A BIOLOGICAL MARKER FOR PSORIASIS

FIELD OF THE INVENTION

This invention is in the fields of diagnosis of psoriasis and determining the effectiveness of treatment of psoriasis, and in particular to use of biological markers associated with psoriasis therefore.

PRIOR ART

The following is a list of prior art which is considered to be pertinent for describing the state of the art in the field of the invention. Acknowledgement of these references herein will at times be made by indicating their number within brackets from the list below.

1. Fishman P ₅ Madi L ₅ Bar- Yehuda S, Barer F, Del Valle L ₅ Khalili K. Evidence for involvement of Wnt signaling pathway in IB-MECA mediated suppression of melanoma cells. Oncogene., 21:4060-4064 (2002).

2. Fishman P, Bar- Yehuda S ₅ Rath-Wolfson L, Ardon E, Barrer F ₅ Ochaion A ₅ Madi L. Targeting the A3 adenosine receptor for cancer therapy: inhibition of Prostate carcinoma cell growth by A ₃ AR agonist. Anticancer Res., 23:2011-2023 (2003).

3. Madi L ₅ Bar- Yehuda S ₅ Barer F ₅ Ardon E ₅ Ochaion A, Fishman P. A3 adenosine receptor activation in melanoma cells: association between receptor fate and tumor growth inhibition. J Bio. Chem., 278:42121-42130 (2003). 4. Ohana G, Bar- Yehuda S ₅ Arich A ₅ Madi L ₅ Dreznick Z ₅ Silberman D ₅ Slosman G ₅ Volfsson-Rath L ₅ Fishman P. Inhibition of primary colon carcinoma growth and liver metastasis by the A3 adenosine receptor agonist IB-MECA. British J. Cancer., 89:1552- 1558 (2003).

5. Fishman P, Bar- Yehuda S, Ohana G, Ochaion A, Engelberg A ₅ Barer F, Madi L. An agonist to the A3 adenosine receptor inhibits colon carcinoma growth in mice via modulation of GSK-3 β and NF-κB. Oncogene, 23 :2465-2471 (2004).

6. US Patent Application No. 2004016709 Al .

7. Szabo, C, et al. Suppression of macrophage inflammatory protein (MIP)-I α production and collagen-induced arthritis by adenosine receptor agonists. British J. Pharmacology, 125:379-387 (1998).

8. Mabley, J., et al. The adenosine A ₃ receptor agonist, N ⁶ -(3-iodobenzyl)-adenosine - 5'-N-methyluronamide, is protective in two murine models of colitis. Eur op. J. Pharmacology, 466:323-329 (2003).

9. Baharav, E., et al. The effect of adenosine and the A ₃ adenosine receptor agonist IB- MECA on joint inflammation and autoimmune diseases models. Inter. J. MoI. Med. 10(supplement 1) page S 104, abstract 499 (2002).

10. PCT Application, publication No. WO2005/0063246, entitled "Method for Treatment of Multiple Sclerosis".

11. Madi L, Ochaion A, Rath-Wolfson L, Bar- Yehuda S, Erlanger A, Ohana G, Harish A, Merimski O ₅ Barer F ₅ Fishman P. The A3 Adenosine Receptor is Highly Expressed in Tumor vs. Normal Cells: Potential Target for Tumor Growth Inhibition. Clinical Cancer Research, 10: 4472-4479, 2004.

12. US Patent Application, publication No. 20040137477 Al ₅ entitled "A3AR as a marker for a diseased state".

13. Gessi, S. et al. Elevated expression of A ₃ adenosine receptors in human colorectal cancer is reflected in peripheral blood cells Clinical Cancer Research 10:5895-5901, 2004.

14. PCT patent application, publication no. WO2006/059327, entitled "A biological marker for inflammation".

15. PCT patent application, publication no. WO2004/045627, entitled "A3AR agonists for the treatment of inflammatory arthritis".

