Bacillus weihenstephanensis and use thereof

Field of Art

The present invention relates to a new strain of Bacillus weihenstephanensis and uses thereof.

Background Art

The growth and spread of pathogens that have acquired new mechanisms of antibiotic resistance are a global problem that threatens human and animal health and life. The World Health Organization (WHO) emphasizes the urgency of the need for new agents for therapeutic purposes and for new strategies for dealing with resistant pathogens. This issue also affects the food industry. One of the main modes of transmission of resistant strains to humans is from livestock and their products. The livestock is commonly treated with antibiotics belonging to the same chemical groups as antibiotics used in human medicine, thus acting as a source of resistant strains.

From the point of view of food quality and safety, the new eating habits of consumers are a global problem. They are increasingly opting for minimally processed foods. The food industry thus faces the challenge of providing foods that contain a minimum of synthetic chemicals, minimum of salt and/or sugar, are nutritionally beneficial, and at the same time stable and microbially safe for as long as possible. To ensure the quality and safety of food products, it is thus necessary to look for effective alternatives with antimicrobial properties, such as bacteriocins (O’Connor, P. M., Kuniyoshi, T. M., Oliveira, R. P., Hill, C., Ross, R. P., Cotter, P. D. 2020. Antimicrobials for food and feed; a bacteriocin perspective. Current Opinion in Biotechnology. 61, pp. 160-167. doi: 10.1016/j.copbio.2019.12.023). Last but not least, there is a growing demand for probiotic bacteria for human use with the ability to inhibit intestinal pathogens such as Clostridium perfringens, Cl. difficile and others. After the recently introduced ban on the feeding of livestock with antibiotic growth promoters, there is an increased attention devoted to the use of probiotics in livestock to improve health and thus their performance (Mingmongkolchai, S., Panbangred, W. 2018. Bacillus probiotics: an alternative to antibiotics for livestock production. Journal of Applied Microbiology. 124 (6). 1334-1346. doi: 10.1111/jam. 13690).

Disclosure of the Invention

The present invention provides a microbial strain which produces an effective antimicrobial protein substance (BLIS - bacteriocin-like inhibitory substance). The antimicrobial protein is highly stable in a broad temperature range (at least -80 °C to 70 °C, and up to 100 °C for short-term exposure) and in a broad pH range (pH 2-9), resistant against cleavage by digestive enzymes pepsin, trypsin, a- chymotrypsin, as well as resistant against N-acetylmuramide glycanhydrolase, lysozyme. It is cleaved by proteinase K after 24h treatment. Furthermore, the antimicrobial protein substance is highly specific - it exerts antimicrobial activity against pathogenic bacteria having lecitinase activity, in particular against bacteria of Bacillus cereus group, Clostridium perfringens and Listeria monocytogenes . The probiotic bacteria such as genera Bifidobacterium, Lactobacillus, Lactococcus, and the commensals naturally occurring in the gastrointestinal tract, such as Enterococcus, Enterobacter, E. coli etc., are resistant against the antimicrobial protein substance.

The herein described properties make the novel microbial strain an ideal agent addressing the current demand for probiotic bacteria which would be useful in food-producing and food-processing technologies as well as in agriculture.

The present invention thus provides a strain of bacterium Bacillus weihenstephanensis CCM 9146. The strain produces an antimicrobial protein effective against pathogenic bacteria having lecitinase activity. The strain is deposited in CCM (Czech Collection of Microorganisms, Kamenice 5, building E25, Bmo, Czech Republic; date of deposit: 05.03.2021).

The novel strain was isolated from water of the pond Kanclif in South Bohemia region, and characterized by MALDI-TOF MS, sequencing of the 16S rRNA gene, whole genom sequencing, and metabolic profiling, which confirmed the taxonomic classification as Bacillus weihenstephanensis . The novel strain has a low pathogenic potential.

The novel strain CCM 9146 can preferably be cultivated under anaerobic conditions, more preferably in Trypton soya broth at temperatures around 20-38 °C and pH 7-7.5, with maximal antimicrobial protein production at temperature of 30 °C. However, the strain may also be cultivated under aerobic conditions.

The proteinaceous nature of the inhibitory substance produced by the Bacillus weihenstephanensis CCM 9146 strain was revealed by its sensitivity to proteinase K, whereas other proteolytic enzymes and lysozyme did not affect the activity. The activity was also stable after the treatment of crude supernatant at pH values of 2.0 to 9.0 and temperatures 65 °C for 10, 30 and 60 min, 72 °C for 10 and 30 min, and 85 °C for 10 min. Partial inactivation was then observed after exposure to 72 °C for 60 min, 85 °C for 30 min and 100 °C for 10 min. An increase in the activity by 15% was revealed when Triton X-100 was added but addition of Tween 80 reduced activity by 15%. A further aspect of the present invention is the culture supernatant of the Bacillus weihenstephanensis CCM 9146 obtained by the following steps:

- cultivating Bacillus weihenstephanensis CCM 9146 at a temperature within the range 20-38 °C, preferably 30 °C, at pH 7.3 ± 0.2, anaerobically;

- harvesting the supernatant by centrifugation and/or sterile fdtration;

- optionally freezing or lyophilizing the supernatant for storage.

The cultivation step may be carried out preferably for at least 13 hours, more preferably for at least 20 hours, even more preferably 40 to 56 hours, yet more preferably about 48 hours.

The step of harvesting the supernatant is preferably carried out by centrifugation and two times sterile filtration (e.g., using bacteriological! filters).

Yet further aspect of the invention is use of Bacillus weihenstephanensis CCM 9146 and/or its culture supernatant as a preservative in food-processing industry. In particular, such preservative prevents damage to food caused by bacteria having lecitinase activity, more specifically damage to food caused by Bacillus cereus, Clostridium perfringens and Listeria monocytogenes .

