1 genomic sequence; ii) corresponding to positions 1243 to 1245 of the B4GALT1 mRNA; or iii) corresponding to positions 1054 to 1056 of the B4GALT1 cDNA; that encode a serine at position 352 of SEQ ID NO:8.

84. The method according to claim 81, wherein the assay comprises contacting the sample with a primer or probe that specifically hybridizes to the B4GALT1 variant genomic sequence, mRNA sequence, or cDNA sequence and not the corresponding wild-type B4GALT1 sequence u nder stringent conditions, and determining whether hybridization has occurred.

85. The method according to any one of claims 81 to 84, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

86. The method according to claim 85, wherein the serum lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

87. The method according to any one of claims 81 to 84, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

88. The method according to any one of claims 81 to 84, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

89. The method according to any one of claims 81 to 84, wherein the cardiovascular condition comprises an atheroth rombotic condition.

90. The method according to claim 89, wherein the atheroth rombotic condition comprises elevated levels of fibrinogen.

91. The method according to claim 90, wherein the atheroth rombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

92. The method according to any one of claims 81 to 84, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

93. The method according to claim 92, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

94. The method according to any one of claims 81 to 93, fu rther comprising: c) for a su bject having an increased risk for developing a cardiovascular condition, administering a therapeutic agent that treats or in hibits the cardiovascular condition.

95. A method of determining a hu man subject's susceptibility to developing a

cardiovascular condition, comprising:

a) performing an assay on a sample obtained from the hu man subject to determine whether a B4GALT1 protein in the sample comprises a serine residue at position 352; and b) classifying the hu man su bject as being at decreased risk for developing the cardiovascular condition if the B4GALT1 polypeptide comprises a serine at the position corresponding to position 352 of the full length/mature B4GALT1 polypeptide, or classifying the human subject as being at increased risk for developing the cardiovascu lar condition if the B4GALT1 polypeptide does not comprise a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide.

96. The method according to claim 95, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

97. The method according to claim 96, wherein the serum lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

98. The method according to claim 95, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

99. The method according to claim 95, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

100. The method according to claim 95, wherein the cardiovascular condition comprises an atheroth rombotic condition.

101. The method according to claim 100, wherein the atherothrombotic condition comprises elevated levels of fibrinogen.

102. The method according to claim 101, wherein the atherothrombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

103. The method according to claim 95, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

104. The method according to claim 103, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

105. The method according to any one of claims 95-105, further comprising: c) for a subject having an increased risk for developing a cardiovascu lar condition, ad ministering a therapeutic agent that treats or inhibits the cardiovascular condition.

106. A guide RNA effective to direct a Cas enzyme to bind to or cleave an endogenous B4GALT1 gene, wherein the guide RNA comprises a DNA-targeting segment that hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene that includes or is proximate to a position corresponding to positions 53575 to 53577 of SEQ I D NO:l.

107. The guide RNA according to claim 106, wherein the guide RNA recognition sequence is selected from SEQ I D NOs:9-12.

108. The guide RNA according to claim 106, wherein the guide RNA recognition sequence is within about 1000 nucleotides of the position corresponding to positions 53575 to 53577 of SEQ ID NO: 1.

109. The guide RNA according to claim 108, wherein the guide RNA recognition sequence includes the position corresponding to positions 53575 to 53577 of SEQ ID NO:l.

110. The guide RNA according to claim 109, wherein the endogenous B4GALT1 gene comprises SEQ ID NO:l.

111. The guide RNA according to any one of claims 106 to 110, wherein the guide RNA comprises a Clustered Regu larly Interspaced Short Palind romic Repeats (CRISPR) RNA (crRNA) comprising the DNA-targeting segment and a trans-activating CRISPR RNA (tracrRNA).

112. An isolated nucleic acid molecule comprising a DNA encoding the guide RNA according to any one of claims 106 to 111.

113. A vector comprising the isolated nucleic acid molecu le according to claim 112 and a heterologous nucleic acid.

114. A composition comprising the guide RNA according to any one of claims 106 to 112 and a Cas protein.

115. A cell comprising the guide RNA according to any one of claims 106 to 111.

116. A method of modifying an endogenous B4GALT1 gene in a cel l, comprising contacting the genome of the cel l with:

a) a Cas protein; and

b) a guide RNA that forms a complex with the Cas protein and hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the guide RNA recognition sequence includes or is proximate to a position corresponding to positions 53575 to 53577 of SEQ I D NO:l, wherein the Cas protein cleaves the B4GALT1 gene.

117. The method according to claim 116, wherein the guide RNA recognition sequence is selected from SEQ I D NOS:9-12.

118. The method according to claim 116, wherein the guide RNA recognition sequence is within about 1000 nucleotides of the position corresponding to positions 53575 to 53577 of

SEQ ID NO:l.

119. The method according to claim 118, wherein the guide RNA recognition sequence includes the positions corresponding to positions 53575 to 53577 of SEQ I D NO:l.

120. The method according to any one of claims 116 to 119, further comprising contacting the genome with an exogenous donor sequence comprising a 5' homology arm that hybridizes to a target sequence 5' of the position corresponding to positions 53575 to 53577 of SEQ ID NO: l and a 3' homology arm that hybridizes to a target sequence 3' of the position

corresponding to positions 53575 to 53577 of SEQ I D NO:l, wherein the exogenous donor sequence recombines with the endogenous B4GALT1 gene.

121. The method according to claim 120, wherein the exogenous donor sequence further comprises a nucleic acid insert flanked by the 5' homology arm and the 3' homology arm.

122. The method according to claim 116, wherein the nucleic acid insert comprises a nucleic acid sequence encoding a serine, and wherein upon recombination of the exogenous donor sequence with the endogenous B4GALT1 gene, the nucleic acid insert is inserted into the endogenous B4GALT1 gene, wherein the nucleic acid sequence encoding the serine is inserted into positions of the endogenous B4GALT1 gene corresponding to positions 53575 to 53577 of SEQ ID NO:l.

123. The method according to any one of claims 120 to 122, wherein the exogenous donor sequence is from about 50 nucleotides to about 1 kb in length.

124. The method according to claim 123, wherein the exogenous donor sequence is from about 80 nucleotides to about 200 nucleotides in length.

125. The method according to any one of claims 120 to 124, wherein the exogenous donor sequence is a single-stranded oligodeoxynucleotide.

126. A method of modifying an endogenous B4GALT1 gene in a cel l, comprising contacting the genome of the cel l with:

a) a Cas protein; and

b) a first guide RNA that forms a complex with the Cas protein and hybridizes to a first guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the first guide RNA recognition sequence comprises the start codon for the B4GALT1 gene or is within about 1,000 nucleotides of the start codon or is selected from SEQ ID NOS:9-12, wherein the Cas protein cleaves or alters expression of the endogenous B4GALT1 gene.

127. The method according to claim 126, wherein the first guide RNA recognition sequence is selected from SEQ ID NOS:9-12.

128. The method according to claim 126 or claim 127, wherein the Cas protein is a nuclease-active Cas protein.

129. The method according to claim 126 or claim 127, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcriptional activator domain or a transcriptional repressor domain.

130. The method according to any one of claims 126 to 128, further comprising contacting the genome of the cel l with a second guide RNA that forms a complex with the Cas protein and hybridizes to a second guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the second guide RNA recognition sequence comprises the stop codon for the endogenous B4GALT1 gene or is within about 1,000 nucleotides of the stop codon or is selected from SEQ ID NOS:9-12, wherein the cell is modified to comprise a deletion between the first guide RNA recognition sequence and the second guide RNA recognition sequence.

131. The method according to any one of claims 126 to 130, further comprising introducing an expression vector into the cel l, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a serine inserted at positions corresponding to positions 53575 to 53577 of SEQ I D NO:2.

132. The method according to claim 131, wherein the recombinant B4GALT1 gene is a B4GALT1 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild-type B4GALT1 gene.

133. The method according to claim 132, wherein the deleted segments comprise one or more intronic sequences.

134. The method according to any one of claims 126 to 130, further comprising introducing an expression vector into the cel l, wherein the expression vector comprises a nucleic acid molecule encoding a B4GALT1 polypeptide that is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:8 and comprises a serine at position 352 corresponding to SEQ I D NO:8.

135. The method according to any one of claims 126 to 13, further comprising introducing a B4GALT1 polypeptide, or fragment thereof, into the cell, wherein the protein or fragment thereof is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ I D NO:8 and comprises a serine at position 352 corresponding to SEQ ID NO:8.

136. The method according to any one of claims 126 to 135, wherein the Cas protein is Cas9.

137. A method for modifying a cell, comprising introducing an expression vector into the cell, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a serine inserted at positions corresponding to positions 53575 to 53577 of SEQ ID NO:2.

138. The method according to claim 137, wherein the recombinant B4GALT1 gene is a

B4GALT1 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild-type B4GALT1 gene.

139. The method according to claim 138, wherein the deleted segments comprise one or more intronic sequences.

140. A method for modifying a cell, comprising introducing an expression vector into the cell, wherein the expression vector comprises a nucleic acid molecule encoding a B4GALT1 polypeptide that is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:8, and comprises a serine at position 352 corresponding to SEQ ID NO:8.

141. A method for modifying a cell, comprising introducing a B4GALT1 polypeptide, or fragment thereof into the cell, wherein the B4GALT1 polypeptide is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:8, and comprises a serine at position 352 corresponding to SEQ ID NO:8.

142. A method of treating a su bject who is not a carrier of the B4GALT1 variant and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject: a) a Cas protein or a nucleic acid encoding the Cas protein;

b) a guide RNA or a nucleic acid encoding the guide RNA, wherein the guide RNA forms a complex with the Cas protein and hybridizes to a guide RNA recognition sequence within an endogenous B4GALT1 gene, wherein the guide RNA recognition sequence includes or is proximate to a position corresponding to positions 53575 to 53577 of SEQ I D NO:l; and

c) an exogenous donor sequence comprising a 5' homology arm that hybridizes to a target sequence 5' of the positions corresponding to positions 53575 to 53577 of SEQ I D NO:l, a 3' homology arm that hybridizes to a target sequence 3' of the positions corresponding to positions 53575 to 53577 of SEQ ID NO:l, and a nucleic acid insert comprising a nucleotide sequence encoding a serine at positions corresponding to positions 53575 to 53577 of SEQ ID NO:2 flan ked by the 5' homology arm and the 3' homology arm, wherein the Cas protein cleaves the endogenous B4GALT1 gene in a cell in the subject and the exogenous donor sequence recombines with the endogenous B4GALT1 gene in the cell, wherein upon recombination of the exogenous donor sequence with the endogenous B4GALT1 gene, the serine is inserted at nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO: l.

143. The method according to claim 142, wherein the guide RNA recognition sequence is selected from SEQ I D NOS:9-12.

144. The method according to claim 142, wherein the guide RNA recognition sequence is within about 1000 nucleotides of the position corresponding to positions 53575 to 53577 of SEQ ID NO:l.

145. The method according to claim 142, wherein the guide RNA recognition sequence includes the position corresponding to positions 53575 to 53577 of SEQ ID NO:l.

146. The method according to any one of claims 142 to 145, wherein the exogenous donor sequence is from about 50 nucleotides to about 1 kb in length.

147. The method according to claim 146, wherein the exogenous donor sequence is from about 80 nucleotides to about 200 nucleotides in length.

148. The method according to any one of claims 142 to 147, wherein the exogenous donor sequence is a single-stranded oligodeoxynucleotide.

149. The method according to any one of claims 142 to 148, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

150. The method according to claim 149, wherein the seru m lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

151. The method according to any one of claims 142 to 148, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

152. The method according to any one of claims 142 to 148, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

153. The method according to any one of claims 142 to 148, wherein the cardiovascular condition comprises an atheroth rombotic condition.

154. The method according to claim 153, wherein the atherothrombotic condition comprises elevated levels of fibrinogen.

155. The method according to claim 154, wherein the atherothrombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

156. The method according to any one of claims 142 to 148, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

157. The method according to claim 156, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

158. A method of treating a su bject who is not a carrier of the B4GALT1 variant and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject: a) a Cas protein or a nucleic acid encoding the Cas protein;

b) a first guide RNA or a nucleic acid encoding the first guide RNA, wherein the first guide RNA forms a complex with the Cas protein and hybridizes to a first guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the first guide RNA recognition sequence comprises the start codon for the endogenous B4GALT1 gene or is within about 1,000 nucleotides of the start codon or is selected from SEQ ID NOS:9-12; and

c) an expression vector comprising a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a serine at positions corresponding to positions 53575 to 53577 of SEQ ID NO:2, wherein the Cas protein cleaves or alters expression of the endogenous

B4GALT1 gene in a cell in the su bject and the expression vector expresses the recombinant B4GALT1 gene in the cell in the subject.

159. The method according to claim 158, wherein the first guide RNA recognition sequence is selected from SEQ ID NOS:9-12.

160. The method according to claim 158 or claim 159, wherein the Cas protein is a nuclease-active Cas protein.

161. The method according to claim 158 or claim 159, wherein the Cas protein is a nuclease-inactive Cas protein fused to a transcriptional repressor domain.

162. The method according to any one of claims 158 to 161, further comprising introducing into the subject a second guide RNA, wherein the second guide RNA forms a complex with the

Cas protein and hybridizes to a second guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the second guide RNA recognition sequence comprises the stop codon for the endogenous B4GALT1 gene or is within about 1,000 nucleotides of the stop codon or is selected from SEQ I D NOS:9-12, wherein the Cas protein cleaves the endogenous B4GALT1 gene in the cel l within both the first guide RNA recognition sequence and the second guide RNA recognition sequence, wherein the cell is modified to comprise a deletion between the first guide RNA recognition sequence and the second guide RNA recognition sequence.

163. The method according to any one of claims 158 to 162, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

164. The method according to claim 163, wherein the seru m lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

165. The method according to any one of claims 158 to 162, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

166. The method according to any one of claims 158 to 162, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

167. The method according to any one of claims 158 to 162, wherein the cardiovascular condition comprises an atheroth rombotic condition.

168. The method according to claim 167, wherein the atherothrombotic condition comprises elevated levels of fibrinogen.

169. The method according to claim 168, wherein the atherothrombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

170. The method according to any one of claims 158 to 162, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

171. The method according to claim 170, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

172. The method according to any one of claims 142 to 171, wherein the Cas protein is Cas9.

173. A method of treating a su bject who is not a carrier of the B4GALT1 variant and has or is susceptible to developing a cardiovascular condition comprising introducing into the subject an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within the endogenous B4GALT1 gene and decreases expression of B4GALT1 polypeptide in a cell in the su bject.

174. The method according to claim 173, fu rther comprising introducing an expression vector into the subject, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a serine at positions corresponding to positions 53575 to 53577 of SEQ ID NO:2, wherein the expression vector expresses the recombinant B4GALT1 gene in a cell in the su bject.

175. The method according to claim 173, fu rther comprising introducing an expression vector into the subject, wherein the expression vector comprises a nucleic acid molecu le encoding a B4GALT1 polypeptide that is at least about 90%, at least about 95%, at least about 98% or at least about 99% identical to SEQ ID NO:8 (B4GALT1 Asn352Ser), wherein the expression vector expresses the nucleic acid encoding the B4GALT1 polypeptide in the cell in the subject.

176. The method according to claim 173, fu rther comprising introducing an mRNA into the su bject, wherein the mRNA encodes a B4GALT1 polypeptide that is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:8 [B4GALT1 Asn352Ser), wherein the mRNA expresses the B4GALT1 polypeptide in the cel l in the subject.

177. The method according to claim 173, fu rther comprising introducing a B4GALT1 Asn352Ser polypeptide or fragment thereof into the subject, wherein the polypeptide is at least about 90%, at least about 95%, at least about 98%, or at least about 99% identical to SEQ ID NO:8 and comprises a serine at position 352 corresponding to SEQ ID NO:8.

178. The method according to any one of claims 173 to 177, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

179. The method according to claim 178, wherein the seru m lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

180. The method according to any one of claims 173 to 177, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

181. The method according to any one of claims 173 to 177, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

182. The method according to any one of claims 173 to 177, wherein the cardiovascular condition comprises an atheroth rombotic condition.

183. The method according to claim 182, wherein the atherothrombotic condition comprises elevated levels of fibrinogen.

184. The method according to claim 183, wherein the atherothrombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

185. The method according to any one of claims 173 to 177, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

186. The method according to claim 185, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

187. A method of treating a su bject who is not a carrier of the B4GALT1 variant and has or is susceptible to developing a cardiovascular condition comprising introducing an expression vector into the subject, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a serine at positions corresponding to positions 53575 to 53577 of SEQ ID NO:2, wherein the expression vector expresses the recombinant B4GALT1 gene in a cell in the su bject.

188. The method according to claim 187 wherein recombinant B4GALT1 gene is at least about 90% at least about 95°% at least about 98% or at least about 99% identical to SEQ ID

NO:2.

189. The method according to claim 187 or claim 188, wherein the recombinant B4GALT1 gene is a B4GALT1 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild-type B4GALT1 gene.

190. The method of claim 187, wherein the deleted segments comprise one or more intronic sequences.

191. The method according to any one of claims 187 to 190, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

192. The method according to claim 191, wherein the seru m lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

193. The method according to any one of claims 187 to 190, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

194. The method according to any one of claims 187 to 190, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

195. The method according to any one of claims 187 to 190, wherein the cardiovascular condition comprises an atheroth rombotic condition.

196. The method according to claim 195, wherein the atherothrombotic condition comprises elevated levels of fibrinogen.

197. The method according to claim 196, wherein the atherothrombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

198. The method according to any one of claims 187 to 190, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

199. The method according to claim 198, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

200. The method according to any one of claims 187 to 199, wherein the expression vector is the vector of any one of claims 5 to 8, 21 to 24, 36 to 39, and 51 to 54.

201. A method of treating a su bject who is not a carrier of a B4GALT1 variant and has or is susceptible to developing a cardiovascular condition comprising introducing an expression vector into the subject, wherein the expression vector comprises a nucleic acid encoding a B4GALT1 polypeptide that is at least about 90% at least about 95% at least about 98% or at least about 99% identical to SEQ ID NO:8 [B4GALT1 Asn352Ser), wherein the expression vector expresses the nucleic acid encoding the B4GALT1 polypeptide in a cell in the subject.

202. The method according to claim 201, wherein the expression vector is the vector of any one of claims 5 to 8, 21 to 24, 36 to 39, and 51 to 54.

203. A method of treating a su bject who is not a carrier of a B4GALT1 variant and has or is susceptible to developing a cardiovascular condition comprising introducing an mRNA into the su bject, wherein the mRNA encodes an B4GALT1 polypeptide that is at least about 90%, at least about 95%, at least about 98% or at least about 99% identical to SEQ ID NO:8 [B4GALT1 Asn352Ser), wherein the mRNA expresses the B4GALT1 polypeptide in a cell in the subject.

204. A method of treating a su bject who is not a carrier of a B4GALT1 variant and has or is susceptible to developing a cardiovascular condition comprising introducing a B4GALT1

Asn352Ser protein or fragment thereof into the subject, wherein the B4GALT1 polypeptide is at least about 90%, at least about 95%, at least about 98% or at least about 99% identical to SEQ I D NO:8 (B4GALT1 Asn352Ser).

205. The method according to claim 204, wherein the polypeptide is the polypeptide of any one of claims 63 to 70.

206. The method according to any one of claims 142 to 205, wherein the introducing into the subject comprises hydrodynamic delivery, virus-mediated delivery, lipid-nanoparticle- mediated delivery, or intravenous infusion.

207. The method according to any one of claims 201 to 206, wherein the cardiovascular condition comprises an elevated level of one or more serum lipids.

208. The method according to claim 207, wherein the seru m lipids comprise one or more of cholesterol, LDL, H DL, triglycerides, HDL-cholesterol, and non-HDL cholesterol.

209. The method according to any one of claims 201 to 206, wherein the cardiovascular condition comprises elevated levels of coronary artery calcification.

210. The method according to any one of claims 201 to 206, wherein the cardiovascular condition comprises elevated levels of pericardial fat.

211. The method according to any one of claims 201 to 206, wherein the cardiovascular condition comprises an atheroth rombotic condition.

212. The method according to claim 211, wherein the atherothrombotic condition comprises elevated levels of fibrinogen.

213. The method according to claim 212, wherein the atherothrombotic condition comprises a blood clot formed from the involvement of fibrinogen activity.

214. The method according to any one of claims 201 to 206, wherein the cardiovascular condition comprises elevated levels of fibrinogen.

215. The method according to claim 214, wherein the cardiovascular condition comprises a blood clot formed from the involvement of fibrinogen activity.

Description:
B4GALT1 Variants And Uses Thereof

Reference To Government Grants

This invention was made with government support under HL121007 awarded by the National I nstitutes of Health. The govern ment has certain rights in the invention.

Reference to a Sequence Listing

This application includes a Sequence Listing submitted electronical ly as a text file named 18923800202SEQ, created on June 4, 2018, with a size of 161 KB. The Sequence Listing is incorporated by reference herein.

Field

The present disclosu re provides variant B4GALT1 genomic, mRNA, and cDNA nucleic acid molecu les, and polypeptides, methods of detecting the presence of these molecules, methods of modu lating endogenous B4GALT1 genomic, mRNA, and cDNA nucleic acid molecules, and polypeptides, methods of ascertaining the risk of developing cardiovascu lar conditions by detecting the presence or absence of the variant B4GALT1 genomic, mRNA, and cDNA nucleic acid molecules, and polypeptides, and methods of treating cardiovascular conditions.

Background

Various publications, including patents, published applications, accession numbers, technical articles and scholarly articles are cited throughout the specification. Each cited publication is incorporated by reference herein, in its entirety and for all purposes.

Beta-l,4-galactosyltransferase 1 (B4GALT1) is a member of the beta-1,4- galactosyltransferase gene family which encode type I I membrane-bound glycoproteins that play a role in the biosynthesis of different glycoconjugates and saccharide structures. The enzyme encoded by B4GALT1 plays a critical role in the processing of N-linked oligosaccharide moieties in glycoproteins, and protein-linked sugar chains often modulate the biological fu nctions of the glycoprotein. Thus, an impaired B4GALT1 activity has potential to alter the structu re of all glycoproteins containing N-linked oligosaccharides. The long form of the B4GALT1 enzyme is localized in the trans-Golgi, where it transfers galactosyl residues to N- acetylglucosamine residues during the course of biosynthetic processing of high-man nose to complex-type N-linked oligosaccharides. Because addition of galactosyl residues is a prerequisite for addition of sialic acids, a defect in B4GALT1 exerts an indirect effect to block addition of sialic acid residues and, therefore, may alter the half-life of plasma glycoproteins. Defects in glycosylation have been reported to impair intracellular trafficking of various glycoproteins - including the LDL receptor. Fu rther, structural abnormalities in N-linked oligosaccharides have the potential to alter protein folding, which in turn could alter the fu nction of glycoproteins and their secretion. A large percentage of proteins contain N-linked glycosylation, including cell su rface receptors (e.g., LDL receptors and insulin receptors) as wel l as various circu lating plasma proteins (e.g., apolipoprotein B and fibrinogen). There have been reports of patients with genetic disease due to homozygosity for protein-truncating mutations in the B4GALT1 gene. One such patient had a severe phenotype characterized by a) severe neu rodevelopmental abnormalities (including hydrocephalus), b) myopathy, and c) blood clotting abnormalities. As predicted, oligosaccharides derived from circulating transferrin lacked galactose and sialic acid residues. Two additional patients with the same genetic defect presented with a milder phenotype, characterized by coagulation disturbances, hepatopathy, and dysmorphic featu res.

Cardiovascular disease is the leading cause of death in the United States and other westernized countries. Major risk factors for atherothrombotic cardiovascu lar diseases such as stroke and myocardial infarction include increased blood cholesterol and thrombotic tendency. Many proteins that are involved in lipid metabolism and coagulation are glycosylated and, thus, su bject to modulation by B4GALT1. Knowledge of genetic factors underlying the development and progression of cardiovascular conditions cou ld improve risk stratification and provide the foundation for novel therapeutic strategies.

Summary

The present disclosu re provides nucleic acid molecules comprising a nucleic acid sequence at least about 90% identical to the B4GALT1 variant genomic sequence (that comprises the SNP designated rs551564683), provided that the nucleic acid sequence also comprises nucleotides that encode a serine at the position corresponding to position 352 of the fu ll length/mature B4GALT1 polypeptide. The present disclosu re also provides nucleic acid molecu les comprising a nucleic acid sequence at least about 90% identical to the B4GALT1 variant mRNA sequence (that comprises the SNP designated rs551564683), provided that the nucleic acid sequence also encodes a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide.

The present disclosu re also provides cDNA molecules encoding a B4GALT1 polypeptide that comprise a nucleic acid sequence at least about 90% identical to the B4GALT1 variant cDNA sequence (that comprises the SNP designated rs551564683), provided that the nucleic acid sequence also encodes a serine at the position corresponding to position 352 in the fu ll length/mature B4GALT1 polypeptide.

The present disclosu re also provides vectors or exogenous donor sequences comprising any one or more of these nucleic acid molecu les.

The present disclosu re also provides isolated polypeptides comprising an amino acid sequence at least about 90% identical to a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide.

The present disclosu re also provides host cells comprising any one of more of these nucleic acid molecules operably linked to a heterologous promoter active in the host cell.

The present disclosu re also provides methods of producing the B4GALT1 polypeptide by cultu ring a host cel l containing a nucleic acid molecu le encoding the B4GALT1 polypeptide, wherein the nucleic acid molecule is operably linked to a heterologous promoter active in the host cell, whereby the nucleic acid molecu le is expressed, and recovering the isolated polypeptide.

The present disclosu re also provides compositions comprising these nucleic acid molecules, or polypeptides, and a carrier for increasing their stability.

The present disclosu re also provides methods of detecting the presence or absence of a B4GALT1 variant nucleic acid molecule (that comprises the SNP designated rs551564683) in a human subject, comprising performing an assay on a biological sample from the human subject that determines whether a nucleic acid molecule in the biological sample comprises a nucleic acid sequence that encodes a variant B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide.

The present disclosu re also provides methods of detecting the presence of a variant B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/mature B4GALT1 polypeptide in a hu man su bject, comprising performing an assay on a biological sample from the human subject that determines the presence of the variant B4GALT1 polypeptide.

The present disclosu re also provides methods of determining a human subject's susceptibility to developing a cardiovascu lar condition, comprising: a) performing an assay on a biological sample from the human subject that determines whether a nucleic acid molecule in the biological sample comprises a nucleic acid sequence that encodes a variant B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide; and b) classifying the hu man su bject as being at decreased risk for developing the cardiovascu lar condition if a nucleic acid molecule comprising a nucleic acid sequence that encodes a variant B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/matu re B4GALT1 polypeptide is detected in the biological sample, or classifying the human subject as being at increased risk for developing the cardiovascular condition if a nucleic acid molecu le comprising a nucleic acid sequence that encodes a variant B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide is not detected in the biological sample.

The present disclosu re also provides methods of determining a human subject's susceptibility to developing a cardiovascu lar condition, comprising: a) performing an assay on a biological sample from the human subject that determines whether a B4GALT1 polypeptide in the biological sample comprises a serine at a position corresponding to position 352; and b) classifying the human subject as being at decreased risk for developing the cardiovascular condition if a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the fu ll length/mature B4GALT1 polypeptide is detected in the biological sample, or classifying the human subject as being at increased risk for developing the cardiovascular condition if a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the fu ll length/mature B4GALT1 polypeptide is not detected in the biological sample.

The present disclosu re also provides guide RNA molecules effective to direct a Cas enzyme to bind to or cleave an endogenous B4GALT1 gene, wherein the guide RNA comprises a DNA-targeting segment that hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene that includes or is proximate (for instance, within a certain number of nucleotides, such as discussed below) to a position corresponding to positions 53575 to 53577 of the wild-type B4GALT1 gene.

The present disclosu re also provides methods of modifying an endogenous B4GALT1 gene in a cell, comprising contacting the genome of the cel l with: a) a Cas protein; and b) a guide RNA that forms a complex with the Cas protein and hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the guide RNA recognition sequence includes or is proximate (for instance, within a certain number of nucleotides, such as discussed below) to a position corresponding to positions 53575 to 53577 of the wild-type B4GALT1 gene, wherein the Cas protein cleaves the endogenous B4GALT1 gene.

The present disclosu re also provides methods of modifying an endogenous B4GALT1 gene in a cell, comprising contacting the genome of the cel l with: a) a Cas protein; and b) a first guide RNA that forms a complex with the Cas protein and hybridizes to a first guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the first guide RNA recognition sequence comprises the start codon for the B4GALT1 gene or is within about 1,000 nucleotides of the start codon, wherein the Cas protein cleaves or alters expression of the endogenous B4GALT1 gene.

The present disclosu re also provides methods for modifying a cel l, comprising introducing an expression vector into the cell, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a B4GALT1

polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide.

The present disclosu re also provides methods for modifying a cel l, comprising introducing an expression vector into the cell, wherein the expression vector comprises a nucleic acid molecule encoding a polypeptide that is at least about 90% identical to a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide, wherein the polypeptide also comprises a serine at the position corresponding to position 352 in the ful l length/matu re B4GALT1 polypeptide.

The present disclosu re also provides methods for modifying a cel l, comprising introducing a polypeptide, or fragment thereof, into the cell, wherein the polypeptide is at least 90% identical to a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/mature B4GALT1 polypeptide, and wherein the polypeptide also comprises a serine at the position corresponding to position 352 in the full length/matu re B4GALT1 polypeptide.

The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the su bject: a) a Cas protein or a nucleic acid encoding the Cas protein; b) a guide RNA or a nucleic acid encoding the guide RNA, wherein the guide RNA forms a complex with the Cas protein and hybridizes to a guide RNA recognition sequence within an endogenous B4GALT1 gene, wherein the guide RNA recognition sequence includes or is proximate to a position corresponding to positions 53575 to 53577 of the wild-type B4GALT1 gene; and c) an exogenous donor sequence comprising a 5' homology arm that hybridizes to a target sequence 5' of the positions corresponding to positions 53575 to 53577 of the wild-type B4GALT1 gene, a 3' homology arm that hybridizes to a target sequence 3' of the positions corresponding to positions 53575 to 53577 of the wild-type B4GALT1 gene, and a nucleic acid insert comprising a nucleotide sequence encoding a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide flan ked by the 5' homology arm and the 3' homology arm, wherein the Cas protein cleaves the endogenous B4GALT1 gene in a cel l in the subject and the exogenous donor sequence recombines with the endogenous B4GALT1 gene in the cell, wherein upon recombination of the exogenous donor sequence with the endogenous B4GALT1 gene, the serine is inserted at nucleotides corresponding to positions 53575 to 53577 of the wild-type B4GALT1 gene.

The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the su bject: a) a Cas protein or a nucleic acid encoding the Cas protein; b) a first guide RNA or a nucleic acid encoding the first guide RNA, wherein the first guide RNA forms a complex with the Cas protein and hybridizes to a first guide RNA recognition sequence within the endogenous B4GALT1 gene, wherein the first guide RNA recognition sequence comprises the start codon for the endogenous B4GALT1 gene or is within about 1,000 nucleotides of the start codon; and c) an expression vector comprising a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/matu re B4GALT1 polypeptide, wherein the Cas protein cleaves or alters expression of the endogenous B4GALT1 gene in a cell in the su bject and the expression vector expresses the recombinant B4GALT1 gene in the cell in the su bject.

The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition comprising introducing into the su bject an antisense DNA, RNA, an siRNA, or an shRNA that hybridizes to a sequence within the endogenous B4GALT1 gene and decreases expression of B4GALT1 polypeptide in a cell in the subject.

The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition comprising introducing an expression vector into the su bject, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a

B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/mature B4GALT1 polypeptide, wherein the expression vector expresses the recombinant B4GALT1 gene in a cell in the su bject.

The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition comprising introducing an expression vector into the su bject, wherein the expression vector comprises a nucleic acid molecule encoding a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/matu re B4GALT1 polypeptide, wherein the expression vector expresses the nucleic acid encoding the B4GALT1 polypeptide in a cell in the subject.

The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition comprising introducing an mRNA into the subject, wherein the mRNA encodes a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the full length/mature B4GALT1 polypeptide, wherein the mRNA expresses the B4GALT1 polypeptide in a cel l in the subject. The present disclosu re also provides methods of treating a subject who is not a carrier of the B4GALT1 variant nucleic acid molecule or polypeptide (that comprises the SNP designated rs551564683) and has or is susceptible to developing a cardiovascular condition comprising introducing a B4GALT1 polypeptide having a serine at the position corresponding to position 352 in the ful l length/mature B4GALT1 polypeptide or fragment thereof into the su bject.

In any of the methods described or exemplified herein, a cardiovascu lar condition may comprise levels of one or more seru m lipids that increase atherosclerotic risk. The serum lipids comprise one or more of cholesterol, LDL, HDL, triglycerides, HDL-cholesterol, and non-HDL cholesterol, or any subfraction thereof (e.g., HDL2, HDL2a, HDL2b, HDL2c, HDL3, HDL3a, HDL3b, HDL3c, HDL3d, LDL1, LDL2, LDL3, lipoprotein A, Lpal, Lpal, Lpa3, Lpa4, or Lpa5). A

cardiovascular condition may comprise elevated levels of coronary artery calcification. A cardiovascular condition may comprise elevated levels of pericardial fat. A cardiovascular condition may comprise an atherothrombotic condition. The atherothrombotic condition may comprise elevated levels of fibrinogen. The atherothrombotic condition may comprise a fibrinogen-mediated blood clot. A cardiovascular condition may comprise elevated levels of fibrinogen. A cardiovascu lar condition may comprise a fibrinogen-mediated blood clot. A cardiovascular condition may comprise a blood clot formed from the involvement of fibrinogen activity. A fibrinogen-mediated blood clot or blood clot formed from the involvement of fibrinogen activity may be in any vein or artery in the body.

Brief Description Of the Figures

Figu re 1 shows the results of a representative genome-wide association of variant B4GALT1 with LDL.

Figu re 2 shows the results of a representative TOPMed WGS association of variant

B4GALT1 with LDL.

Figu re 3 shows the results of a representative haplotype structu re of the top B4GALT1- associated SNPs.

Figu re 4 shows the association of the variant B4GALT1 gene with LDL in the Amish identified by exome sequencing.

Figu re 5 shows that the frequency of the variant B4GALT1 gene is greater than 1000- fold en riched in the Amish. Figu re 6 shows the association of B4GALT1 Asn352Ser with decreased seru m lipids.

Figu re 7 shows the high degree of association of B4G A ill Asn352Ser with decreased serum lipids and increased AST.

Figu re 8 shows the association of B4GALT1 Asn352Ser with all lipid subfractions.

Figu re 9 shows the association of B4GALT1 Asn352Ser with decreased fibrinogen levels.

Figu re 10 shows reduced b4galtl transcript in 5 days post fertilization of zebrafish larvae injected with antisense morpholino oligonucleotide at the indicated concentrations.

Figu re 11 shows diagnostic marker of antisense morpholino oligonucleotide off-target effects in 5 days post fertilization zebrafish larvae injected with antisense morpholino oligonucleotide at the indicated concentrations.

Figu re 12 shows average LDL concentration in homogenates of 100 5 days post fertilization zebrafish larvae per experiment.

Figu re 13 shows a rescue of LDL-c phenotype by co-expression of 50 pg human B4GALT1 mRNA in the zebrafish.

Figu re 14 shows the genetic association results between B4GALT1 N352S and LDL using targeted genotyping.

Figu re 15 shows confocal microscopy images of Flag-352Asn or Flag-352Ser su bcel lular localization.

Figu re 16 shows confocal microscopy images of endogenous B4GALT1, Flag-352Asn, and Flag-352Se sub-cellular localization in relation with the trans Golgi Network marker TGN46.