16. Bioventure View, 6 May 2003 "Can-fite can do phase II".

BACKGROUND OF THE INVENTION

The A ₃ adenosine receptor, a Gi protein-associated cell surface receptor, was proposed as a target to combat cancer and inflammation. The receptor is highly expressed in various tumor cell types while expression in adjacent normal tissues is relatively low. Activation of the receptor by a specific synthetic agonist induces modulation of downstream signal transduction pathways which include the Wnt and the NF-kB, resulting in tumor growth inhibition (1-5).

In vivo studies have shown that A ₃ adenosine receptor (A ₃ AR) agonists inhibit tihe development of colon, prostate and pancreatic carcinomas as well as melanoma and hepatoma. A ₃ AR agonists were also been shown to act as anti-inflammatory agents by ameliorating the inflammatory process in different experimental autoimmune models such as rheumatoid arthritis, Crohn's disease and multiple sclerosis (6-10).

A ₃ adenosine receptor (A ₃ AR) expression levels are elevated in cancer cells as compared to normal cells (11). Thus, the A ₃ AR expression level has been described as a means for the diagnosis of cancer (12). In addition, A ₃ AR expression levels have also been described to be elevated in peripheral blood cells of patients with colorectal cancer (13).

The A ₃ AR was found to be highly expressed in inflammatory tissues (synovia and paw) derived from adjuvant (AIA) and collagen induced arthritis experimental models (14). This over expression was reflected in the PBMNC of the animals. Treatment of ALA rats with an A ₃ AR agonist resulted in disease amelioration and receptor down-regulation. hi patients with Rheumatoid arthritis (RA) ₅ the receptor was found to be highly expressed in peripheral blood mononuclear cells (PBMNC) (14). Moreover, in a group of RA patients that was treated with an A ₃ AR agonist, a direct correlation was found between A ₃ AR expression at baseline and response of the patients to the drug (15).

Psoriasis is a chronic condition. Currently, there is no cure for psoriasis. People often experience flares and remissions throughout their life. However, there are many treatment options that can clear psoriasis for a period of time. Each treatment has advantages and disadvantages, and what works for one patient may not be effective for another.

There are several forms of psoriasis, and each form has unique characteristics that allow dermatologists to visually identify psoriasis to determine what type, or types, of psoriasis is present. Sometimes a skin biopsy will be performed to confirm the diagnosis. The main types of psoriasis include the following: ■ Plaque Psoriasis (reddened areas a few inches across covered by silvery scales)

^■ Pustular Psoriasis (blisters of noninfectious pus on red skin)

■ Arthritic Psoriasis or Psoriatic Arthritis

■ Guttate Psoriasis (small, red spots on the skin) ^■ Inverse or Flexural Psoriasis (shiny, red patches in areas of friction such as in the folds of skin in the groin, the armpits or under the breasts)

■ Erythroderma Psoriasis (reddening and scaling of most of the skin). Treatment depends on the severity and type of psoriasis. Some psoriasis is so mild that the person is unaware of the condition. A few develop such severe psoriasis that lesions cover most of the body and hospitalization is required. These represent the extremes. Most cases of psoriasis fall somewhere in between. Psoriasis treatments fall into 3 categories:

• Topical (applied to the skin) — Mild to moderate psoriasis

• Phototherapy (light, usually ultraviolet, applied to the skin) - Moderate to severe psoriasis

• Systemic (taken orally or by injection or infusion) - Moderate, severe or disabling psoriasis. hi an article published on the internet (16), it is stated that CFlOl (an A ₃ AR agonist) could be applicable in indications such as inflammatory bowel disease and psoriasis.

SUMMARY OF THE INVENTION

The present invention is based on the finding that there is an increase in the level of A ₃ adenosine receptor expression in the peripheral blood mononuclear cells (PBMNC) of subjects suffering from psoriasis as compared to the PBMNC of a healthy subject. This finding paves the way for the use of the A ₃ adenosine receptor expression level as a means for the diagnosis of a psoriasis state, as well as for other applications described below.