A further aspect of the invention is Bacillus weihenstephanensis CCM 9146 for use as a probiotic strain and/or its culture supernatant as a postbiotic in modulation of gastrointestinal tract function. For this use, the Bacillus weihenstephanensis CCM 9146 strain and/or its culture supernatant may be formulated as a component of a medicament, a dietary supplement or a food supplement, in combination with at least one pharmaceutically acceptable excipient.

A further aspect of the invention is Bacillus weihenstephanensis CCM 9146 and/or its culture supernatant for use for preventing or treating infections, in particular infections caused by bacteria having lecitinase activity, more specifically infections caused by Bacillus cereus group, Clostridium perfringens and Listeria monocytogenes . For this use, the Bacillus weihenstephanensis CCM 9146 strain and/or its culture supernatant may be formulated as a component of a medicament, a dietary supplement or a food supplement, in combination with at least one pharmaceutically acceptable excipient.

In some embodiments, it is advantageous when the Bacillus weihenstephanensis CCM 9146 strain and/or its culture supernatant is frozen or lyophilized. Brief Description of Drawings

Figure 1: Growth and dynamics of antimicrobial peptide production of B. weihenstephanensis CCM 9146. The line represents a growth curve; the columns represent inhibitory activity against B. cereus CCM 2010.

Figure 2: Effect of antimicrobial substance on the growth of the indicator strain B. cereus CCM 2010. Culture with 100, 50, 25 % and without (x) supernatant from B. weihenstephanensis CCM 9146; supernatant was applied after 16 hours of indicator strain growth.

Examples

Example 1: Isolation of Bacillus weihenstephanensis CCM 9146

The novel strain was isolated from from water of the pond Kanclif in South Bohemia region. Water samples were collected in sterile vessels and heldat 4 °C until analysed. Sample analyses were performed within 5 h of collection. Bacterium was isolated after the cultivation of water samples on yeast extract- trypton agar (YT, Oxoid, Basingstoke, UK) supplemented with 1 gL of glucose. Cultivation was performed under anaerobic condition in anaerobic jars (Anaerobic Plus System, Oxoid, Basingstoke, UK) in the presence of an AnaeroGen oxygen scavenging system (Thermo Fisher Scientific, Waltham, USA) at 24 °C for 5 days.

Example 2: Characterization of Bacillus weihenstephanensis CCM 9146

MALDI-TOF MS identification:

Initial identification of the production strain was performed by MALDI-TOF mass spectrometry, based on the analysis of ribosomal proteins.

A culture grown in Typtone soya broth (Oxoid) at 30 °C for 24 hours was used for analysis. The purity was verified using a phase contrast microscope (Nikon Instruments Europe B.V.). One milliliter of the culture was transferred to a 1.5 ml microcentrifiige tube and centrifuged at 14,500 rpm for 3 minutes. Subsequently, the supernatant was removed and the pellet was resuspended in 70% ethanol. This step was repeated twice to ensure sufficient washing of the culture medium.

The pellet was allowed to dry for several minutes at room temperature. Then 15 pl of 70% formic acid was added, mixed thoroughly and 15 pl of 100% acetonitrile was added. The sample was centrifuged at maximum speed for 2 minutes. One microliter of the supernatant was applied to an MTP 384 MALDI plate (Bruker Daltonik GmbH) and immediately after drying covered with 1 pl of HCCA matrix (saturated solution of a-cyano-4-hydroxycinnamic acid in 50% acetonitrile with 2.5% trifluoroacetic acid, Bruker Daltonik GmbH). The spectra were measured automatically using FlexControl software. Strain identification and analysis was performed based on mass spectra comparisons in BioTyper software version 2.0 (Bruker Daltonik GmbH). The measurement was performed in two replicates.

16S rRNA gene sequencing:

B. weihenstephanensis CCM 9146 was further identified by sequencing the 16S rDNA gene. This method is based on the determination of a highly conserved nucleotide sequence of a small ribosomal subunit that serves as a biomarker in the identification of organisms.

Preparation of cell lysate for PCR: One milliliter of pure freshly grown culture was transferred to a 1.5 ml microcentrifiige tube and centrifuged at 14,500 rpm for 2 minutes. The supernatant was slurried and the pellet resuspended in 100 pl of PrepMan® Ultra Sample Preparation Reagent (Applied Biosystems) followed by incubation in a thermoblock at 100 °C for 10 minutes. After cooling, the sample was centrifuged again (14,500 rpm for 2 minutes) and 60 pl of the supernatant was collected in a new microcentrifuge tube. The cell lysate thus prepared was stored at -18 °C and used for polymerase chain reaction (PCR).

Amplification, visualization and purification: Primers fDl (5' AGA GTT TGA TCC TGG CTC AG 3 ', SEQ ID NO. 1) and rP2 (5' ACG GCT ACC TTG TTA CGA CTT 3 ', SEQ ID NO. 2) designed in the study by Weisburg WG, Bams SM, Pelletier DA et al. J Biotechnoll991,113.691-1Q3). The total volume of the reaction mixture was 25 pl and contained: 12.5 pl DreamTaq Green PCR Master Mix (Thermo Fisher Scientific), 8.5 pl PCR water (Thermo Fisher Scientific), 1 pl from each primer (10 pM) and 2 pl template DNA. The amplification was performed in an automatic thermocycler T100 (BioRad). PCR process conditions were: initial denaturation at 92 °C for 5 minutes, followed by 35 cycles of denaturation (92 °C, 1 min), hybridization (52.5 °C, 90 s) and elongation (72 °C, 2 min), and final elongation at 72 °C for 5 minutes.