Figu re 17 (Panels A and B) shows the effect of 352Ser on steady-state levels of B4GALT1 protein; (Panel A) COS7 cells expressing either 352Asn or 352Ser Flag tag proteins fusion with free EGFP; and (Panel B) mRNA expression levels for B4GALT1 gene determined by RT-q PCR analysis.

Figu re 18 (Panels A, B, and C) shows the effect of 352Ser mutation on activity; (Panels A and B) COS7 cells expressing either 352Asn or 352Ser Flag tag proteins fusion expressed in COS7 cel ls and analyzed by Western blot for B4GALT1 or Flag; (Panel C) B4GALT1 activity in the immunoprecipitates.

Figu re 19 shows the tri-sialo/di-oligo ratio by B4GALT1 N352S genotype group.

Figu re 20 shows a representative HILIC-FLR-MS spectru m of N-Glycan analysis of Glycoprotein from a matched pair of minor (SS) and major (NN) homozygotes of B4GALT1 N352S.

Detailed Description

As set forth herein, sequencing studies have identified a variant of B4GALT1 having a serine at the position corresponding to position 352 in the ful l length/matu re B4GALT1 polypeptide instead of an asparagine present in about 11%-12% of individuals of the Old Order Amish (OOA) (alternate allele frequency = 6%), and is extremely rare in the general population. This mutation changes the asparagine to serine in position 352 (N352S) of the 398 amino acid long human protein, or in position 311 of the short isoform. The variant B4GALT1 has been observed to be associated with lower levels of low density lipoprotein cholesterol (LDL), total cholesterol, and fibrinogen and eGFR, increased levels of aspartate transaminase (AST) (but not alanine transaminase (ALT)) and serum levels of creatine kinase and creatinine, expression in muscle tissue (but not liver or red blood cells), and a decrease in basophils. It is believed that the N352S variant is protective against one or more cardiovascular conditions. It is further believed that B4GALT1, including its variant status, may be used to diagnose a patient's risk of developing cardiovascu lar conditions.

The phrase "corresponding to" when used in the context of the nu mbering of a given amino acid or polynucleotide sequence refers to the nu mbering of the residues of a specified reference sequence when the given amino acid or polynucleotide sequence is compared to the reference sequence (with the reference sequence herein being the polynucleotide (gDNA sequence, mRNA sequence, cDNA sequence) or polypeptide of (wild-type/full length)

B4GALT1). In other words, the residue number or residue position of a given polymer is designated with respect to the reference sequence rather than by the actual numerical position of the residue within the given amino acid or polynucleotide sequence. For example, a given amino acid sequence can be aligned to a reference sequence by introducing gaps to optimize residue matches between the two sequences. In these cases, although the gaps are present, the numbering of the residue in the given amino acid or polynucleotide sequence is made with respect to the reference sequence to which it has been aligned.

As used herein, the singular forms of the articles "a," "an," and "the" include plu ral references unless the context clearly dictates otherwise. As used herein, and un less otherwise apparent from the context, "about"

encompasses values within a standard margin of error of measurement (e.g., SEM) of a stated value.

As used herein, "and/or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

As used herein, the terms "comprising" or "including" means that one or more of the recited elements may include other elements not specifically recited. For example, a composition that "comprises" or "includes" a protein may contain the protein alone or in combination with other ingredients. The transitional ph rase "consisting essentially of" means that the scope of a claim is to be interpreted to encompass the specified elements recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed subject matter. Thus, the term "consisting essentially of" when used in a claim of the present disclosu re is not intended to be interpreted to be equivalent to "comprising."

As used herein, "optional" or "optionally" means that the subsequently described event or circu mstance may or may not occur and that the description includes instances in which the event or circumstance occurs and instances in which it does not.

As used herein, "or" refers to any one member of a particular list and also includes any combination of members of that list.

Designation of a range of values includes all integers within or defining the range

(including the two end point values), and all subranges defined by integers within the range.

It should be appreciated that particular featu res of the disclosu re, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the disclosu re which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable subcombination.

The present disclosu re provides isolated B4GALT1 genomic and mRNA variants, B4GALT1 cDNA variants, or any complement thereof, and isolated B4GALT1 polypeptide variants. These variants are believed to be associated with a diminished risk of developing various cardiovascular conditions including, but not limited to, elevated levels of seru m lipids, and elevated levels fibrinogen, coronary artery calcification, coronary artery disease (CAD), and increased levels of aspartate aminotransferase (AST), but not alanine transaminase (ALT). Without wishing to be bound by any thory, it is believed that these B4GALT1 variants associate with expression in muscle tissue, and not liver or red blood cells, as evidenced by the experimentally-observed increased levels of AST, but not ALT. Compositions comprising B4GALT1 genomic and mRNA variants, B4GALT1 cDNA variants, and isolated B4GALT1 polypeptide variants are also provided herein. Nucleic acid molecules that hybridize to the B4GALT1 genomic and mRNA variants and B4GALT1 cDNA variants are also provided herein. The present disclosure also provides vectors and cells comprising B4GALT1 genomic and mRNA variants, B4GALT1 cDNA variants, and B4GALT1 polypeptide variants.

The present disclosu re also provides methods of detecting the presence of and/or levels of genomic and/or mRNA variants, B4GALT1 cDNA variants, or complement thereof, and/or B4GALT1 polypeptide variants in a biological sample. Also provided are methods for determining a su bject's susceptibility to developing a cardiovascu lar condition, and methods of diagnosing a subject with a cardiovascular condition or at risk for a cardiovascular condition. Also provided are methods for modifying a cell through the use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, and expression vectors for expressing a recombinant B4GALT1 gene or a nucleic acid encoding an B4GALT1 polypeptide. Also provided are therapeutic and prophylactic methods for treating a su bject having or at risk of developing a cardiovascular condition.

The wild-type human genomic B4GALT1 nucleic acid is approximately 56.7 kb in length, includes 6 exons, and is located at chromosome 9 in the human genome. An exemplary wild- type human genomic B4GALT1 sequence is assigned NCBI Accession No. NG_008919.1 (SEQ ID NO: l). A variant of human genomic B4GALT1 is shown in SEQ ID NO:2, and comprises a single nucleotide polymorphism (SNP) (A to G at position 53576; referred to herein as a variant B4GALT1). The variant SNP resu lts in a serine at the position corresponding to position 352 in the full length/matu re B4GALT1 polypeptide of the encoded B4GALT1 variant polypeptide, rather than the asparagine encoded by the wild-type B4GALT1 polypeptide. The variant human genomic B4GALT1 nucleic acid comprises, for example, three bases (e.g., "agt") encoding a serine at the positions corresponding to positions 53575 to 53577 of the wild-type human genomic B4GALT1, as opposed to the th ree bases "aat" at positions 53575 to 53577 of the wild- type human genomic B4GALT1 (comparing SEQ ID NO:2 to SEQ ID NO:l, respectively). In some embodiments, the isolated nucleic acid molecule comprises SEQ ID NO:2. In some

embodiments, the isolated nucleic acid molecule consists of SEQ ID NO:2. In some embodiments, the isolated nucleic acid molecule is a complement of any genomic B4GALT1 nucleic acid molecule disclosed herein.

In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleic acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to SEQ ID NO:2. In some embodiments, such nucleic acid sequence also comprises nucleotides corresponding to positions 53575 to 53577 of SEQ I D NO:2. I n some embodiments, the isolated nucleic acid molecu les comprise or consist of a nucleic acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a portion of SEQ ID NO:2 that comprises exons 1 to 6 of the B4GALT1 gene. In some embodiments, such nucleic acid sequence also comprises nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:2. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleic acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a portion of SEQ ID NO:2 comprising exon 5. In some embodiments, such nucleic acid sequence also comprises nucleotides corresponding to positions 53575 to 53577 of SEQ I D NO:2. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence at least about 90% identical to SEQ ID NO:2, provided that the nucleic acid sequence comprises nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:2.

Percent complementarity between particu lar stretches of nucleic acid sequences within nucleic acids can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs (Altschul et al., J. Mol. Biol., 1990, 215, 403-410; Zhang and Madden, Genome Res., 1997, 7, 649-656) or by using the Gap program (Wisconsin

Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using defau lt settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482-489).

In some embodiments, the isolated nucleic acid molecules comprise less than the entire genomic sequence. In some embodiments, the isolated nucleic acid molecu les comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 2000, at least about 3000, at least about 4000, at least about 5000, at least about 6000, at least about 7000, at least about 8000, at least about 9000, at least about 10000, at least about 11000, at least about 12000, at least about 13000, at least about 14000, at least about 15000, at least about 16000, at least about 17000, at least about 18000, at least about 19000, or at least about 20000 contiguous nucleotides of SEQ ID NO:2. In some embodiments, such isolated nucleic acid molecules also comprise nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:2. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000 contiguous nucleotides of SEQ ID NO:2. In some embodiments, such isolated nucleic acid molecules also comprise nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:2. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000 contiguous nucleotides of exon 5 of SEQ I D NO:2. In some embodiments, such isolated nucleic acid molecules also comprise nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:2.

For example, in some embodiments, the isolated nucleic acid molecu le comprises at least 15 contiguous nucleotides of SEQ ID NO:2, wherein the contiguous nucleotides include nucleotides 53575 to 53577 of SEQ ID NO:2. In some such embodiments, the isolated nucleic acid molecu le comprises at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:2. In some embodiments, the isolated nucleic acid molecule comprises between 15 and 50 contiguous nucleotides of SEQ ID NO:2, wherein the contiguous nucleotides include nucleotides 53575 to 53577 of SEQ ID NO:2. In some such embodiments, the isolated nucleic acid molecule comprises at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:2.

In some embodiments, the disclosure provides an isolated nucleid acid that comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ I D NO:2, wherein the portion of SEQ ID NO:2 comprises nucleotides 53575 to 53577 of SEQ ID NO:2 and wherein the portion of SEQ ID NO:2 is at least 15 nucleotides in length. In some such embodiments, the portion of SEQ ID NO:2 is at least 20, at least 25, or at least 30 nucleotides in length. In some embodiments, the disclosure provides an isolated nucleid acid that comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ I D NO:2, wherein the portion of SEQ I D NO:2 comprises nucleotides 53575 to 53577 of SEQ ID NO:2 and wherein the portion of SEQ I D NO:2 is between 15 and 50 nucleotides in length. In some such embodiments, the portion of SEQ ID NO:2 is at least 20, at least 25, or at least 30 nucleotides in length.

In some embodiments, the disclosure provides an isolated nucleid acid that comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ I D NO:2, wherein the portion of SEQ ID NO:2 comprises nucleotides 53575 to 53577 of SEQ ID NO:2 and wherein the portion of SEQ ID NO:2 is at least 15 nucleotides in length. In some such embodiments, the portion of SEQ ID NO:2 is at least 20, at least 25, or at least 30 nucleotides in length. In some embodiments, the disclosure provides an isolated nucleid acid that comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ I D NO:2, wherein the portion of SEQ I D NO:2 comprises nucleotides 53575 to 53577 of SEQ ID NO:2 and wherein the portion of SEQ I D NO:2 is between 15 and 50 nucleotides in length. In some such embodiments, the portion of SEQ ID NO:2 is at least 20, at least 25, or at least 30 nucleotides in length.

Such isolated nucleic acid molecules can be used, for example, to express variant B4GALT1 mRNAs and proteins or as exogenous donor sequences. It is understood that gene sequences within a population can vary due to polymorphisms, such as SNPs. The examples provided herein are only exemplary sequences, and other sequences are also possible.

In some embodiments, the isolated nucleic acid molecules comprise a variant B4GALT1 minigene, in which one or more nonessential segments of SEQ ID NO:2 have been deleted with respect to a corresponding wild-type B4GALT1 gene. In some embodiments, the deleted nonessential segments comprise one or more intron sequences. In some embodiments, the B4GALT1 minigenes can comprise, for example, exons corresponding to any one or more of exons 1 to 6, or any combination of such exons, from variant B4GALT1 (SEQ ID NO:2). In some embodiments, the minigene comprises or consists of exon 5 of SEQ ID NO:2. In some embodiments, the B4GALT1 minigene is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a portion of SEQ ID NO:2 comprising any one or more of exons 1 to 6, or any combination of such exons. In some embodiments, the B4GALT1 minigene is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to a portion of SEQ ID NO:2 comprising any one or more of exons 1 to 6, or any combination of such exons and comprise nucleotides corresponding to positions 53575 to 53577 of SEQ I D NO:2. In some embodiments, the B4GALT1 minigene is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a portion of SEQ ID NO:2 comprising exon 5.

The present disclosu re also provides isolated nucleic acid molecules that hybridize to a variant B4GALT1 genomic sequence or a variant B4GALT1 minigene. In some embodiments, such isolated nucleic acid molecu les comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 2000, at least about 3000, at least about 4000, at least about 5000, at least about 6000, at least about 7000, at least about 8000, at least about 9000, at least about 10000, at least about 11000, at least about 12000, at least about 13000, at least about 14000, at least about 15000, at least about 16000, at least about 17000, at least about 18000, at least about 19000, or at least about 20000 nucleotides. In some embodiments, such isolated nucleic acid molecules also hybridize to positions 53575 to 53577 of SEQ I D NO:2. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of variant B4GALT1 genome or minigene at a segment that includes or is within about 1000, within about 500, within about 400, within about 300, within about 200, within about 100, within about 50, within about 45, within about 40, within about 35, within about 30, within about 25, within about 20, within about 15, within about 10, or within about 5 nucleotides of positions 53575 to 53577 of SEQ I D NO:2. In some embodiments, the isolated nucleic acid molecules hybridize to at least about 15 contiguous nucleotides of a nucleic acid molecule that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to variant B4GALT1 genomic DNA or minigene. I n some embodiments, such isolated nucleic acid molecules also hybridize to positions 53575 to 53577 of SEQ I D NO:2. In some embodiments, the isolated nucleic acid molecules comprise or consist of from about 15 to about 100 nucleotides, or from about 15 to about 35 nucleotides.

For example, in some embodiments, the disclosure provides an isolated nucleic acid molecule that comprises at least 15 nucleotides, wherein the isolated nucleic acid molecule hybridizes to a nucleic acid comprising the sequence of SEQ ID NO:2, wherein the isolated nucleic acid molecule hybridizes to a portion of SEQ ID NO:2, and wherein the portion of SEQ ID NO:2 comprises nucleotides 53575 to 53577 of SEQ ID NO:2. In some such embodiments, the isolated nucleic acid molecule comprises at least 20, at least 25, or at least 30 nucleotides. In some embodiments, the disclosure provides an isolated nucleic acid molecu le that comprises 15 to 50 nucleotides, wherein the isolated nucleic acid molecule hybridizes to a nucleic acid comprising the sequence of SEQ I D NO:2, wherein the isolated nucleic acid molecu le hybridizes to a portion of SEQ ID NO:2, and wherein the portion of SEQ I D NO:2 comprises nucleotides 53575 to 53577 of SEQ ID NO:2. In some such embodiments, the isolated nucleic acid molecule comprises at least 20, at least 25, or at least 30 nucleotides.

In some embodiments, the isolated nucleic acid molecules hybridize to at least 15 contiguous nucleotides of a nucleic acid, wherein the contiguous nucleotides are at least 90% identical to a portion of SEQ ID NO:2, wherein the contiguous nucleotides comprise nucleotides 53575 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ I D NO:2. I n some such embodiments, the contiguous nucleotides are at least 20, at least 25, or at least 30 nucleotides in length. In some embodiments, the isolated nucleic acid molecules hybridize to at least 15 contiguous nucleotides of a nucleic acid, wherein the contiguous nucleotides are at least 95% identical to a portion of SEQ I D NO:2, wherein the contiguous nucleotides comprise nucleotides 53575 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ ID NO:2. In some such embodiments, the contiguous nucleotides are at least 20, at least 25, or at least 30 nucleotides in length. In some

embodiments, the isolated nucleic acid molecules hybridize to at least 15 contiguous nucleotides of a nucleic acid, wherein the contiguous nucleotides are at least 100% identical to a portion of SEQ ID NO:2, wherein the contiguous nucleotides comprise nucleotides 53575 to 53577 of SEQ I D NO:2 at positions that correspond to positions 53757 to 53577 of SEQ ID NO:2. I n some such embodiments, the contiguous nucleotides are at least 20, at least 25, or at least 30 nucleotides in length.

In some embodiments, the isolated nucleic acid molecules hybridize to 15 to 50 contiguous nucleotides of a nucleic acid, wherein the contiguous nucleotides are at least 90% identical to a portion of SEQ ID NO:2, wherein the contiguous nucleotides comprise nucleotides 53575 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ I D NO:2. I n some such embodiments, the contiguous nucleotides are at least 20, at least 25, or at least 30 nucleotides in length. In some embodiments, the isolated nucleic acid molecules hybridize to 15 to 50 contiguous nucleotides of a nucleic acid, wherein the contiguous nucleotides are at least 95% identical to a portion of SEQ I D NO:2, wherein the contiguous nucleotides comprise nucleotides 53575 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ ID NO:2. In some such embodiments, the contiguous nucleotides are at least 20, at least 25, or at least 30 nucleotides in length. In some

embodiments, the isolated nucleic acid molecules hybridize to 15 to 50 contiguous nucleotides of a nucleic acid, wherein the contiguous nucleotides are at least 100% identical to a portion of SEQ ID NO:2, wherein the contiguous nucleotides comprise nucleotides 53575 to 53577 of SEQ I D NO:2 at positions that correspond to positions 53757 to 53577 of SEQ I D NO:2. In some such embodiments, the contiguous nucleotides are at least 20, at least 25, or at least 30 nucleotides in length.

Such isolated nucleic acid molecules can be used, for example, as guide RNAs, primers, probes, or exogenous donor sequences.

A representative wild-type B4GALT1 genomic sequence is recited in SEQ ID NO:l. A representative variant B4GALT1 genomic sequence variant is recited in SEQ ID NO:2.

The present disclosu re also provides isolated nucleic acid molecules comprising a variant of B4GALT1 mRNA. An exemplary wild-type human B4GALT1 mRNA is assigned NCBI Accession NM_001497 (SEQ I D NO:3), and consists of 4214 nucleotide bases. A variant of human B4GALT1 mRNA is shown in SEQ ID NO:4, and comprises the SNP (A to G at position 1244; referred to herein as a variant B4GALT1), which results in a serine at the position corresponding to position 352 of the encoded B4GALT1 variant polypeptide. The variant human B4GALT1 mRNA comprises, for example, the three bases "agu" encoding a serine at positions corresponding to positions 1243 to 1245 of the wild-type human B4GALT1 mRNA, as opposed to the th ree bases "aau" at positions 1243 to 1245 of the wild-type human B4GALT1 mRNA (comparing SEQ ID NO:4 to SEQ ID NO:3, respectively). I n some embodiments, the isolated nucleic acid molecule comprises SEQ ID NO:4. In some embodiments, the isolated nucleic acid molecule consists of SEQ I D NO:4.

In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleic acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to SEQ ID NO:4. In some embodiments, such nucleic acid sequences also comprise nucleotides corresponding to positions 1243 to 1245 of SEQ ID NO:4. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleotide sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a portion of SEQ ID NO:4 comprising exons 1 to 6. In some embodiments, such nucleic acid sequences also comprise nucleotides corresponding to positions 1243 to 1245 of SEQ ID NO:4. In some embodiments, the isolated nucleic acid molecule is a complement of any B4GALT1 mRNA molecule disclosed herein.

In some embodiments, the isolated nucleic acid molecules comprises less than the entire mRNA sequence. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 2000, at least about 3000, or at least about 4000 contiguous nucleotides of SEQ ID NO:4. In some embodiments, such isolated nucleic acid molecules also comprise nucleotides corresponding to positions 1243 to 1245 of SEQ I D NO:4. I n some embodiments, the isolated nucleic acid molecu les comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000 contiguous nucleotides of SEQ ID NO:4. In some embodiments, such isolated nucleic acid molecules also comprises nucleotides corresponding to positions 1243 to 1245 of SEQ ID NO:4. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000 contiguous nucleotides of exons 1 to 6 of SEQ ID NO:4. In some embodiments, such isolated nucleic acid molecules also comprise nucleotides corresponding to positions 1243 to 1245 of SEQ ID NO:4.

In some embodiments, the disclosure provides an isolated nucleic acid molecule that comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ I D NO:4, wherein the portion of SEQ I D NO:4 comprises nucleotides 1243 to 1245 of SEQ ID NO:4 and wherein the portion of SEQ I D NO:4 comprises at least 15 nucleotides of SEQ I D NO:4. I n some such embodiments, the portion of SEQ I D NO:4 is at least 20, at least 25 or at least 30 nucleotides of SEQ ID NO:4. In some embodiments, the disclosu re provides an isolated nucleic acid molecu le that comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ ID NO:4, wherein the portion of SEQ ID NO:4 comprises nucleotides 1243 to 1245 of SEQ I D NO:4 and wherein the portion of SEQ ID NO:4 comprises at least 15 nucleotides of SEQ ID NO:4. In some such embodiments, the portion of SEQ I D NO:4 is at least 20, at least 25 or at least 30 nucleotides of SEQ ID NO:4. In some embodiments, the disclosure provides an isolated nucleic acid molecule that comprises a nucleic acid sequence that is 100% identical to a portion of SEQ ID NO:4, wherein the portion of SEQ ID NO:4 comprises nucleotides 1243 to 1245 of SEQ I D NO:4 and wherein the portion of SEQ ID NO:4 comprises at least 15 nucleotides of SEQ ID NO:4. In some such embodiments, the portion of SEQ I D NO:4 is at least 20, at least 25 or at least 30 nucleotides of SEQ ID NO:4. In some embodiments, the disclosure provides an isolated nucleic acid molecule that comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ ID NO:4, wherein the portion of SEQ ID NO:4 comprises nucleotides 1243 to 1245 of SEQ ID NO:4 and wherein the portion of SEQ I D NO:4 comprises 15 to 50 nucleotides of SEQ ID NO:4. In some such embodiments, the portion of SEQ ID NO:4 is at least 20, at least 25 or at least 30 nucleotides of SEQ ID NO:4. In some embodiments, the disclosure provides an isolated nucleic acid molecule that comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ ID NO:4, wherein the portion of SEQ ID NO:4 comprises nucleotides 1243 to 1245 of SEQ ID NO:4 and wherein the portion of SEQ ID NO:4 comprises 15 to 50 nucleotides of SEQ ID NO:4. In some such embodiments, the portion of SEQ ID NO:4 is at least 20, at least 25 or at least 30 nucleotides of SEQ ID NO:4. In some embodiments, the disclosu re provides an isolated nucleic acid molecule that comprises a nucleic acid sequence that is 100% identical to a portion of SEQ ID NO:4, wherein the portion of SEQ ID NO:4 comprises nucleotides 1243 to 1245 of SEQ ID NO:4 and wherein the portion of SEQ ID NO:4 comprises 15 to 50 nucleotides of SEQ ID NO:4. In some such embodiments, the portion of SEQ I D NO:4 is at least 20, at least 25 or at least 30 nucleotides of SEQ ID NO:4.

Such isolated nucleic acid molecules can be used, for example, to express B4GALT1 variant polypeptides or as exogenous donor sequences. It is understood that gene sequences within a population can vary due to polymorphisms such as SNPs. The examples provided herein are only exemplary sequences, and other sequences are also possible.

In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleic acid sequence encoding a polypeptide at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the variant Asn352Ser B4GALT1 polypeptide (SEQ ID NO:8), provided that the polypeptide comprises a serine at the position corresponding to position 352. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleic acid sequence encoding a polypeptide at least about 90%, identical to SEQ ID NO:8, provided that the polypeptide comprises a serine at the position corresponding to position 352. I n some embodiments, the isolated nucleic acid molecu les comprise or consist of a nucleic acid sequence encoding a polypeptide at least about 95%, identical to SEQ ID NO:8, provided that the polypeptide comprises a serine at the position corresponding to position 352.

For example, in some embodiments, the isolated nucleic acid molecu le comprises a nucleic acid sequence encoding a polypeptide that has an amino acid sequence that is at least 10 amino acids long, wherein the amino acid sequence is 90% identical to a portion of the amino acid sequence of SEQ ID NO:8, wherein the portion comprises a serine at the position corresponding to position 352 of SEQ ID NO:8. In some such embodiments, the nucleic acid sequence encodes a polypeptide that has an amino acid sequence that is at least 15, at least 20 or at least 25 amino acids long. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide that has an amino acid sequence that is at least 10 amino acids long, wherein the amino acid sequence is 95% identical to a portion of the amino acid sequence of SEQ ID NO:8, wherein the portion comprises a serine at the position corresponding to position 352 of SEQ ID NO:8. In some such embodiments, the nucleic acid sequence encodes a polypeptide that has an amino acid sequence that is at least 15, at least 20 or at least 25 amino acids long. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide that has an amino acid sequence that is 10 to 50 amino acids long, wherein the amino acid sequence is 90% identical to a portion of the amino acid sequence of SEQ ID NO:8, wherein the portion comprises a serine at the position corresponding to position 352 of SEQ ID NO:8. In some such embodiments, the nucleic acid sequence encodes a polypeptide that has an amino acid sequence that is at least 15, at least 20 or at least 25 amino acids long. In some embodiments, the isolated nucleic acid molecule comprises a nucleic acid sequence encoding a polypeptide that has an amino acid sequence that is 10 to 50 amino acids long, wherein the amino acid sequence is 95% identical to a portion of the amino acid sequence of SEQ ID NO:8, wherein the portion comprises a serine at the position corresponding to position 352 of SEQ ID NO:8. In some such embodiments, the nucleic acid sequence encodes a polypeptide that has an amino acid sequence that is at least 15, at least 20 or at least 25 amino acids long. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleic acid sequence encoding a polypeptide identical to SEQ ID NO:8.

The present disclosu re also provides isolated nucleic acid molecules that hybridize to a variant B4GALT1 mRNA sequence. In some embodiments, such isolated nucleic acid molecu les comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, at least about 2000, at least about 3000, or at least about 4000 nucleotides. In some embodiments, such isolated nucleic acid molecules also hybridize to positions 1243 to 1245 of SEQ I D NO:4. In some embodiments, the isolated nucleic acid molecules hybridize to a portion of a variant B4GALT1 mRNA at a segment that includes or is within about 1000, within about 500, within about 400, within about 300, within about 200, within about 100, within about 50, within about 45, within about 40, within about 35, within about 30, within about 25, within about 20, within about 15, within about 10, or within about 5 nucleotides of positions 1243 to 1245 of SEQ I D NO:4.

In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides and hybridize to a portion of a variant B4GALT1 mRNA (for example, SEQ ID NO:4) at a segment that includes or is within 5 nucleotides of positions 1243 to 1245 of SEQ ID NO:4. In some such embodiments, the isolated nucleic acid molecu les comprise at least 20, at least 25 or at least 30 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides, hybridize to a portion of a variant B4GALT1 mRNA (for example, SEQ I D NO:4) at a segment that includes or is within 5 nucleotides of positions 1243 to 1245 of SEQ ID NO:4 and hybridize to positions 1243 to 1245 of SEQ I D NO:4. I n some such embodiments, the isolated nucleic acid molecules comprise at least 20, at least 25 or at least 30 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise 15 to 50 nucleotides and hybridize to a portion of a variant B4GALT1 mRNA (for example, SEQ I D NO:4) at a segment that includes positions 1243 to 1245 of SEQ ID NO:4 and hybridize to positions 1243 to 1245 of SEQ ID NO:4. In some such embodiments, the isolated nucleic acid molecules comprise at least 20, at least 25 or at least 30 nucleotides.

In some embodiments, the isolated nucleic acid molecules hybridize to at least about 15 contiguous nucleotides of a nucleic acid molecule that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a variant B4GALT1 mRNA (such as, for example, SEQ ID NO:4). In some embodiments, the isolated nucleic acid molecules also hybridize to positions 1243 to 1245 of SEQ ID NO:4. In some embodiments, the isolated nucleic acid molecules comprise or consist of from about 15 to about 100 nucleotides, or from about 15 to about 35 nucleotides.

In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides and hybridize to a portion of a variant B4GALT1 mRNA at a segment that includes or is within 5 nucleotides of positions 1243 to 1245 of SEQ ID NO:4, wherein the variant B4GALT1 mRNA is at least 90% identical to a variant B4GALT1 mRNA (such as, for example, SEQ ID NO:4). In some such embodiments, the isolated nucleic acid molecules comprise at least 20, at least 25 or at least 30 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides and hybridize to a portion of a variant B4GALT1 mRNA at a segment that includes or is within 5 nucleotides of positions 1243 to 1245 of SEQ ID NO:4, wherein the variant B4GALT1 mRNA is at least 95% identical to a variant B4GALT1 mRNA (such as, for example, SEQ ID NO:4). In some such embodiments, the isolated nucleic acid molecules comprise at least 20, at least 25 or at least 30 nucleotides. In some embodiments, the isolated nucleic acid molecu les comprise or consist of at least 15 nucleotides, hybridize to a portion of a variant B4GALT1 mRNA at a segment that includes or is within 5 nucleotides of positions 1243 to 1245 of SEQ ID NO:4 and hybridize to positions 1243 to 1245 of SEQ ID NO:4, wherein the variant B4GALT1 mRNA is at least 90% identical to a variant B4GALT1 mRNA (such as, for example, SEQ ID NO:4). In some such embodiments, the isolated nucleic acid molecules comprise at least 20, at least 25 or at least 30 nucleotides. In some embodiments, the isolated nucleic acid molecu les comprise or consist of at least 15 nucleotides, hybridize to a portion of a variant B4GALT1 mRNA at a segment that includes or is within 5 nucleotides of positions 1243 to 1245 of SEQ ID NO:4 and hybridize to positions 1243 to 1245 of SEQ ID NO:4, wherein the variant B4GALT1 mRNA is at least 95% identical to a variant B4GALT1 mRNA (such as, for example, SEQ ID NO:4). In some such embodiments, the isolated nucleic acid molecules comprise at least 20, at least 25 or at least 30 nucleotides. In some embodiments, the isolated nucleic acid molecu les comprise or consist of from 15 to 100 nucleotides, or from 15 to 35 nucleotides.

Such isolated nucleic acid molecules can be used, for example, as guide RNAs, primers, probes, or exogenous donor sequences.

A representative wild-type B4GALT1 mRNA sequence is recited in SEQ ID NO:3. A representative variant B4GALT1 mRNA sequence is recited in SEQ ID NO:4.

The present disclosu re also provides nucleic acid molecu les comprising a variant of B4GALT1 cDNA encoding all or part of a B4GALT1 variant polypeptide. An exemplary wild-type human B4GALT1 cDNA (e.g., coding region of mRNA written as DNA) consists of 1197 nucleotide bases (SEQ ID NO:5). A variant of hu man B4GALT1 cDNA is shown in SEQ ID NO:6, and comprises the SNP (A to G at position 1055; referred to herein as a variant B4GALT1), which results in a serine at the position corresponding to position 352 of the encoded B4GALT1 variant polypeptide. The variant human B4GALT1 cDNA comprises, for example, "agt" encoding a serine at positions corresponding to positions 1054 to 1056 of the full length/mature wild- type human B4GALT1 cDNA, as opposed to the three bases "aat" of the wild-type human B4GALT1 cDNA at positions 1054 to 1056 (comparing SEQ I D NO:6 to SEQ I D NO:5,

respectively). I n some embodiments, the nucleic acid molecule comprises SEQ ID NO:6. In some embodiments, the nucleic acid molecule consists of SEQ I D NO:6. I n some embodiments, the cDNA molecu les are isolated.

In some embodiments, the cDNA molecu les comprise or consist of a nucleic acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to SEQ ID NO:6. In some embodiments, the cDNA molecules also comprise nucleotides corresponding to positions 1054 to 1056 of SEQ I D NO:6. I n some embodiments, the isolated nucleic acid molecu le is a complement of any B4GALT1 cDNA molecu le disclosed herein.

In some embodiments, the cDNA molecu les comprise less than the entire cDNA sequence. In some embodiments, the cDNA molecules comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, or at least about 1100 contiguous nucleotides of SEQ ID NO:6. In some

embodiments, such cDNA molecules also comprise nucleotides corresponding to positions 1054 to 1056 of SEQ ID NO:6. In some embodiments, the cDNA molecu les comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, or at least about 500 contiguous nucleotides of SEQ ID NO:6. In some embodiments, such cDNA molecu les also comprise nucleotides corresponding to positions 1054 to 1056 of SEQ ID NO:6.

For example, in some embodiments, the cDNA molecule comprises at least 15 contiguous nucleotides of SEQ ID NO:6, wherein the contiguous nucleotides include nucleotides 1054 to 1056 of SEQ ID NO:6. In some such embodiments, the isolated nucleic acid molecule comprises at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the cDNA molecule comprises 15 to 50 contiguous nucleotides of SEQ I D NO:6, wherein the contiguous nucleotides include nucleotides 1054 to 1056 of SEQ ID NO:6. In some such embodiments, the isolated nucleic acid molecu le comprises at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecu le that comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ I D NO:6 comprises at least 15 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecu le that comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ ID NO:6 comprises at least 15 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosu re provides a cDNA molecule that comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ ID NO:6 comprises 15 to 50 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ I D NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecule that comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ I D NO:6 comprises 15 to 50 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecu le that comprises nucleotides 1054 to 1056 of SEQ ID NO:6 at positions corresponding to nucleotides 1054 to 1056 of SEQ ID NO:6, wherein the cDNA molecule comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to

1056 of SEQ ID NO:6 and wherein the portion of SEQ I D NO:6 comprises at least 15 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecu le that comprises nucleotides 1054 to 1056 of SEQ ID NO:6 at positions corresponding to nucleotides 1054 to 1056 of SEQ ID NO:6, wherein the cDNA molecule comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ I D NO:6 comprises at least 15 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecu le that comprises nucleotides 1054 to 1056 of SEQ ID NO:6 at positions corresponding to nucleotides 1054 to 1056 of SEQ ID NO:6, wherein the cDNA molecule comprises a nucleic acid sequence that is at least 90% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ I D NO:6 comprises 15 to 50 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6. In some embodiments, the disclosure provides a cDNA molecu le that comprises nucleotides 1054 to 1056 of SEQ ID NO:6 at positions corresponding to nucleotides 1054 to 1056 of SEQ ID NO:6, wherein the cDNA molecule comprises a nucleic acid sequence that is at least 95% identical to a portion of SEQ ID NO:6, wherein the portion of SEQ ID NO:6 comprises nucleotides 1054 to 1056 of SEQ ID NO:6 and wherein the portion of SEQ I D NO:6 comprises 15 to 50 contiguous nucleotides nucleotides of SEQ ID NO:6. In some such embodiments, the portion of SEQ ID NO:6 is at least 20, at least 25 or at least 30 contiguous nucleotides of SEQ ID NO:6.

Such cDNA molecu les can be used, for example, to express B4GALT1 variant proteins or as exogenous donor sequences. It is understood that gene sequences within a population can vary due to polymorphisms such as SN Ps. The examples provided herein are only exemplary sequences, and other sequences are also possible.

In some embodiments, the cDNA molecu les comprise or consist of a nucleic acid sequence encoding a polypeptide at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to the variant Asn352Ser B4GALT1 polypeptide (SEQ ID NO:8), provided that the polypeptide comprises a serine at the position corresponding to position 352. In some embodiments, the cDNA molecules comprise or consist of a nucleic acid sequence encoding a polypeptide at least about 90%, identical to SEQ ID NO:8, provided that the polypeptide comprises a serine at the position corresponding to position 352. In some embodiments, the cDNA molecu les comprise or consist of a nucleic acid sequence encoding a polypeptide at least about 95%, identical to SEQ ID NO:8, provided that the polypeptide comprises a serine at the position corresponding to position 352. In some embodiments, the cDNA molecu le comprises or consists of a nucleic acid sequence encoding a polypeptide identical to SEQ ID NO:8.