In accordance with some aspects of the invention, the A ₃ AR level of expression in PBMNC may be used for determining the state or severity of psoriasis, e.g. for determining the presence or absence of a psoriasis state. In accordance with other aspects of the invention, the A3 AR level of expression may be used for quantitative determination of the degree of severity of the psoriasis state. Thus, the term "determining" or "determination" as used herein encompasses both quantitative and qualitative determination. In a first aspect of the invention, there is provided a method of determining a psoriasis state in a subject that comprises determining the level of expression of A ₃ adenosine receptor (A ₃ AR) in PBMNC from the subject. A high level of expression of A ₃ AR is indicative of a psoriasis state in the subject. Optionally, the value of a parameter indicative of said level of expression OfA ₃ AR is determined. Although the present specification refers to PBMNC in describing the method of the invention, the method of the invention may also be practiced using other blood cells, in particular lymphocytes.

The sample comprising PBMNC may be whole blood or may be a blood fraction that contains PBMNC. A PBMNC-comprising sample may also at times be obtained from the lymphatic system, e.g. from lymph nodes.

Determining the level of expression may be carried out through determination of the level of A ₃ AR mRNA as well or the level of A ₃ AR protein. The term "level of expression" as used herein thus includes the level of A ₃ AR mRNA as well as the level ofA ₃ AR protein or A ₃ AR protein fragments in the sampled cells. In one embodiment, the level of the A ₃ AR expression in the PBMNC is compared to a control level, the control level being the level of A ₃ AR expression in normal PBMNC of a healthy subject, or being a standard reference level for the A ₃ AR expression which is indicative of a normal state.

It was found that medication may influence the level of the cellular A ₃ AR expression. Thus, past disease history including prior or current treatment may influence the A ₃ AR expression level and may need to be taken into account in the performance of the methods of the invention. • In a second aspect of the invention, there is provided a method for determining the severity of a psoriasis state in a subject comprising deterrnining the level of expression of A ₃ AR in PBMNC of the subject, comparing the level of expression of A ₃ AR in the cells with the level of prior determined standards that correlate A ₃ AR expression level with severity of psoriasis disease, and optionally displaying the corresponding level of prior determined standards, said value being indicative of the severity of the psoriasis state in the subject.

In one embodiment, wherein the value of a parameter indicative of the level of expression of A ₃ AR is determined, and compared to the value of a corresponding parameter of prior determined standards, the value of a corresponding parameter being indicative of the severity of the psoriasis state in the subject.

The prior determined standards may include, for example, a set of values, which may be a list of discrete values or a continuous curve, correlating results to a measure of severity of psoriasis; or it may be a set of descriptors, such as a qualitative list of possible results and their meanings in respect of severity of psoriasis, e.g. if the outcome is manifested as a color reaction, the descriptors may list the range of possible color or color intensity outcomes and their meaning in respect of severity of psoriasis; or it may included graphical or pictorial representations of expected assay outcomes for different severities of psoriasis or different psoriasis states; or a set of reference standards, which may be run in parallel with the sample for calibration and evaluation of the data. The standards may typically be obtained by assaying the expression level of A ₃ AR in a plurality of samples from each of a number of psoriasis disease states to obtain a statistical measure of the correlation between expression level and the disease state. The classification into disease states may for example be binary: light psoriasis and severe psoriasis. The classification may also include a plurality of different states, such as, for example, light, moderate and severe psoriasis. The classification may also be by the use of a numerical value, according to the. level of expression, e.g. a number between 1 and 10, for corresponding light through severe psoriasis, etc. As will be appreciated, there

may be many types of classifications and the invention is not limited to specific types of classifications.