The formation of a PCR product of the desired length was verified by gel electrophoresis in a 1% agarose gel with the composition: 1 g agarose and 100 ml 0.75 x TAE buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, Fermentas). To visualize the PCR product, 5 pl of GelRedTM dye (Biotium) was added to the gel. The separation was performed at a constant voltage of 130 V for 60 min. After this time, DNA fragments were visualized using a UV transilluminator (Bio-Rad) and digital images were taken. Mass Ruler DNA Ladder Mix (Thermo Fisher Scientific) was used as a standard to determine the size of the PCR product. The PCR product was purified using a commercial E.Z.N.A. Cycle Pure kit (OMEGA bio-tek) according to the manufacturer's instructions.

Sequencing and evaluation of sequences: 5 pl of purified PCR product was mixed with 5 pl of one of the primers (5 pM). The sample was sequenced twice, once with fDl and once with rP2 primer. The sequencing was performed by the Sanger method by the GATC service of Eurofins Genomics. The obtained data were processed using Chromas Lite and BioEdit programs. Finally, the sequence was compared with sequences published in the GenBank (National Center for Biotechnology Information, NCBI) and EzBioCloud databases.

Final strain identification:

The B. weihenstephanensis strain CCM 9146 was classified into a subgroup of B. mycoides based on MALDI-TOF MS and was identically identified by sequencing (100% identity with B. mycoides and B. weihenstephanensis).

Table 1: Results of species identification of B. weihenstephanensis CCM 9146 by MALDI-TOF MS analysis and 16S rRNA gene sequencing.

Strain 16S rRNA-based % Analyzed MALDI- MALDI score identification* identity fragment length TOF MS- (reliability)

(bp) based identification

2 284

9146 Bacillus _{1()o %} ¹³³⁵ Bacillus weihenstephanensis weihenstephanensis

Reliability: (+++) - highly probable identification of species; (++) - probable identification of species; (+) - likely identification of species.

*Phylogenetically closest relative as determined by BLAST analysis, Fylogeneticky nejblize pribuzny stanoveny analyzou BLAST; agreement higher than 99,9 %.

Whole genome sequencing:

Purified genomic DNA from 1 ml of overnight axenic culture was extracted with E.Z.N.A. Bacterial DNA Kit (Omega Bio-tek). DNA concentration (ng/pl) and purity (260/280 and 260/230) were measured using NanoDrop 1000 spectrometer. DNA concetration was found to be 46.21 ng/pl. A260/280 and 260/230 OD ratios were found in the range of 1.81 and 2.21. Genome was sequenced using an Illumina NextSeq 500 (StarSeq, Germany) to a 8 Mb bacterial genome to 100 fold coverage with a read length of 150 bp. The De novo assembly to contigs was performed using SPAdes Genome Assembler v3.9.0 resulting in 753 genomic scaffolds were functionally annotated using the Prokka Genome Annotation vl.l l (Seemann T. (2014): Prokka: rapid prokaryotic genome annotation. Bioinformatics Jul 15 ;30 (14):2068-9.PMID:24642063) yielding 6018 predicted annotated entries. The resulting scaffolds were assembled using Bacillus mycoides strain AH621 (GenBank accession n. CM000719.1) using ntjoin vl.0.8 using K-mer size 16 and window size 150. The sequence is presented in the Sequence Listing under SEQ ID NO. 27.

Metabolic profile determination: The metabolic profiles of B. weihenstephanensis strain CCM 9146 and type strains B. mycoides DSMZ 2048 and B. mycoides (weihenstephanensis) DSMZ 11821 were determined using a commercially available biochemical kit API 50 CHB (bioMerieux). It is a standardized system designed to study the metabolic potential and identify bacilli and related genera based on carbohydrate metabolism. During incubation, the substrates are converted to organic acids, which cause the pH to drop. The indicator phenol red reacts to a decrease in pH and a positive reaction shows a color change (yellow color).

Cultures grown under the same conditions as for MALDI-TOF MS were used for the experiment and their purity was also microscopically verified. First, 2 ml of culture was collected in a sterile microtube and centrifuged at 4,500 rpm for 5 minutes. Subsequently, the supernatant was removed and the pellet was resuspended in 1 ml of physiological saline. This step was repeated twice to ensure sufficient removal of the culture medium. The inoculum suspension was concentrated to a volume of 0.5 ml. In a tube with 5 ml of sterile saline, a cell suspension with an optical density corresponding to level 2 of the McFarland turbidity scale was prepared, using a standard (bioMerieux). In the process, the number of drops necessary to create the optimum density was counted. A two-fold amount was then transferred to API 50 CHB/E suspension medium (bioMerieux) and thoroughly homogenized. The medium was evenly dispensed into the individual wells using a sterile syringe so as to avoid contact with dehydrated substrates and the formation of air capsules. The cultivation was performed aerobically at 30 °C for 48 hours. Results were read after 24 and 48 hours.

The biochemical profile of B. weihenstephanensis CCM 9146 was compared with the strains B. mycoides DSMZ 2048 and B. mycoides (weihenstephanensis) DSMZ 11821 collection cultures using the API 50 CHB method. The test results showed that B. weihenstephanensis CCM 9146 corresponds to its biochemical profile of B. mycoides (weihenstephanensis) DSMZ 11821. Both ferment D-glucose, D-fructose, N-acetylglucosamine, arbutin, ferric citrate esculin, salicin, D-maltose, D-trehalose, starch and glycogen. Unlike the other two strains tested, B. mycoides DSMZ 2048 can utilize D-sucrose as the sole carbon source. No differences in fermentation profile over time, i.e. after 24 and 48 hours of cultivation, and under different oxygen level conditions, i.e. aerobic and anaerobic, were observed.