The present disclosu re also provides isolated nucleic acid molecules that hybridize to a variant B4GALT1 cDNA sequence. In some embodiments, such isolated nucleic acid molecu les comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, at least about 1000, or at least about 1100 nucleotides. In some embodiments, such isolated nucleic acid molecules also hybridize to positions 1054 to

1056 of SEQ ID NO:6. In some embodiments, such isolated nucleic acid molecu les hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within about 600, within about 500, within about 400, within about 300, within about 200, within about 100, within about 50, within about 45, within about 40, within about 35, within about 30, within about 25, within about 20, within about 15, within about 10, or within about 5 nucleotides of positions 1054 to 1056 of SEQ ID NO:6. In some embodiments, the isolated nucleic acid molecules hybridize to at least about 15 contiguous nucleotides of a cDNA molecule that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to a variant B4GALT1 cDNA (such as, for example, SEQ I D NO:6). In some embodiments, the isolated nucleic acid molecules also hybridize to positions 1054 to 1056 of SEQ ID NO:6. In some embodiments, the isolated nucleic acid molecules comprise or consist of from about 15 to about 100 nucleotides, or from about 15 to about 35 nucleotides.

In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides and hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within 5 nucleotides of positions 1054 to 1056 of SEQ ID NO:6, wherein the variant B4GALT1 cDNA is at least 90% identical to a variant B4GALT1 cDNA (such as, for example, SEQ ID NO:6). In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides and hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within 5 nucleotides of positions 1054 to 1056 of SEQ ID NO:6, wherein the variant B4GALT1 cDNA is at least 95% identical to a variant B4GALT1 cDNA (such as, for example, SEQ ID NO:6). In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides and hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within 5 nucleotides of positions 1054 to 1056 of SEQ I D NO:6, wherein the variant B4GALT1 cDNA is 100% identical to a variant B4GALT1 cDNA (such as, for example, SEQ ID NO:6). In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15 nucleotides, hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within 5 nucleotides of positions 1054 to 1056 of SEQ ID NO:6 and hybridize to positions 1054 to 1056 of SEQ ID NO:6, wherein the variant B4GALT1 cDNA is at least 90% identical to a variant B4GALT1 cDNA (such as, for example, SEQ I D NO:6). In some embodiments, the isolated nucleic acid molecules comprise or consist of at least 15

nucleotides, hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within 5 nucleotides of positions 1054 to 1056 of SEQ ID NO:6 and hybridize to positions 1054 to 1056 of SEQ ID NO:6, wherein the variant B4GALT1 cDNA is at least 95% identical to a variant B4GALT1 cDNA (such as, for example, SEQ I D NO:6). In some embodiments, the isolated nucleic acid molecu les comprise or consist of at least 15 nucleotides, hybridize to a portion of a variant B4GALT1 cDNA at a segment that includes or is within 5 nucleotides of positions 1054 to 1056 of SEQ ID NO:6 and hybridize to positions 1054 to 1056 of SEQ ID NO:6, wherein the variant B4GALT1 cDNA is 100% identical to a variant B4GALT1 cDNA (such as, for example, SEQ ID NO:6). In some embodiments, the isolated nucleic acid molecules comprise or consist of from 15 to 100 nucleotides, or from 15 to 35 nucleotides.

Such isolated nucleic acid molecules can be used, for example, as guide RNAs, primers, probes, exogenous donor sequences, antisense RNAs, siRNAs, or shRNAs.

A representative wild-type B4GALT1 cDNA sequence is recited in SEQ ID NO:5. A representative variant B4GALT1 cDNA sequence is recited in SEQ ID NO:6.

The nucleic acid molecules disclosed herein can comprise a nucleic acid sequence of a natu ral ly occurring B4GALT1 gene or mRNA transcript, or can comprise a non-natural ly occu rring sequence. In some embodiments, the naturally occurring sequence can differ from the non-naturally occu rring sequence due to synonymous mutations or mutations that do not affect the encoded B4GALT1 polypeptide. For example, the sequence can be identical with the exception of synonymous mutations or mutations that do not affect the encoded B4GALT1 polypeptide. A synonymous mutation or substitution is the substitution of one nucleotide for another in an exon of a gene coding for a protein such that the produced amino acid sequence is not modified. This is possible because of the degeneracy of the genetic code, with some amino acids being coded for by more than one three-base pair codon. Synonymous

su bstitutions are used, for example, in the process of codon optimization. The nucleic acid molecules disclosed herein can be codon optimized.

Also provided herein are functional polynucleotides that can interact with the disclosed nucleic acid molecu les. Fu nctional polynucleotides are nucleic acid molecules that have a specific function, such as binding a target molecu le or catalyzing a specific reaction. Examples of functional polynucleotides include, but are not limited to, antisense molecules, aptamers, ribozymes, triplex forming molecu les, and external guide sequences. The functional polynucleotides can act as effectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional polynucleotides can possess a de novo activity independent of any other molecules.

Antisense molecules are designed to interact with a target nucleic acid molecule th rough either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule th rough, for example, RNase-H-mediated RNA-DNA hybrid degradation. Alternately, the antisense molecule is designed to interru pt a processing function that normally would take place on the target molecu le, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecu le. Nu merous methods for optimization of antisense efficiency by identifying the most accessible regions of the target molecule exist. Exemplary methods include, but are not limited to, in vitro selection experiments and DNA modification studies using DMS and DEPC. Antisense molecu les generally bind the target molecule with a dissociation constant (k d ) less than or equal to about 10 "6 , less than or equal to about 10 s , less than or equal to about 10 "10 , or less than or equal to about 10 "12 . A

representative sample of methods and techniques which aid in the design and use of antisense molecules can be found in the following non-limiting list of U.S. Patents: 5,135,917; 5,294,533; 5,627,158; 5,641,754; 5,691,317; 5,780,607; 5,786,138; 5,849,903; 5,856,103; 5,919,772;

5,955,590; 5,990,088; 5,994,320; 5,998,602; 6,005,095; 6,007,995; 6,013,522; 6,017,898;

6,018,042; 6,025,198; 6,033,910; 6,040,296; 6,046,004; 6,046,319; and 6,057,437. Examples of antisense molecules include, but are not limited to, antisense RNAs, small interfering RNAs (siRNAs), and short hairpin RNAs (shRNAs).

The isolated nucleic acid molecules disclosed herein can comprise RNA, DNA, or both RNA and DNA. The isolated nucleic acid molecu les can also be linked or fused to a heterologous nucleic acid sequence, such as in a vector, or a heterologous label. For example, the isolated nucleic acid molecules disclosed herein can be in a vector or exogenous donor sequence comprising the isolated nucleic acid molecule and a heterologous nucleic acid sequence. The isolated nucleic acid molecules can also be lin ked or fused to a heterologous label, such as a fluorescent label. Other examples of labels are disclosed elsewhere herein.

The label can be directly detectable (e.g., fluorophore) or indirectly detectable (e.g., hapten, enzyme, or fluorophore quencher). Such labels can be detectable by spectroscopic, photochemical, biochemical, immunochemical, or chemical means. Such labels include, for example, radiolabels that can be measured with radiation-counting devices; pigments, dyes or other chromogens that can be visually observed or measu red with a spectrophotometer; spin labels that can be measured with a spin label analyzer; and fluorescent labels (e.g., fluorophores), where the output signal is generated by the excitation of a suitable molecular adduct and that can be visualized by excitation with light that is absorbed by the dye or can be measured with standard fluorometers or imaging systems. The label can also be, for example, a chemilu minescent substance, where the output signal is generated by chemical modification of the signal compound; a metal-containing substance; or an enzyme, where there occu rs an enzyme-dependent secondary generation of signal, such as the formation of a colored product from a colorless substrate. The term "label" can also refer to a "tag" or hapten that can bind selectively to a conjugated molecule such that the conjugated molecule, when added su bsequently along with a substrate, is used to generate a detectable signal. For example, one can use biotin as a tag and then use an avidin or streptavidin conjugate of horseradish peroxidate (HRP) to bind to the tag, and then use a calorimetric substrate (e.g.,

tetramethylbenzidine (TMB)) or a fluorogenic su bstrate to detect the presence of HRP.

Exemplary labels that can be used as tags to facilitate pu rification include, but are not limited to, myc, HA, FLAG or 3XFLAG, 6XHis or polyhistidine, glutathione-S-transferase (GST), maltose binding protein, an epitope tag, or the Fc portion of immunoglobu lin. Nu merous labels are known and include, for example, particles, fluorophores, haptens, enzymes and their calorimetric, fluorogenic and chemilu minescent su bstrates and other labels.

The disclosed nucleic acid molecu les can be made u p of, for example, nucleotides or non-natural or modified nucleotides, such as nucleotide analogs or nucleotide substitutes. Such nucleotides include a nucleotide that contains a modified base, sugar, or phosphate group, or that incorporates a non-natural moiety in its structu re. Examples of non-natural nucleotides include, but are not limited to, dideoxynucleotides, biotinylated, aminated, deaminated, alkylated, benzylated, and fluorophor-labeled nucleotides.

The nucleic acid molecules disclosed herein can also comprise one or more nucleotide analogs or substitutions. A nucleotide analog is a nucleotide which contains a modification to either the base, sugar, or phosphate moieties. Modifications to the base moiety include, but are not limited to, natural and synthetic modifications of A, C, G, and T/U, as well as different purine or pyrimidine bases such as, for example, pseudouridine, uracil-5-yl, hypoxanthin-9-yl (I), and 2-aminoadenin-9-yl. Modified bases include, but are not limited to, 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine,

5-propynyl u racil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil),

4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hyd roxyl and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted u racils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine and 3-deazaguanine and 3-deazaadenine. Certain nucleotide analogs such as, for example, 5-substituted pyrimidines, 6-azapyrimidines, and N-2, N-6 and 0-6 substituted purines including, but not limited to, 2-aminopropyladenine,

5- propynyluracil, 5-propynylcytosine, and 5-methylcytosine can increase the stability of duplex formation. Often, base modifications can be combined with, for example, a sugar modification, such as 2'-0-methoxyethyl, to achieve unique properties such as increased duplex stability.

Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety include, but are not limited to, natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include, but are not limited to, the following modifications at the 2' position: OH; F; 0-, S-, or N-al kyl; 0-, S-, or N-alkenyl; 0-, S- or N-al kynyl; or O-al kyl-O-alkyl, wherein the alkyl, alkenyl, and al kynyl may be substituted or unsubstituted Ci-ioalkyl or C 2 -ioalkenyl, and C2-ioal kynyl. Exemplary 2' sugar modifications also include, but are not limited to, -0[(CH 2 )nO] m CH 3 , -0(CH 2 )nOCH 3 , -0(CH 2 ) n NH 2 , -0(CH 2 ) n CH 3 , -0(CH 2 ) n -ONH 2 , and -0(CH 2 ) n ON [(CH 2 ) n CH 3 )] 2 , where n and m are from 1 to about 10.

Other modifications at the 2' position include, but are not limited to, Ci_i 0 alkyl, su bstituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH 3 , OCN, CI, Br, CN, CF 3 , OCF 3 , SOCH 3 , S0 2 CH 3 , ON0 2 , N0 2 , N 3 , NH 2 , heterocycloal kyl, heterocycloalkaryl, aminoal kylamino, polyal kylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a grou p for improving the pharmacodynamic properties of an oligonucleotide, and other su bstituents having similar properties. Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide. Modified sugars can also include those that contain modifications at the bridging ring oxygen, such as CH2 and S. Nucleotide sugar analogs can also have sugar mimetics, such as cyclobutyl moieties in place of the pentofu ranosyl sugar.

Nucleotide analogs can also be modified at the phosphate moiety. Modified phosphate moieties include, but are not limited to, those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, aminoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkyl phosphotriesters, and boranophosphates. These phosphate or modified phosphate linkage between two nucleotides can be th rough a 3'-5' linkage or a 2'-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts, and free acid forms are also included.

Nucleotide substitutes include molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes include molecu les that will recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structu re when interacting with the appropriate target nucleic acid.

Nucleotide substitutes also include nucleotides or nucleotide analogs that have had the phosphate moiety or sugar moieties replaced. In some embodiments, nucleotide su bstitutes may not contain a standard phosphorus atom. Substitutes for the phosphate can be, for example, short chain alkyl or cycloal kyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside lin kages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; su lfide, sulfoxide and su lfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones;

methyleneimino and methylenehyd razino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH 2 component parts.

It is also understood in a nucleotide su bstitute that both the sugar and the phosphate moieties of the nucleotide can be replaced by, for example, an amide type linkage

(aminoethylglycine) (PNA).

It is also possible to link other types of molecules (conjugates) to nucleotides or nucleotide analogs to enhance, for example, cellular uptake. Conjugates can be chemically linked to the nucleotide or nucleotide analogs. Such conjugates include, for example, lipid moieties such as a cholesterol moiety, cholic acid, a thioether such as hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain such as dodecandiol or undecyl residues, a phospholipid such as di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl-rac-glycero-3-H- phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.

The present disclosu re also provides vectors comprising any one or more of the nucleic acid molecu les disclosed herein. I n some embodiments, the vectors comprise any one or more of the nucleic acid molecules disclosed herein and a heterologous nucleic acid. The vectors can be viral or nonviral vectors capable of transporting a nucleic acid molecule. In some

embodiments, the vector is a plasmid or cosmid (e.g., a circular double-stranded DNA into which additional DNA segments can be ligated). In some embodiments, the vector is a viral vector, wherein additional DNA segments can be ligated into the viral genome. In some embodiments, the vector can autonomously replicate in a host cell into which it is introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). In some embodiments, the vector (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell and thereby are replicated along with the host genome. Moreover, particu lar vectors can direct the expression of genes to which they are operatively linked. Such vectors are referred to herein as

"recombinant expression vectors" or "expression vectors." Such vectors can also be targeting vectors (i.e., exogenous donor sequences).

In some embodiments, the proteins encoded by the various genetic variants disclosed herein are expressed by inserting nucleic acid molecules encoding the disclosed genetic variants into expression vectors, such that the genes are operatively linked to expression control sequences, such as transcriptional and translational control sequences. Expression vectors include, but are not limited to, plasmids, cosmids, retroviruses, adenoviruses, adeno-associated viruses (AAV), plant viruses such as cau liflower mosaic virus and tobacco mosaic virus, yeast artificial chromosomes (YACs), Epstein-Barr (EBV)-derived episomes, and the like. In some embodiments, nucleic acid molecules comprising the disclosed genetic variants can be ligated into a vector such that transcriptional and translational control sequences within the vector serve their intended function of regulating the transcription and translation of the genetic variant. The expression vector and expression control sequences are chosen to be compatible with the expression host cell used. Nucleic acid sequences comprising the disclosed genetic variants can be inserted into separate vectors or into the same expression vector as the variant genetic information. A nucleic acid sequence comprising the disclosed genetic variants can be inserted into the expression vector by standard methods (e.g., ligation of complementary restriction sites on the nucleic acid comprising the disclosed genetic variants and vector, or blunt end ligation if no restriction sites are present).

In addition to a nucleic acid sequence comprising the disclosed genetic variants, the recombinant expression vectors can carry regulatory sequences that control the expression of the genetic variant in a host cell. The design of the expression vector, including the selection of regu latory sequences can depend on such factors as the choice of the host cell to be transformed, the level of expression of protein desired, and so forth. Desired regu latory sequences for mammalian host cell expression can include, for example, viral elements that direct high levels of protein expression in mammalian cells, such as promoters and/or enhancers derived from retroviral LTRs, cytomegalovirus (CMV) (such as the CMV

promoter/enhancer), Simian Virus 40 (SV40) (such as the SV40 promoter/en hancer), adenovirus, (e.g., the adenovirus major late promoter (AdMLP)), polyoma and strong mammalian promoters such as native immunoglobulin and actin promoters. Methods of expressing polypeptides in bacterial cel ls or fungal cells (e.g., yeast cells) are also well known.

A promoter can be, for example, a constitutively active promoter, a conditional promoter, an inducible promoter, a temporally restricted promoter (e.g., a developmental^ regu lated promoter), or a spatially restricted promoter (e.g., a cel l-specific or tissue-specific promoter). Examples of promoters can be found, for example, in WO 2013/176772. Examples of inducible promoters include, for example, chemically regu lated promoters and physically-regu lated promoters. Chemically regulated promoters include, for example, alcohol-regulated promoters (e.g., an alcohol dehydrogenase (alcA) gene promoter), tetracycline-regu lated promoters (e.g., a tetracycline-responsive promoter, a tetracycline operator sequence (tetO), a tet-On promoter, or a tet-Off promoter), steroid regu lated promoters (e.g., a rat glucocorticoid receptor, a promoter of an estrogen receptor, or a promoter of an ecdysone receptor), or metal-regulated promoters (e.g., a metalloprotein promoter). Physically regulated promoters include, for example temperature-regulated promoters (e.g., a heat shock promoter) and light-regu lated promoters (e.g., a light-inducible promoter or a light-repressible promoter).

Tissue-specific promoters can be, for example, neu ron-specific promoters, glia-specific promoters, muscle cell-specific promoters, heart cell-specific promoters, kidney cell-specific promoters, bone cel l-specific promoters, endothelial cell-specific promoters, or immune cel l- specific promoters (e.g., a B cell promoter or a T cel l promoter).

Developmental^ regu lated promoters include, for example, promoters active only during an embryonic stage of development, or only in an adult cell.

In addition to a nucleic acid sequence comprising the disclosed genetic variants and regu latory sequences, the recombinant expression vectors can carry additional sequences, such as sequences that regulate replication of the vector in host cel ls (e.g., origins of replication) and selectable marker genes. A selectable marker gene can facilitate selection of host cells into which the vector has been introduced (see e.g., U.S. Patents 4,399,216; 4,634,665; and 5,179,017). For example, a selectable marker gene can confer resistance to d rugs, such as G418, hygromycin, or methotrexate, on a host cell into which the vector has been introduced. Exemplary selectable marker genes include, but are not limited to, the dihydrofolate reductase (DHFR) gene (for use in d hfr-host cells with methotrexate selection/amplification), the neo gene (for G418 selection), and the glutamate synthetase (GS) gene.

The present disclosu re also provides isolated polypeptides comprising a variant B4GALT1 polypeptide (Asn352Ser). An exemplary wild-type human B4GALT1 polypeptide is assigned UniProt Accession No. P15291 (SEQ ID NO:7), and consists of 398 amino acids. A human variant B4GALT1 polypeptide comprises a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide (SEQ ID NO:8), as opposed to an asparagine at the same position in the wild-type hu man B4GALT1 (comparing SEQ ID NO:8 to SEQ ID NO:7, respectively). In some embodiments, the isolated polypeptide comprises SEQ ID NO:8. In some embodiments, the isolated polypeptide consists of SEQ ID NO:8.

In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 90% identical to SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 90% identical to SEQ I D NO:8 and comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 90% identical to SEQ ID NO:8, provided that the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8.

In some embodiments, the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 95% identical to SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 95% identical to SEQ ID NO:8 and comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 95% identical to SEQ ID NO:8, provided that the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 98% identical to SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 98% identical to SEQ I D NO:8 and comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 98% identical to SEQ ID NO:8, provided that the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 99% identical to SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 99% identical to SEQ ID NO:8 and comprise a serine at the position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence that is at least about 99% identical to SEQ I D NO:8, provided that the isolated polypeptides comprise a serine at the position corresponding to position 352 of SEQ ID NO:8.

In some embodiments, the isolated polypeptides comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, or at least about 350 contiguous amino acids of SEQ I D NO:8. In some embodiments, the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to at least about 8, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, or at least about 350 contiguous amino acids of SEQ ID NO:8. In some embodiments, the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8. I n some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to at least about 8, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 150, at least about 200, at least about 250, at least about 300, or at least about 350 contiguous amino acids of SEQ I D NO:8. I n some embodiments, the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ I D NO:8.

In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 90% identical to at least 300 contiguous amino acids of SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 90% identical to at least 300 contiguous amino acids of SEQ ID NO:8 and the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8. I n some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 95% identical to at least 300 contiguous amino acids of SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 95% identical to at least 300 contiguous amino acids of SEQ ID NO:8 and the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8. I n some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 98% identical to at least 300 contiguous amino acids of SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 98% identical to at least 300 contiguous amino acids of SEQ ID NO:8 and the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ I D NO:8. I n some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 99% identical to at least 300 contiguous amino acids of SEQ I D NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least 99% identical to at least 300 contiguous amino acids of SEQ ID NO:8 and the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8.

In some embodiments, the isolated polypeptides comprise or consist of at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 contiguous amino acids of SEQ ID NO:8. In some embodiments, the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8. In some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to at least about 8, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 contiguous amino acids of SEQ ID NO:8. In some embodiments, the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ ID NO:8. I n some embodiments, the isolated polypeptides comprise or consist of an amino acid sequence at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100% identical to at least about 8, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, or at least about 100 contiguous amino acids of SEQ ID NO:8. In some embodiments, the isolated polypeptides also comprise a serine at a position corresponding to position 352 of SEQ I D NO:8.

A representative wild-type B4GALT1 polypeptide sequence is recited in SEQ ID NO:7. A representative B4GALT1 variant polypeptide sequence is recited in SEQ ID NO:8.

The isolated polypeptides disclosed herein can comprise an amino acid sequence of a natu ral ly occurring B4GALT1 polypeptide, or can comprise a non-natu rally occu rring sequence. I n some embodiments, the naturally occu rring sequence can differ from the non-natu rally occu rring sequence due to conservative amino acid substitutions. For example, the sequence can be identical with the exception of conservative amino acid substitutions.

In some embodiments, the isolated polypeptides disclosed herein are linked or fused to heterologous polypeptides or heterologous molecu les or labels, nu merous examples of which are disclosed elsewhere herein. For example, the proteins can be fused to a heterologous polypeptide providing increased or decreased stability. The fused domain or heterologous polypeptide can be located at the N-terminus, the C-terminus, or internally within the polypeptide. A fusion partner may, for example, assist in providing T helper epitopes (an immunological fusion partner), or may assist in expressing the protein (an expression enhancer) at higher yields than the native recombinant polypeptide. Certain fusion partners are both immunological and expression en hancing fusion partners. Other fusion partners may be selected to increase the solubility of the polypeptide or to facilitate targeting the polypeptide to desired intracellular compartments. Some fusion partners include affinity tags, which facilitate purification of the polypeptide.

In some embodiments, a fusion protein is directly fused to the heterologous molecule or is linked to the heterologous molecule via a linker, such as a peptide linker. Suitable peptide linker sequences may be chosen, for example, based on the following factors: 1) the ability to adopt a flexible extended conformation; 2) the resistance to adopt a secondary structure that could interact with functional epitopes on the first and second polypeptides; and 3) the lack of hyd rophobic or charged residues that might react with the polypeptide functional epitopes. For example, peptide linker sequences may contain Gly, Asn and Ser residues. Other near neutral amino acids, such as Th r and Ala may also be used in the linker sequence. Amino acid sequences which may be usefu lly employed as linkers include those disclosed in, for example, Maratea et al., Gene, 1985, 40, 39-46; Murphy et al., Proc. Natl. Acad. Sci. USA, 1986, 83, 8258- 8262; and U.S. Patents 4,935,233 and 4,751,180. A linker sequence may generally be, for example, from 1 to about 50 amino acids in length. Linker sequences are generally not required when the first and second polypeptides have non-essential N-terminal amino acid regions that can be used to separate the functional domains and prevent steric interference.

In some embodiments, the polypeptides are operably lin ked to a cel l-penetrating domain. For example, the cell-penetrating domain can be derived from the H IV-1 TAT protein, the TLM cell-penetrating motif from human hepatitis B virus, M PG, Pep-1, VP22, a

cell-penetrating peptide from Herpes simplex virus, or a polyarginine peptide sequence. See, e.g., WO 2014/089290. The cel l-penetrating domain can be located at the N-terminus, the C- terminus, or anywhere within the protein.

In some embodiments, the polypeptides are operably lin ked to a heterologous polypeptide for ease of tracking or purification, such as a fluorescent protein, a purification tag, or an epitope tag. Examples of fluorescent proteins include, but are not limited to, green fluorescent proteins (e.g., GFP, GFP-2, tagG FP, tu rboG FP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreen l), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g. eBFP, eBFP2, Azu rite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g. eCFP,

Ceru lean, CyPet, AmCyanl, Midoriishi-Cyan), red fluorescent proteins (mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eq FP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (mOrange, mKO, Kusabira -Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include, but are not limited to, glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, SI, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and cal modulin. In some embodiments, the heterologous molecule is an immunoglobulin Fc domain, a peptide tag, a transduction domain, poly(ethylene glycol), polysialic acid, or glycolic acid.

In some embodiments, the isolated polypeptides comprise non-natural or modified amino acids or peptide analogs. For example, there are numerous D-amino acids or amino acids which have a different functional su bstituent than the naturally occu rring amino acids. The opposite stereo isomers of naturally occu rring peptides are disclosed, as well as the stereo isomers of peptide analogs. These amino acids can readily be incorporated into polypeptide chains by charging tRNA molecules with the amino acid of choice and engineering genetic constructs that utilize, for example, amber codons, to insert the analog amino acid into a peptide chain in a site-specific way.

In some embodiments, the isolated polypeptides are peptide mimetics, which can be produced to resemble peptides, but which are not connected via a natural peptide linkage. For example, lin kages for amino acids or amino acid analogs include, but are not limited to, -CH 2 NH-, -CH 2 S-, -CH 2 -, -CH=CH- (cis and trans), -COCH 2 -, -CH(OH)CH 2 -, and -CHH 2 SO-. Peptide analogs can have more than one atom between the bond atoms, such as b-alanine, gaminobutyric acid, and the like. Amino acid analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, and so forth), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, and others desirable properties.

In some embodiments, the isolated polypeptides comprise D-amino acids, which can be used to generate more stable peptides because D amino acids are not recognized by peptidases. Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type (e.g., D-lysine in place of L-lysine) can be used to generate more stable peptides. Cysteine residues can be used to cyclize or attach two or more peptides together. This can be beneficial to constrain peptides into particu lar conformations (see, e.g., Rizo and Gierasch, Ann. Rev. Biochem., 1992, 61, 387).

The present disclosu re also provides nucleic acid molecu les encoding any of the polypeptides disclosed herein. This includes all degenerate sequences related to a specific polypeptide sequence (i.e., al l nucleic acids having a sequence that encodes one particular polypeptide sequence as well as all nucleic acids, including degenerate nucleic acids, encoding the disclosed variants and derivatives of the protein sequences). Thus, while each particular nucleic acid sequence may not be written out herein, each and every sequence is in fact disclosed and described herein through the disclosed polypeptide sequences.

The present disclosu re also provides compositions comprising any one or more of the nucleic acid molecules and/or any one or more of the polypeptides disclosed herein. In some embodiments, the compositions comprise a carrier. In some embodiments, the carrier increases the stability of the nucleic acid molecule and/or polypeptide (e.g., prolonging the period under given conditions of storage (e.g., -20°C, 4°C, or ambient temperatu re) for which degradation products remain below a threshold, such as below 0.5% by weight of the starting nucleic acid or protein; or increasing the stability in vivo). Examples of carriers include, but are not limited to, poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micelles, inverse micelles, lipid coch leates, and lipid microtubules.

The present disclosu re also provides methods of producing any of the B4GALT1 polypeptides or fragments thereof disclosed herein. Such B4GALT1 polypeptides or fragments thereof can be produced by any suitable method. For example, B4GALT1 polypeptides or fragments thereof can be produced from host cells comprising nucleic acid molecu les (e.g., recombinant expression vectors) encoding such B4GALT1 polypeptides or fragments thereof. Such methods can comprise culturing a host cell comprising a nucleic acid molecule (e.g., recombinant expression vector) encoding an B4GALT1 polypeptide or fragment thereof u nder conditions sufficient to produce the B4GALT1 polypeptide or fragment thereof, thereby producing the B4GALT1 polypeptide or fragment thereof. The nucleic acid can be operably linked to a promoter active in the host cell, and the culturing can be carried out under conditions whereby the nucleic acid is expressed. Such methods can further comprise recovering the expressed B4GALT1 polypeptide or fragment thereof. The recovering can fu rther comprise purifying the B4GALT1 polypeptide or fragment thereof. Examples of suitable systems for protein expression include host cells such as, for example: bacterial cel l expression systems (e.g., Escherichia coli, Lactococcus lactis), yeast cell expression systems (e.g., Saccharomyces cerevisiae, Pichia pastoris), insect cell expression systems (e.g., baculovirus-mediated protein expression), and mammalian cell expression systems.

Examples of nucleic acid molecules encoding B4GALT1 polypeptides or fragments thereof are disclosed in more detail elsewhere herein. In some embodiments, the nucleic acid molecules are codon optimized for expression in the host cell. In some embodiments, the nucleic acid molecules are operably linked to a promoter active in the host cell. The promoter can be a heterologous promoter (i.e., a promoter than is not a naturally occu rring B4GALT1 promoter). Examples of promoters suitable for Escherichia coli include, but are not limited to, arabinose, lac, tac, and T7 promoters. Examples of promoters suitable for Lactococcus lactis include, but are not limited to, P170 and nisin promoters. Examples of promoters suitable for Saccharomyces cerevisiae include, but are not limited to, constitutive promoters such as alcohol dehyd rogenase (ADH I) or enolase (ENO) promoters or inducible promoters such as PHO, CUP1, GAL1, and G10. Examples of promoters suitable for Pichia pastoris include, but are not limited to, the alcohol oxidase I (AOX I) promoter, the glyceraldehyde 3 phosphate dehydrogenase (GAP) promoter, and the glutathione dependent formaldehyde dehydrogenase (FLDI) promoter. An example of a promoter suitable for a baculovirus-mediated system is the late viral strong polyhedrin promoter.

In some embodiments, the nucleic acid molecules encode a tag in frame with the B4GALT1 polypeptide or fragment thereof to facilitate protein purification. Examples of tags are disclosed elsewhere herein. Such tags can, for exa mple, bind to a partner ligand (e.g., immobilized on a resin) such that the tagged protein can be isolated from all other proteins (e.g., host cell proteins). Affinity ch romatography, high performance liquid chromatography (H PLC), and size exclusion chromatography (SEC) are examples of methods that can be used to improve the pu rity of the expressed protein.

Other methods can also be used to produce B4GALT1 polypeptides or fragments thereof. For example, two or more peptides or polypeptides can be lin ked together by protein chemistry techniques. For example, peptides or polypeptides can be chemical ly synthesized using either Fmoc (9-fluorenyl methyloxycarbonyl) or Boc (terf -butyloxycarbonoyl) chemistry. Such peptides or polypeptides can be synthesized by standard chemical reactions. For example, a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin, whereas the other fragment of a peptide or protein can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal grou p which is functional ly blocked on the other fragment. By peptide condensation reactions, these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively. Alternately, the peptide or polypeptide can be independently synthesized in vivo as described herein. Once isolated, these independent peptides or polypeptides may be linked to form a peptide or fragment thereof via similar peptide condensation reactions.

In some embodiments, enzymatic ligation of cloned or synthetic peptide segments allow relatively short peptide fragments to be joined to produce larger peptide fragments, polypeptides, or whole protein domains (Abrah msen et al., Biochemistry, 1991, 30, 4151). Alternately, native chemical ligation of synthetic peptides can be utilized to synthetically construct large peptides or polypeptides from shorter peptide fragments. This method can consist of a two-step chemical reaction (see, Dawson et al., Science, 1994, 266, 776-779). The first step can be the chemoselective reaction of an unprotected synthetic peptide-thioester with another un protected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate can undergo spontaneous, rapid intramolecu lar reaction to form a native peptide bond at the ligation site.

In some embodiments, unprotected peptide segments can be chemically linked where the bond formed between the peptide segments as a resu lt of the chemical ligation is an u nnatu ral (non-peptide) bond (see, Schnolzer et al., Science, 1992, 256, 221).

The present disclosu re also provides cells (e.g., recombinant host cells) comprising any one or more of the nucleic acid molecules and/or any one or more of the polypeptides disclosed herein. The cells can be in vitro, ex vivo, or in vivo. Nucleic acid molecu les can be linked to a promoter and other regulatory sequences so they are expressed to produce an encoded protein.

In some embodiments, the cel l is a totipotent cell or a pluri potent cell (e.g., an embryonic stem (ES) cell such as a rodent ES cell, a mouse ES cell, or a rat ES cell). Totipotent cells include undifferentiated cel ls that can give rise to any cell type, and plu ripotent cel ls include undifferentiated cel ls that possess the ability to develop into more than one differentiated cell types. Such plu ripotent and/or totipotent cells can be, for example, ES cells or ES-like cells, such as an induced pluripotent stem (iPS) cells. ES cells include embryo-derived totipotent or pluripotent cells that are capable of contributing to any tissue of the developing embryo upon introduction into an embryo. ES cells can be derived from the inner cell mass of a blastocyst and are capable of differentiating into cells of any of the th ree vertebrate germ layers (endoderm, ectoderm, and mesoderm).

In some embodiments, the cel l is a primary somatic cell, or a cell that is not a primary somatic cel l. Somatic cel ls can include any cell that is not a gamete, germ cell, gametocyte, or u ndifferentiated stem cell. I n some embodiments, the cell can also be a primary cell. Primary cells include cells or cu ltures of cells that have been isolated directly from an organism, organ, or tissue. Primary cells include cells that are neither transformed nor immortal. Primary cells include any cell obtained from an organism, organ, or tissue which was not previously passed in tissue cu lture or has been previously passed in tissue culture but is incapable of being indefinitely passed in tissue culture. Such cells can be isolated by conventional techniques and include, for example, somatic cells, hematopoietic cells, endothelial cells, epithelial cells, fibroblasts, mesenchymal cells, keratinocytes, melanocytes, monocytes, mononuclear cel ls, adipocytes, preadipocytes, neurons, glial cel ls, hepatocytes, skeletal myoblasts, and smooth muscle cel ls. For example, primary cells can be derived from connective tissues, muscle tissues, nervous system tissues, or epithelial tissues.

In some embodiments, the cel ls may normally not proliferate indefinitely but, due to mutation or alteration, have evaded normal cel lular senescence and instead can keep u ndergoing division. Such mutations or alterations can occu r naturally or be intentionally induced. Examples of immortalized cells include, but are not limited to, Chinese hamster ovary (CHO) cells, human embryonic kidney cel ls (e.g., HEK 293 cells), and mouse embryonic fibroblast cel ls (e.g., 3T3 cel ls). Nu merous types of immortalized cells are wel l known.

I mmortalized or primary cells include cells that are typically used for cu lturing or for expressing recombinant genes or proteins. In some embodiments, the cell is a differentiated cell, such as a liver cell (e.g., a human liver cell).

The cell can be from any source. For example, the cell can be a eu karyotic cell, an animal cell, a plant cell, or a fungal (e.g., yeast) cel l. Such cells can be fish cells or bird cel ls, or such cells can be mammalian cel ls, such as hu man cells, non-human mammalian cells, rodent cells, mouse cells or rat cel ls. Mammals include, but are not limited to, hu mans, non-hu man primates, monkeys, apes, cats dogs, horses, bulls, deer, bison, sheep, rodents (e.g., mice, rats, hamsters, guinea pigs), livestock (e.g., bovine species such as cows, steer, etc.; ovine species such as sheep, goats, etc.; and porcine species such as pigs and boars). Birds include, but are not limited to, chickens, tu rkeys, ostrich, geese, ducks, etc. Domesticated animals and agricultu ral animals are also included. The term "non-hu man animal" excludes humans.

The present disclosu re also provides methods for detecting the presence of a B4GALT1 variant gene, mRNA, cDNA, and/or polypeptide in a biological sample from a subject hu man. It is understood that gene sequences within a population and mRNAs and proteins encoded by such genes can vary due to polymorphisms such as single-nucleotide polymorphisms. The sequences provided herein for the B4GALT1 gene, mRNA, cDNA, and polypeptide are only exemplary sequences. Other sequences for the B4GALT1 gene, mRNA, cDNA, and polypeptide are also possible.