Example 3: Cultivation of Bacillus weihenstephanensis CCM 9146

Bacterial culture was cultivated in Typtone soya broth (Oxoid) at 30 °C for 24 hours 48 hours under anaerobic conditions. For anaerobic culture, the medium was prepared according to the method of Hungate RE. A roll tube method for cultivation of strict anaerobes. In: Norris JR, Ribbons DW (eds). Methods in Microbiology. London: Academic Press, 1969, 117-32.

Stock bacterial culture was stored in freezer at -30 °C in Trypton soya broth (Oxoid) supplemented by glycerol (20% w/v). Example 4: Harvesting of culture supernatant

Purity of bacterial culture cultivated in Typtone soya broth (Oxoid) was verified using a phase contrast microscope (Nikon Instruments Europe B.V.). One milliliter of the culture was transferred to a 1.5 ml microcentrifuge tube and centrifuged at 14,500 rpm for 3 minutes. Cell -free supernatant was sterilised twice by filtration through bacteriological filter (pore size 0.22 pm).

Example 5 : Assessment of pathogenic potential

Hemolytic and lecithinase activity were tested, and genes encoding important virulence factors and an enzyme inhibiting bacterial cell communication were detected.

Test of haemolytic and lecithinase activity:

Hemolytic activity was determined by plating a freshly grown culture on Columbia blood agar (Oxoid) plates supplemented with 5% sheep blood (v / v). Hemolysis was assessed after 24 and 48 h incubation at 30 °C. Strains showing a transparent zone around the colonies are considered to have P-hemolytic activity, and those that show a green zone around the colonies are considered to have a-hemolytic activity. If no zone is created, the strain is considered non-hemolytic.

The strain B. weihenstephanensis CCM 9146 was shown to be non-hemolytic.

To assess lecithinase activity, the freshly grown culture was plated on Egg Yolk Agar Base (Himedia) solid medium plates enriched with a sterile yolk emulsion (100 ml/1, Oxoid) and cultured at 30 °C. Activity was assessed after 24 and 48 h of incubation. Strains showing a precipitation zone around the colonies are considered lecithinase positive.

The strain B. weihenstephanensis CCM 9146 was shown to have a slight lecithinase activity.

Detection of genes encoding virulence factors and of an enzyme inhibiting bacterial cell communication: The same cell lysate was used for this experiment as for 16S rRNA sequencing. Genes encoding cereulide (ces), hemolysin BL (hbl), non-hemolytic enterotoxin (nhe), cytotoxin K (cytK), cereolysin O (do), hemolysin II (hlyll), hemolysin III (hlylll), phospholipase c-phosphatidylinositol-specific (phosC), phospholipase-phosphatidylcholine-preferred (cerA), sphingomyelinase (cerB), immune inhibitor A (inhA2) and AHL lactonase (aiiA) were detected by PCR. An overview of the genes tested, primers used, including sequences, estimated PCR product size, and PCR programs used are shown in Table 2. PCR reactions were performed in a total reaction mixture volume of 25 pl containing 12.5 pl DreamTaq Green PCR Master Mix (Thermo Fisher Scientific), 8.5 pl PCR water (Thermo Fisher Scientific), 1 pl of each primer (lOpM) and 2 pl template DNA. PCR was performed in an automatic thermocycler T100 (Bio-Rad). Amplification conditions for individual programs are shown in Table 3. Separation and visualization of PCR products was also performed according to the protocol shown above. GeneRuler Low Range DNA Ladder or GeneRuler DNA Ladder Mix (Thermo Fisher) were used as the size standard, depending on the expected size of the amplicons.

Table 2: Sequences of primers used to detect genes encoding virulence factors, final product size, and PCR program used. size ( _z bp) program

CesFl GGTGACACATTATCATATAAGGTG (SEQ ID NO.3) ces 12 / 1 la

CesR2 GTAAGCGAACCTGTCTGTAACAACA (SEQ ID NOT)

HD2F GTA AAT TAT GAT GAT CAA TTTC (SEQ ID NO.5) rlul lUv l 1

HA4R AGA ATA GGC ATT CAT AGA TT (SEQ ID NO.6)

NA2F AAG CTG CTC TTC GTA TTC (SEQ ID NO.7) line /oo 1

NB 1R TTT GTT GAA ATA AGC TGT GG (SEQ ID NO.8)

CKF2 ACAGATATCGGTCAAAATGC (SEQ ID NO.9) phosCl CGCTATCAAATGGACCATGG (SEQ ID NO.17) yi/z iis Cx 3 o y 3 a phosC2 GGACTATTCCATGCTGTACC (SEQ ID NO.18)

CERA 1 ACTGAGTTAGAGAACGGTAT (SEQ ID NO.19) cerA 33o 3a

CERA 2 CGCTTACCTGTCATTGGTGT (SEQ ID NO.20)

CERB 1 TCGTAGTAGTGGAAGCGAAT (SEQ ID NO.21) ceris 4? / 3a

CERB 2 AGTCGCTGTATGTCCAGTAT (SEQ ID NO.22) inhA2 inhA2.1 CGCGGATCCCACCGATTTATCTG (SEQ ID NO.23) 3087 6b

Table 3: PCR conditions (temperature, time, cycle counts) for individual PCR programs

Program PCR conditions

°C Time Cycle count

Results: It was found that the B. weihenstephanensis strain CCM 9146 has a low pathogenic potential. It has only weak lecithinase activity and is non-hemolytic. The fact that only genes for phospholipase c and non- hemolytic enterotoxin were detected in its genome correlates with this. The presence of the gene for acylhomoserine lactonase was also detected, so it probably has the ability to inhibit quorum sensing (QS), the so-called intercellular communication of bacteria.

Table 4: Presence of genes encoding virulence factors in the strain B. weihenstephanensis CCM 9146.

Example 7: Testing of antimicrobial activity of Bacillus weihenstephanensis CCM 9146

Indicator strains:

The antimicrobial activity of the strain CCM 9146 was tested against potentially pathogenic microorganisms and bacteria causing food and feed spoilage, and against probiotic bacteria.