The biological sample can be derived from any cell, tissue, or biological fluid from the su bject. The sample may comprise any clinically relevant tissue, such as a bone marrow sample, a tu mor biopsy, a fine needle aspirate, or a sample of bodily fluid, such as blood, plasma, serum, lymph, ascitic fluid, cystic fluid, or urine. In some cases, the sample comprises a buccal swab. The sample used in the methods disclosed herein will vary based on the assay format, natu re of the detection method, and the tissues, cells, or extracts that are used as the sample. A biological sample can be processed differently depending on the assay being employed. For example, when detecting a variant B4GALT1 nucleic acid molecule, preliminary processing designed to isolate or enrich the sample for the genomic DNA can be employed. A variety of known techniques may be used for this pu rpose. When detecting the level of B4GALT1 mRNA, different tech niques can be used en rich the biological sample with mRNA. Various methods to detect the presence or level of a mRNA or the presence of a particular variant genomic DNA locus can be used.

In some embodiments, the disclosure provides methods of detecting the presence or absence of a variant B4GALT1 nucleic acid molecule comprising sequencing at least a portion of a nucleic acid in a biological sample to determine whether the nucleic acid comprises nucleotides 53757 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ I D NO:2.

In some embodiments, the disclosu re provides methods of detecting the presence or absence of a variant B4GALT1 nucleic acid molecule comprising sequencing at least a portion of a nucleic acid in a biological sample to determine whether the nucleic acid comprises nucleotides 1243 to 1245 of SEQ ID NO:4 at positions that correspond to positions 1243 to 1245 of SEQ ID NO:4.

In some embodiments, the disclosure provides methods of detecting the presence or absence of a variant B4GALT1 nucleic acid molecule comprising sequencing at least a portion of a nucleic acid in a biological sample to determine whether the nucleic acid comprises nucleotides 1054 to 1056 of SEQ ID NO:6 at positions that correspond to positions 1054 to 1056 of SEQ ID NO:6.

In some embodiments, the methods of detecting the presence or absence of a variant B4GALT1 nucleic acid molecu le (e.g., gene, mRNA, or cDNA) in a hu man subject, comprise: performing an assay on a biological sample from the hu man subject that determines whether a nucleic acid molecule in the biological sample comprises a nucleic acid sequence that encodes a serine at position 352 of SEQ ID NO:8. In some embodiments, the biological sample comprises a cell or cel l lysate. Such methods can comprise, for example, obtaining a biological sample from the subject comprising a B4GALT1 gene, mRNA, or cDNA and performing an assay on the biological sample that determines that a position of the B4GALT1 gene, mRNA, or cDNA corresponding to positions 53757 to 53577 of SEQ I D NO:2 (gene), positions 1243 to 1245 of SEQ ID NO:4 (mRNA), or positions 1054 to 1056 of SEQ ID NO:6 (cDNA) encodes a serine instead of an asparagine at a position corresponding to position 352 of the variant B4GALT1 polypeptide. Such assays can comprise, for example determining the identity of these positions of the particu lar B4GALT1 nucleic acid molecule.

In some embodiments, the assay comprises: sequencing a portion of the B4GALT1 genomic sequence of a nucleic acid molecu le in the biological sample from the human subject, wherein the portion sequenced includes positions corresponding to positions 53575 to 53577 of SEQ ID NO:2; sequencing a portion of the B4GALT1 mRNA sequence of a nucleic acid molecule in the biological sample from the human subject, wherein the portion sequenced includes positions corresponding to positions 1243 to 1245 of SEQ ID NO:4; or sequencing a portion of the B4GALT1 cDNA sequence of a nucleic acid molecule in the biological sample from the human subject, wherein the portion sequenced includes positions corresponding to positions 1054 to 1056 of SEQ ID NO:6.

In some embodiments, the assay comprises: a) contacting the biological sample with a primer hybridizing to: i) a portion of the B4GALT1 genomic sequence that is proximate to a position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577 of SEQ I D NO:2; ii) a portion of the B4GALT1 mRNA sequence that is proximate to a position of the B4GALT1 mRNA corresponding to positions 1243 to 1245 of SEQ ID NO:4; or iii) a portion of the B4GALT1 cDNA sequence that is proximate to a position of the B4GALT1 cDNA corresponding to positions 1054 to 1056 of SEQ ID NO:6; b) extending the primer at least through: i) the position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577; ii) the position of the B4GALT1 mRNA corresponding to positions 1243 to 1245; or iii) the position of the B4GALT1 cDNA corresponding to positions 1054 to 1056; and c) determining whether the extension product of the primer comprises nucleotides at positions: i) corresponding to positions 53575 to 53577 of the B4GALT1 genomic sequence; ii) corresponding to positions 1243 to 1245 of the B4GALT1 mRNA; or iii) corresponding to positions 1054 to 1056 of the B4GALT1 cDNA; that encode a serine at position 352 of SEQ ID NO:8. In some embodiments, only B4GALT1 genomic DNA is analyzed. In some embodiments, only B4GALT1 mRNA is analyzed. In some embodiments, only B4GALT1 cDNA is analyzed.

In some embodiments, the assay comprises contacting the biological sample with a primer or probe that specifically hybridizes to a variant B4GALT1 genomic sequence, mRNA sequence, or cDNA sequence and not the corresponding wild-type B4GALT1 sequence under stringent conditions, and determining whether hybridization has occurred.

In some embodiments, the assays described above comprise RNA sequencing (RNA- Seq). In some embodiments, the assays also comprise reverse transcription polymerase chain reaction (RT-PCR).

In some embodiments, the methods utilize probes and primers of sufficient nucleotide length to bind to the target nucleic acid sequence and specifical ly detect and/or identify a polynucleotide comprising a variant B4GALT1 gene, mRNA, or cDNA. The hybridization conditions or reaction conditions can be determined by the operator to achieve this result. This length may be any length that is sufficient to be useful in a detection method of choice.

General ly, for example, about 8, about 11, about 14, about 16, about 18, about 20, about 22, about 24, about 26, about 28, about 30, about 40, about 50, about 75, about 100, about 200, about 300, about 400, about 500, about 600, or about 700 nucleotides, or more, or from about 11 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 100, from about 100 to about 200, from about 200 to about 300, from about 300 to about 400, from about 400 to about 500, from about 500 to about 600, from about 600 to about 700, or from about 700 to about 800, or more nucleotides in length are used. Such probes and primers can hybridize specifically to a target sequence under high stringency hybridization conditions. Probes and primers may have complete nucleic acid sequence identity of contiguous nucleotides with the target sequence, although probes differing from the target nucleic acid sequence and that retain the ability to specifically detect and/or identify a target nucleic acid sequence may be designed by conventional methods. Accordingly, probes and primers can share about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or 100% sequence identity or complementarity to the target nucleic acid molecule.

In some embodiments, specific primers can be used to amplify the variant B4GALT1 locus and/or B4GALT1 variant mRNA or cDNA to produce an amplicon that can be used as a specific probe or can itself be detected for identifying the variant B4GALT1 locus or for determining the level of specific B4GALT1 mRNA or cDNA in a biological sample. The B4GALT1 variant locus can be used to denote a genomic nucleic acid sequence including a position corresponding to positions 53575 to 53577 in SEQ ID NO:2. When the probe is hybridized with a nucleic acid molecule in a biological sample under conditions that allow for the binding of the probe to the nucleic acid molecule, this binding can be detected and allow for an indication of the presence of the variant B4GALT1 locus or the presence or the level of variant B4GALT1 mRNA or cDNA in the biological sample. Such identification of a bou nd probe has been described. The specific probe may comprise a sequence of at least about 80%, from about 80% to about 85%, from about 85% to about 90%, from about 90% to about 95%, and from about 95% to about 100% identical (or complementary) to a specific region of a variant B4GALT1 gene. The specific probe may comprise a sequence of at least about 80%, from about 80% to about 85%, from about 85% to about 90%, from about 90% to about 95%, and from about 95% to about 100% identical (or complementary) to a specific region of a variant B4GALT1 mRNA. The specific probe may comprise a sequence of at least about 80%, from about 80% to about 85%, from about 85% to about 90%, from about 90% to about 95%, and from about 95% to about 100% identical (or complementary) to a specific region of a variant B4GALT1 cDNA.

In some embodiments, to determine whether the nucleic acid complement of a biological sample comprises the serine encoding nucleotides at positions 53575 to 53577 in the variant B4GALT1 gene locus (SEQ ID NO:2), the biological sample may be su bjected to a nucleic acid amplification method using a primer pair that includes a first primer derived from the 5' flan king sequence adjacent to positions 53575 to 53577 and a second primer derived from the 3' flan king sequence adjacent to positions 53575 to 53577 to produce an amplicon that is diagnostic for the presence of the SNP at positions 53575 to 53577 in the variant B4GALT1 gene locus (SEQ ID NO:2). In some embodiments, the amplicon may range in length from the combined length of the primer pairs plus one nucleotide base pair to any length of amplicon producible by a DNA amplification protocol. This distance can range from one nucleotide base pair up to the limits of the amplification reaction, or about twenty thousand nucleotide base pairs. Optionally, the primer pair flanks a region including positions 53575 to 53577 and at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides on each side of positions 53575 to 53577. Similar amplicons can be generated from the mRNA and/or cDNA sequences.

Representative methods for preparing and using probes and primers are described, for example, in Molecular Cloning: A Laboratory Manual, 2nd Ed., Vol. 1-3, ed. Sambrook et al., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989 (hereinafter, "Sambrook et al., 1989"); Current Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and Wiley-lnterscience, New York, 1992 (with periodic updates) (hereinafter, "Ausubel et al., 1992"); and I nnis et al., PCR Protocols: A Guide to Methods and Applications, Academic Press: San Diego, 1990). PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose, such as the PCR primer analysis tool in Vector NTI version 10 (Informax Inc., Bethesda Md.); PrimerSelect (DNASTAR Inc., Madison, Wis.); and Primer3 (Version 0.4.0.COPYRGT., 1991, Whitehead Institute for Biomedical Research, Cambridge, Mass.). Additionally, the sequence can be visually scanned and primers manually identified using known guidelines.

As described in further detail below, any conventional nucleic acid hybridization or amplification or sequencing method can be used to specifically detect the presence of the variant B4GALT1 gene locus and/or the level of variant B4GALT1 mRNA or cDNA. In some embodiments, the nucleic acid molecule can be used either as a primer to amplify a region of the B4GALT1 nucleic acid or the nucleic acid molecule can be used as a probe that hybridizes u nder stringent conditions to a nucleic acid molecule comprising the variant B4GALT1 gene locus or a nucleic acid molecule comprising a variant B4GALT1 mRNA or cDNA.

A variety of nucleic acid techniques are known, including, for example, nucleic acid sequencing, nucleic acid hybridization, and nucleic acid amplification. Il lustrative examples of nucleic acid sequencing techniques include, but are not limited to, chain terminator (Sanger) sequencing and dye terminator sequencing. Other methods involve nucleic acid hybridization methods other than sequencing, including using labeled primers or probes directed against pu rified DNA, amplified DNA, and fixed cell preparations (fluorescence in situ hybridization). In some methods, a target nucleic acid may be amplified prior to or simultaneous with detection. Illustrative examples of nucleic acid amplification techniques include, but are not limited to, polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), and nucleic acid sequence based amplification (NASBA). Other methods include, but are not limited to, ligase chain reaction, strand displacement amplification, and thermophilic SDA (tSDA).

Any method can be used for detecting either the non-amplified or amplified polynucleotides including, for example, Hybridization Protection Assay (HPA), quantitative evaluation of the amplification process in real-time, and determining the quantity of target sequence initially present in a sample, but which is not based on a real-time amplification.

Also provided are methods for identifying nucleic acids which do not necessarily require sequence amplification and are based on, for example, the known methods of Southern (DNA:DNA) blot hybridizations, in situ hybridization (ISH), and fluorescence in situ hybridization (FISH) of chromosomal material, using appropriate probes. Southern blotting can be used to detect specific nucleic acid sequences. In such methods, nucleic acid that is extracted from a sample is fragmented, electrophoretical ly separated on a matrix gel, and transferred to a membrane filter. The filter bound nucleic acid is subject to hybridization with a labeled probe complementary to the sequence of interest. Hybridized probe bound to the filter is detected.

In hybridization techniques, stringent conditions can be employed such that a probe or primer will specifically hybridize to its target. In some embodiments, a polynucleotide primer or probe under stringent conditions will hybridize to its target sequence (e.g., the variant B4GALT1 gene locus, mRNA, or cDNA) to a detectably greater degree than to other sequences (e.g., the corresponding wild-type B4GALT1 locus, mRNA, or cDNA), such as at least 2-fold over background or 10-fold over background. Stringent conditions are sequence-dependent and will be different in different circumstances. By control ling the stringency of the hybridization and/or washing conditions, target sequences that are 100% complementary to the probe can be identified (homologous probing). Alternately, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of identity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length or less than about 500 nucleotides in length. Appropriate stringency conditions which promote DNA hybridization, for example, 6X sodiu m chloride/sodium citrate (SSC) at about 45°C, followed by a wash of 2X SSC at 50°C, are known or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y.

(1989), 6.3.1-6.3.6. Typically, stringent conditions for hybridization and detection will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperatu re is at least about 30°C for short probes (e.g., 10 to 50 nucleotides) and at least about 60°C for longer probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCI, 1% SDS (sodium dodecyl su lfate) at 37°C, and a wash in IX to 2X SSC (20X SSC = 3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55°C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCI, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCI, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C. Optionally, wash buffers may comprise about 0.1% to about 1% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hou rs. The du ration of the wash time will be at least a length of time sufficient to reach equilibrium.

In hybridization reactions, specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T m can be approximated from the equation of Meinkoth and Wahl, Anal. Biochem., 1984, 138, 267-284: T m = 81.5°C + 16.6 (log M) + 0.41 (% GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T m is the temperatu re (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the T m can be decreased 10°C. General ly, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1°C, 2°C, 3°C, or 4°C lower than the thermal melting point (T m ); moderately stringent conditions can utilize a hybridization and/or wash at 6°C, 7°C, 8°C, 9°C, or 10°C lower than the thermal melting point (T m ); low stringency conditions can utilize a hybridization and/or wash at 11°C, 12°C, 13°C, 14°C, 15°C, or 20°C lower than the thermal melting point (T m ). Using the equation, hybridization and wash compositions, and desired T m , those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T m of less than 45°C (aqueous solution) or 32°C (formamide solution), it is optimal to increase the SSC concentration so that a higher temperatu re can be used.

Also provided are methods for detecting the presence or levels of variant B4GALT1 polypeptide in a biological sample, including, for example, protein sequencing and

immunoassays. In some embodiments, the method of detecting the presence of B4GALT1 Asn352Ser in a human su bject, comprises performing an assay on a biological sample from the human subject that determines the presence of B4GALT1 Asn352Ser in the biological sample.

Illustrative non-limiting examples of protein sequencing techniques include, but are not limited to, mass spectrometry and Edman degradation. Illustrative examples of

immunoassays include, but are not limited to, immunoprecipitation, Western blot,

immunohistochemistry, ELISA, immunocytochemistry, flow cytometry, and immuno-PCR.

Polyclonal or monoclonal antibodies detectably labeled using various known techniques (e.g., calorimetric, fluorescent, chemiluminescent, or radioactive) are suitable for use in the immunoassays.

The present disclosu re also provides methods for determining a su bject's susceptibility to developing a cardiovascular condition or risk of developing a cardiovascular condition. The su bject can be any organism, including, for example, a hu man, a non-hu man mammal, a rodent, a mouse, or a rat. In some embodiments, the methods comprise detecting the presence of the variant B4GALT1 genomic DNA, mRNA, or cDNA in a biological sample from the subject. It is u nderstood that gene sequences within a popu lation and mRNAs encoded by such genes can vary due to polymorphisms such as SNPs. The sequences provided herein for the B4GALT1 gene, mRNA, cDNA, and polypeptide are only exemplary sequences and other such sequences are also possible.

Non-limiting examples of a cardiovascular condition include an elevated level of one or more seru m lipids. The seru m lipids comprise one or more of cholesterol, LDL, HDL, triglycerides, HDL-cholesterol, and non-HDL cholesterol, or any subfraction thereof (e.g., HDL2, HDL2a, HDL2b, H DL2c, HDL3, HDL3a, HDL3b, H DL3c, HDL3d, LDL1, LDL2, LDL3, lipoprotein A, Lpal, Lpal, Lpa3, Lpa4, or Lpa5). A cardiovascular condition may comprise elevated levels of coronary artery calcification. A cardiovascular condition may comprise Type lid glycosylation (CDG-lld). A cardiovascular condition may comprise elevated levels of pericardial fat. A cardiovascular condition may also comprise coronary artery disease (CAD), myocardial infarction (Ml), peripheral artery disease (PAD), stroke, pulmonary embolism, deep vein th rombosis (DVT), and bleeding diatheses and coagulopathies. A cardiovascular condition may comprise an atherothrombotic condition. The atherothrombotic condition may comprise elevated levels of fibrinogen. The atherothrombotic condition may comprises a fibrinogen- mediated blood clot. A cardiovascular condition may comprise elevated levels of fibrinogen. A cardiovascular condition may comprise a fibrinogen-mediated blood clot. A cardiovascu lar condition may comprise a blood clot formed from the involvement of fibrinogen activity. A fibrinogen-mediated blood clot or blood clot formed from the involvement of fibrinogen activity may be in any vein or artery in the body.

In some embodiments, the methods of determining a hu man subject's susceptibility to developing a cardiovascu lar condition, comprise: a) performing an assay on a biological sample from the hu man subject that determines whether a nucleic acid molecule in the biological sample comprises a nucleic acid sequence that encodes a serine at the position corresponding to position 352 of the fu ll length/mature variant B4GALT1 Asn352Ser polypeptide; and b) classifying the human subject as being at decreased risk for developing the cardiovascular condition if a nucleic acid molecu le comprising a nucleic acid sequence that encodes a serine at position 352 of the full length/matu re variant B4GALT1 Asn352Ser polypeptide is detected in the biological sample, or classifying the hu man subject as being at increased risk for developing the cardiovascular condition if a nucleic acid molecu le comprising a nucleic acid sequence that encodes a serine at position 352 of the full length/mature variant B4GALT1 Asn352Ser polypeptide is not detected in the biological sample. In some embodiments, the variant B4GALT1 Asn352Ser polypeptide comprises SEQ ID NO:8. In some embodiments, the nucleic acid molecu le in the biological sample is genomic DNA, mRNA, or cDNA.

In some embodiments, the disclosure provides methods of determining a human su bject's susceptibility to developing a cardiovascular condition, comprising: a) performing an assay on a biological sample from the hu man subject that determines whether a nucleic acid molecule in the biological sample comprises nucleotides 53757 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ ID NO:2; and b) classifying the human subject as being at decreased risk for developing the cardiovascular condition if a nucleic acid molecule comprising nucleotides 53757 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ ID NO:2 is detected in the biological sample, or classifying the human subject as being at increased risk for developing the cardiovascular condition if a nucleic acid molecu le comprising nucleotides 53757 to 53577 of SEQ ID NO:2 at positions that correspond to positions 53757 to 53577 of SEQ ID NO:2 is not detected in the biological sample.

In some embodiments, the disclosure provides methods of determining a human su bject's susceptibility to developing a cardiovascular condition, comprising: a) performing an assay on a biological sample from the hu man subject that determines whether a nucleic acid molecule in the biological sample comprises nucleotides 1243 to 1245 of SEQ ID NO:4 at positions that correspond to positions 1243 to 1245 of SEQ ID NO:4; and b) classifying the human subject as being at decreased risk for developing the cardiovascular condition if a nucleic acid molecule comprising nucleotides 1243 to 1245 of SEQ ID NO:4 at positions that correspond to positions 1243 to 1245 of SEQ ID NO:4 is detected in the biological sample, or classifying the human subject as being at increased risk for developing the cardiovascular condition if a nucleic acid molecu le comprising nucleotides 1243 to 1245 of SEQ ID NO:4 at positions that correspond to positions 1243 to 1245 of SEQ ID NO:4 is not detected in the biological sample.

In some embodiments, the disclosure provides methods of determining a human su bject's susceptibility to developing a cardiovascular condition, comprising: a) performing an assay on a biological sample from the hu man subject that determines whether a nucleic acid molecule in the biological sample comprises nucleotides 1054 to 1056 of SEQ ID NO:6 at positions that correspond to positions 1054 to 1056 of SEQ ID NO:6; and b) classifying the human subject as being at decreased risk for developing the cardiovascular condition if a nucleic acid molecule comprising nucleotides 1054 to 1056 of SEQ ID NO:6 at positions that correspond to positions 1054 to 1056 of SEQ ID NO:6 is detected in the biological sample, or classifying the human subject as being at increased risk for developing the cardiovascular condition if a nucleic acid molecu le comprising nucleotides 1054 to 1056 of SEQ ID NO:6 at positions that correspond to positions 1054 to 1056 of SEQ ID NO:6 is not detected in the biological sample.

In some embodiments, the methods comprise detecting the presence of a variant B4GALT1 genomic DNA in a biological sample. In some embodiments, such methods comprise determining a su bject's susceptibility to developing a cardiovascu lar condition or risk of developing a cardiovascu lar condition, comprising: a) obtaining a biological sample from the su bject that comprises genomic DNA; b) performing an assay on the genomic DNA that determines the identity of the nucleotides in the DNA occupying positions corresponding to positions 53575 to 53577 of the variant B4GALT1 gene (see, for example, SEQ ID NO:2); and c) classifying the subject as being at decreased risk for developing the cardiovascu lar condition if the positions in the genomic DNA corresponding to positions 53575 to 53577 of the variant B4GALT1 gene encodes a serine rather than an asparagine. Alternately, the subject can be classified as being at increased risk for developing the cardiovascu lar condition if the positions in the genomic DNA corresponding to positions 53575 to 53577 of the variant B4GALT1 gene do not encode a serine rather than an asparagine.

In some embodiments, such methods comprise diagnosing a su bject with

cardiovascular condition, comprising: a) obtaining a biological sample from the subject that comprises genomic DNA; b) performing an assay on the genomic DNA that determines the identity of the nucleotides in the DNA occupying positions corresponding to positions 53575 to 53577 of the variant B4GALT1 gene (see, for example, SEQ I D NO:2); and c) classifying the su bject as having a cardiovascular condition if the positions in the genomic DNA corresponding to positions 53575 to 53577 of the variant B4GALT1 gene encodes a serine rather than an asparagine. Alternately, the subject can be classified as not having a cardiovascu lar condition if the positions in the genomic DNA corresponding to positions 53575 to 53577 of the variant B4GALT1 gene do not encode a serine rather than an asparagine.

In some embodiments, the methods comprise detecting the presence of a variant B4GALT1 mRNA in a biological sample. In some embodiments, such methods comprise determining a su bject's susceptibility to developing a cardiovascu lar condition or risk of developing a cardiovascu lar condition, comprising: a) obtaining a biological sample from the su bject that comprises mRNA; b) performing an assay on the mRNA that determines the identity of the nucleotides in the mRNA occupying positions corresponding to positions 1243 to 1245 of the variant B4GALT1 mRNA (see, for exam ple, SEQ I D NO:4); and c) classifying the su bject as being at decreased risk for developing the cardiovascular condition if the positions in the mRNA corresponding to positions 1243 to 1245 of the variant B4GALT1 mRNA encodes a serine rather than an asparagine. Alternately, the su bject can be classified as being at increased risk for developing the cardiovascu lar condition if the positions in the mRNA corresponding to positions 1243 to 1245 of the variant B4GALT1 mRNA do not encode a serine rather than an asparagine.

In some embodiments, such methods comprise diagnosing a su bject with

cardiovascular condition, comprising: a) obtaining a biological sample from the subject that comprises mRNA; b) performing an assay on the mRNA that determines the identity of the nucleotides in the mRNA occu pying positions corresponding to positions 1243 to 1245 of the variant B4GALT1 mRNA (see, for example, SEQ ID NO:4); and c) classifying the subject as having a cardiovascu lar condition if the positions in the mRNA corresponding to positions 1243 to 1245 of the variant B4GALT1 mRNA encodes a serine rather than an asparagine. Alternately, the su bject can be classified as not having a cardiovascular condition if the positions in the mRNA corresponding to positions 1243 to 1245 of the variant B4GALT1 mRNA do not encode a serine rather than an asparagine.

In some embodiments, the methods comprise detecting the presence of a variant B4GALT1 cDNA in a biological sample. In some embodiments, such methods comprise determining a su bject's susceptibility to developing a cardiovascu lar condition or risk of developing a cardiovascu lar condition, comprising: a) obtaining a biological sample from the su bject that comprises cDNA; b) performing an assay on the cDNA that determines the identity of the nucleotides in the cDNA occupying positions corresponding to positions 1054 to 1056 of the variant B4GALT1 cDNA (see, for example, SEQ ID NO:6); and c) classifying the subject as being at decreased risk for developing the cardiovascular condition if the positions in the cDNA corresponding to positions 1054 to 1056 of the variant B4GALT1 cDNA encodes a serine rather than an asparagine. Alternately, the subject can be classified as being at increased risk for developing the cardiovascular condition if the positions in the cDNA corresponding to positions 1054 to 1056 of the variant B4GALT1 cDNA do not encode a serine rather than an asparagine.

In some embodiments, such methods comprise diagnosing a su bject with

cardiovascular condition, comprising: a) obtaining a biological sample from the subject that comprises cDNA; b) performing an assay on the cDNA that determines the identity of the nucleotides in the cDNA occupying positions corresponding to positions 1054 to 1056 of the variant B4GALT1 cDNA (see, for example, SEQ ID NO:6); and c) classifying the subject as having a cardiovascu lar condition if the positions in the cDNA corresponding to positions 1054 to 1056 of the variant B4GALT1 cDNA encodes a serine rather than an asparagine. Alternately, the su bject can be classified as not having a cardiovascular condition if the positions in the cDNA corresponding to positions 1054 to 1056 of the variant B4GALT1 cDNA do not encode a serine rather than an asparagine.

In some embodiments, the assay comprises: sequencing a portion of the B4GALT1 genomic sequence of a nucleic acid molecu le in the biological sample from the human subject, wherein the portion sequenced includes positions corresponding to positions 53575 to 53577 of SEQ ID NO:2; sequencing a portion of the B4GALT1 mRNA sequence of a nucleic acid molecule in the biological sample from the human subject, wherein the portion sequenced includes positions corresponding to positions 1243 to 1245 of SEQ ID NO:4; or sequencing a portion of the B4GALT1 cDNA sequence of a nucleic acid molecule in the biological sample from the human subject, wherein the portion sequenced includes positions corresponding to positions 1054 to 1056 of SEQ ID NO:6.

In some embodiments, the assay comprises: a) contacting the biological sample with a primer hybridizing to: i) a portion of the B4GALT1 genomic sequence that is proximate to a position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577 of SEQ I D NO:2; ii) a portion of the B4GALT1 mRNA sequence that is proximate to a position of the B4GALT1 mRNA corresponding to positions 1243 to 1245 of SEQ ID NO:4; or iii) a portion of the B4GALT1 cDNA sequence that is proximate to a position of the B4GALT1 cDNA corresponding to positions 1054 to 1056 of SEQ ID NO:6; b) extending the primer at least through: i) the position of the B4GALT1 genomic sequence corresponding to positions 53575 to 53577; ii) the position of the B4GALT1 mRNA corresponding to positions 1243 to 1245; or iii) the position of the B4GALT1 cDNA corresponding to positions 1054 to 1056; and c) determining the whether the extension product of the primer comprises nucleotides at positions: i) corresponding to positions 53575 to 53577 of the B4GALT1 genomic sequence; ii) corresponding to positions 1243 to 1245 of the B4GALT1 mRNA; or iii) corresponding to positions 1054 to 1056 of the B4GALT1 cDNA; that encode a serine at position 352 of SEQ ID NO:8.

In some embodiments, the assay comprises contacting the biological sample with a primer or probe that specifically hybridizes to the variant B4GALT1 genomic sequence, mRNA sequence, or cDNA sequence and not the corresponding wild-type B4GALT1 sequence under stringent conditions, and determining whether hybridization has occurred. In some

embodiments, the primer or probe specifically hybridizes to positions within the genomic DNA in the biological sample that corresponds to positions 53575 to 53577 of SEQ ID NO:2. In some embodiments, the primer or probe specifically hybridizes to positions within the mRNA in the biological sample that corresponds to positions 1243 to 1245 of SEQ ID NO:4. In some embodiments, the primer or probe specifically hybridizes to positions within the cDNA in the biological sample that corresponds to positions 1054 to 1056 of SEQ ID NO:6.

Other assays that can be used in the methods disclosed herein include, for example, reverse transcription polymerase chain reaction (RT-PCR) or quantitative RT-PCR (qRT-PCR). Yet other assays that can be used in the methods disclosed herein include, for example, RNA sequencing (RNA-Seq) followed by determination of the presence and quantity of variant mRNA or cDNA in the biological sample.

The present disclosu re also provides methods of determining a human subject's susceptibility to developing a cardiovascu lar condition or diagnosing a su bject with

cardiovascular condition, comprising: a) performing an assay on a biological sample from the human subject that determines whether a B4GALT1 polypeptide in the biological sample comprises a serine at a position corresponding to position 352 of SEQ ID NO:8; and b) classifying the human subject as being at decreased risk for developing the cardiovascular condition if a B4GALT1 polypeptide comprising a serine at a position corresponding to position 352 of SEQ I D NO:8 is detected in the biological sample, or classifying the hu man subject as being at increased risk for developing the cardiovascular condition if a B4GALT1 polypeptide comprising a serine at a position corresponding to position 352 of SEQ ID NO:8 is not detected in the biological sample. In some embodiments, the methods fu rther comprise obtaining a biological sample from the subject.

In some embodiments, where a subject has been diagnosed with a cardiovascular condition or as having an increased risk for developing a cardiovascu lar condition, a therapeutic or prophylactic agent that treats or prevents the cardiovascular condition is ad ministered to the su bject. Alternately, the method can fu rther comprise ad ministering a therapeutic agent tailored to prevent or alleviate one or more symptoms associated with progression to more clinically advanced stages of cardiovascular condition, particu larly in patients with increased LDL levels and/or those patients who have had or are at increased risk of thrombotic events. The present disclosu re also provides methods for modifying a cel l th rough use of any combination of nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, antisense molecules such as antisense RNA, siRNA, and shRNA, B4GALT1 polypeptides or fragments thereof, and expression vectors for expressing a recombinant B4GALT1 gene or a nucleic acid encoding an B4GALT1 polypeptide. The methods can occu r in vitro, ex vivo, or in vivo. The nuclease agents, exogenous donor sequences, transcriptional activators, transcriptional repressors, antisense molecules such as antisense RNA, siRNA, and shRNA, B4GALT1 polypeptides or fragments thereof, and expression vectors can be introduced into the cell in any form and by any means as described elsewhere herein, and all or some can be introduced simultaneously or sequentially in any combination. Some methods involve only altering an endogenous B4GALT1 gene in a cell. Some methods involve only altering expression of an endogenous B4GALT1 gene through use of transcriptional activators or repressors or through use of antisense molecu les such as antisense RNA, siRNA, and shRNA. Some methods involve only introducing a recombinant B4GALT1 gene or nucleic acid encoding a B4GALT1 polypeptide or fragment thereof into a cel l. Some methods involve only introducing a B4GALT1 polypeptide or fragment thereof into a cell (e.g., any one of or any combination of the B4GALT1 polypeptides or fragments thereof disclosed herein). Other methods involve both altering an endogenous B4GALT1 gene in a cel l and introducing a B4GALT1 polypeptide or fragment thereof or recombinant B4GALT1 gene or nucleic acid encoding a B4GALT1 polypeptide or fragment thereof into the cel l. Other methods involve both altering expression of an endogenous B4GALT1 gene in a cell and introducing a B4GALT1 polypeptide or fragment thereof or recombinant B4GALT1 gene or nucleic acid encoding a B4GALT1 polypeptide or fragment thereof into the cel l.

The present disclosu re provides methods for modifying an endogenous B4GALT1 gene in a genome within a cel l (e.g., a plu ripotent cel l or a differentiated cel l) th rough use of nuclease agents and/or exogenous donor sequences. The methods can occu r in vitro, ex vivo, or in vivo. The nuclease agent can be used alone or in combination with an exogenous donor sequence. Alternately, the exogenous donor sequence can be used alone or in combination with a nuclease agent.

Repair in response to double-strand breaks (DSBs) occurs principally through two conserved DNA repair pathways: non-homologous end joining (NHEJ) and homologous recombination (HR) (see, Kasparek & Humph rey, Seminars in Cell & Dev. Biol., 2011, 22, 886- 897). Repair of a target nucleic acid (e.g., an endogenous B4GALT1 gene) mediated by an exogenous donor sequence can include any process of exchange of genetic information between the two polynucleotides. For example, NHEJ can also resu lt in the targeted integration of an exogenous donor sequence th rough direct ligation of the break ends with the ends of the exogenous donor sequence (i.e., NHEJ-based capture). Repair can also occur via homology directed repair (HDR) or homologous recombination (HR). H DR or HR includes a form of nucleic acid repair that can require nucleotide sequence homology, uses a "donor" molecule as a template for repair of a "target" molecule (i.e., the one that experienced the dou ble-strand break), and leads to transfer of genetic information from the donor to target.

Targeted genetic modifications to an endogenous B4GALT1 gene in a genome can be generated by contacting a cell with an exogenous donor sequence comprising a 5' homology arm that hybridizes to a 5' target sequence at a target genomic locus within the endogenous B4GALT1 gene and a 3' homology arm that hybridizes to a 3' target sequence at the target genomic locus within the endogenous B4GALT1 gene. The exogenous donor sequence can recombine with the target genomic locus to generate the targeted genetic modification to the endogenous B4GALT1 gene. As one example, the 5' homology arm can hybridize to a target sequence 5' of the position corresponding to positions 53575 to 53577 of SEQ ID NO:l, and the 3' homology arm can hybridize to a target sequence 3' of the position corresponding to positions 53575 to 53577 of SEQ I D NO:l. Such methods can result, for example, in a B4GALT1 gene which contains a nucleotide sequence that encodes a serine at the position corresponding to position 352 of the fu ll length/mature polypeptide produced therefrom. Examples of exogenous donor sequences are disclosed elsewhere herein.

For example, targeted genetic modifications to an endogenous B4GALT1 gene in a genome can be generated by contacting a cell or the genome of a cell with a Cas protein and one or more guide RNAs that hybridize to one or more guide RNA recognition sequences within a target genomic locus in the endogenous B4GALT1 gene. For example, such methods can comprise contacting a cell with a Cas protein and a guide RNA that hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene. In some embodiments, the guide RNA recognition sequence is located within a region corresponding to exon 5 of SEQ ID NO:l. In some embodiments, the guide RNA recognition sequence can include or is proximate to a position corresponding to positions 53575 to 53577 of SEQ ID NO:l. For example, the guide RNA recognition sequence can be within about 1000, within about 500, within about 400, within about 300, within about 200, within about 100, within about 50, within about 45, within about 40, within about 35, within about 30, within about 25, within about 20, within about 15, within about 10, or within about 5 nucleotides of the position corresponding to positions 53575 to 53577 of SEQ ID NO:l. As yet another example, the guide RNA recognition sequence can include or be proximate to the start codon of an endogenous B4GALT1 gene or the stop codon of an endogenous B4GALT1 gene. For example, the guide RNA recognition sequence can be within about 10, within about 20, within about 30, within about 40, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the start codon or the stop codon. The Cas protein and the guide RNA form a complex, and the Cas protein cleaves the guide RNA recognition sequence.