Collection strains from the CCM collection (Czech Collection of Microorganisms) were used fortesting, namely Aeromonas hydrophila CCM 7232, Bacillus cereus CCM 2010, B. fusiformis CCM 4609, Bifidobacterium adolescentis CCM 4987, Clostridioides difficile CCM 3593, Klebsiella aerogenes CCM 7797, Lactobacillus fermentum CCM 91 , Moraxella canis CCM 4590, Pseudomonas aeruginosa CCM 1960 and P. fluorescens CCM 2115. Furthermore, strains from the DSMZ collection (German Collection for Microorganisms and Cell Cultures) were used fortesting, namely Bacillus mycoides DSM 2048, B. mycoides (weihenstephanensis) DSMZ 11821, Bifidobacterium animalis ssp. lactis DSM 10140, Bifidobacterium bifidum DSM 20082, Bifidobacterium longum ssp. infantis DSM 20090, Clostridium butyricum DSM 10702, Cl. clostridioforme DSM 933, Cl. perfringens DSMZ 11778, Cl. tertium DSMZ 2485, Lactobacillus acidophilus DSMZ 20079, Cutibacterium acnes ssp. acnes DSM 1897 and Serratia marcescens DSMZ 30121. Furthermore, strains from ATCC (American Type Culture Collection) were tested, namely Bifidobacterium breve ATCC 15700, Escherichia coli ATCC 25922, Lactococcus lactis ssp. lactis ATCC 11454, Micrococcus luteus ATCC 10240, Salmonella enterica subsp. enterica serovar Enteritidis ATCC 13076, Staphylococcus aureus ssp. aureus ATCC 25923, and 3 strains from the CCDM collection (LAKTOFLORA® Pure Dairy Cultures Collection), Lactobacillus plantarum MILCOM 195, Lactococcus lactis ssp. lactis MILCOM 612 a Streptococcus thermophilus MILCOM 55. Finally, strains from the KMVD collection (Collection of the Department of Microbiology, Nutrition and Dietetics), namely E. coli C7050 KMVD, E. coli 2163 KMVD, Enterococcus faecalis KMVD a Salmonella KMVD, were tested.

Bacterial isolates from various environments were also used fortesting. A total of 74 strains of B. cereus group were tested. Furthermore, 8 strains of Clostridium perfringens isolated from the digestive tract of dogs and from honey, 2 strains of Listeria monocytogenes isolated from food, 1 strain of B. aerophilus isolated from Kanclif pond water and 1 strain of B. subtilis isolated from Hejtman pond water were used. Two strains of Lactococcus garvieae from the digestive tract of the honey bee and 1 strain of Paenibacillus polymyxa from cleansing beetroot tea were also tested. The susceptibility of G-bacteria was also tested, namely 1 strain of Acinetobacter johnsonii isolate from the Asian clam, 1 strain of E. coli from the human digestive tract, 1 strain of Chromobacterium sp. isolate from Pectinatella magnifica and 1 strain of Salmonella sp. isolated from meat.

Antimicrobial activity testing:

Antimicrobial activity was tested by agar well diffusion method. It is a qualitative method for determining the susceptibility or resistance of organisms to an antimicrobial substance. The sensitivity of the indicator strain is manifested by the formation of an inhibition zone.

For this experiment, the strain was cultured in tryptone soy broth (TSB, Oxoid) at 30 °C for 48 hours under anaerobic conditions. For anaerobic culture, the medium was prepared according to the method of Hungate RE. A roll tube method for cultivation of strict anaerobes. In: Norris JR, Ribbons DW(eds). Methods in Microbiology . London: Academic Press, 1969, 117-32. At the end of the incubation period, the culture was centrifuged at 14,500 rpm for 5 minutes, and the supernatant was used to test for antagonist activity.

The agar suitable for the given indicator strain was sterilized in a pressure cooker for 45 min and then tempered to 50 ° C in a water bath. Then, 1 ml of a freshly grown microscopically verified indicator strain was transferred to a petri dish and 20 ml of the prepared agar was poured using a tilting pipette. To achieve uniform growth, the agar was mixed with the inoculated culture in a gentle swirling motion. After solidification, wells were formed around the perimeter of the agar by a sterile cork borer, from which excess agar was removed with a sterile needle. Sixty pl of supernatant was dispensed into the wells using a pipette. Anaerobic microorganisms were rapidly placed in anaerostats (Oxoid) with an anaerobic atmosphere generator (AnaeroGen, Oxoid). The petri dishes thus prepared were left in the refrigerator for 4 hours to allow full diffusion of the supernatant into the medium. After this period, the organisms were cultured at the temperature optimal for the species. Antimicrobial activity was tested in 3 replicates and the sensitivity of a given strain was evaluated as the average of inhibition zones after 24-48 h of incubation, depending on the indicator organism.

Table 5 : Cultivation conditions of the indicator strains

Antimicrobial activity of the strain CCM 9146:

The results of the antimicrobial activity are shown in Table 6. Inhibitory activity was found against members of the B. cereus group, also against important pathogenic bacteria Cl. perfringens and L. monocytogenes . The growth of none of the indicator probiotic bacteria or BMK was inhibited by B. weihenstephanensis CCM 9146. Also, all indicator G-bacteria were resistant to the effects of the tested supernatant.

Table 6: Inhibition spectrum of B. weihenstephanensis CCM 9146 determined by agar diffusion method

Gram-positive

Group of Bacillus cereus LGHG

Bacillus aerophillus 0/1

Bacillus fusiformis 0/1

Bacillus suhtilis 0/1

Bifidobacterium spp. 0/5

Clostridium butyricum 0/1

Clostridium clostridioforme 0/1

Clostridioides difficile 0/1

Clostridium perfringens 9/9

Clostridium tertium 0/1

Enterococcus fae calls 0/1

Lactobacillus spp. 0/2

Lactococcus spp. 0/4 Listeria monocytogenes 1/3

Micrococcus luteus 0/1

Paenibacillus polymyxa 0/1

Cutibacterium acnes 0/1

Staphylococcus aureus 0/1

Streptococcus thermophilus 0/1

Gram-negative

Klebsiella aerogenes 0/1

Escherichia coli 0/2

Chromobacterium sp. 0/1

Moraxella canis 0/1

Pseudomonas aeruginosa 0/1

Pseudomonas fluor escens 0/1

Salmonella spp. 0/2

Serratia marcescens 0/1

Example 8: Characterization of the antimicrobial agent of Bacillus weihenstephanensis CCM 9146

The supernatant prepared as described above in Example 4 was used for all subsequent experiments.

The supernatant was exposed to various enzymes, pH and temperatures. Residual activity was assessed using the agar diffusion method. Due to its high sensitivity, the B. cereus CCM 2010 strain was chosen as the indicator organism. The diameters of the inhibition zones were measured after 24 hours of anaerobic culture on Wilkins-Chalgren agar (Oxoid) at 30 ° C.

Effect of enzymes:

To determine the physicochemical nature of the antimicrobial substance, the supernatant of B. weihenstephanensis strain CCM 9146 was exposed to the proteolytic enzymes pepsin, proteinase K, a- chymotrypsin and trypsin (all Sigma-Aldrich) as well as the enzyme lysozyme (Sigma- Aldrich), which cleaves glycoproteins.

Enzymes were aseptically added to the supernatant in such an amount as to give a final concentration of 1 mg/ml. For optimal pepsin activity, the pH of the supernatant was adjusted to 2 with 35% hydrochloric acid. Subsequently, the samples were incubated for 24 hours in a thermostat. The incubation temperature was chosen to induce maximum enzyme activity, for proteinase K it was 42 °C, for other enzymes 37 °C. Residual activity was assessed after 1 and 24 hours of incubation. The pH of the supernatant with pepsin was always adjusted to the original value with 2M sodium hydroxide solution after incubation. As a control, the supernatant alone, incubated under the same temperature conditions as the enzyme variants, served to avoid possible degradation at the given temperatures. Furthermore, the inhibitory activity of the enzymes alone (1 mg/ml distilled water) was tested. Effect of pH:

To determine the effect of pH on antimicrobial activity, the pH of supernatant samples was adjusted to values between 2 and 9. The desired pH values were achieved by the addition of 2M sodium hydroxide solution and 35% hydrochloric acid. At the same time, the antimicrobial activity of the untreated supernatant (pH 6.1) was tested. To verify that the pH alone did not inhibit the indicator strain, samples of distilled water adjusted to similar pH values as the supernatants were tested.

Effect of temperatures:

To analyze the thermostability of the antimicrobially active substance, the supernatant was exposed to different temperatures for a defined period of time, as shown in Table 7. Subsequently, the extent of residual inhibitory activity against the indicator strain was determined by agar diffusion assay.

Results:

The results of the residual antimicrobial activity of the supernatant after exposure to enzymes, various temperatures and pH are shown in Table 8.

None of the enzymes affected the activity of the antimicrobial after 1 hour of incubation. The activity was demonstrably impaired only by the action of proteinase K after 24 hours of incubation.

Antimicrobial activity has been demonstrated in a wide range of pH values. At pH 5, however, the activity decreased by about 30% compared to the control. In contrast, at pH 3 and 2.2, the activity of the supernatant increased significantly (by 60%). The negative control showed that the indicator strain is resistant to pH 3. At pH 2.2, however, the indicator strain was also inhibited by the pH value itself, when an average inhibition zone of 16.70 mm was measured.

Low temperatures of -80 and -18 ° C had no effect on antimicrobial activity. The activity was also maintained or only negligibly reduced (less than 10%) at temperatures and exposure times of 65 °C for 60 minutes, 72 °C for 30 minutes and at 85 °C for 10 minutes. Complete inactivation occurred only at 80 °C for 60 min, 100 °C for 30 min, including 125 °C for 15 min. Table 8: Residual activity (%) of the antimicrobially active substance after exposure of the supernatant to enzymes, various pH and temperature values. 100% = untreated supernatant activity

Effect of storage conditions:

Effect of storage period on the activity of the antimicrobially active substance: Aliquots of the supernatant were dispensed into microtubes and stored at various storage temperatures (-80, -18, 4, 30, 37, 42 °C and room temperature). Changes in antimicrobial activity were monitored at intervals of 1, 2, and 4 weeks, and 'A, 1, and 1/2years. Residual activity was evaluated in comparison with the activity of the freshly prepared supernatant tested on the day of the start of the storage experiment. Effect of storage conditions on the activity of the antimicrobially active substance: The results of the effect of storage duration at different temperatures on the antimicrobial activity are shown in Table 9. Storing the supernatant at freezer temperatures (-80 and - 18 °C) has absolutely no effect on the activity. The refrigerator temperature of 4 °C also ensures high stability of the antimicrobial substance for a period of 0.5 year, but inactivation took place after one year of storage. The ability of the antimicrobial substance of B. weihenstephanensis CCM 9146 to retain activity up to 37 °C for at least 4 weeks is also significant. In contrast, storage at 42 °C causes a complete loss of activity after only 1 week.