Cleavage by the Cas protein can create a double-strand break or a single-strand break (e.g., if the Cas protein is a nickase). Such methods can resu lt, for example, in an endogenous B4GALT1 gene in which the region corresponding to exon 5 of SEQ I D NO:l is disru pted, the start codon is disru pted, the stop codon is disrupted, or the coding sequence is deleted. Examples and variations of Cas (e.g., Cas9) proteins and guide RNAs that can be used in the methods are described elsewhere herein.

In some embodiments, two or more nuclease agents can be used. For example, two nuclease agents can be used, each targeting a nuclease recognition sequence within a region corresponding to exon 5 of SEQ ID NO:l, or including or proximate to a position corresponding to positions 53575 to 53577 of SEQ ID NO:l (e.g., within about 1000, within about 500, within about 400, within about 300, within about 200, within about 100, within about 50, within about 45, within about 40, within about 35, within about 30, within about 25, within about 20, within about 15, within about 10, or within about 5 nucleotides of the positions corresponding to positions 53575 to 53577 of SEQ I D NO:l). As another example, two or more nuclease agents can be used, each targeting a nuclease recognition sequence including or proximate to the start codon. As another example, two nuclease agents can be used, one targeting a nuclease recognition sequence including or proximate to the start codon, and one targeting a nuclease recognition sequence including or proximate to the stop codon, wherein cleavage by the nuclease agents can result in deletion of the coding region between the two nuclease recognition sequences. As yet another example, th ree or more nuclease agents can be used, with one or more (e.g., two) targeting nuclease recognition sequences including or proximate to the start codon, and one or more (e.g., two) targeting nuclease recognition sequences including or proximate to the stop codon, wherein cleavage by the nuclease agents can result in deletion of the coding region between the nuclease recognition sequences including or proximate to the start codon and the nuclease recognition sequence including or proximate to the stop codon.

In some embodiments, the cel l can be further contacted with one or more additional guide RNAs that hybridize to additional guide RNA recognition sequences within the target genomic locus in the endogenous B4GALT1 gene. By contacting the cell with one or more additional guide RNAs (e.g., a second guide RNA that hybridizes to a second guide RNA recognition sequence), cleavage by the Cas protein can create two or more double-strand breaks or two or more single-strand breaks (e.g., if the Cas protein is a nickase).

In some embodiments, the cel l can additionally be contacted with one or more exogenous donor sequences which recombine with the target genomic locus in the endogenous B4GALT1 gene to generate a targeted genetic modification. Examples and variations of exogenous donor sequences that can be used in the methods are disclosed elsewhere herein.

The Cas protein, guide RNA(s), and exogenous donor sequence(s) can be introduced into the cel l in any form and by any means as described elsewhere herein, and all or some of the Cas protein, guide RNA(s), and exogenous donor sequence(s) can be introduced

simultaneously or sequentially in any combination.

In some embodiments, the repair of the target nucleic acid (e.g., the endogenous B4GALT1 gene) by the exogenous donor sequence occu rs via homology-directed repair (HDR). Homology-directed repair can occur when the Cas protein cleaves both strands of DNA in the endogenous B4GALT1 gene to create a double-strand break, when the Cas protein is a nickase that cleaves one strand of DNA in the target nucleic acid to create a single-strand break, or when Cas nickases are used to create a double-strand break formed by two offset nicks. In such methods, the exogenous donor sequence comprises 5' and 3' homology arms corresponding to 5' and 3' target sequences. The guide RNA recognition sequence(s) or cleavage site(s) can be adjacent to the 5' target sequence, adjacent to the 3' target sequence, adjacent to both the 5' target sequence and the 3' target sequence, or adjacent to neither the 5' target sequence nor the 3' target sequence. I n some embodiments, the exogenous donor sequence can further comprise a nucleic acid insert flanked by the 5' and 3' homology arms, and the nucleic acid insert is inserted between the 5' and 3' target sequences. If no nucleic acid insert is present, the exogenous donor sequence can function to delete the genomic sequence between the 5' and 3' target sequences. Examples of exogenous donor sequences are disclosed elsewhere herein.

Alternately, the repair of the endogenous B4GALT1 gene mediated by the exogenous donor sequence can occur via non-homologous end joining (NHEJ)-mediated ligation. In such methods, at least one end of the exogenous donor sequence comprises a short single-stranded region that is complementary to at least one overhang created by Cas-mediated cleavage in the endogenous B4GALT1 gene. The complementary end in the exogenous donor sequence can flan k a nucleic acid insert. For example, each end of the exogenous donor sequence can comprise a short single-stranded region that is complementary to an overhang created by Cas- mediated cleavage in the endogenous B4GALT1 gene, and these complementary regions in the exogenous donor sequence can flank a nucleic acid insert.

Overhangs (i.e., staggered ends) can be created by resection of the blunt ends of a double-strand break created by Cas-mediated cleavage. Such resection can generate the regions of microhomology needed for fragment joining, but this can create unwanted or u ncontrollable alterations in the B4GALT1 gene. Alternately, such overhangs can be created by using paired Cas nickases. For example, the cel l can be contacted with first and second nickases that cleave opposite strands of DNA, whereby the genome is modified th rough double nicking. This can be accomplished by contacting a cell with a first Cas protein nickase, a first guide RNA that hybridizes to a first guide RNA recognition sequence within the target genomic locus in the endogenous B4GALT1 gene, a second Cas protein nickase, and a second guide RNA that hybridizes to a second guide RNA recognition sequence within target genomic locus in the endogenous B4GALT1 gene. The first Cas protein and the first guide RNA form a first complex, and the second Cas protein and the second guide RNA form a second complex. The first Cas protein nickase cleaves a first strand of genomic DNA within the first guide RNA recognition sequence, the second Cas protein nickase cleaves a second strand of genomic DNA within the second guide RNA recognition sequence, and optionally the exogenous donor sequence recombines with the target genomic locus in the endogenous B4GALT1 gene to generate the targeted genetic modification.

The first nickase can cleave a first strand of genomic DNA (i.e., the complementary strand), and the second nickase can cleave a second strand of genomic DNA (i.e., the non- complementary strand). The first and second nickases can be created, for example, by mutating a catalytic residue in the RuvC domain (e.g., the D10A mutation described elsewhere herein) of Cas9 or mutating a catalytic residue in the H NH domain (e.g., the H840A mutation described elsewhere herein) of Cas9. In such methods, the double nicking can be employed to create a double-strand break having staggered ends (i.e., overhangs). The first and second guide RNA recognition sequences can be positioned to create a cleavage site such that the nicks created by the first and second nickases on the first and second strands of DNA create a double-strand break. Overhangs are created when the nicks within the first and second CRISPR RNA recognition sequences are offset. The offset window can be, for example, at least about 5 bp, at least about 10 bp, at least about 20 bp, at least about 30 bp, at least about 40 bp, at least about 50 bp, at least about 60 bp, at least about 70 bp, at least about 80 bp, at least about 90 bp, at least about 100 bp, or more. See, e.g., Ran ef al., Cell, 2013, 154, 1380-1389; Mali ef al., Nat. Biotech., 213, 31, 833-838; and Shen ef al., Nat. Methods, 2014, 11, 399-404.

Various types of targeted genetic modifications can be introduced using the methods described herein. Such targeted modifications can include, for example, additions of one or more nucleotides, deletions of one or more nucleotides, substitutions of one or more nucleotides, a point mutation, or a combination thereof. For example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 7, at least 8, at least 9, or at least 10, or more nucleotides can be changed (e.g., deleted, inserted, or substituted) to form the targeted genomic modification.

Such targeted genetic modifications can result in disruption of a target genomic locus. Disruption can include alteration of a regulatory element (e.g., promoter or en hancer), a missense mutation, a nonsense mutation, a frame-shift mutation, a truncation mutation, a null mutation, or an insertion or deletion of small nu mber of nucleotides (e.g., causing a frameshift mutation), and it can resu lt in inactivation (i.e., loss of fu nction) or loss of an al lele. For example, a targeted modification can comprise disruption of the start codon of an endogenous B4GALT1 gene such that the start codon is no longer functional.

In some embodiments, a targeted modification can comprise a deletion between the first and second guide RNA recognition sequences or Cas cleavage sites. If an exogenous donor sequence (e.g., repair template or targeting vector) is used, the modification can comprise a deletion between the first and second guide RNA recognition sequences or Cas cleavage sites as well as an insertion of a nucleic acid insert between the 5' and 3' target sequences.

In some embodiments, if an exogenous donor sequence is used, alone or in combination with a nuclease agent, the modification can comprise a deletion between the 5' and 3' target sequences as well as an insertion of a nucleic acid insert between the 5' and 3' target sequences in the pair of first and second homologous ch romosomes, thereby resulting in a homozygous modified genome. Alternately, if the exogenous donor sequence comprises 5' and 3' homology arms with no nucleic acid insert, the modification can comprise a deletion between the 5' and 3' target sequences.

The deletion between the first and second guide RNA recognition sequences or the deletion between the 5' and 3' target sequences can be a precise deletion wherein the deleted nucleic acid consists of only the nucleic acid sequence between the first and second nuclease cleavage sites or only the nucleic acid sequence between the 5' and 3' target sequences such that there are no additional deletions or insertions at the modified genomic target locus. The deletion between the first and second guide RNA recognition sequences can also be an imprecise deletion extending beyond the first and second nuclease cleavage sites, consistent with imprecise repair by non-homologous end joining (NHEJ), resu lting in additional deletions and/or insertions at the modified genomic locus. For example, the deletion can extend about 1 bp, about 2 bp, about 3bp, about 4 bp, about 5 bp, about 10 bp, about 20 bp, about 30 bp, about 40 bp, about 50 bp, about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, or more beyond the first and second Cas protein cleavage sites. Likewise, the modified genomic locus can comprise additional insertions consistent with imprecise repair by NH EJ, such as insertions of about 1 bp, about 2 bp, about 3 bp, about 4 bp, about 5 bp, about 10 bp, about 20 bp, about 30 bp, about 40 bp, about 50 bp, about 100 bp, about 200 bp, about 300 bp, about 400 bp, about 500 bp, or more.

The targeted genetic modification can be, for example, a biallelic modification or a monoallelic modification. Biallelic modifications include events in which the same modification is made to the same locus on corresponding homologous chromosomes (e.g., in a diploid cell), or in which different modifications are made to the same locus on corresponding homologous chromosomes. In some embodiments, the targeted genetic modification is a monoallelic modification. A monoallelic modification includes events in which a modification is made to only one allele (i.e., a modification to the endogenous B4GALT1 gene in only one of the two homologous ch romosomes). Homologous ch romosomes include chromosomes that have the same genes at the same loci but possibly different alleles (e.g., ch romosomes that are paired during meiosis).

A monoallelic mutation can result in a cell that is heterozygous for the targeted B4GALT1 modification. Heterozygosity includes situation in which on ly one allele of the B4GALT1 gene (i.e., corresponding alleles on both homologous chromosomes) have the targeted modification.

A biallelic modification can result in homozygosity for a targeted modification.

Homozygosity includes situations in which both alleles of the B4GALT1 gene (i.e., corresponding alleles on both homologous chromosomes) have the targeted modification. Alternately, a biallelic modification can result in compound heterozygosity (e.g., hemizygosity) for the targeted modification. Compound heterozygosity includes situations in which both alleles of the target locus (i.e., the alleles on both homologous chromosomes) have been modified, but they have been modified in different ways (e.g., a targeted modification in one allele and inactivation or disruption of the other allele).

The methods disclosed herein can further comprise identifying a cell having a modified B4GALT1 gene. Various methods can be used to identify cells having a targeted genetic modification, such as a deletion or an insertion. Such methods can comprise identifying one cel l having the targeted genetic modification in the B4GALT1 gene. Screening can be performed to identify such cel ls with modified genomic loci. The screening step can comprise a quantitative assay for assessing modification of allele (MOA) (e.g., loss-of-allele (LOA) and/or gain-of-allele (GOA) assays) of a parental ch romosome.

Other examples of suitable quantitative assays include fluorescence-mediated in situ hybridization (FISH), comparative genomic hybridization, isothermic DNA amplification, quantitative hybridization to an immobilized probe(s), INVADER * Probes, TAQMAN * Molecular Beacon probes, or ECLIPSE™ probe technology. Conventional assays for screening for targeted modifications, such as long-range PCR, Southern blotting, or Sanger sequencing, can also be used. Such assays typically are used to obtain evidence for a lin kage between the inserted targeting vector and the targeted genomic locus. For example, for a long-range PCR assay, one primer can recognize a sequence within the inserted DNA while the other recognizes a target genomic locus sequence beyond the ends of the targeting vector's homology arms.

Next generation sequencing (NGS) can also be used for screening. Next-generation sequencing can also be referred to as "NGS" or "massively paral lel sequencing" or "high th roughput sequencing." In some embodiments, it is not necessary to screen for targeted cells using selection markers. For example, the MOA and NGS assays described herein can be relied on without using selection cassettes. The present disclosu re also provides methods for altering expression of nucleic acids encoding B4GALT1 polypeptides. In some embodiments, expression is altered th rough cleavage with a nuclease agent to cause disruption of the nucleic acid encoding the endogenous B4GALT1 polypeptide, as described in further detail elsewhere herein. In some embodiments, expression is altered through use of a DNA-binding protein fused or linked to a transcription activation domain or a transcription repression domain. In some embodiments, expression is altered through use of RNA interference compositions, such as antisense RNA, shRNA, or siRNA.

In some embodiments, expression of an endogenous B4GALT1 gene or a nucleic acid encoding a B4GALT1 polypeptide can be modified by contacting a cell or the genome within a cell with a nuclease agent that induces one or more nicks or double-strand breaks at a recognition sequence at a target genomic locus within the endogenous B4GALT1 gene or nucleic acid encoding a B4GALT1 polypeptide. Such cleavage can resu lt in disruption of expression of the endogenous B4GALT1 gene or nucleic acid encoding a B4GALT1 polypeptide. For example, the nuclease recognition sequence can include or be proximate to the start codon of the endogenous B4GALT1 gene. For example, the recognition sequence can be within about 10, within about 20, within about 30, within about 40, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the start codon, and cleavage by the nuclease agent can disrupt the start codon. I n some embodiments, two or more nuclease agents can be used, each targeting a nuclease recognition sequence including or proximate to the start codon. In some embodiments, two nuclease agents can be used, one targeting a nuclease recognition sequence including or proximate to the start codon, and one targeting a nuclease recognition sequence including or proximate to the stop codon, wherein cleavage by the nuclease agents can result in deletion of the coding region between the two nuclease recognition sequences. I n some embodiments, th ree or more nuclease agents can be used, with one or more (e.g., two) targeting nuclease recognition sequences including or proximate to the start codon, and one or more (e.g., two) targeting nuclease recognition sequences including or proximate to the stop codon, wherein cleavage by the nuclease agents can result in deletion of the coding region between the nuclease recognition sequences including or proximate to the start codon and the nuclease recognition sequence including or proximate to the stop codon. Other examples of modifying an endogenous B4GALT1 gene or a nucleic acid encoding a B4GALT1 polypeptide are disclosed elsewhere herein. In some embodiments, expression of an endogenous B4GALT1 gene or a nucleic acid encoding a B4GALT1 polypeptide can be modified by contacting a cell or the genome within a cell with a DNA-binding protein that binds to a target genomic locus within the endogenous B4GALT1 gene. The DNA-binding protein can be, for example, a nuclease-inactive Cas protein fused to a transcriptional activator domain or a transcriptional repressor domain. Other examples of DNA-binding proteins include zinc finger proteins fused to a transcriptional activator domain or a transcriptional repressor domain, or Transcription Activator-Like Effector (TALE) proteins fused to a transcriptional activator domain or a transcriptional repressor domain. Examples of such proteins are disclosed elsewhere herein.

The recognition sequence (e.g., guide RNA recognition sequence) for the DNA-binding protein can be anywhere within the endogenous B4GALT1 gene or a nucleic acid encoding a B4GALT1 polypeptide suitable for altering expression. In some embodiments, the recognition sequence can be within a regulatory element, such as an enhancer or promoter, or can be in proximity to a regulatory element. For example, the recognition sequence can include or be proximate to the start codon of an endogenous B4GALT1 gene. In some embodiments, the recognition sequence can be within about 10, within about 20, within about 30, within about 40, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the start codon.

In some embodiments, antisense molecu les can be used to alter expression of an endogenous B4GALT1 gene or a nucleic acid encoding a B4GALT1 polypeptide. Examples of antisense molecules include, but are not limited to, antisense RNAs, siRNAs, and shRNAs. Such antisense RNAs, siRNAs, or shRNAs can be designed to target any region of an mRNA. For example, the antisense RNAs, siRNAs, or shRNAs can be designed to target a region unique of the B4GALT1 mRNA.

The nucleic acids and proteins disclosed herein can be introduced into a cell by any means. In some embodiments, the introducing can be accomplished by any means, and one or more of the components (e.g., two of the components, or all of the components) can be introduced into the cel l simultaneously or sequentially in any combination. For example, an exogenous donor sequence can be introduced prior to the introduction of a nuclease agent, or it can be introduced following introduction of nuclease agent (e.g., the exogenous donor sequence can be administered about 1, about 2, about 3, about 4, about 8, about 12, about 24, about 36, about 48, or about 72 hours before or after introduction of the nuclease agent). Contacting the genome of a cell with a nuclease agent or exogenous donor sequence can comprise introducing one or more nuclease agents or nucleic acids encoding nuclease agents (e.g., one or more Cas proteins or nucleic acids encoding one or more Cas proteins, and one or more guide RNAs or nucleic acids encoding one or more guide RNAs (i.e., one or more CRISPR RNAs and one or more tracrRNAs)) and/or one or more exogenous donor sequences into the cell. Contacting the genome of cell (i.e., contacting a cell) can comprise introducing only one of the above components, one or more of the components, or all of the components into the cell.

A nuclease agent can be introduced into the cell in the form of a protein or in the form of a nucleic acid encoding the nuclease agent, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. When introduced in the form of a DNA, the DNA can be operably lin ked to a promoter active in the cell. Such DNAs can be in one or more expression constructs.

In some embodiments, a Cas protein can be introduced into the cell in the form of a protein, such as a Cas protein complexed with a gRNA, or in the form of a nucleic acid encoding the Cas protein, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. A guide RNA can be introduced into the cel l in the form of an RNA or in the form of a DNA encoding the guide RNA. When introduced in the form of a DNA, the DNA encoding the Cas protein and/or the guide RNA can be operably linked to a promoter active in the cell. Such DNAs can be in one or more expression constructs. For example, such expression constructs can be components of a single nucleic acid molecule. Alternately, they can be separated in any combination among two or more nucleic acid molecules (i.e., DNAs encoding one or more CRISPR RNAs, DNAs encoding one or more tracrRNAs, and DNA encoding a Cas protein can be components of separate nucleic acid molecules).

In some embodiments, DNA encoding a nuclease agent (e.g., a Cas protein and a guide RNA) and/or DNA encoding an exogenous donor sequence can be introduced into a cel l via DNA minicircles. DNA minicircles are su percoiled DNA molecules that can be used for non-viral gene transfer that have neither an origin of replication nor an antibiotic selection marker. Thus, DNA minicircles are typically smal ler in size than plasmid vector. These DNAs are devoid of bacterial DNA, and thus lack the un methylated CpG motifs found in bacterial DNA.

The methods described herein do not depend on a particular method for introducing a nucleic acid or protein into the cel l, only that the nucleic acid or protein gains access to the interior of a least one cell. Methods for introducing nucleic acids and proteins into various cel l types are known and include, but are not limited to, stable transfection methods, transient transfection methods, and virus-mediated methods.

Transfection protocols as well as protocols for introducing nucleic acids or proteins into cells may vary. Non-limiting transfection methods include chemical-based transfection methods using liposomes, nanoparticles, calcium, dendrimers, and cationic polymers such as DEAE-dextran or polyethylenimine. Non-chemical methods include electroporation, sono- poration, and optical transfection. Particle-based transfection includes the use of a gene gun, or magnet-assisted transfection. Viral methods can also be used for transfection.

Introduction of nucleic acids or proteins into a cell can also be mediated by

electroporation, by intracytoplasmic injection, by viral infection, by adenovirus, by adeno- associated virus, by lentivirus, by retrovirus, by transfection, by lipid-mediated transfection, or by nucleofection. Nucleofection is an improved electroporation technology that enables nucleic acid substrates to be delivered not only to the cytoplasm but also through the nuclear membrane and into the nucleus. In addition, use of nucleofection in the methods disclosed herein typical ly requires much fewer cel ls than regular electroporation (e.g., on ly about 2 million compared with 7 million by regular electroporation). In some embodiments, nucleofection is performed using the LONZA ® NUCLEOFECTOR™ system.

Introduction of nucleic acids or proteins into a cell can also be accomplished by microinjection. Microinjection of an mRNA is usual ly into the cytoplasm (e.g., to deliver mRNA directly to the translation machinery), while microinjection of a protein or a DNA encoding a DNA encoding a Cas protein is usually into the nucleus. Alternately, microinjection can be carried out by injection into both the nucleus and the cytoplasm: a needle can first be introduced into the nucleus and a first amount can be injected, and while removing the needle from the cel l a second amou nt can be injected into the cytoplasm. If a nuclease agent protein is injected into the cytoplasm, the protein may comprise a nuclear localization signal to ensure delivery to the nucleus/pronucleus.

Other methods for introducing nucleic acid or proteins into a cell can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid- nanoparticle-mediated delivery, cell-penetrating-peptide-mediated delivery, or implantable- device-mediated delivery. Methods of administering nucleic acids or proteins to a subject to modify cel ls in vivo are disclosed elsewhere herein. Introduction of nucleic acids and proteins into cells can also be accomplished by hydrodynamic delivery (HDD).

Other methods for introducing nucleic acid or proteins into a cell can include, for example, vector delivery, particle-mediated delivery, exosome-mediated delivery, lipid- nanoparticle-mediated delivery, cell-penetrating-peptide-mediated delivery, or implantable- device-mediated delivery. In some embodiments, a nucleic acid or protein can be introduced into a cell in a carrier such as a poly(lactic acid) (PLA) microsphere, a poly(D,L-lactic-coglycolic- acid) (PLGA) microsphere, a liposome, a micel le, an inverse micelle, a lipid cochleate, or a lipid microtu bule.

The introduction of nucleic acids or proteins into the cel l can be performed one time or multiple times over a period of time. In some embodiments, the introduction can be performed at least two times over a period of time, at least th ree times over a period of time, at least fou r times over a period of time, at least five times over a period of time, at least six times over a period of time, at least seven times over a period of time, at least eight times over a period of time, at least nine times over a period of times, at least ten times over a period of time, at least eleven times, at least twelve times over a period of time, at least thirteen times over a period of time, at least fou rteen times over a period of time, at least fifteen times over a period of time, at least sixteen times over a period of time, at least seventeen times over a period of time, at least eighteen times over a period of time, at least nineteen times over a period of time, or at least twenty times over a period of time.

In some embodiments, the cel ls employed in the methods and compositions have a DNA construct stably incorporated into their genome. In such cases, the contacting can comprise providing a cell with the construct already stably incorporated into its genome. In some embodiments, a cell employed in the methods disclosed herein may have a preexisting Cas-encoding gene stably incorporated into its genome (i.e., a Cas-ready cell). In some embodiments, the polynucleotide integrates into the genome of the cell and is capable of being inherited by progeny thereof. Any protocol may be used for the stable incorporation of the DNA constructs or the various components of the targeted genomic integration system.

Any nuclease agent that induces a nick or double-strand break into a desired recognition sequence or any DNA-binding protein that binds to a desired recognition sequence can be used in the methods and compositions disclosed herein. A naturally occu rring or native nuclease agent can be employed so long as the nuclease agent induces a nick or double-strand break in a desired recognition sequence. Likewise, a natu rally occurring or native DNA-binding protein can be employed so long as the DNA-binding protein binds to the desired recognition sequence. Alternately, a modified or engineered nuclease agent or DNA-binding protein can be employed. An engineered nuclease agent or DNA-binding protein can be derived from a native, natu ral ly occurring nuclease agent or DNA-binding protein or it can be artificially created or synthesized. The engineered nuclease agent or DNA-binding protein can recognize a recognition sequence, for example, wherein the recognition sequence is not a sequence that would have been recognized by a native (non-engineered or non-modified) nuclease agent or DNA-binding protein. The modification of the nuclease agent or DNA-binding protein can be as few as one amino acid in a protein cleavage agent or one nucleotide in a nucleic acid cleavage agent.

Recognition sequences for a nuclease agent includes a DNA sequence at which a nick or double-strand break is induced by a nuclease agent. Likewise, recognition sequences for a DNA-binding protein include a DNA sequence to which a DNA-binding protein will bind. The recognition sequence can be endogenous (or native) to the cell or the recognition sequence can be exogenous to the cell. The recognition sequence can also exogenous to the polynucleotides of interest that one desires to be positioned at the target locus. In some embodiments, the recognition sequence is present only once in the genome of the host cel l.

Active variants and fragments of the exemplified recognition sequences are also provided. Such active variants can comprise at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or 100% sequence identity to the given recognition sequence, wherein the active variants retain biological activity and are capable of being recognized and cleaved by a nuclease agent in a sequence-specific manner. Assays to measure the double-strand break of a recognition sequence by a nuclease agent are known (e.g., TAQMAN * qPCR assay, Frendewey et al., Methods in Enzymology, 2010, 476, 295- 307).

The length of the recognition sequence can vary, and includes, for example, recognition sequences that are from about 30 to about 36 bp for a zinc finger protein or zinc finger nuclease (ZFN) pair (i.e., from about 15 to about 18 bp for each ZFN), about 36 bp for a TALE protein or Transcription Activator-Like Effector Nuclease (TALEN), or about 20 bp for a CRISPR/Cas9 guide RNA.

The recognition sequence of the DNA-binding protein or nuclease agent can be positioned anywhere in or near the target genomic locus. The recognition sequence can be located within a coding region of a gene (e.g., the B4GALT1 gene), or within regulatory regions that influence the expression of the gene. A recognition sequence of the DNA-binding protein or nuclease agent can be located in an intron, an exon, a promoter, an enhancer, a regu latory region, or any non-protein coding region.

One type of DNA-binding protein that can be employed in the various methods and compositions disclosed herein is a TALE. A TALE can be fused or linked to, for example, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Examples of such domains are described with respect to Cas proteins, below, and can also be fou nd, for example, in PCT Publication WO 2011/145121. Correspondingly, one type of nuclease agent that can be employed in the various methods and compositions disclosed herein is a TALEN. Transcription activator-like (TAL) effector nucleases are a class of sequence-specific nucleases that can be used to make double-strand breaks at specific target sequences in the genome of a prokaryotic or eukaryotic organism. TAL effector nucleases are created by fusing a native or engineered TAL effector, or functional part thereof, to the catalytic domain of an endonuclease such as Fokl. The unique, modular TAL effector DNA binding domain allows for the design of proteins with potentially any given DNA recognition specificity. Thus, the DNA binding domains of the TAL effector nucleases can be engineered to recognize specific DNA target sites and thus, used to make double-strand breaks at desired target sequences. Examples of suitable TAL nucleases, and methods for preparing suitable TAL nucleases, are disclosed, for example, in U.S. Patent Application Publications 2011/0239315; 2011/0269234; 2011/0145940; 2003/0232410; 2005/0208489; 2005/0026157; 2005/0064474; 2006/0188987; and 2006/0063231.

In some TALENs, each monomer of the TALEN comprises from about 33 to about 35 TAL repeats that recognize a single base pair via two hypervariable residues. In some TALENs, the nuclease agent is a chimeric protein comprising a TAL-repeat-based DNA binding domain operably linked to an independent nuclease such as a Fokl endonuclease. For example, the nuclease agent can comprise a first TAL-repeat-based DNA binding domain and a second TAL- repeat-based DNA binding domain, wherein each of the first and the second TAL-repeat-based DNA binding domains is operably linked to a Fokl nuclease, wherein the first and the second TAL-repeat-based DNA binding domain recognize two contiguous target DNA sequences in each strand of the target DNA sequence separated by a spacer sequence of varying length (from about 12 to about 20 bp), and wherein the Fokl nuclease su bunits dimerize to create an active nuclease that makes a double strand break at a target sequence. Another example of a DNA-binding protein is a zinc finger protein. Such zinc finger proteins can be lin ked or fused to, for example, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Examples of such domains are described with respect to Cas proteins, below, and can also be found, for example, in PCT Publication WO 2011/145121. Correspondingly, another example of a nuclease agent that can be employed in the various methods and compositions disclosed herein is a ZFN. In some ZFNs, each monomer of the ZFN comprises three or more zinc finger-based DNA binding domains, wherein each zinc finger-based DNA binding domain binds to a 3 bp su bsite. In other ZFNs, the ZFN is a chimeric protein comprising a zinc finger-based DNA binding domain operably linked to an independent nuclease such as a Fokl endonuclease. For example, the nuclease agent can comprise a first ZFN and a second ZFN, wherein each of the first ZFN and the second ZFN is operably lin ked to a Fokl nuclease su bunit, wherein the first and the second ZFN recognize two contiguous target DNA sequences in each strand of the target DNA sequence separated by about 5 to about 7 bp spacer, and wherein the Fokl nuclease su bunits dimerize to create an active nuclease that makes a double strand break.

Other suitable DNA-binding proteins and nuclease agents for use in the methods and compositions described herein include CRISPR-Cas systems, which are described elsewhere herein.

The DNA-binding protein or nuclease agent may be introduced into the cell by any known means. A polypeptide encoding the DNA-binding protein or nuclease agent may be directly introduced into the cel l. Alternately, a polynucleotide encoding the DNA-binding protein or nuclease agent can be introduced into the cell. When a polynucleotide encoding the DNA-binding protein or nuclease agent is introduced into the cell, the DNA-binding protein or nuclease agent can be transiently, conditionally, or constitutively expressed within the cell. For example, the polynucleotide encoding the DNA-binding protein or nuclease agent can be contained in an expression cassette and be operably lin ked to a conditional promoter, an inducible promoter, a constitutive promoter, or a tissue-specific promoter. Such promoters are discussed in further detail elsewhere herein. In some embodiments, the DNA-binding protein or nuclease agent can be introduced into the cell as an mRNA encoding a DNA-binding protein or a nuclease agent.

A polynucleotide encoding a DNA-binding protein or nuclease agent can be stably integrated in the genome of the cell and operably linked to a promoter active in the cell. Alternately, a polynucleotide encoding a DNA-binding protein or nuclease agent can be in a targeting vector or in a vector or a plasmid that is separate from the targeting vector comprising the insert polynucleotide.

When the DNA-binding protein or nuclease agent is provided to the cell through the introduction of a polynucleotide encoding the DNA-binding protein or nuclease agent, such a polynucleotide encoding a DNA-binding protein or nuclease agent can be modified to substitute codons having a higher frequency of usage in the cel l of interest, as compared to the naturally occu rring polynucleotide sequence encoding the DNA-binding protein or nuclease agent. In some embodiments, the polynucleotide encoding the DNA-binding protein or nuclease agent can be modified to substitute codons having a higher frequency of usage in a given prokaryotic or eukaryotic cell of interest, including a bacterial cell, a yeast cell, a human cell, a non-human cell, a mammalian cell, a rodent cell, a mouse cell, a rat cell or any other host cell of interest, as compared to the natu rally occurring polynucleotide sequence.

The methods disclosed herein can utilize Clustered Regularly Interspersed Short Palind romic Repeats (CRISPR)/CRISPR-associated (Cas) systems or components of such systems to modify a genome within a cell. CRISPR-Cas systems include transcripts and other elements involved in the expression of, or directing the activity of, Cas genes. A CRISPR-Cas system can be a type I, a type II, or a type III system. Alternately a CRISPR/Cas system can be, for example, a type V system (e.g., subtype V-A or subtype V-B). The methods and compositions disclosed herein can employ CRISPR-Cas systems by utilizing CRISPR complexes (comprising a guide RNA (gRNA) complexed with a Cas protein) for site-directed cleavage of nucleic acids.

The CRISPR-Cas systems used in the methods disclosed herein are non-natu rally occu rring. For example, some CRISPR-Cas systems employ non-natu ral ly occurring CRISPR complexes comprising a gRNA and a Cas protein that do not naturally occu r together.

Cas proteins generally comprise at least one RNA recognition or binding domain that can interact with guide RNAs (gRNAs, described in more detail below). Cas proteins can also comprise nuclease domains (e.g., DNase or RNase domains), DNA binding domains, helicase domains, protein-protein interaction domains, dimerization domains, and other domains. A nuclease domain possesses catalytic activity for nucleic acid cleavage, which includes the breakage of the covalent bonds of a nucleic acid molecule. Cleavage can produce blunt ends or staggered ends, and it can be single-stranded or double-stranded. A wild-type Cas9 protein will typically create a blunt cleavage product. Alternately, a wild-type Cpfl protein (e.g., FnCpfl) can result in a cleavage product with a 5-nucleotide 5' overhang, with the cleavage occurring after the 18th base pair from the PAM sequence on the non-targeted strand and after the 23rd base on the targeted strand. A Cas protein can have full cleavage activity to create a double- strand break in the endogenous B4GALT1 gene (e.g., a double-strand break with blunt ends), or it can be a nickase that creates a single-strand break in the endogenous B4GALT1 gene.

Examples of Cas proteins include, but are not limited to, Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas5e (CasD), Cas6, Cas6e, Cas6f, Cas7, Cas8al, Cas8a2, Cas8b, Cas8c, Cas9 (Csnl or Csxl2), CaslO, CaslOd, CasF, CasG, CasH, Csyl, Csy2, Csy3, Csel (CasA), Cse2 (CasB), Cse3 (CasE), Cse4 (CasC), Csel, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cul966, and homologs or modified versions thereof.

In some embodiments, the Cas protein is a Cas9 protein or is derived from a Cas9 protein from a type II CRISPR-Cas system. Cas9 proteins are from a type II CRISPR-Cas system and typically share fou r key motifs with a conserved architecture. Motifs 1, 2, and 4 are RuvC-like motifs, and motif 3 is an HNH motif. Exemplary Cas9 proteins include, but are not limited to, those are from Streptococcus pyogenes, Streptococcus thermophilus, Streptococcus sp., Staphylococcus aureus, Nocardiopsis dassonvillei, Streptomyces pristinaespiralis,

Streptomyces viridochromogenes, Streptomyces viridochromogenes, Streptosporangium roseum, Streptosporangium roseum, Alicyclobacillus acidocaldarius, Bacillus pseudomycoides, Bacillus selenitireducens, Exiguobacterium sibiricum, Lactobacillus delbrueckii, Lactobacillus salivarius, Microscilla marina, Burkholderiales bacterium, Polaromonas naphthalenivorans, Polaromonas sp., Crocosphaera watsonii, Cyanothece sp., Microcystis aeruginosa,

Synechococcus sp., Acetohalobium arabaticum, Ammonifex degensii, Caldicelulosiruptor becscii, Candidatus Desulforudis, Clostridium botulinum, Clostridium difficile, Finegoldia magna, Natranaerobius thermophilus, Pelotomaculum thermopropionicum, Acidithiobacillus caldus, Acidithiobacillus ferrooxidans, Allochromatium vinosum, Marinobacter sp., Nitrosococcus halophilus, Nitrosococcus watsoni, Pseudoalteromonas haloplanktis, Ktedonobacter racemifer, Methanohalobium evestigatum, Anabaena variabilis, Nodularia spumigena, Nostoc sp., Arthrospira maxima, Arthrospira platensis, Arthrospira sp., Lyngbya sp., Microcoleus chthonoplastes, Oscillatoria sp., Petrotoga mobilis, Thermosipho africanus, or Acaryochloris marina. Additional examples of the Cas9 family members are described in PCT Publication WO 2014/131833. Cas9 from 5. pyogenes (assigned SwissProt accession number Q99ZW2) is an exemplary enzyme. Cas9 from S. aureus (assigned UniProt accession nu mber J7RUA5) is another exemplary enzyme.