Table 9: Residual activity (%) of the supernatant depending on the temperature and period of storage. 100% = fresh supernatant activity

Example 9: Assaying of the antimicrobial activity of Bacillus weihenstephanensis CCM 9146

Growth curve in relation to the production of the antimicrobial substance:

To determine the dynamics of antimicrobial production during the cell cycle, B. weihenstephanensis CCM 9146 was cultured in 10 ml TSB (Oxoid) tubes under anaerobic conditions at 30 °C for 40 hours, in duplicate. 0.4 ml of culture optimized for optical density (OD) corresponding to level 5 of the McFarland turbidity scale, using a standard (bioMerieux), was used as inoculum. The optical density (OD _565nm+/-15nm ) of the culture was measured every half hour of cultivation using a McFarland type densitometer type DEN- IB (Biosan). A sample was aseptically taken every hour and a supernatant was prepared from it. Subsequently, the antimicrobial activity of the obtained supernatants was tested. Based on the obtained data, a growth curve was compiled and a growth phase was determined, during which the expression of the antimicrobial substance is initiated and the phase when the production reaches the highest values. The growth curve of B. weihenstephanensis CCM 9146 is shown in Fig. 1 and shows that the culture reached the early exponential phase 6 hours after inoculation, the stationary phase after 20 hours of cultivation and remained there until the end of the experiment. The expression of the antimicrobial substance was started already at the end of the exponential phase, i.e. after 13 hours of cultivation. The maximum level of production was reached after 19 hours, when the culture went into an early stationary phase. From this point on, the extent of inhibitory activity remained virtually unchanged.

Effect of cultivation temperature on the expression of the antimicrobial substance:

For this experiment, the freshly grown culture was inoculated into TSB (Oxoid) vials and cultured at 4, 20, 30, 37 and 42 °C for 48 hours under anaerobic conditions. At the end of the incubation period, a supernatant was prepared from all culture variants and diluted by two-fold dilution in sterile saline. The level of production was again evaluated on the basis of the size of the inhibition zones determined by the agar diffusion method.

The results of testing the effect of B. weihenstephanensis CCM 9146 culture temperature on antimicrobial production rate are shown in Table 10. Under anaerobic conditions, the strain was able to grow in the temperature range of 4 to 37 °C, when grown at 42 °C the growth was suppressed, namely even if the strain was cultured under aerobic conditions. However, after moving the cultures from 42 °C to room temperature, the variant cultured in the presence of oxygen was able to grow.

The inhibitor was expressed at 20, 30 and 37 °C. The highest activity was recorded in the culture incubated at 30 °C. This temperature therefore appears to be optimal in terms of maximum antimicrobial production. In cultures grown at 20 and 37 °C, there was almost no difference in the size of the inhibition zones. However, when the concentration of the supernatant was reduced, activity was observed only in the variant cultured at 20 °C. Thus, at this temperature, the antimicrobial agent appears to be more highly expressed.

Table 10: Antimicrobial expression level as a function of B. weihenstephanensis CCM 9146 culture temperature (expressed as arithmetic mean of inhibition zones in mm ± standard deviation of a given supernatant concentration). R = resistant, N = no growth of culture Effect of the antimicrobial substance on the cell growth:

In order to study the effect of the inhibitory substance on the cell, and thus the possible mechanism of the antimicrobial effect, two experiments were performed in parallel. For both tests, B. cereus CCM 2010 cultured for 16 hours (in the middle of the logarithmic phase) under aerobic conditions was again used as an indicator. Cultivation was performed in tubes with 10 ml TSB (Oxoid). Next, the culture supernatant of B. weihenstephanensis CCM 9146, prepared as described in Example 4 and sterilized by a membrane fdter with a pore size of 0.22 pm, was used for the experiments.

For the first experiment, the indicator strain cultures were centrifuged at 4,000 rpm for 5 minutes to preserve cell viability and immediately remove aseptically the supernatant. The supernatant from B. weihenstephanensis CCM 9146 at a final concentration of 100, 50 and 25% was then applied to the individual tubes to the cell pellet. For variants with 50 and 25% concentration, the volume was supplemented with supernatant from B. cereus CCM 2010, cultured under the same conditions and for the same time as the strain CCM 9146. The tubes thus prepared were transferred to a thermostat and cultured at 30 °C. Optical density (OD _565nm+/-15nm ) was measured at regular intervals for 30 hours using a McFarland DEN-1B densitometer (Biosan) and culture samples were taken for microscopic (Nikon Instruments Europe B.V. phase contrast) cell integrity monitoring. Culture without supernatant from the strain CCM 9146 was used as a control for the growth of the indicator strain. Finally, the samples were inoculated into TSB (Oxoid) and cultured under aerobic and anaerobic conditions at 30 °C for 1 week, and the viability of the indicator strain was determined based on the presence/absence of turbidity. The resulting OD values of the individual supernatant concentrations were evaluated by analysis of variance ANOVA using the Scheff method in Statistica 12 (StatSoft).

For the second experiment, tubes with supernatant from B. weihenstephanensis CCM 9146 were prepared, again at a final concentration of 100, 50 and 25%. These were inoculated with 0.3 ml of a freshly grown indicator strain and transferred to a thermostat for culturing at 30 °C for 30 hours. The OD was measured at regular intervals and the ability of B. cereus CCM 2010 cells to proliferate in the presence of the active substance was monitored. At the end of the experiment, the number of viable bacteria was determined by culture using a plate culture method. Individual variants were serially diluted ten-fold to a concentration of 10 ^-9 . One ml of each dilution was plated on MYP agar (Mannitol Egg Yolk Polymyxin B) in petri dishes, on which colonies of B. cereus typically stained pink and exhibited lecithinase activity. Cultivation was performed for 48 hours under aerobic conditions at 30 °C, then colonies were counted and the total number of viable bacteria was determined.