Another example of a Cas protein is a Cpfl (CRISPR from Prevotella and Francisella 1) protein. Cpfl is a large protein (about 1300 amino acids) that contains a RuvC-like nuclease domain homologous to the corresponding domain of Cas9 along with a cou nterpart to the characteristic arginine-rich cluster of Cas9. However, Cpfl lacks the HNH nuclease domain that is present in Cas9 proteins, and the RuvC-like domain is contiguous in the Cpfl sequence, in contrast to Cas9 where it contains long inserts including the HNH domain. Exemplary Cpfl proteins include, but are not limited to, those from Francisella tularensis 1, Francisella tularensis subsp. novicida, Prevotella albensis, Lachnospiraceae bacterium MC2017 1,

Butyrivibrio proteodasticus, Peregrinibacteria bacterium GW2011_GWA2_33_10, Parcubacteria bacterium GW2011_GWC2_44_17, Smithella sp. SCADC, Acidaminococcus sp. BV3L6,

Lachnospiraceae bacterium MA2020, Candidatus Methanoplasma termitum, Eubacterium eligens, Moraxella bovoculi 237, Leptospira inadai, Lachnospiraceae bacterium ND2006, Porphyromonas crevioricanis 3, Prevotella disiens, and Porphyromonas macacae. Cpfl from Francisella novicida U112 (FnCpfl; assigned UniProt accession number A0Q7Q2) is an exemplary enzyme.

Cas proteins can be wild-type proteins (i.e., those that occur in nature), modified Cas proteins (i.e., Cas protein variants), or fragments of wild-type or modified Cas proteins. Cas proteins can also be active variants or fragments of wild-type or modified Cas proteins. Active variants or fragments can comprise at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, or 100% sequence identity to the wild-type or modified Cas protein or a portion thereof, wherein the active variants retain the ability to cut at a desired cleavage site and hence retain nick-inducing or double-strand-break-inducing activity. Assays for nick-inducing or double-strand-break-inducing activity are known and generally measure the overal l activity and specificity of the Cas protein on DNA substrates containing the cleavage site.

Cas proteins can comprise at least one nuclease domain, such as a DNase domain. For example, a wild-type Cpfl protein generally comprises a RuvC-like domain that cleaves both strands of target DNA, perhaps in a dimeric configuration. Cas proteins can comprise at least two nuclease domains, such as DNase domains. For example, a wild-type Cas9 protein general ly comprises a RuvC-like nuclease domain and an HNH-like nuclease domain. The RuvC and HNH domains can each cut a different strand of double-stranded DNA to make a double-stranded break in the DNA.

Cas proteins (e.g., nuclease-active Cas proteins or nuclease-inactive Cas proteins) can also be operably linked to heterologous polypeptides as fusion proteins. For example, a Cas protein can be fused to a cleavage domain, an epigenetic modification domain, a transcriptional activation domain, or a transcriptional repressor domain. Examples of transcriptional activation domains include a herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), a NFKB p65 activation domain, p53 activation domains 1 and 2, a CREB (cAMP response element binding protein) activation domain, an E2A activation domain, and an NFAT (nuclear factor of activated T-cells) activation domain. Other examples include, but are not limited to, activation domains from Octl, Oct-2A, SP1, AP-2, CTF1, P300, CBP, PCAF, SRC1, PvALF, ERF-2, OsGAI, HALF-1, CI, API, ARF-5, ARF-6, ARF-7, ARF-8, CPRF1, CPRF4, MYC-RP/GP, TRAB1PC4, and HSF1. See, e.g., U.S. Patent Application Publication 2016/0237456, European Patent EP3045537, and PCT Publication WO 2011/145121.

In some embodiments, a transcriptional activation system can be used comprising a dCas9-VP64 fusion protein paired with MS2-p65-HSFl. Guide RNAs in such systems can be designed with aptamer sequences appended to sgRNA tetraloop and stem-loop 2 designed to bind dimerized MS2 bacteriophage coat proteins. See, e.g., Konermann et al., Nature, 2015, 517, 583-588. Examples of transcriptional repressor domains include inducible cAMP early repressor (ICER) domains, Kruppel-associated box A (KRAB-A) repressor domains, YY1 glycine rich repressor domains, Spl-like repressors, E(spl) repressors, ΙκΒ repressor, and MeCP2. Other examples include, but are not limited to, transcriptional repressor domains from A/B, KOX, TGF- beta-inducible early gene (TIEG), v-erbA, SID, SID4X, MBD2, MBD3, DNMT1, DNMG3A,

DNMT3B, Rb, ROM2, See, e.g., European Patent EP3045537 and PCT Publication WO

2011/145121. Cas proteins can also be fused to a heterologous polypeptide providing increased or decreased stability. The fused domain or heterologous polypeptide can be located at the N- terminus, the C-terminus, or internally within the Cas protein.

An example of a Cas fusion protein is a Cas protein fused to a heterologous

polypeptide that provides for subcellular localization. Such heterologous polypeptides can include, for example, one or more nuclear localization signals (NLS) such as the SV40 NLS for targeting to the nucleus, a mitochondrial localization signal for targeting to the mitochondria, an ER retention signal, and the like. Such subcellular localization signals can be located at the N- terminus, the C-terminus, or anywhere within the Cas protein. An NLS can comprise a stretch of basic amino acids, and can be a monopartite sequence or a bipartite sequence.

Cas proteins can also be operably linked to a cell-penetrating domain. For example, the cell-penetrating domain can be derived from the H IV-1 TAT protein, the TLM cell-penetrating motif from human hepatitis B virus, M PG, Pep-1, VP22, a cell penetrating peptide from Herpes simplex virus, or a polyarginine peptide sequence. The cell-penetrating domain can be located at the N-terminus, the C-terminus, or anywhere within the Cas protein.

Cas proteins can also be operably linked to a heterologous polypeptide for ease of tracking or purification, such as a fluorescent protein, a purification tag, or an epitope tag. Examples of fluorescent proteins include green fluorescent proteins (e.g., GFP, GFP-2, tagGFP, tu rboGFP, eGFP, Emerald, Azami Green, Monomeric Azami Green, CopGFP, AceGFP, ZsGreenl), yellow fluorescent proteins (e.g., YFP, eYFP, Citrine, Venus, YPet, PhiYFP, ZsYellowl), blue fluorescent proteins (e.g. eBFP, eBFP2, Azurite, mKalamal, GFPuv, Sapphire, T-sapphire), cyan fluorescent proteins (e.g. eCFP, Ceru lean, CyPet, AmCyan l, Midoriishi-Cyan), red fluorescent proteins (mKate, mKate2, mPlum, DsRed monomer, mCherry, mRFPl, DsRed-Express, DsRed2, DsRed-Monomer, HcRed-Tandem, HcRedl, AsRed2, eqFP611, mRaspberry, mStrawberry, Jred), orange fluorescent proteins (mOrange, mKO, Kusabira-Orange, Monomeric Kusabira-Orange, mTangerine, tdTomato), and any other suitable fluorescent protein. Examples of tags include glutathione-S-transferase (GST), chitin binding protein (CBP), maltose binding protein, thioredoxin (TRX), poly(NANP), tandem affinity purification (TAP) tag, myc, AcV5, AU1, AU5, E, ECS, E2, FLAG, hemagglutinin (HA), nus, Softag 1, Softag 3, Strep, SBP, Glu-Glu, HSV, KT3, S, SI, T7, V5, VSV-G, histidine (His), biotin carboxyl carrier protein (BCCP), and cal modulin.

Cas9 proteins can also be tethered to exogenous donor sequences or labeled nucleic acids. Such tethering (i.e., physical lin king) can be achieved through covalent interactions or noncovalent interactions, and the tethering can be direct (e.g., th rough direct fusion or chemical conjugation, which can be achieved by modification of cysteine or lysine residues on the protein or intein modification), or can be achieved through one or more intervening lin kers or adapter molecules such as streptavidin or aptamers. Noncovalent strategies for synthesizing protein-nucleic acid conjugates include biotin-streptavidin and nickel-histidine methods.

Covalent protein-nucleic acid conjugates can be synthesized by connecting appropriately fu nctionalized nucleic acids and proteins using a wide variety of chemistries. Some of these chemistries involve direct attachment of the oligonucleotide to an amino acid residue on the protein su rface (e.g., a lysine amine or a cysteine thiol), while other more complex schemes require post-translational modification of the protein or the involvement of a catalytic or reactive protein domain. Methods for covalent attach ment of proteins to nucleic acids can include, for example, chemical cross-linking of oligonucleotides to protein lysine or cysteine residues, expressed protein-ligation, chemoenzymatic methods, and the use of photoaptamers. The exogenous donor sequence or labeled nucleic acid can be tethered to the C-terminus, the N-terminus, or to an internal region within the Cas9 protein. In some embodiments, the exogenous donor sequence or labeled nucleic acid is tethered to the C-terminus or the N- terminus of the Cas9 protein. Likewise, the Cas9 protein can be tethered to the 5' end, the 3' end, or to an internal region within the exogenous donor sequence or labeled nucleic acid. In some embodiments, the Cas9 protein is tethered to the 5' end or the 3' end of the exogenous donor sequence or labeled nucleic acid.

Cas proteins can be provided in any form. For example, a Cas protein can be provided in the form of a protein, such as a Cas protein complexed with a gRNA. Alternately, a Cas protein can be provided in the form of a nucleic acid encoding the Cas protein, such as an RNA (e.g., messenger RNA (mRNA)) or DNA. In some embodiments, the nucleic acid encoding the Cas protein can be codon optimized for efficient translation into protein in a particular cell or organism. For example, the nucleic acid encoding the Cas protein can be modified to substitute codons having a higher frequency of usage in a bacterial cell, a yeast cell, a hu man cell, a non- human cel l, a mammalian cell, a rodent cell, a mouse cel l, a rat cel l, or any other host cell of interest, as compared to the naturally occu rring polynucleotide sequence. When a nucleic acid encoding the Cas protein is introduced into the cell, the Cas protein can be transiently, conditionally, or constitutively expressed in the cel l.

Nucleic acids encoding Cas proteins can be stably integrated in the genome of the cell and operably lin ked to a promoter active in the cel l. Alternately, nucleic acids encoding Cas proteins can be operably linked to a promoter in an expression construct. Expression constructs include any nucleic acid constructs capable of directing expression of a gene or other nucleic acid sequence of interest (e.g., a Cas gene) and which can transfer such a nucleic acid sequence of interest to a target cell. For example, the nucleic acid encoding the Cas protein can be in a targeting vector comprising a nucleic acid insert and/or a vector comprising a DNA encoding a gRNA. Alternately, it can be in a vector or plasmid that is separate from the targeting vector comprising the nucleic acid insert and/or separate from the vector comprising the DNA encoding the gRNA. Promoters that can be used in an expression construct include promoters active, for example, in one or more of a eukaryotic cel l, a human cel l, a non-hu man cell, a mammalian cel l, a non-hu man mammalian cell, a rodent cell, a mouse cell, a rat cell, a hamster cell, a rabbit cell, a pluripotent cell, an embryonic stem (ES) cell, or a zygote. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. In some embodiments, the promoter can be a bidirectional promoter d riving expression of both a Cas protein in one direction and a guide RNA in the other direction. Such bidirectional promoters can consist of: 1) a complete, conventional, unidirectional Pol III promoter that contains 3 external control elements: a distal sequence element (DSE), a proximal sequence element (PSE), and a TATA box; and 2) a second basic Pol III promoter that includes a PSE and a TATA box fused to the 5' terminus of the DSE in reverse orientation. For example, in the HI promoter, the DSE is adjacent to the PSE and the TATA box, and the promoter can be rendered bidirectional by creating a hybrid promoter in which transcription in the reverse direction is controlled by appending a PSE and TATA box derived from the U6 promoter. Use of a bidirectional promoter to express genes encoding a Cas protein and a guide RNA simultaneously allow for the generation of compact expression cassettes to facilitate delivery.

The present disclosu re also provides guide RNA (gRNA) that binds to a Cas protein (e.g., Cas9 protein) and targets the Cas protein to a specific location within a target DNA (e.g., the B4GALT1 gene). In some embodiments, the guide RNA is effective to direct a Cas enzyme to bind to or cleave an endogenous B4GALT1 gene, wherein the guide RNA comprises a DNA- targeting a segment that hybridizes to a guide RNA recognition sequence within the

endogenous B4GALT1 gene that includes or is proximate to, for example, positions 53575 to 53577 of SEQ I D NO:l. For example, the guide RNA recognition sequence can be within about 5, within about 10, within about 15, within about 20, within about 25, within about 30, within about 35, within about 40, within about 45, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of positions 53575 to 53577 of SEQ ID NO:l. Other exemplary guide RNAs comprise a DNA- targeting segment that hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene that is within a region corresponding to exon 5 of SEQ ID NO:l. Other exemplary guide RNAs comprise a DNA-targeting segment that hybridizes to a guide RNA recognition sequence within the endogenous B4GALT1 gene that includes or is proximate to the start codon of the endogenous B4GALT1 gene or includes or is proximate to the stop codon of the endogenous B4GALT1 gene. For example, the guide RNA recognition sequence can be within about 5, within about 10, within about 15, within about 20, within about 25, within about 30, within about 35, within about 40, within about 45, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the start codon or within about 5, within about 10, within about 15, within about 20, within about 25, within about 30, within about 35, within about 40, within about 45, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the stop codon. The endogenous B4GALT1 gene can be a B4GALT1 gene from any organism. For example, the B4GALT1 gene can be a human

B4GALT1 gene or an ortholog from another organism, such as a non-hu man mammal, a rodent, a mouse, or a rat.

In some embodiments, guide RNA recognition sequences are present at the 5' end of the human B4GALT1 gene. In some embodiments, guide RNA recognition sequences are adjacent to the transcription start site (TSS) of the hu man B4GALT1 gene. I n some

embodiments, guide RNA recognition sequences are present at the 3' end of the human B4GALT1 gene. In some embodiments, guide RNA recognition sequences are proximate to positions 53575 to 53577 of SEQ ID NO:l. Exemplary guide RNA recognition sequences proximate to positions 53575 to 53577 of SEQ ID NO: l include, but are not limited to,

ATTAGTTTTTAGAGGCATGT (SEQ ID NO:9) and GGCTCTCAGGCCAAGTGTAT (SEQ ID NO:10) (both 5' to positions 53575 to 53577 of SEQ ID NO:l) and TACTCCTTCCCCCTTTAGGA (SEQ ID NO:ll) and GTCCG AG G CTCTG G G CCTAG (SEQID NO: 12) (both 3' to positions 53575 to 53577 of SEQ ID NO: l).

Guide RNAs can comprise two segments: a DNA-targeting segment and a protein- binding segment. Some gRNAs comprise two separate RNA molecules: an activator-RNA (e.g., tracrRNA) and a targeter-RNA (e.g., CRISPR RNA or crRNA). Other gRNAs are a single RNA molecule (single RNA polynucleotide; single-molecule gRNA, single-guide RNA, or sgRNA). For Cas9, for example, a single-guide RNA can comprise a crRNA fused to a tracrRNA (e.g., via a linker). For Cpfl, for example, only a crRNA is needed to achieve cleavage. gRNAs include both double-molecule (i.e., modular) gRNAs and single-molecule gRNAs.

The DNA-targeting segment (crRNA) of a given gRNA comprises a nucleotide sequence that is complementary to a sequence (i.e., the guide RNA recognition sequence) in a target DNA. The DNA-targeting segment of a gRNA interacts with a target DNA (e.g., the B4GALT1 gene) in a sequence-specific manner via hybridization (i.e., base pairing). As such, the nucleotide sequence of the DNA-targeting segment may vary and determines the location within the target DNA with which the gRNA and the target DNA will interact. The DNA-targeting segment of a subject gRNA can be modified to hybridize to any desired sequence within a target DNA. Naturally occu rring crRNAs differ depending on the CRISPR-Cas system and organism but often contain a targeting segment from about 21 to about 72 nucleotides length, flan ked by two direct repeats (DR) of a length from about 21 to about 46 nucleotides. In the case of S. pyogenes, the DRs are 36 nucleotides long and the targeting segment is 30 nucleotides long. The 3' located DR is complementary to and hybridizes with the corresponding tracrRNA, which in turn binds to the Cas protein.

The DNA-targeting segment can have a length of at least about 12 nucleotides, at least about 15 nucleotides, at least about 17 nucleotides, at least about 18 nucleotides, at least about 19 nucleotides, at least about 20 nucleotides, at least about 25 nucleotides, at least about 30 nucleotides, at least about 35 nucleotides, or at least about 40 nucleotides. Such DNA- targeting segments can have a length from about 12 nucleotides to about 100 nucleotides, from about 12 nucleotides to about 80 nucleotides, from about 12 nucleotides to about 50 nucleotides, from about 12 nucleotides to about 40 nucleotides, from about 12 nucleotides to about 30 nucleotides, from about 12 nucleotides to about 25 nucleotides, or from about 12 nucleotides to about 20 nucleotides. For example, the DNA targeting segment can be from about 15 nucleotides to about 25 nucleotides (e.g., from about 17 nucleotides to about 20 nucleotides, or about 17 nucleotides, about 18 nucleotides, about 19 nucleotides, or about 20 nucleotides). See, e.g., U.S. Application Publication 2016/0024523. For Cas9 from 5. pyogenes, a typical DNA-targeting segment is from about 16 to about 20 nucleotides in length or from about 17 to about 20 nucleotides in length. For Cas9 from 5. aureus, a typical DNA-targeting segment is from about 21 to about 23 nucleotides in length. For Cpfl, a typical DNA-targeting segment is at least about 16 nucleotides in length or at least about 18 nucleotides in length.

The percent complementarity between the DNA-targeting sequence and the guide RNA recognition sequence within the target DNA can be at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%). The percent complementarity between the DNA-targeting sequence and the guide RNA recognition sequence within the target DNA can be at least about 60% over about 20 contiguous nucleotides. As an example, the percent complementarity between the DNA- targeting sequence and the guide RNA recognition sequence within the target DNA is about 100% over about 14 contiguous nucleotides at the 5' end of the guide RNA recognition sequence within the complementary strand of the target DNA and as low as about 0% over the remainder. In such a case, the DNA-targeting sequence can be considered to be about 14 nucleotides in length. As another example, the percent complementarity between the DNA- targeting sequence and the guide RNA recognition sequence within the target DNA is about 100% over the seven contiguous nucleotides at the 5' end of the guide RNA recognition sequence within the complementary strand of the target DNA and as low as about 0% over the remainder. In such a case, the DNA-targeting sequence can be considered to be about 7 nucleotides in length. I n some guide RNAs, at least about 17 nucleotides within the DNA-target sequence are complementary to the target DNA. For example, the DNA-targeting sequence can be about 20 nucleotides in length and can comprise 1, 2, or 3 mismatches with the target DNA (the guide RNA recognition sequence). In some embodiments, the mismatches are not adjacent to a protospacer adjacent motif (PAM) sequence (e.g., the mismatches are in the 5' end of the DNA-targeting sequence, or the mismatches are at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, or at least 19 base pairs away from the PAM sequence).

Guide RNAs can include modifications or sequences that provide for additional desirable features (e.g., modified or regulated stability; subcel lular targeting; tracking with a fluorescent label; a binding site for a protein or protein complex; and the like). Examples of such modifications include, for example, a 5' cap (e.g., a 7-methylguanylate cap (m7G)); a 3' polyadenylated tail (i.e., a 3' poly(A) tail); a riboswitch sequence (e.g., to allow for regu lated stability and/or regu lated accessibility by proteins and/or protein complexes); a stability control sequence; a sequence that forms a dsRNA duplex (i.e., a hairpin); a modification or sequence that targets the RNA to a su bcellular location (e.g., nucleus, mitochondria, ch loroplasts, and the like); a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecu le, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, and so forth); a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like); and combinations thereof.

Guide RNAs can be provided in any form. For example, the gRNA can be provided in the form of RNA, either as two molecules (separate crRNA and tracrRNA) or as one molecule (sgRNA), and optional ly in the form of a complex with a Cas protein. For example, gRNAs can be prepared by in vitro transcription using, for example, T7 RNA polymerase. Guide RNAs can also be prepared by chemical synthesis.

The gRNA can also be provided in the form of DNA encoding the gRNA. The DNA encoding the gRNA can encode a single RNA molecu le (sgRNA) or separate RNA molecules (e.g., separate crRNA and tracrRNA). In the latter case, the DNA encoding the gRNA can be provided as one DNA molecule or as separate DNA molecu les encoding the crRNA and tracrRNA, respectively. When a gRNA is provided in the form of DNA, the gRNA can be transiently, conditionally, or constitutively expressed in the cel l. DNAs encoding gRNAs can be stably integrated into the genome of the cel l and operably lin ked to a promoter active in the cel l. Alternately, DNAs encoding gRNAs can be operably linked to a promoter in an expression construct. For example, the DNA encoding the gRNA can be in a vector comprising a heterologous nucleic acid. The vector can fu rther comprise an exogenous donor sequence and/or the vector can fu rther comprise a nucleic acid encoding a Cas protein. Alternately, the DNA encoding the gRNA can be in a vector or a plasmid that is separate from the vector comprising an exogenous donor sequence and/or the vector comprising the nucleic acid encoding the Cas protein. Promoters that can be used in such expression constructs include promoters active, for example, in one or more of a eukaryotic cell, a hu man cell, a non-human cell, a mammalian cell, a non-human mammalian cell, a rodent cel l, a mouse cell, a rat cell, a hamster cell, a rabbit cell, a pluri potent cell, an embryonic stem cel l, or a zygote. Such promoters can be, for example, conditional promoters, inducible promoters, constitutive promoters, or tissue-specific promoters. Such promoters can also be, for example, bidirectional promoters. Specific examples of suitable promoters include an RNA polymerase III promoter, such as a human U6 promoter, a rat U6 polymerase III promoter, or a mouse U6 polymerase I II promoter.

The present disclosu re also provides compositions comprising one or more guide RNAs

(e.g., 1, 2, 3, 4, or more guide RNAs) disclosed herein and a carrier increasing the stability of the isolated nucleic acid or protein (e.g., prolonging the period u nder given conditions of storage (e.g., -,20°C, 4°C, or ambient temperature) for which degradation products remain below a th reshold, such below 0.5% by weight of the starting nucleic acid or protein; or increasing the stability in vivo). Examples of such carriers include, but are not limited to, poly(lactic acid) (PLA) microspheres, poly(D,L-lactic-coglycolic-acid) (PLGA) microspheres, liposomes, micel les, inverse micelles, lipid cochleates, and lipid microtubules. Such compositions can further comprise a Cas protein, such as a Cas9 protein, or a nucleic acid encoding a Cas protein. Such compositions can fu rther comprise one or more (e.g., 1, 2, 3, 4, or more) exogenous donor sequences and/or one or more (e.g., 1, 2, 3, 4, or more) targeting vectors and/or one or more (e.g., 1, 2, 3, 4, or more) expression vectors as disclosed elsewhere herein.

Guide RNA recognition sequences include nucleic acid sequences present in a target

DNA (e.g., the B4GALT1 gene) to which a DNA-targeting segment of a gRNA will bind, provided sufficient conditions for binding exist. For example, guide RNA recognition sequences include sequences to which a guide RNA is designed to have complementarity, where hybridization between a guide RNA recognition sequence and a DNA targeting sequence promotes the formation of a CRISPR complex. Ful l complementarity is not necessarily required, provided that there is sufficient complementarity to cause hybridization and promote formation of a CRISPR complex. Guide RNA recognition sequences also include cleavage sites for Cas proteins, described in more detail below. A guide RNA recognition sequence can comprise any polynucleotide, which can be located, for example, in the nucleus or cytoplasm of a cel l or within an organelle of a cell, such as a mitochondrion or chloroplast.

The guide RNA recognition sequence within a target DNA can be targeted by (i.e., be bound by, or hybridize with, or be complementary to) a Cas protein or a gRNA. Suitable DNA/RNA binding conditions include physiological conditions normally present in a cell. Other suitable DNA/RNA binding conditions are known.

The Cas protein can cleave the nucleic acid at a site within or outside of the nucleic acid sequence present in the target DNA to which the DNA-targeting segment of a gRNA will bind. The "cleavage site" includes the position of a nucleic acid at which a Cas protein produces a single-strand break or a double-strand break. For example, formation of a CRISPR complex (comprising a gRNA hybridized to a guide RNA recognition sequence and complexed with a Cas protein) can resu lt in cleavage of one or both strands in or near (e.g., within 1, within 2, within 3, within 4, within 5, within 6, within 7, within 8, within 9, within 10, within 20, or within 50, or more base pairs from) the nucleic acid sequence present in a target DNA to which a DNA- targeting segment of a gRNA will bind. The cleavage site can be on on ly one strand or on both strands of a nucleic acid. Cleavage sites can be at the same position on both strands of the nucleic acid (producing blunt ends) or can be at different sites on each strand (producing staggered ends (i.e., overhangs)). In some embodiments, the guide RNA recognition sequence of the nickase on the first strand is separated from the guide RNA recognition sequence of the nickase on the second strand by at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, at least 75, at least 100, at least 250, at least 500, or at least 1,000 base pairs.

Site-specific cleavage of target DNA by Cas proteins can occu r at locations determined by both i) base-pairing complementarity between the gRNA and the target DNA and ii) a short motif, called the protospacer adjacent motif (PAM), in the target DNA. The PAM can flan k the guide RNA recognition sequence. In some embodiments, the guide RNA recognition sequence can be flanked on the 3' end by the PAM. Alternately, the guide RNA recognition sequence can be flanked on the 5' end by the PAM. For example, the cleavage site of Cas proteins can be about 1 to about 10, or about 2 to about 5 base pairs (e.g., 3 base pairs) u pstream or downstream of the PAM sequence. In some cases (e.g., when Cas9 from 5. pyogenes or a closely related Cas9 is used), the PAM sequence of the non-complementary strand can be 5'- NiGG-3', where Ni is any DNA nucleotide and is immediately 3' of the guide RNA recognition sequence of the non-complementary strand of the target DNA. As such, the PAM sequence of the complementary strand wou ld be 5'-CCN 2 -3', where N 2 is any DNA nucleotide and is immediately 5' of the guide RNA recognition sequence of the complementary strand of the target DNA. In some such cases, Ni and N 2 can be complementary and the Ni-N 2 base pair can be any base pair (e.g., Ni=C and N 2 =G; Ni=G and N 2 =C; Ni=A and N 2 =T; or Ni=T, and N 2 =A). In the case of Cas9 from S. aureus, the PAM can be NNGRRT (SEQ ID NO:13) or NNGRR (SEQ ID NO: 14) where N can A, G, C, or T, and R can be G or A. In some cases (e.g., for FnCpfl), the PAM sequence can be upstream of the 5' end and have the sequence 5'-TTN-3'.

Examples of guide RNA recognition sequences include a DNA sequence

complementary to the DNA-targeting segment of a gRNA, or such a DNA sequence in addition to a PAM sequence. For example, the target motif can be a 20-nucleotide DNA sequence immediately preceding an NGG motif recognized by a Cas9 protein, such as GN 19 NGG (SEQ I D NO: 15) or N 20 NGG (SEQ ID NO:16) (see, e.g., PCT Pu blication WO 2014/165825). The guanine at the 5' end can facilitate transcription by RNA polymerase in cells. Other examples of guide RNA recognition sequences can include two guanine nucleotides at the 5' end (e.g., GG N20NGG; SEQ I D NO:17) to facilitate efficient transcription by T7 polymerase in vitro. See, e.g., PCT Publication WO 2014/065596. Other guide RNA recognition sequences can have from about 4 to about 22 nucleotides in length, including the 5' G or GG and the 3' GG or NGG. In some embodiments, the guide RNA recognition sequences can have from about 14 to about 20 nucleotides in length.

The guide RNA recognition sequence can be any nucleic acid sequence endogenous or exogenous to a cel l. The guide RNA recognition sequence can be a sequence coding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory sequence) or can include both.

In some embodiments, the guide RNA recognition sequence can be within a region corresponding to exon 5 of SEQ ID NO:l. In some embodiments, the guide RNA recognition sequence can includes or is proximate to positions 53575 to 53577 of SEQ ID NO:l. For example, the guide RNA recognition sequence can be within about 1000, within about 500, within about 400, within about 300, within about 200, within about 100, within about 50, within about 45, within about 40, within about 35, within about 30, within about 25, within about 20, within about 15, within about 10, or within about 5 nucleotides of the position corresponding to positions 53575 to 53577 of SEQ I D NO:l. In some embodiments, the guide RNA recognition sequence can include or be proximate to the start codon of an endogenous B4GALT1 gene or the stop codon of an endogenous B4GALT1 gene. For example, the guide RNA recognition sequence can be within about 10, within about 20, within about 30, within about 40, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the start codon or the stop codon.

The methods and compositions disclosed herein can utilize exogenous donor sequences (e.g., targeting vectors or repair templates) to modify an endogenous B4GALT1 gene, either without cleavage of the endogenous B4GALT1 gene or following cleavage of the endogenous B4GALT1 gene with a nuclease agent. An exogenous donor sequence refers to any nucleic acid or vector that includes the elements that are required to enable site-specific recombination with a target sequence. Using exogenous donor sequences in combination with nuclease agents may result in more precise modifications within the endogenous B4GALT1 gene by promoting homology-directed repair. In such methods, the nuclease agent cleaves the endogenous B4GALT1 gene to create a single-strand break (nick) or double-strand break, and the exogenous donor sequence recombines with the endogenous B4GALT1 gene via non-homologous end joining (NHEJ)- mediated ligation or through a homology-directed repair event. Repair with the exogenous donor sequence may remove or disru pt the nuclease cleavage site so that alleles that have been targeted cannot be re-targeted by the nuclease agent.

Exogenous donor sequences can comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), they can be single-stranded or double-stranded, and they can be in linear or circular form. For example, an exogenous donor sequence can be a single-stranded

oligodeoxynucleotide (ssODN). An exemplary exogenous donor sequence is from about 50 nucleotides to about 5 kb in length, from about 50 nucleotides to about 3 kb in length, or from about 50 to about 1,000 nucleotides in length. Other exemplary exogenous donor sequences are from about 40 to about 200 nucleotides in length. For example, an exogenous donor sequence can be from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about

110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200 nucleotides in length. Alternately, an exogenous donor sequence can be from about 50 to about 100, from about 100 to about 200, from about 200 to about 300, from about 300 to about 400, from about 400 to about 500, from about 500 to about 600, from about 600 to about 700, from about 700 to about 800, from about 800 to about 900, or from about 900 to about 1,000 nucleotides in length. Alternately, an exogenous donor sequence can be from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 2.5 kb, from about 2.5 kb to about 3 kb, from about 3 kb to about 3.5 kb, from about 3.5 kb to about 4 kb, from about 4 kb to about 4.5 kb, or from about 4.5 kb to about 5 kb in length. Alternately, an exogenous donor sequence can be, for example, no more than about 5 kb, no more than about 4.5 kb, no more than about 4 kb, no more than about 3.5 kb, no more than about 3 kb, no more than about 2.5 kb, no more than about 2 kb, no more than about 1.5 kb, no more than about 1 kb, no more than about 900 nucleotides, no more than about 800 nucleotides, no more than about 700 nucleotides, no more than about 600 nucleotides, no more than about 500 nucleotides, no more than about 400 nucleotides, no more than about 300 nucleotides, no more than about 200 nucleotides, no more than about 100 nucleotides, or no more than about 50 nucleotides in length.

In some embodiments, an exogenous donor sequence is a ssODN that is from about 80 nucleotides to about 200 nucleotides in length (e.g., about 120 nucleotides in length). In another example, an exogenous donor sequences is a ssODN that is from about 80 nucleotides to about 3 kb in length. Such an ssODN can have homology arms, for example, that are each from about 40 nucleotides to about 60 nucleotides in length. Such a ssODN can also have homology arms, for example, that are each from about 30 nucleotides to 100 nucleotides in length. The homology arms can be symmetrical (e.g., each about 40 nucleotides or each about 60 nucleotides in length), or they can be asymmetrical (e.g., one homology arm that is about 36 nucleotides in length, and one homology arm that is about 91 nucleotides in length).

Exogenous donor sequences can include modifications or sequences that provide for additional desirable features (e.g., modified or regu lated stability; tracking or detecting with a fluorescent label; a binding site for a protein or protein complex; and so forth). Exogenous donor sequences can comprise one or more fluorescent labels, pu rification tags, epitope tags, or a combination thereof. For example, an exogenous donor sequence can comprise one or more fluorescent labels (e.g., fluorescent proteins or other fluorophores or dyes), such as at least 1, at least 2, at least 3, at least 4, or at least 5 fluorescent labels. Exemplary fluorescent labels include fluorophores such as fluorescein (e.g., 6-carboxyfluorescein (6-FAM)), Texas Red, HEX, Cy3, Cy5, Cy5.5, Pacific Blue, 5-(and-6)-carboxytetramethylrhodamine (TAMRA), and Cy7. A wide range of fluorescent dyes are available commercially for labeling oligonucleotides (e.g., from Integrated DNA Technologies). Such fluorescent labels (e.g., internal fluorescent labels) can be used, for example, to detect an exogenous donor sequence that has been directly integrated into a cleaved endogenous B4GALT1 gene having protruding ends compatible with the ends of the exogenous donor sequence. The label or tag can be at the 5' end, the 3' end, or internally within the exogenous donor sequence. For example, an exogenous donor sequence can be conjugated at 5' end with the IR700 fluorophore from Integrated DNA Technologies (5'IRDYE S 700).

Exogenous donor sequences can also comprise nucleic acid inserts including segments of DNA to be integrated into the endogenous B4GALT1 gene. Integration of a nucleic acid insert in the endogenous B4GALT1 gene can result in addition of a nucleic acid sequence of interest in the endogenous B4GALT1 gene, deletion of a nucleic acid sequence of interest in the endogenous B4GALT1 gene, or replacement of a nucleic acid sequence of interest in the endogenous B4GALT1 gene (i.e., deletion and insertion). Some exogenous donor sequences are designed for insertion of a nucleic acid insert in the endogenous B4GALT1 gene without any corresponding deletion in the endogenous B4GALT1 gene. Other exogenous donor sequences are designed to delete a nucleic acid sequence of interest in the endogenous B4GALT1 gene without any corresponding insertion of a nucleic acid insert. Other exogenous donor sequences are designed to delete a nucleic acid sequence of interest in the endogenous B4GALT1 gene and replace it with a nucleic acid insert.

The nucleic acid insert and the corresponding nucleic acid in the endogenous B4GALT1 gene being deleted and/or replaced can be various lengths. An exemplary nucleic acid insert or corresponding nucleic acid in the endogenous B4GALT1 gene being deleted and/or replaced is from about 1 nucleotide to about 5 kb in length or is from about 1 nucleotide to about 1,000 nucleotides in length. For example, a nucleic acid insert or a corresponding nucleic acid in the endogenous B4GALT1 gene being deleted and/or replaced can be from about 1 to about 10, from about 10 to about 20, from about 20 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 110, from about 110 to about 120, from about 120 to about 130, from about 130 to about 140, from about 140 to about 150, from about 150 to about 160, from about 160 to about 170, from about 170 to about 180, from about 180 to about 190, or from about 190 to about 200 nucleotides in length. Likewise, a nucleic acid insert or a corresponding nucleic acid in the endogenous B4GALT1 gene being deleted and/or replaced can be from about 1 to about 100, from about 100 to about 200, from about 200 to about 300, from about 300 to about 400, from about 400 to about 500, from about 500 to about 600, from about 600 to about 700, from about 700 to about 800, from about 800 to about 900, or from about 900 to about 1,000 nucleotides in length. Likewise, a nucleic acid insert or a corresponding nucleic acid in the endogenous B4GALT1 gene being deleted and/or replaced can be from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, from about 2 kb to about 2.5 kb, from about 2.5 kb to about 3 kb, from about 3 kb to about 3.5 kb, from about 3.5 kb to about 4 kb, from about 4 kb to about 4.5 kb, or from about 4.5 kb to about 5 kb in length.

The nucleic acid insert can comprise genomic DNA or any other type of DNA. For example, the nucleic acid insert can comprise cDNA. The nucleic acid insert can comprise a sequence that is homologous to all or part of the endogenous B4GALT1 gene (e.g., a portion of the gene encoding a particular motif or region of a B4GALT1 polypeptide). For example, the nucleic acid insert can comprise a sequence that comprises one or more point mutations (e.g., 1, 2, 3, 4, 5, or more) or one or more nucleotide insertions or deletions compared with a sequence targeted for replacement in the endogenous B4GALT1 gene.

The nucleic acid insert or the corresponding nucleic acid in the endogenous B4GALT1 gene being deleted and/or replaced can be a coding region such as an exon; a non-coding region such as an intron, an untranslated region, or a regu latory region (e.g., a promoter, an enhancer, or a transcriptional repressor-binding element); or any combination thereof.

Nucleic acid inserts can also comprise a polynucleotide encoding a selection marker. Alternately, the nucleic acid inserts can lack a polynucleotide encoding a selection marker. The selection marker can be contained in a selection cassette. I n some embodiments, the selection cassette can be a self-deleting cassette. As an example, the self-deleting cassette can comprise a Cre gene (comprises two exons encoding a Cre recombinase, which are separated by an intron) operably lin ked to a mouse Prml promoter and a neomycin resistance gene operably linked to a hu man ubiquitin promoter. Exemplary selection markers include neomycin phosphotransferase (neo r ), hygromycin B phosphotransferase (hyg r ), pu romycin-N- acetyltransferase (puro r ), blasticidin S deaminase (bsr r ), xanthine/guanine phosphoribosyl transferase (gpt), or herpes simplex virus thymidine kinase (HSV-k), or a combination thereof. The polynucleotide encoding the selection marker can be operably linked to a promoter active in a cell being targeted. Examples of promoters are described elsewhere herein.

The nucleic acid insert can also comprise a reporter gene. Exemplary reporter genes include those encoding luciferase, β-galactosidase, green fluorescent protein (GFP), enhanced green fluorescent protein (eGFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), en hanced yel low fluorescent protein (eYFP), blue fluorescent protein (BFP), enhanced blue fluorescent protein (eBFP), DsRed, ZsGreen, M mGFP, mPlum, mCherry, tdTomato, mStrawberry, J-Red, mOrange, mKO, mCitrine, Venus, YPet, Emerald, CyPet, Cerulean, T-Sapphire, and alkaline phosphatase. Such reporter genes can be operably linked to a promoter active in a cell being targeted. Examples of promoters are described elsewhere herein. The nucleic acid insert can also comprise one or more expression cassettes or deletion cassettes. A particu lar cassette can comprise one or more of a nucleotide sequence of interest, a polynucleotide encoding a selection marker, and a reporter gene, along with various regu latory components that influence expression. Examples of selectable markers and reporter genes that can be included are discussed in detail elsewhere herein.

The nucleic acid insert can comprise a nucleic acid flanked with site-specific recombination target sequences. Alternately, the nucleic acid insert can comprise one or more site-specific recombination target sequences. Although the entire nucleic acid insert can be flan ked by such site-specific recombination target sequences, any region or individual polynucleotide of interest within the nucleic acid insert can also be flan ked by such sites.

Site-specific recombination target sequences, which can flan k the nucleic acid insert or any polynucleotide of interest in the nucleic acid insert can include, for example, ΙοχΡ, lox511, lox2272, lox66, lox71, loxM2, lox5171, FRT, FRT11, FRT71, attp, att, FRT, rox, or a combination thereof. In some embodiments, the site-specific recombination sites flan k a polynucleotide encoding a selection marker and/or a reporter gene contained within the nucleic acid insert. Following integration of the nucleic acid insert into the endogenous B4GALT1 gene, the sequences between the site-specific recombination sites can be removed. In some

embodiments, two exogenous donor sequences can be used, each with a nucleic acid insert comprising a site-specific recombination site. The exogenous donor sequences can be targeted to 5' and 3' regions flan king a nucleic acid of interest. Following integration of the two nucleic acid inserts into the target genomic locus, the nucleic acid of interest between the two inserted site-specific recombination sites can be removed.

Nucleic acid inserts can also comprise one or more restriction sites for restriction endonucleases (i.e., restriction enzymes), which include Type I, Type I I, Type III, and Type IV endonucleases. Type I and Type III restriction endonucleases recognize specific recognition sequences, but typically cleave at a variable position from the nuclease binding site, which can be hundreds of base pairs away from the cleavage site (recognition sequence). In Type I I systems the restriction activity is independent of any methylase activity, and cleavage typically occu rs at specific sites within or near to the binding site. Most Type II enzymes cut palindromic sequences, however Type Ma enzymes recognize non-palindromic recognition sequences and cleave outside of the recognition sequence, Type lib enzymes cut sequences twice with both sites outside of the recognition sequence, and Type Ms enzymes recognize an asymmetric recognition sequence and cleave on one side and at a defined distance of about 1 to about 20 nucleotides from the recognition sequence. Type IV restriction enzymes target methylated DNA.

In some embodiments, the exogenous donor sequences have short single-stranded regions at the 5' end and/or the 3' end that are complementary to one or more overhangs created by nuclease-mediated or Cas-protein-mediated cleavage at the target genomic locus (e.g., in the B4GALT1 gene). These overhangs can also be referred to as 5' and 3' homology arms. For example, some exogenous donor sequences have short single-stranded regions at the 5' end and/or the 3' end that are complementary to one or more overhangs created by Cas- protein-mediated cleavage at 5' and/or 3' target sequences at the target genomic locus. I n some embodiments, such exogenous donor sequences have a complementary region on ly at the 5' end or only at the 3' end. For example, some such exogenous donor sequences have a complementary region on ly at the 5' end complementary to an overhang created at a 5' target sequence at the target genomic locus or only at the 3' end complementary to an overhang created at a 3' target sequence at the target genomic locus. Other such exogenous donor sequences have complementary regions at both the 5' and 3' ends. For example, other such exogenous donor sequences have complementary regions at both the 5' and 3' ends e.g., complementary to first and second overhangs, respectively, generated by Cas-mediated cleavage at the target genomic locus. For example, if the exogenous donor sequence is double- stranded, the single-stranded complementary regions can extend from the 5' end of the top strand of the donor sequence and the 5' end of the bottom strand of the donor sequence, creating 5' overhangs on each end. Alternately, the single-stranded complementary region can extend from the 3' end of the top strand of the donor sequence and from the 3' end of the bottom strand of the template, creating 3' overhangs.

The complementary regions can be of any length sufficient to promote ligation between the exogenous donor sequence and the endogenous B4GALT1 gene. Exemplary complementary regions are from about 1 to about 5 nucleotides in length, from about 1 to about 25 nucleotides in length, or from about 5 to about 150 nucleotides in length. For example, a complementary region can be at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, or at least about 25 nucleotides in length. Alternately, the complementary region can be about 5 to about 10, about 10 to about 20, about 20 to about 30, about 30 to about 40, about 40 to about 50, about 50 to about 60, about 60 to about 70, about 70 to about 80, about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150 nucleotides in length, or longer.

Such complementary regions can be complementary to overhangs created by two pairs of nickases. Two double-strand breaks with staggered ends can be created by using first and second nickases that cleave opposite strands of DNA to create a first double-strand break, and third and fourth nickases that cleave opposite strands of DNA to create a second double- strand break. For example, a Cas protein can be used to nick first, second, third, and fourth guide RNA recognition sequences corresponding with first, second, third, and fourth guide RNAs. The first and second guide RNA recognition sequences can be positioned to create a first cleavage site such that the nicks created by the first and second nickases on the first and second strands of DNA create a double-strand break (i.e., the first cleavage site comprises the nicks within the first and second guide RNA recognition sequences). Likewise, the third and fourth guide RNA recognition sequences can be positioned to create a second cleavage site such that the nicks created by the third and fourth nickases on the first and second strands of DNA create a double-strand break (i.e., the second cleavage site comprises the nicks within the third and fourth guide RNA recognition sequences). In some embodiments, the nicks within the first and second guide RNA recognition sequences and/or the third and fourth guide RNA recognition sequences can be off-set nicks that create overhangs. The offset window can be, for example, at least about 5 bp, at least about 10 bp, at least about 20 bp, at least about 30 bp, at least about 40 bp, at least about 50 bp, at least about 60 bp, at least about 70 bp, at least about 80 bp, at least about 90 bp, or at least about 100 bp or more. In such embodiments, a double- stranded exogenous donor sequence can be designed with single-stranded complementary regions that are complementary to the overhangs created by the nicks within the first and second guide RNA recognition sequences and by the nicks within the third and fourth guide RNA recognition sequences. Such an exogenous donor sequence can then be inserted by non- homologous-end-joining-mediated ligation.

In some embodiments, the exogenous donor sequences (i.e., targeting vectors) comprise homology arms. If the exogenous donor sequence also comprises a nucleic acid insert, the homology arms can flank the nucleic acid insert. For ease of reference, the homology arms are referred to herein as 5' and 3' (i.e., upstream and downstream) homology arms. This terminology relates to the relative position of the homology arms to the nucleic acid insert within the exogenous donor sequence.

A homology arm and a target sequence correspond to one another when the two regions share a sufficient level of sequence identity to one another to act as substrates for a homologous recombination reaction. The sequence identity between a particu lar target sequence and the corresponding homology arm found in the exogenous donor sequence can be any degree of sequence identity that allows for homologous recombination to occu r. For example, the amou nt of sequence identity shared by the homology arm of the exogenous donor sequence (or a fragment thereof) and the target sequence (or a fragment thereof) can be at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity, such that the sequences undergo homologous recombination. Moreover, a corresponding region of homology between the homology arm and the corresponding target sequence can be of any length that is sufficient to promote homologous recombination. Exemplary homology arms are from about 25 nucleotides to about 2.5 kb in length, from about 25 nucleotides to about 1.5 kb in length, or from about 25 to about 500 nucleotides in length. For example, a given homology arm (or each of the homology arms) and/or corresponding target sequence can comprise corresponding regions of homology that are from about 25 to about 30, from about 30 to about 40, from about 40 to about 50, from about 50 to about 60, from about 60 to about 70, from about 70 to about 80, from about 80 to about 90, from about 90 to about 100, from about 100 to about 150, from about 150 to about 200, from about 200 to about 250, from about 250 to about 300, from about 300 to about 350, from about 350 to about 400, from about 400 to about 450, or from about 450 to about 500 nucleotides in length, such that the homology arms have sufficient homology to undergo homologous recombination with the corresponding target sequences within the endogenous B4GALT1 gene. Alternately, a particular homology arm (or each homology arm) and/or corresponding target sequence can comprise corresponding regions of homology that are from about 0.5 kb to about 1 kb, from about 1 kb to about 1.5 kb, from about 1.5 kb to about 2 kb, or from about 2 kb to about 2.5 kb in length. For example, the homology arms can each be about 750 nucleotides in length. The homology arms can be symmetrical (each about the same size in length), or they can be asymmetrical (one longer than the other).

The homology arms can correspond to a locus that is native to a cel l (e.g., the targeted locus). Alternately, they can correspond to a region of a heterologous or exogenous segment of DNA that was integrated into the genome of the cell, including, for example, transgenes, expression cassettes, or heterologous or exogenous regions of DNA. In some embodiments, the homology arms of the targeting vector can correspond to a region of a yeast artificial chromosome (YAC), a bacterial artificial ch romosome (BAC), a human artificial ch romosome, or any other engineered region contained in an appropriate host cell. In some embodiments, the homology arms of the targeting vector can correspond to or be derived from a region of a BAC library, a cosmid library, or a PI phage library, or can be derived from synthetic DNA.

When a nuclease agent is used in combination with an exogenous donor sequence, the 5' and 3' target sequences are generally located in sufficient proximity to the nuclease cleavage site so as to promote the occurrence of a homologous recombination event between the target sequences and the homology arms upon a single-strand break (nick) or double-strand break at the nuclease cleavage site. Nuclease cleavage sites include a DNA sequence at which a nick or double-strand break is created by a nuclease agent (e.g., a Cas9 protein complexed with a guide RNA). The target sequences within the endogenous B4GALT1 gene that correspond to the 5' and 3' homology arms of the exogenous donor sequence are "located in sufficient proximity" to a nuclease cleavage site if the distance is such as to promote the occurrence of a homologous recombination event between the 5' and 3' target sequences and the homology arms upon a single-strand break or double-strand break at the nuclease cleavage site. Thus, the target sequences corresponding to the 5' and/or 3' homology arms of the exogenous donor sequence can be, for example, within at least 1 nucleotide of a given nuclease cleavage site or within at least 10 nucleotides to about 1,000 nucleotides of a particular nuclease cleavage site. In some embodiments, the nuclease cleavage site can be immediately adjacent to at least one or both of the target sequences.

The spatial relationship of the target sequences that correspond to the homology arms of the exogenous donor sequence and the nuclease cleavage site can vary. In some

embodiments, the target sequences can be located 5' to the nuclease cleavage site, target sequences can be located 3' to the nuclease cleavage site, or the target sequences can flan k the nuclease cleavage site.

The present disclosu re also provides therapeutic methods and methods of treatment or prophylaxis of a cardiovascu lar condition in a su bject having or at risk of having the disease using the methods disclosed herein for modifying or altering expression of an endogenous B4GALT1 gene. The present disclosure also provides therapeutic methods and methods of treatment or prophylaxis of a cardiovascu lar condition in a su bject having or at risk for the disease using methods for decreasing expression of endogenous B4GALT1 mRNA or using methods for providing recombinant nucleic acids encoding B4GALT1 polypeptides, providing mRNAs encoding B4GALT1 polypeptides, or providing B4GALT1 polypeptides to the subject.

The methods can comprise introducing one or more nucleic acid molecules or proteins into the su bject, into an organ of the subject, or into a cel l of the subject (e.g., in vivo or ex vivo).

In some embodiments, the disclosure provides mRNAs encoding B4GALT1

polypeptides (e.g. polynucleotides as discussed herein, for example an mRNA that comprises the sequence of SEQ ID NO:4) for use in therapy. In some such embodiments, the therapy is treating or preventing a cardiovascular condition.

In some embodiments, the disclosure provides B4GALT1 polypeptides (e.g.

polypeptides as discussed herein, for example polypeptides that comprise the sequence of SEQ I D NO:8) for use in therapy. In some such embodiments the therapy is treating or preventing a cardiovascular condition.

Su bjects include human and other mammalian subjects (e.g., feline, canine, rodent, mouse, or rat) or non-mammalian subjects (e.g., poultry) that receive either prophylactic or therapeutic treatment. Such subjects can be, for example, a subject (e.g., a human) who is not a carrier of the variant B4GALT1 (or is on ly a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition.

Non-limiting examples of a cardiovascular condition include an elevated level of one or more seru m lipids. The seru m lipids comprise one or more of cholesterol, LDL, HDL, triglycerides, HDL-cholesterol, and non-HDL cholesterol, or any subfraction thereof (e.g., HDL2, HDL2a, HDL2b, H DL2c, HDL3, HDL3a, HDL3b, H DL3c, HDL3d, LDL1, LDL2, LDL3, lipoprotein A, Lpal, Lpal, Lpa3, Lpa4, or Lpa5). A cardiovascu lar condition may comprise elevated levels of coronary artery calcification. A cardiovascular condition may comprise Type lid glycosylation (CDG-lld). A cardiovascu lar condition may comprise elevated levels of pericardial fat. A cardiovascular condition may comprise an atheroth rombotic condition. The atherothrombotic condition may comprise elevated levels of fibrinogen. The atheroth rombotic condition may comprises a fibrinogen-mediated blood clot. A cardiovascular condition may comprise elevated levels of fibrinogen. A cardiovascular condition may comprise a fibrinogen-mediated blood clot. A cardiovascu lar condition may comprise a blood clot formed from the involvement of fibrinogen activity. A fibrinogen-mediated blood clot or blood clot formed from the

involvement of fibrinogen activity may be in any vein or artery in the body.

Such methods can comprise genome editing or gene therapy. For example, an endogenous B4GALT1 gene that is not the variant B4GALT1 can be modified to comprise the variation associated with the variant B4GALT1 (i.e., replacement of asparagine with a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide). As another example, an endogenous B4GALT1 gene that is not the variant B4GALT1 can be knocked out or inactivated. Likewise, an endogenous B4GALT1 gene that is not the variant B4GALT1 can be knocked out or inactivated, and an B4GALT1 gene comprising the modification associated with the variant B4GALT1 (e.g., the complete variant B4GALT1 or a minigene comprising the modification) can be introduced and expressed. Similarly, an endogenous B4GALT1 gene that is not the variant B4GALT1 can be knocked out or inactivated, and a recombinant DNA encoding the B4GALT1 variant polypeptide can be introduced and expressed, an mRNA encoding the B4GALT1 variant polypeptide can be introduced and expressed (e.g., intracellu lar protein replacement therapy), and/or a variant B4GALT1 polypeptide can be introduced (e.g., protein replacement therapy).

In some embodiments, the methods comprise introducing and expressing a recombinant B4GALT1 gene comprising the modification associated with the B4GALT1 rs551564683 variant (e.g., the complete variant B4GALT1 or a minigene comprising the modification), introducing and expressing recombinant nucleic acids (e.g., DNA) encoding the variant B4GALT1 polypeptide or fragments thereof, introducing and expressing one or more mRNAs encoding the variant B4GALT1 polypeptide or fragments thereof (e.g., intracellular protein replacement therapy), or introducing the variant B4GALT1 polypeptide or fragments thereof (e.g., protein replacement therapy) without knocking out or inactivating an endogenous B4GALT1 gene that is not the variant B4GALT1. In some embodiments, such methods can also be carried out in combination with methods in which endogenous B4GALT1 mRNA that is not the variant B4GALT1 is targeted for reduced expression, such as through use of antisense RNA, siRNA, or shRNA.

A B4GALT1 gene or minigene or a DNA encoding the variant B4GALT1 polypeptide or fragments thereof can be introduced and expressed in the form of an expression vector that does not modify the genome, it can be introduced in the form of a targeting vector such that it genomically integrates into an endogenous B4GALT1 locus, or it can be introduced such that it genomically integrates into a locus other than the endogenous B4GALT1 locus, such as a safe harbor locus. The genomically integrated B4GALT1 gene can be operably linked to a B4GALT1 promoter or to another promoter, such as an endogenous promoter at the site of integration. Safe harbor loci are chromosomal sites where transgenes can be stably and reliably expressed in all tissues of interest without adversely affecting gene structure or expression. Safe harbor loci can have, for example, one or more or all of the following characteristics: 1) a distance of greater than about 50 kb from the 5' end of any gene; a distance of greater than about 300 kb from any cancer-related gene; a distance of greater than about 300 kb from any microRNA; outside a gene transcription unit, and outside of ultra-conserved regions. Examples of suitable safe harbor loci include, but are not limited to, adeno-associated virus site 1 (AAVS1), the chemokine (CC motif) receptor 5 (CCR5) gene locus, and the human orthologue of mouse ROSA26 locus.

In some embodiments, the methods comprise a method of treating a subject who is not a carrier of the variant B4GALT1 (or is only a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject or introducing into a cell in the subject: a) a nuclease agent (or nucleic acid encoding) that binds to a nuclease recognition sequence within an endogenous B4GALT1 gene, wherein the nuclease recognition sequence includes or is proximate to positions 53575 to 53577 of SEQ I D NO:l; and b) an exogenous donor sequence comprising a 5' homology arm that hybridizes to a target sequence 5' of positions 53575 to 53577 of SEQ I D NO:l, and a nucleic acid insert comprising a nucleic acid sequence encoding a serine flan ked by the 5' homology arm and the 3' homology arm. The nuclease agent can cleave the endogenous B4GALT1 gene in a cell in the su bject, and the exogenous donor sequence can recombine with the endogenous B4GALT1 gene in the cell, wherein upon recombination of the exogenous donor sequence with the endogenous B4GALT1 gene, the nucleic acid sequence encoding a serine is inserted at nucleotides corresponding to positions 53575 to 53577 of SEQ ID NO:l. Examples of nuclease agents (e.g., a Cas9 protein and a guide RNA) that can be used in such methods are disclosed elsewhere herein.

In some embodiments, the methods comprise a method of treating a subject who is not a carrier of the variant B4GALT1 (or is only a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject or introducing into a cell in the subject an exogenous donor sequence comprising a 5' homology arm that hybridizes to a target sequence 5' of the position corresponding to positions 53575 to 53577 of SEQ ID NO:l, a 3' homology arm that hybridizes to a target sequence 3' of positions 53575 to 53577 of SEQ ID NO:l, and a nucleic acid insert comprising a nucleotide sequence encoding a serine flan ked by the 5' homology arm and the 3' homology arm. The exogenous donor sequence can recombine with the endogenous B4GALT1 gene in the cell, wherein upon recombination of the exogenous donor sequence with the endogenous B4GALT1 gene, the nucleotide sequence encoding a serine is inserted at nucleotides corresponding to positions 53575 to 53577 of SEQ I D NO:l.

Some such methods comprise a method of treating a subject who is not a carrier of the variant B4GALT1 ant (or is on ly a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject or introducing into a cel l in the subject: a) a nuclease agent (or nucleic acid encoding) that binds to a nuclease recognition sequence within an endogenous B4GALT1 gene, wherein the nuclease recognition sequence comprises the start codon for the endogenous B4GALT1 gene or is within about 10, about 20, about 30, about 40, about 50, about 100, about 200, about 300, about 400, about 500, or about 1,000 nucleotides of the start codon or is selected from SEQ ID NOS:9-12. The nuclease agent can cleave and disrupt expression of the endogenous B4GALT1 gene in a cell in the subject.

In some embodiments, the methods comprise a method of treating a subject who is not a carrier of the variant B4GALT1 (or is only a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject or introducing into a cell in the subject: a) a nuclease agent (or nucleic acid encoding) that binds to a nuclease recognition sequence within an endogenous B4GALT1 gene, wherein the nuclease recognition sequence comprises the start codon for the endogenous B4GALT1 gene or is within about 10, within about 20, within about 30, within about 40, within about 50, within about 100, within about 200, within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the start codon or is selected from SEQ ID NOS:9-12; and b) an expression vector comprising a recombinant B4GALT1 gene comprising a nucleotide sequence at positions 53575 to 53577 encoding a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide. The expression vector can be one that does not genomical ly integrate. Alternately, a targeting vector (i.e., exogenous donor sequence) can be introduced comprising a recombinant B4GALT1 gene comprising a nucleotide sequence at positions 53575 to 53577 encoding a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide. The nuclease agent can cleave and disrupt expression of the within B4GALT1 gene in a cell in the subject, and the expression vector can express the recombinant B4GALT1 gene in the cell in the subject. Alternately, the genomically integrated, recombinant B4GALT1 gene can be expressed in the cell in the subject. Examples of nuclease agents (e.g., a nuclease-active Cas9 protein and guide RNA) that can be used in such methods are disclosed elsewhere herein. Examples of suitable guide RNAs and guide RNA recognition sequences are also disclosed elsewhere herein. Step b) can alternately comprise introducing an expression vector or targeting vector comprising a nucleic acid (e.g., DNA) encoding a B4GALT1 polypeptide that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 mRNA or a fragment thereof. Likewise, step b) can also comprise introducing an mRNA encoding a B4GALT1 Asn352Ser polypeptide that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1

Asn352Ser polypeptide or a fragment thereof and/or having a complementary DNA (or a portion thereof) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 mRNA or a fragment thereof. Likewise, step b) can also comprise introducing a protein comprising an amino acid sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof.

In some embodiments, a second nuclease agent is also introduced into the subject or into the cel l in the subject, wherein the second nuclease agent binds to a second nuclease recognition sequence within the endogenous B4GALT1 gene, wherein the second nuclease recognition sequence comprises the stop codon for the endogenous B4GALT1 gene or is within about 10, within about 20, within about 30, within about 40, within about 50, within about 100, within about 200 7 within about 300, within about 400, within about 500, or within about 1,000 nucleotides of the stop codon or is selected from SEQ I D NOS:9-12, wherein the nuclease agent cleaves the endogenous B4GALT1 gene in the cel l within both the first nuclease recognition sequence and the second nuclease recognition sequence, wherein the cel l is modified to comprise a deletion between the first nuclease recognition sequence and the second nuclease recognition sequence. In some embodiments, the second nuclease agent can be a Cas9 protein and a guide RNA. Suitable guide RNAs and guide RNA recognition sequences in proximity to the stop codon are disclosed elsewhere herein.

In some embodiments, the methods can also comprise a method of treating a subject who is not a carrier of the variant B4GALT1 (or is only a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject or introducing into a cell in the subject: an antisense RNA, an siRNA, or an shRNA that hybridizes to a sequence within a region of within endogenous B4GALT1 mRNA. For example, the antisense RNA, siRNA, or shRNA can hybridize to sequence within a region in exon 5 of SEQ ID NO:3 (B4GALT1 mRNA) and decrease expression of B4GALT1 mRNA in a cell in the subject. In some embodiments, such methods can further comprise introducing into the subject an expression vector comprising a recombinant B4GALT1 gene comprising a nucleotide sequence encoding a serine inserted at positions 53575 to 53577 of SEQ ID NO:2. The expression vector can be one that does not genomical ly integrate.

Alternately, a targeting vector (i.e., exogenous donor sequence) can be introduced comprising a recombinant B4GALT1 gene comprising nucleic acid sequence encoding a serine at positions corresponding to positions 53575 to 53577 of SEQ I D NO:2. In methods in which an expression vector is used, the expression vector can express the recombinant B4GALT1 gene in the cel l in the subject. Alternately, in methods in which a recombinant B4GALT1 gene is genomically integrated, the recombinant B4GALT1 gene can express in the cel l in the subject.

In some embodiments, such methods can alternately comprise introducing an expression vector or targeting vector comprising a nucleic acid (e.g., DNA) encoding a B4GALT1 polypeptide that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to variant B4GALT1 mRNA or a fragment thereof. Likewise, such methods can alternately comprise introducing an mRNA encoding a polypeptide that is at least 90% at least 95% at least 96% at least 97% at least 98°% at least 99°% or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof and/or having a complementary DNA (or a portion thereof) that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 mRNA or a fragment thereof. Likewise, such methods can alternately comprise introducing a polypeptide comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof.

In some embodiments, such methods can comprise methods of treating a subject who is not a carrier of the variant B4GALT1 (or is only a heterozygous carrier of the variant B4GALT1) and has or is susceptible to developing a cardiovascular condition, comprising introducing into the subject or introducing into a cell in the subject an expression vector, wherein the expression vector comprises a recombinant B4GALT1 gene comprising a nucleotide sequence at positions 53575 to 53577 that encode a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide, wherein the expression vector expresses the recombinant B4GALT1 gene in a cell in the subject. The expression vector can be one that does not genomically integrate. Alternately, a targeting vector (i.e., exogenous donor sequence) can be introduced comprising a recombinant B4GALT1 gene comprising a nucleotide sequence at positions 53575 to 53577 of SEQ ID NO:2 that encode a serine at the position corresponding to position 352 of the full length/matu re B4GALT1 polypeptide. In methods in which an expression vector is used, the expression vector can express the recombinant B4GALT1 gene in the cel l in the subject. Alternately, in methods in which a recombinant B4GALT1 gene is genomically integrated, the recombinant B4GALT1 gene can express in the cel l in the subject.

Such methods can alternately comprise introducing an expression vector or targeting vector comprising a nucleic acid (e.g., DNA) encoding a B4GALT1 polypeptide that is at least

90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof and/or comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 mRNA or a fragment thereof. Likewise, such methods can alternately comprise introducing an mRNA encoding a polypeptide that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 polypeptide or a fragment thereof and/or having a complementary DNA (or a portion thereof) that is at least 90% at least 95% at least 96% at least 97% at least 98% at least 99% or 100% identical to the variant B4GALT1 mRNA or a fragment thereof. Likewise, such methods can alternately comprise introducing a protein comprising a sequence that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to the variant B4GALT1 Asn352Ser polypeptide or a fragment thereof.

Suitable expression vectors and recombinant B4GALT1 genes for use in any of the above methods are disclosed elsewhere herein. For example, the recombinant B4GALT1 gene can be the complete B4GALT1 variant gene or can be a B4GALT1 minigene in which one or more nonessential segments of the gene have been deleted with respect to a corresponding wild-type B4GALT1 gene. As an example, the deleted segments can comprise one or more intronic sequences, and the minigene can comprise exons 1 through 6. An example of a complete B4GALT1 variant gene is one that is at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO:2.

In some embodiments, such methods comprise a method of modifying a cell in a su bject having or susceptible to developing a cardiovascular condition. In such methods, the nuclease agents and/or exogenous donor sequences and/or recombinant expression vectors can be introduced into the cell via administration in an effective regime meaning a dosage, route of ad ministration and frequency of ad ministration that delays the onset, reduces the severity, inhibits further deterioration, and/or ameliorates at least one sign or symptom of a cardiovascular condition being treated. The term "symptom" refers to a subjective evidence of a disease as perceived by the subject, and a "sign" refers to objective evidence of a disease as observed by a physician. If a subject is already suffering from a disease, the regime can be referred to as a therapeutically effective regime. If the su bject is at elevated risk of the disease relative to the general population but is not yet experiencing symptoms, the regime can be referred to as a prophylactically effective regime. In some instances, therapeutic or prophylactic efficacy can be observed in an individual patient relative to historical controls or past experience in the same su bject. In other instances, therapeutic or prophylactic efficacy can be demonstrated in a preclinical or clinical trial in a population of treated subjects relative to a control popu lation of untreated subjects.

Delivery can be any suitable method, as disclosed elsewhere herein. For example, the nuclease agents or exogenous donor sequences or recombinant expression vectors can be delivered by, for example, vector delivery, viral delivery, particle-mediated delivery, nanoparticle-mediated delivery, liposome-mediated delivery, exosome-mediated delivery, lipid- mediated delivery, lipid-nanoparticle-mediated delivery, cel l-penetrating-peptide-mediated delivery, or implantable-device-mediated delivery. Specific examples include hydrodynamic delivery, virus-mediated delivery, and lipid-nanoparticle-mediated delivery.

Administration can be by any suitable route including, but not limited to, parenteral, intravenous, oral, subcutaneous, intra-arterial, intracranial, intrathecal, intraperitoneal, topical, intranasal, or intramuscular. A specific example which is often used, for example, for protein replacement therapies is intravenous infusion. The frequency of ad ministration and the number of dosages can depend on the half-life of the nuclease agents or exogenous donor sequences or recombinant expression vectors, the condition of the subject, and the route of administration among other factors. Pharmaceutical compositions for administration are desirably sterile and su bstantially isotonic and manufactu red under GMP conditions. Pharmaceutical compositions can be provided in unit dosage form (i.e., the dosage for a single administration).

Pharmaceutical compositions can be formulated using one or more physiologically and pharmaceutically acceptable carriers, diluents, excipients or auxiliaries. The formulation depends on the route of administration chosen. The term "pharmaceutically acceptable" means that the carrier, diluent, excipient, or auxiliary is compatible with the other ingredients of the formu lation and not substantially deleterious to the recipient thereof.

Other such methods comprise an ex vivo method in a cel l from a subject having or susceptible to developing a cardiovascular condition. The cel l with the targeted genetic modification can then be transplanted back into the su bject.

The present disclosu re provides methods of decreasing LDL in a subject in need thereof, by reducing expression of endogenous wild-type B4GALT1 or increasing expression of B4GALT1 Asn352Ser, by any of the methods described herein. The present disclosure provides methods of decreasing total cholesterol in a subject in need thereof, by reducing expression of endogenous wild-type B4GALT1 or increasing expression of B4G A ill Asn352Ser, by any of the methods described herein. The present disclosure provides methods of decreasing fibrinogen in a subject in need thereof, by reducing expression of endogenous wild-type B4GALT1 or increasing expression of B4G A ill Asn352Ser, by any of the methods described herein. The present disclosu re provides methods of decreasing eGFR in a subject in need thereof, by reducing expression of endogenous wild-type B4GALT1 or increasing expression of B4GALT1 Asn352Ser, by any of the methods described herein. The present disclosure provides methods of increasing AST, but not ALT, in a subject in need thereof, by reducing expression of endogenous wild-type B4GALT1 or increasing expression of B4G A ill Asn352Ser, by any of the methods described herein. The present disclosure provides methods of increasing creatinine in a subject in need thereof, by reducing expression of endogenous wild-type B4GALT1 or increasing expression of B4G A ill Asn352Ser, by any of the methods described herein.

The present disclosu re also provides methods of diagnosing the risk of developing a cardiovascular condition, or diagnosing the risk of developing a cardiovascular condition and treating the same in a subject in need thereof, comprising: requesting a test providing the results of an analysis of a sample from the subject for the presence or absence of variant B4GALT1 gene, mRNA, cDNA, or polypeptide, as described herein; and, in those subjects not having the variant B4GALT1 gene, mRNA, cDNA, or polypeptide, ad ministering a therapeutic agent, such as described herein, to the su bject. Any of the tests described herein whereby the presence or absence of variant B4GALT1 gene, mRNA, cDNA, or polypeptide is determined can be used.

The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les disclosed herein in the

manufacture of a medicament for decreasing LDL, decreasing total cholesterol, decreasing fibrinogen, decreasing eGFR, increasing AST (but not ALT), and increasing creatinine in a subject in need thereof. The present disclosure also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecules in the manufacture of a medicament for treating coronary artery disease, coronary artery calcification, and related disorders.

The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les disclosed herein for decreasing LDL, decreasing total cholesterol, decreasing fibrinogen, decreasing eGFR, increasing AST (but not ALT), and increasing creatinine in a subject in need thereof.

The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les for treating coronary artery disease, coronary artery calcification, Type lid glycosylation (CDG-l ld), and related disorders.

The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les disclosed herein for modifying a B4GALT1 gene in a cell in a subject in need thereof. The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les disclosed herein for altering expression of a B4GALT1 gene in a cell in a subject in need thereof.

The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les disclosed herein for diagnosing the risk of developing any of the cardiovascular conditions disclosed herein.

The present disclosu re also provides uses of any of the variant B4GALT1 genes, mRNAs, cDNAs, polypeptides, and hybridizing nucleic acid molecu les disclosed herein for diagnosing a su bject of having any of the cardiovascu lar conditions disclosed herein.

All patent documents, websites, other publications, accession nu mbers and the like cited above or below are incorporated by reference in their entirety for all purposes to the same extent as if each individual item were specifical ly and individually indicated to be so incorporated by reference. If different versions of a sequence are associated with an accession number at different times, the version associated with the accession number at the effective filing date of this application is meant. The effective filing date means the earlier of the actual filing date or filing date of a priority application referring to the accession number if applicable. Likewise, if different versions of a pu blication, website or the like are pu blished at different times, the version most recently published at the effective filing date of the application is meant unless otherwise indicated. Any feature, step, element, embodiment, or aspect of the present disclosu re can be used in combination with any other feature, step, element, embodiment, or aspect unless specifical ly indicated otherwise. Although the present disclosu re has been described in some detail by way of illustration and example for purposes of clarity and u nderstanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.

The nucleotide and amino acid sequences recited herein are shown using standard letter abbreviations for nucleotide bases, and one-letter code for amino acids. The nucleotide sequences fol low the standard convention of beginning at the 5' end of the sequence and proceeding forward (i.e., from left to right in each line) to the 3' end. Only one strand of each nucleotide sequence is shown, but the complementary strand is understood to be included by any reference to the displayed strand. The amino acid sequences follow the standard convention of beginning at the amino terminus of the sequence and proceeding forward (i.e., from left to right in each line) to the carboxy terminus. U.S. Application No. 62/659,344, filed April 18, 2018, U.S. Application No. 62/550,161, filed August 25, 2017, and U.S. Application No. 62/515,140, filed Ju ne 5, 2017, are each incorporated herein by reference in its entirety.