The effect of the inhibitory substance produced by B. weihenstephanensis strain CCM 9146 on the cell growth of the indicator strain B. cereus CCM 2010 was monitored for 30 hours and is shown in Figure 2. The addition of supernatant from B. weihenstephanensis CCM 9146 at a concentration of 100, 50 and 25% to the B. cereus cell pellet in the exponential growth phase resulted in a slight decrease in optical density (OD). Thus, there was a reduction in the number of viable cells compared to the control, when, on the contrary, the OD increased and an increase in bacterial culture was demonstrated. Between supernatant concentrations, there was no statistically significant difference (P> 0.05) observed for OD decrease. Based on subculturing in TSB (Oxoid), a bactericidal effect of 100 and 50% of the supernatant concentration was found. Even after a week of subculturing in both aerobic and anaerobic conditions, no increase in the indicator strain was observed in any of the variants. In the case of 25% concentration of the supernatant, after subculturing, the culture increased in aerobic and anaerobic conditions, so the concentration had a bacteriostatic effect.

The integrity of the indicator culture cells was determined microscopically after 2, 20 and 30 hours of culture. Although there was a slight decrease in OD due to cell death, microscopically, the cells appeared intact with a smooth surface, the cell membrane appeared intact, and no cell fragments were observed. Thus, it can be assumed that the ability of cell division has been inhibited.

In this second experiment, the ability of the cells of the indicator strain to proliferate was determined. In the variants with 100 and 50% supernatant, there was no colony growth on MYP agar from zero dilution, at these concentrations the antimicrobial substance was bactericidal and completely prevented the reproductive ability of B. cereus CCM 2010. In the variant with 25% supernatant there was a slight increase in optical density, with the total number of viable bacteria in this variant being 2* 10 ⁵ CTU/ml.

Antimicrobial activity assay using microdilution method:

The antimicrobial activity of B. weihenstephanensis CCM 9146 supernatant was also tested by microdilution in a 96-well microtiter plate against B. cereus CCM 2010, two Cl. perfringens strains - DSMZ 11778 and N12/3D, and three strains of L. monocytogenes - ATCC 11778, 7 and 72. The minimum inhibitory concentration (MIC) and the minimum bactericidal concentration (MBC) of the supernatant were determined. Freshly grown cultures of indicator bacteria, cultured under the conditions described above in Table 5, were standardized to a density of 1 x 10 ⁶ CTU/ml. The supernatant from the production strain was pipetted into a microtiter plate and serially diluted 2-fold up to the value 0.015625, using the culture medium appropriate for the organism. The resulting volume of medium in each well was 90 pl. The wells were then inoculated with 10 pl of the corresponding culture at a defined density. As controls, the following were tested: medium suitable for the indicator strain without the addition of supernatant inoculated with bacterial culture, medium suitable for the indicator strain diluted with TSB and inoculated with bacterial culture, and medium with supernatant without bacterial culture. The resulting volume in all wells was always 100 pl. All experiments were performed in 3 replicates. Plates thus inoculated with strains of Cl. perfringens were cultured anaerobically in bags with anaerobic atmosphere generators (AnaeroGen, Oxoid). The other strains were cultured under aerobic conditions. To verify whether the presence of oxygen affects antimicrobial susceptibility, B. cereus was cultured under both aerobic and anaerobic conditions. The plates were incubated for 48 hours at a temperature appropriate for the strain. Bacterial growth in the medium was determined spectrophotometrically by measuring turbidity in individual wells using an Infinite 200 PRO Microplate Reader (Tecan, Switzerland) spectrometer at 610 nm. Measurements were performed after 24 and 48 hours of incubation. MICs were defined as the lowest concentration of supernatant that inhibited the growth of test bacteria by > 80% compared to control. MBC was determined by subculturing 10 pl of sample from each well without visible bacterial growth in antimicrobial-free medium. The lowest concentration that inhibited the growth of 99.9% of bacteria was considered MBC.

The results of the minimum inhibitory and bactericidal concentrations of the supernatant are shown in Table 11. All indicator bacteria were susceptible, including two isolates of L. monocytogenes 7 and 72, which appeared to be resistant using the agar diffusion method. It is also clear that the MICs, after 48 hours of incubation, with the exception of L. monocytogenes strain 7, correspond to MBCs. The most sensitive strain was B. cereus CCM 2010. Under anaerobic conditions, it was inhibited by 4x lower supernatant concentration (1:32) than in aerobic culture (1: 8). Thus, the presence or absence of oxygen plays an important role in the antimicrobial resistance of B. cereus CCM 2010. Very good results were also obtained when the supernatant was treated with the highly pathogenic isolate Cl. perfringens N12/3D (MIC and MBC 1: 4), whereas a collection strain of the same species was sensitive only to the undiluted supernatant.

Table 11 : Minimum inhibitory concentrations (MIC) and minimum bactericidal concentrations (MBC) of B. weihenstephanensis CCM 9146 supernatant expressed as titer.

Assay of antibiotic resistance/sensitivity of the strain B. weihenstephanensis CCM 9146:

The antibiotic resistance/sensitivity of the strain B. weihenstephanensis CCM 9146 assay was performed using a disc diffusion method under conditions determined by EUCAST: https://www.eucast.org/ fileadmin/src/media/PDFs/EUCAST_files/General_documents/Publ ications/Disk_diffusion_paper_pri nted_version_March_2014.pdf; Matuschek E., Brown D.F.J., Kahlmeter G: Development of the EUCAST disk diffusion antimicrobial susceptibility testing method and its implementation in routine mikrobiology laboratories. Clinical Microbiology and Infection, Volume 20 Number 4, April 2014; https://www.eucast.org/fdeadmin/src/media/PDFs/EUCAST_fdes/B reakpoint_tables/v_l l.O_Breakpoi nt_Tables.pdf, p. 103, Bacillus sp.; The European Committee on Antimicrobial Susceptibility Testing. Breakpoint tables for interpretation of MICs and zone diameters. Version 11.0, 2021. http://www.eucast.org.