The following examples are provided to describe the embodiments in greater detail. They are intended to illustrate, not to limit, the claimed embodiments.

EXAMPLES

Example 1: Determination of a Novel Locus on Chromosome 9p.21 Associated with Serum Lipid Traits at Genome-Wide Statistical Significance

Materials and Methods:

Chip genotyping and QC: Genomic DNA was extracted from whole blood from individuals of the OOA, and quantitated using picogreen. Genome-wide genotyping was performed with Affymetrix 500K and 6.0 chips at the University of Maryland Biopolymer Core Facility. The BRLMM algorithm was used for genotype cal ling. Samples with call rate <0.93, high level of Mendelian error, or gender mismatch were excluded. SN Ps with call rate <0.95, HWEpval < 1.0E-6, or MAF <0.01 were excluded. SN Ps on chromosomes X and Y, and the mitochondrial genome were also excluded.

WGS and QC: Library preparation and whole genome sequencing was performed by the Broad Institute of M IT and Harvard. The NH LBI Informatics Resource Core at the University of Michigan performed align ment, base calling, and sequence quality scoring of all TOPMed samples and delivered bcf files for all variants passing all quality filters with read depth at least 10, which was used for the analysis. Further QC applied to this files including removing all sites in LCR, or X chromosomes. Variants with > 5% missing rates, HWE p-value < 1.0E-09 and MAF <0.1% were also removed. Sample QC was performed to remove samples with > 5% missing rates, high level of Mendelian error (in some instances), or identical (MZ) twins (one of each pair).

WES and QC: Exome capturing and sequencing was performed at the Regeneron Genetics Center (RGC) as described below in more detail. Briefly, the captured libraries were sequenced on the lllumina HiSeq 2500 platform with v4 chemistry using paired-end 75 bp reads. Paired-end sequencing of the captu red bases was performed so that >85% of the bases were covered at 20x or greater, which is sufficient for calling heterozygous variants across most of the targeted bases. Read alignment and variant calling were performed using BWA-MEM and GATK as implemented in the RGC DNAseq analysis pipeline. Samples with call rate <0.90, high level of Mendelian errors, identical (MZ) twins (one of each pair), or gender mismatch were excluded. SN Ps with call rate <0.90, and monomorphic SNPs were also excluded. SNPs in chromosomes X and Y, and the mitochond rial genome were also excluded.

Association analysis: Fasting blood samples were collected and used for lipid analysis.

LDL was calculated using the Friedewald formula, and in some analyses with subjects on lipid lowering medication adjusted by dividing their LDL levels by 0.7. The genetic association analysis was performed using linear mixed models to account for familial correlation using the pedigree based kinship matrix and/or familial correction that estimates kinship from WES. The analysis was also adjusted for age, age squared, sex, cohort, and APOB R3527Q genotype. APOB R3527Q is enriched in the Amish and was previously identified to have a strong effect on LDL levels (58 mg/d l) (Shen et al., Arch Intern. Med., 2010, 170, 1850-1855), and, therefore, the effect of this variant in the LDL analysis was taken into consideration. Genome-wide corrected p-value of 5.0E-08 was used as the significance threshold.

Identifying the association between chromosome 9p region and LDL using Genome Wide Association Study (GWAS):

To identify causative variants in novel genes associated with cardiovascular risk factors, a genome-wide association analysis was performed using 1852 Old Order Amish su bjects genotyped with Affymetrix 500K and 6.0 chips. The basic characteristics of these participants are shown in Table 1.

Table 1: Basic characteristics of the study populat

LDL (mg/d l) 138.2 ± 42.1 140.4 ± 43.2 132.7 ± 44.9

Triglycerides (mg/d l) 80.4 ± 53.0 77.7 ± 48.8 72.1 ± 45.6

Cholesterol lowering med. (%) 2.4 3.2 1.9

Diabetes (%) 2.6 2.4 2.2

Almost all of WGS fine mapping samples (96%) were included in GWAS discovery samples.

Only 30% of WES samples were included in GWAS or WGS samples.

As shown in Figure 1, a strong novel association signal between LDL and a locus on chromosome 9p was discovered. The lead associated SNP was rs855453 (p=2.2E-08) and had a frequency of 15% in the Amish and 25% in the general population. The minor Ύ allele was associated with a 10 mg/dl lower LDL level. Thus, this GWAS SNP is common in both Amish and non-Amish and has large effect size, but has never been identified in any of the large GWAS meta analyses. These characteristics match those of previous studies (APOC3 and LIPE), and based on that it was concluded that this GWAS SNP was not the causal/functional variant in this region but rather in lin kage disequilibrium (LD) with another variant that is rare in the general population but common in the Amish popu lation. Furthermore, multiple studies based on 5 independent crosses of multiple strains also found the syntenic region of the rat genome, located on rat ch romosome 5, harbors a QTL for seru m cholesterol and triglyceride level (The Rat Genome Database(RGD). Scll2.26. 35. 44, 54 and Stl 28).

Confirmation using Whole Exome Sequencing (WES):

High quality QC'd WES for 4,565 Amish individuals, the basic characteristics of which are shown in Table 1, were subsequently used. The results of a mixed model exome wide analysis of LDL identified the B4GALT1 rs551564683 missense variant as the most significant association with a p-value of 3.3E-18 and effect size of 14.7 mg/dl lower LDL. The rs551564683 variant had a MAF of 6% in the Amish while extremely rare in the general population. The variant is in dbSNP without frequency or population information, does not exist in the ExAC database (60,000 samples), and on ly one copy was found in the WGS from 15,387 non-Amish in the NHLBI Trans-Omics for Precision Medicine (TOPMed) dataset. Moreover, in a collective data set of other population cohorts available to the investigators - totaling 125,401 individuals - only 79 heterozygotes and 5 homozygotes of this variant were found (showing over one thousand-fold enrichement in the Amish population). This missense variant is 500 Kb away from the GWAS variant with an r2 estimate of LD of 0.5. There are no perfectly correlated variants with rs551564683; in fact, the next most significant SNP is rsl49557496 with p-value E- 14. Thus, not on ly does the strength of the rs551564683 association confirm that the chromosome 9 GWAS locus is real, but rs551564683 has all the characteristics expected of the casual variant.

Fine-mapping the chromosome 9p region using Whole Genome sequencing(WGS):

WGS available on a smaller sample was used to fill in the gaps in the exome sequencing to provide further evidence that rs551564683 is causal. WGS data for 1083 OOA was generated as part of the TOPMed program. Basic characteristics of the WGS samples are shown in Table 1. WGS captu res all the SNPs and Indels (insertion/deletion) - both coding and non-coding - that might be correlated with the top variants in the region of interest. Since the top variants are ~6% frequency, it is very unlikely there would be insufficient sequence reads to cause the variant caller to miss a variant. However, there may be variants excluded during the QC procedure. By investigating the variants that did not pass QC, 2 additional variants were added in the analysis. The association analysis identified the missense SNP (N352S)

rs551564683 in the B4GALT1 gene as the most significantly associated variant with LDL in this region with p-value of 2.9E-06 and effect size of -16.4 mg/dl (see, Table 2).

Table 2: Mean (n) LDL levels (mg/d l) by rs551564683-containing genotype in the OOA

The TOPMed WGS data set provided 20 variants associated with LDL with p-values from 2.9E-06 to 2.5E-05, and high ly, but not perfectly, correlated with the top hit rs551564683 (r2 = 0.83- 0.94) (see, red in Figure 2). Conditional analysis adjusting for rs551564683 completely abolished the association signal of the 20 variants and did not reveal any other signal in this region, strongly implicating a single causal variant.

By careful ly investigating these 20 variants (see, red in Figu re 2) the variants were split into 2 groups: 7 red variants inside the shaded triangle and 13 u nshaded red variants. The 7 red variants in the shaded triangle were al most fully correlated with each other and had r2 of 0.83 with the top hit rs551564683. These 7 variants were safely excluded as causal/functional based on th ree reasons: 1) they are relatively common outside the OOA (maf > 1%), 2) they did not show any association with LDL in 3877 samples from Framingham Heart Study (FHS) within TOPMed, and 3) one of these 7 variants had an LDL association p-value of 6.3E-14 vs 3.3E-18 for the top hit rs551564683 in the WES data of 4,565 OOA subjects.

Another group of variants in the shaded rectangle in Figure 2 also had association p-values only of about 10E-6 and were ful ly correlated with each other and had r2 of 0.68 with the top hit rs551564683. This group was also excluded as causal/functional because they are common outside the OOA (maf ~ 4%), and did not show any association with LDL in 3877 samples from FHS within TOPMed.

The top hit rs551564683 and 13 unshaded red variants in Figure 2, which extend over

4 M b on the short arm of chromosome 9 from 31.5 M b to 35.5 Mb, remained. As described above, these 13 variants were almost fully correlated with each other and had r2 of 0.91-0.94 with the top hit rs551564683. Among these variants, the top hit rs551564683 was the only coding variant, and it was classified as damaging or deleterious by 5 out of 9 algorithms that predict the effect of a variant on protein function. The top hit rs551564683 and these 13 variants had maf of 6% in the OOA while being almost not existent in the general popu lation. Haplotype analysis:

Imperfect r2 between distinct loci is a resu lt of recombination events. A detailed analysis of the primary 14-SNP haplotypes was undertaken. Figure 3 shows 3 main haplotypes in this 4 Mb region. There are 115 subjects (1 homozygote, and 114 heterozygotes) with Haplotype A, which had identical genotypes at the 14 SNPs, provided no information as to which SNP might be causal. Six subjects had haplotype B, which contained heterozygote genotypes at rs551564683 plus 4 u pstream SNPs, and 7 subjects had haplotype C, which contained heterozygote genotypes at rs551564683 plus 9 downstream SNPs. The recombinant haplotypes B and C clustered in related subjects, providing evidence they are not artifacts of genotyping error. Table 3 shows the p-values of rs551564683 after adding individuals with haplotypes B and C into a single group compared to individuals with haplotype A.

Table 3: Haplotype analysis resu lts A B C B + C

Carriers 115 7 6 13

Total N 1063 1070 1069 1076 rs551564683 3.43E-05 1.40E-05 1.18E-05 4.82E-06

Adding each of haplotypes B and C individually improved the p-value and adding both of them improved the p-value even more. The improved p-values indicated that both haplotypes B and C carry the causal allele. The only SNP in common between B and C was rs551564683, which was considered to be the causal variant.

BAG ALU Congenital Disorder of Glycosylation supports rs551564683 functional role:

A phenotype-wide association study (PheWAS) was performed to test the association of rs551564683 with all traits in the Amish database. The strongest association after LDL (p= 3.3E-18) and total cholesterol (p= 3.0E-18) was found with aspartate transaminase (AST) (p= 3.0E-8) where the minor allele homozygotes had a two-fold increase in AST levels over wild- type homozygotes. Higher AST was previously reported in a Congenital Disorder of

Glycosylation (CGD) case caused by a frame shift insertion in the B4GALT1 that resulted in a truncated dysfunctional protein. Moreover, a strong association was observed with fibrinogen levels (p= 5.0E-4) where the minor homozygote level was about 20% lower than the wild-type, consistent with a blood clotting defect in the same CDG patient. Moreover, in a small experiment, a 50% increase (p=0.02) in creatine kinase serum levels was found in 13 minor allele homozygotes compared to 13 wild-type homozygotes. This consistency in the phenotype associated with the missense SNP and those caused by a truncating insertion in B4GALT1 further strengthen the evidence that B4GALT1 rs551564683 SNP is the causal/functional gene and variant in this region.

The association between lipid subfractions and rs551564683 was examined in a subset of 759 Amish individuals, and an association with lower levels of almost all subfractions with significant or non significant p-values was found, as shown in Table 4.

Coronary calcification score, aortic calcification score, and pericardial fat showed trend of association with lower levels, but with no significant p-values.

PheWAS also found rs551564683 to be associated with higher creatinine and lower eGFR, as well as higher hematocrit and lower basophils.

Table 4: Association between rs551564683 and lipid subfractions in 759 OOA individuals TRAIT effect size p-value

Choi -1.66E+01 3.79E-04

HDL -4.16E+00 8.72E-03

HDL2 -1.51E+00 4.53E-02

HDL2a -9.26E-01 9.93E-02

HDL2b -1.94E-01 2.96E-01

HDL2c -2.64E-01 2.14E-01

HDL3 -2.64E+00 3.98E-03

HDL3a -1.51E+00 2.00E-02

HDL3b -1.68E-01 4.16E-01

HDL3c -5.93E-01 1.47E-02

HDL3d -4.44E-01 2.48E-02

IDL -7.31E-01 4.92E-01

IDL1 -1.19E-02 9.73E-01

IDL2 -7.65E-01 3.37E-01

LDL -1.23E+01 2.37E-03

LDL1 -2.22E+00 7.20E-02

LDL2 -5.64E+00 3.99E-02

LDL3 -3.81E+00 1.32E-01

LDL4 -3.96E-02 9.65E-01

LDLReal -1.12E+01 9.53E-04

Lpa -2.15E-01 6.34E-01

Lpal -2.91E-01 3.00E-01

Lpa2 4.67E-02 8.27E-01

Lpa3 2.31E-01 5.04E-01

Lpa4 -2.91E-02 9.19E-01

Lpa5 -2.48E-01 3.11E-01

RemnantLipoprotien -7.23E-01 5.97E-01

TCHDLRatio -3.29E-02 7.68E-01

TotalNonH DL -1.24E+01 3.97E-03

TotalVLDL -1.03E-01 8.70E-01 Triglyceride 2.19E+00 6.46E-01

VLDLlPlus2 -4.10E-02 8.86E-01

VLDL3 6.15E-03 9.86E-01

VLDL3a 2.28E-02 8.97E-01

VLDL3b -6.57E-02 7.30E-01

Example 2: Sample Preparation and Sequencing

Genomic DNA sample concentrations were obtained from the Amish subjects, and then transferred to an in-house facility and stored at -80°C (LiCONiC TubeStore) until sequence analysis. Sample quantity was determined by fluorescence (Life Technologies) and quality was assessed by running 100 ng of sample on a 2% pre-cast agarose gel (Life Technologies).

DNA samples were normalized and a sample of each was sheared to an average fragment length of 150 base pairs using focused acoustic energy (Covaris LE220). The sheared genomic DNA was prepared for exome capture with a custom reagent kit from Kapa Biosystems using a fully-automated approach developed in house. A unique 6 base pair barcode was added to each DNA fragment during library preparation to facilitate multiplexed exome capture and sequencing. Equal amounts of sample were pooled prior to exome capture on the xGen design available from IDT with some modifications. The multiplexed samples were sequenced using 75 bp paired-end sequencing on an lllumina v4 HiSeq 2500.

Raw sequence data generated on the lllumina Hiseq 2500 platform was uploaded to the high-performance computing resource in DNAnexus (DNAnexus lnc Mountain View, CA), and automated workflows processed the raw .bcl files into annotated variant calls. Raw reads were assigned to appropriate samples for analysis based on sample specific barcodes using CASAVA software (lllumina Inc., San Diego, CA).

The sample specific reads were then aligned to the reference sequence using BWA- mem (Li and Durbin, Bioinformatics, 2009, 25, 1754-1760). This produced a binary alignment file (BAM) for each sample with all of a particular sample's reads and the genomic coordinates to which each read mapped. Once aligned, a sample's reads were evaluated to identify and flag duplicate reads with the Picard MarkDuplicates tool (picard.sourceforge.net), producing an alignment file with each duplicate read marked (duplicatesMarked.BAM).

The Genome Analysis Toolkit (GATK) (Van der Auwera, Cur. Protocols in Bioinformatics, 2013, 11, 11-33; McKenna, Genome Res., 2010, 20, 1297-1303) was then used to conduct local realignment of the aligned and duplicate-marked reads of each sample. The GATK

HaplotypeCaller was then used to process the realigned, duplicate-marked reads and to identify all exonic positions at which the sample varies from the genome reference, including single nucleotide variations and INDELs, and the zygosity of the variant within a sample at any position where that particular sample differs from the reference.

Associated metrics, including read counts assigned to both reference and alternate allele, genotype quality representing the confidence of the genotype call, and the overall quality of the variant cal l at that position were output at every variant site. Variant Quality Score Recalibration (VQSR) from GATK was then employed to evaluate the overal l quality score of a sample's variants using training datasets to assess and recalculate this score to increase specificity. Metric statistics were captured for each sample to evaluate captu re performance, alignment performance, and variant calling. Following completion of cohort sequencing, a project-level VCF was generated by joint-genotyping using GATK to produce genotype and the associated metric information for all samples at any site where any sample in the cohort carries a variant from the reference genome. It was this project-level VCF that was used for downstream statistical analyses. In addition to VQSR, variants were annotated with the Quality By Depth (QD) metric using GATK, and bi-allelic variants with QD > 2.0, missingness rates < 1%, and with Hardy-Wein berg equilibriu m p-values > 1.0 x 10 "6 were retained for further analysis.

Prior to downstream sequence data analysis, samples with reported gender that was discordant with genetical ly determined gender, samples with high rates of heterozygosity, low sequence coverage (defined as 20X coverage of less than 75% of targeted bases), or unusually high degree of cryptic relatedness, and genetically identified sample duplicates were excluded.

Sequence variants were annotated using an annotation pipeline that uses ANNOVAR (Wang et al., Nuc. Acids Res., 2010, 38, el64) and other customized algorithms for annotation and analysis. Variants were classified according to their potential functional effects, and su bsequently filtered by their observed frequencies in pu blicly available population control databases, and databases in order to filter out common polymorphisms and high frequency, likely benign variants. Algorithms for bioinformatic prediction of functional effects of variants along with conservation scores based on multiple species alignments were incorporated as part of the annotation process of variants and used to inform on the potential deleteriousness of identified candidate variants. Example 3: B4GALT1 rs551564683 N352S Frequency is Enriched in the Amish

Th rough exome sequencing and association analysis in ~4700 Amish subjects, rs551564683 on chromosome 9 was found to be highly associated with total cholesterol levels (p=1.3E-10)(see, Figu re 4). RS551564683 encodes a missense va riant in which serine is changed to asparagine at position 352 in the B4GALT1 protein. The next most highly LDL-associated variant in the region was rsl49557496 with a p-value of on ly 10 ~5 suggesting the N352S variant as being the most likely causative variant. Referring specifically to Figu re 4, in exome sequence data, the variant in highest LD with Asn352Ser B4GALT1 was rsl49557496 in HRCT1, 2.8Mb distant, R 2 0.78, P-value with LDL in Amish of 10 ~5 . Whole genome sequence data in the Amish (TOPM ED) failed to identify a variant more highly associated with LDL-C in this region.

Fu rther analysis revealed that the B4GALT1 N352S variant frequency was over one thousand-fold enriched in the Amish popu lation (see, Figu re 5). The data showed that in the cohort of 4725 Amish, 548 heterozygous carriers for the rs551564683-containing allele were identified, and 13 carriers were homozygous for the allele (see, Figu re 5). In comparison, a collective data set of other popu lation cohorts available to the investigators - totaling 125,401 individuals - was analyzed, and only 79 heterozygotes and 5 homozygotes were identified in this col lective data set. The allele frequency in the Amish cohort was estimated to be about 0.06, compared to about 0.0025 in the collective date set (see, Figure 5). It is believed that genetic drift may accou nt for the higher frequency of this allele in the Amish.

Example 4: B4GALT1 N352S Associates with Decreased Serum Lipids and Increased AST

Association of the B4GALT1 N352S variation with various phenotypes, including serum lipids, coronary artery disease (CAD), and liver traits was assessed. The associations were carried out based on the Amish cohort, with individuals who were homozygous for the reference al lele, who were heterozygous for the alternate allele, and who were homozygous for the alternate al lele. The genotypic means for the lipid and liver traits and risk of CAD were determined, with the effect measures adjusted by removing the effects of subject age and age squared, subject sex, and study (since the phenotype data were col lected from several studies over a period of years). In the case of pericardial fat, the genotypic means were fu rther adjusted for BM I. The effect sizes of the variation on the measured phenotypes were measured at the 95% confidence interval. The traits and the results are presented in Figure 6, Figu re 7, and Figure 8. As shown in Figure 6, the presence of the N352S variation general ly correlated with decreased seru m lipids, particularly for total cholesterol (p-value 1.3 x 10 ~10 ) and LDL (p-value 1.8 x 10 ~9 ) levels, which achieved strong statistical significance. Individuals heterozygous and homozygous for this alteration showed 17.3 mg/dL and 31.2 mg/d L reduction, respectively, for LDL levels. There was a trend between the variant and decreased coronary artery calcification. I n addition, the presence of this variation correlated with increased aspartate aminotransferase (AST) levels (p-value 6.0 x 10 s ). The recessive model p-value for the AST levels was determined to be 9 x 10 ~23 . The variation did not appear to correlate with increased alanine

aminotransferase (ALT) levels, al kaline phosphatase levels, or liver fat levels. The cholesterol, LDL, and AST levels are shown graphically in Figure 7. In Figure 7, the levels of cholesterol, LDL, and AST are shown for subjects who were homozygous (TT) for the reference al lele, heterozygous (CT) for the alternate al lele, and homozygous (CC) for the alternate allele. Values shown are unadjusted. The values were recalcu lated based on adjustments for subject age and age squared, sex, and study (tabulated in the bottom of the Figure 7).

The effect of the N352S alteration on lipid subfractions was also assessed. These results are shown in Figure 8. The associations were carried out based on the Amish cohort, with individuals who were homozygous for the reference allele, who were heterozygous for the alternate allele, and who were homozygous for the alternate allele. The results in Figure 8 show that the B4GALT1 N352S alteration associates with decreases in all lipid subfractions tested.

Example 5: B4GALT1 N352S Associates with Decreased Fibrinogen Levels

Association of the B4GALT1 N352S variation with fibrinogen levels was also assessed in a subset of samples. As for the serum lipids, CAD, and liver traits assessed in Example 4, the association with fibrinogen levels was carried out based on the Amish cohort, with individuals who were homozygous for the alternate allele, who were heterozygous for the reference allele, and who were homozygous for the alternate allele. The genotypic means for fibrinogen levels were determined in two subgroups of individuals - individuals not on a clopidogrel regimen (d rug naive) and individuals on a clopidogrel regimen (on-clopidogrel) and, as part of the analysis, the mean levels in each group were adjusted by removing the effects of subject age and age squared, subject sex, and study. The effect sizes of the variation on fibrinogen levels was measu red at the 95% confidence interval. As shown in Figure 9, the presence of the N352S variation was associated with decreased fibrinogen levels in each of the d rug naive (p-value 1.15 x 10 ~3 ) and on-clopidogrel (p-value 2.74 x 10 ~5 ) groups. The drug naive subgroup showed a decrease of approximately 24 mg/dL of fibrinogen (see, Figure 9). The on-clopidogrel su bgroup showed a decrease of approximately 32.5 mg/dL of fibrinogen (see, Figure 9). Example 6: Additional B4GALT1 N352S Associations

Within the Amish cohort, assessment of associations between the B4GALT1 N352S variation and other traits, including creatinine levels, estimated glomerular filtration rate (eGFR), basophil levels, and hematocrit percentage was also carried out. As shown in Figure 9, the variant weakly associated with a smal l increase in creatinine levels, but did not significantly associate with eGFR, basophil levels, or the hematocrit percentage.

Example 7: b4galtl Ortholog Knockdown in Zebrafish

In parallel to the evidence in cell-based assays, a zebrafish model was pursued to investigate the effect of B4GALT1 p.Asn352Ser on LDL.

Zebrafish husbandry, morpholino injection and validation

Wild-type (Tubingen) zebrafish stocks were used to generate embryos for morpholino injection. Adult fish were maintained and bred at 27-29°C and embryos were raised at 28.5°C. All animals were housed and maintained in accordance with protocols approved by the University of Maryland Institutional Animal Care and Use Committee. Morpholino antisense oligonucleotides (MOs) were obtained (Gene Tools, Inc.) based on previously pu blished MOs targeted against b4galtl (Machingo et al., Dev. Biol., 2006, 297, 471-482). MOs were injected at the 1-2 cel l stage and validated by qRT-PCR quantification of wild type b4galtl transcript. Off- target toxicity was assessed by qRT-PCR quantification of the deltall3 isoform of p53 (Robu et al., PLoS Genet., 2007, 3, e78). For mRNA rescue experiments, human B4GALT1 mRNA was transcribed from a pCS2 + plasmid vector containing the open reading frame (ORF) of the wild- type or N352S variant of the gene. mRNA was mixed with MO at varying concentrations and co- injected into 1-2 cell stage embryos. For each injection experiment, a total of 200-400 embryos were injected and each experiment was repeated a minimu m of three times.

LDL quantification in Zebrafish

One hund red 5 days post fertilization (dpf) larvae were homogenized per experiment in 400 μΙ of ice-cold 10 μΜ butylated hydroxytoluene. The homogenate was filtered through a 0.45 μιτι Dura PVDF membrane filter (Millipore) in preparation for lipid extraction. Using the HDL and LDL/VLDL Cholesterol Assay Kit (Cell Biolabs, Inc.), the homogenate was processed as per manufacturer's protocol. After precipitation and dilution, samples were analyzed by fluorimetric analysis using a SpectraMax Gemini EM plate reader and SoftMax Pro microplate data acquisition and analysis software (Molecular Devices).

A genomic knockout of the zebrafish ortholog (b4galtl) was generated using

CRISPR/Cas9-mediated targeting of exon 2. Consistent with mouse reports of embryonic lethality in knockout animals, injected FO animals were not viable to adulthood and consistently died at juvenile stages. To circumvent the lack of viability, a knockdown approach using a previously reported splice-blocking antisense morpholino oligonucleotide (MO) injected into embryos (Machingo et al., Dev. Biol., 2006, 297, 471-482) was employed. The efficacy of the

MO was validated at two different concentrations by qRT-PCR (see, Figu re 10) and ruled out the possibility of off-target toxicity (see, Figu re 11). To quantify changes in LDL levels, 8 ng of MO was injected and injected embryos were cu ltured until 5 days post fertilization (dpf), at which stage larvae were assayed for total LDL as per previously published protocols (O'Hare et al., J. Lipid Res., 2014, 55, 2242-2253). A significant decrease in LDL in MO-injected larvae was observed compared to control larvae consistent with a role for b4galtl in LDL homeostasis (see, Figure 12). This resu lt was confirmed using a second splice-blocking MO targeting exon 2 which produced a reduction in LDL concentration upon injection of 2 ng of MO (data not shown). To validate the specificity of these observations and to test the functionality of human B4GALT1 in zebrafish, full length capped mRNA encoding the human gene was generated by in vitro transcription from a pCS2 + plasmid carrying the open reading frame (ORF) of the hu man gene. To assess the capacity of the wild type hu man mRNA to rescue the knockdown phenotype, it was co-injected with b4galtl MO into embryos and LDL in unfed larvae was assessed. Th ree concentrations of mRNA (10 pg, 25 pg, and 50 pg) were co-injected with 8 ng of MO. Co- injection of 50 pg of B4GALT1 mRNA resulted in LDL levels that were statistically

indistinguishable from those in larvae injected only with a control MO (p-value = 0.14), suggesting that the human mRNA could rescue the effects of knockdown of the zebrafish gene (see, Figu re 12; larvae were treated with MO against b4galtl, MO co-injected with WT human B4GALT1 mRNA (WT rescue), or MO co-injected with B4GALT1 mRNA encoding the Asn352Ser mutation (N352S rescue)).

These data support the use of this system for fu nctional interpretation of variants in human B4GALT1, and suggest that hu man wild type B4GALT1 mRNA is functional in zebrafish with respect to regu lation of systemic LDL levels. The impact of p.Asn352Ser on B4GALT1 fu nction was fu rther investigated. Using site-directed mutagenesis (O'Hare et al., Hepatology, 2017, 65, 1526-1542), a T to C change was introduced in the coding sequence of the human B4GALT1 ORF construct to generate ful l length mRNA. Co-injection of the B4GALT1 p.352Ser mRNA with MO resulted in a reduced capacity for rescue of the LDL phenotype. The resulting LDL concentration was 15% lower than that resulting from co-injection of wild type mRNA with MO, a statistically significant effect (39.9 μΜ compared to 46.6 μΜ, p-value = 0.02). This level of LDL was also statistically greater, however, than b4galtl MO alone (p-value = 0.01) (see, Figure 12), suggesting a partial defect in function introduced by the missense variant.

Example 8: Targeted Genotyping

Targeted SNP genotyping using the QuantStudio system (Thermo Fisher Scientific) was performed for 3,236 OOA subjects. Based on the LD structure of the 14 SNPs, seven SNPs were selected for genotyping, and the association evidence for rs551564683 was 4.1E-13, while it was about E-10 for the other SNPs (Figu re 14), confirming that rs551564683 is the causal variant in this region.

Example 9: B4GALT1 N352S Causes Reduced Enzymatic Activity in Absence of Change in Protein Stability or Cellular Localization

Investigations of the properties of B4GALT1 were carried out in COS-7 and Huh7 cells overexpressing human epitope-tagged Flag-B4GALT1 352Asn or epitope-tagged Flag-B4GALT1 352Ser (Figures 15 and 16). Referring to Figure 15, confocal microscopy images of Flag-352Asn or Flag-352Ser using B4GALT1 or Flag antibodies indicate an identical pattern of staining (scale bars = 10 μιτι). Referring to Figu re 16, subcellular localization by indirect immunofluorescence of Hu h7 cells showed a co-localization of endogenously expressed B4GALT1 and TGN56, a Golgi apparatus marker. A similar co-localization pattern was observed whether human epitope- tagged Flag-B4GALT1 352Asn or epitope-tagged Flag-B4GALT1 352Ser were over expressed (Figure 16). Referring to Figure 16, endogenous B4GALT1, Flag-352Asn, and Flag-352ser overexpressed in hu man hepatoma Huh7 cells co-localized with the Trans Golgi Network marker TG N46. Shown are confocal microscopy images of endogenous B4GALT1, Flag-352Asn, and Flag-352Se sub-cellular localization in relation with the trans Golgi Network marker TGN46, with scale bars = 10 μιτι. COS-7 cells were observed to have a low content of endogenous B4GALT1 (Figure 17, Panel B), so this cell line was used to assess the effect of the missense mutation on protein stability and/or steady-state levels, and galactosyltransferase activity. The results showed that the missense mutation does not affect protein stability and/or steady-state levels (by Western blot) (Figu re 17). Referring to Figure 17, the effect of 352Ser on protein stability and/or steady- state levels is shown. Panel A shows COS7 cells expressing either 352Asn or 352Ser Flag tag proteins fusion with free EGFP were expressed in COS7 cells. Cell lysates were analyzed by Western blot for B4GALT1, Bactin, and EGFP using commercial antibodies. One of four similar experiments is shown. Panel B shows mRNA expression levels for B4GALT1 gene determined by RT-q PCR analysis. Data represent means ± S.E. of 4 experiments.

To determine the catalytic activity of 352Ser, lysates of nontransfected COS-7 cells and COS-7 cel ls transfected with the expression vector alone or containing the cDNA insert of wild- type or mutant B4GALT1 were analyzed for galactosyltransferase activity. When normalized relative to the expression of FLAG-tagged protein (immunoblotting experiment in Figu re 18, Panels A and B), the enzymatic activity of the 352Ser was approximately 50% decreased in comparison to 352Asn (Figure 18, Panel C). Referring to Figure 18, the effect of 352Ser mutation on activity is shown. Panels A and B show COS7 cel ls expressing either 352Asn or 352Ser Flag tag proteins fusion expressed in COS7 cel ls. Cell lysates were incubated with rabbit anti-Flag IgG or rabbit pre-immune control IgG. Immunoprecipitates were analyzed by Western blot for B4GALT1 or Flag using commercial antibodies. One of four similar experiments is shown. Panel C shows B4GALT1 activity in the immunoprecipitates measu red with a commercial kit (R&D). Each data point represents the average of the calcu lated ratio of B4GALT1 specific activity with the amount of 352Asn or 352Ser protein recovered in the immnunoprecipitates. Signals from Western blots ECL were quantified by densitometry using I mageJ software. Data represent means ± S.E. of 4 experiments (*, p < 0.05, 352Asn vs 352Ser).

These experiments show that this missense mutation has no effect on the level of protein expression and its localization, but it leads to lower enzymatic activity.

Example 10: Carbohydrate Deficient Transferrin for Congenital Disorders of Glycosylation (CDG) Test

The CDG test was performed using 0.1 ml serum samples from 24 subjects from the genotype grou ps (8 minor homozygotes, 8 heterozygotes and 8 major homozygotes). Each minor homozygote was matched with a heterozygote and a major homozygote that are either sibs or closely related same sex individual based on the kinship coefficient. The age, and the carrier status were also matched for major lipid-altering gene al leles in APOB R3527Q .

Water diluted samples were dou ble washed using an immu noaffinity column.

Glycosylation profiling of eluted proteins was performed using a mass spectrometer operated with 2 scan ranges specific for APOCIII and transferrin. Glycoform ratios of each protein were used to determine glycosylation deficiency. The CDG test was performed at the Mayo medical laboratory of the Mayo Clinic.

The results showed that all 24 samples had normal levels of the mono- oligosaccharide/di-oligosaccharide transferrin ratio, the a-oligosaccharide/di-oligosaccharide transferrin ratio, the ApoCII I-l/ApoCIII-2 ratio, and the ApoCIII-O/ApoCIII-2 ratio. However, while all wild type samples had normal levels of the tri-sialo/di-oligosaccharide transferrin ratio, the level in all heterozygotes were in the intermediate range and the level in all minor homozygotes was abnormal and significantly higher than matched wild type and heterzygotes (p=7.6 E-10) (Figu re 19). These results show that this missense mutation is associated with defective glycosylation as a result of the decreased enzymatic activity of B4GALT1.

Example 11: Global N-Linked Glycan Analysis of Plasma Glycoproteins

To determine if the desialylation and hypogalactsylation are affecting only transferrin or extending to other glycoproteins, global N-Glycan analysis was performed by the analytical chemistry group at Regneron. Lectin enriched glycoproteins were extracted from serum of 5 pairs of major and minor homozygotes in duplicate, and Global N-linked glycan separation was performed for labeled glycans using hydrophilic interaction ch romatography and detected by fluorescence and analyzed by mass spectrometry (HILIC -FLR-MS) (Figure 20 and Table 5).

Referring to Figure 20, a representative HILIC-FLR-MS spectrum of N-G lycan analysis of Glycoprotein from a matched pair of minor (SS) and major (NN) homozygotes of B4GALT1 N352S is shown. The results showed that the minor homozygotes have significantly higher levels of hypogalactosylated and less sialylated glycans including biantennary glycans with only one galactose and one sialic acid (p=3.1 E-5), asialylated biantennary glycans with one galactose (p=0.001), and truncated biantennary glycans missing both galactoses and sialic acids(p=0.005). On the other hand, the minor homozygotes have significantly lower levels (p=0.001) of biantennary glycans with two galactose and two sialic acid (Table 5). There was a significantly lower overall galactosylation (p=9.2 E-5) and sialylation (p=0.001) among minor homozygotes, while there was no difference in fucosylation level (p=0.5). Both CDT and global N-glycan analysis of seru m show significantly increased levels of carbohyd rate-deficient glycoproteins in minor homozygotes, indicating that B4GALT1N352S is leading to defective protein

glycosylation.

Table 5: Mean (+sd) of % peak area of significantly different glycans

between minor and major homozygotes

The disclosu re is not limited to the embodiments described and exemplified above, but is capable of variation and modification within the scope of the appended claims. The disclosu re is also not to be limited in any manner by the use of any headers recited herein.