In a third aspect of the invention, there is provided a method for determining the effectiveness of a psoriasis therapeutic treatment of a subject, the treatment comprising administering an A ₃ AR agonist to the subject. The treatment may be a monotherapy with an A ₃ AR or a combination therapy of an A ₃ AR with another drug, such as a combination of an A ₃ AR with methotrexate or cyclosporin: The method in accordance with this aspect of the invention comprises determining the expression level of A ₃ AR in PBMNCs from the subject at two or more successive time points, at least one of which is during the psoriasis treatment of said subject, and optionally displaying a value corresponding to a difference in the expression level from the two or more time points, wherein a statistically significant difference in the level is indicative of effectiveness of the drug treatment. The successive time points may, for example, be one or more taken before a psoriasis treatment and one or more during the treatment, or one or more taken during the treatment and one or more taken during a treatment cessation.

In a first embodiment, a high level of expression of A ₃ AR is employed as an indicator of a psoriasis state in the subject. The term "high level" is to be understood as meaning a significantly higher level of expression than in normal cells. A significantly higher level is determined according to statistical tests and considerations as known to those versed in statistical analyses. For example, the level of the A ₃ AR expression in the PBMNC may be compared to a control level, the control level being the level of A ₃ AR expression in normal PBMNC of a healthy subject. At times it may be useful to determine the expression level by testing an assayed sample from an individual in parallel to one or more reference standards, e.g. one reference standard indicative of a normal state and another indicative of a psoriasis state; or one reference standard indicative of a normal state and two or more of different disease states.

In a second embodiment, the determined expression level is compared to standards. The standards may be based on previously determined levels from healthy individuals and from individuals with a psoriasis state or with different psoriasis states. The standards may be provided, for example, in the form of discrete numeric values or, in case the assay method is colorimetric, in the form of a chart with different colors or shadings for healthy and psoriasis states; or they may be provided in the form of a comparative curve prepared on the basis of such standards.

Such standards may be prepared by determining the level of A ₃ AR expression (which may be the level of A ₃ AR protein, protein fragment, or mRNA level etc., as discussed above) present in PBMNC cells obtained from a plurality of patients positively diagnosed (by other means, for example by a physician, by histological techniques etc.) as having psoriasis at varying levels of severity. The severity of the disease for the preparation of the standards may also be determined by various conventional methods such as by pathological techniques. In another embodiment, the assay is carried out in parallel to a number of standards of healthy subjects and subjects of different psoriasis states and the level determined in the assayed sample is then compared to such standards.

For example, a protein content level of between X ₁ to X ₂ per 1,000,000 cells may be defined as being indicative of grade 1 psoriasis, a higher protein content of Y ₁ to Y ₂ per 1,000,000 cells may be defined as being indicative of grade 2 psoriasis, etc. After such standards are prepared, it is possible to compare the level of A ₃ AR expression obtained from a specific individual to the corresponding value of the standards, and thus obtain an assessment of the severity of the disease.

The effectiveness of a psoriasis therapeutic treatment of a subject may be assessed by taking samples of PBMNC at various time points before, during and after the treatment. For example, a first sample may be taken at a time point prior to initiation of the treatment and a second sample may be taken at a time point during the treatment. A decrease in the level of the A ₃ AR expression in the second sample as compared to the first sample would be indicative that the treatment is effective. The degree of decrease could be indicative of the degree of effectiveness of the treatment, i.e. the correlation would be quantitative. In another example, a first sample may be taken at a time point during the treatment and a second sample may be taken at a time point during the treatment subsequent to the time point of the first sample. A decrease in the level of the A ₃ AR expression in the second sample as compared to the first sample would be indicative that the treatment is effective. In a third example, a first sample may be taken at a time point during the treatment and a second sample may be taken at a time point after the treatment has been discontinued. In this case, an increase in the level of the A ₃ AR expression in the second

sample as compared to the first sample would be indicative that the treatment is effective.

Of course, various other combinations may be carried out, as well as the taking of samples at more than two time points. The invention also provided a method for selecting a subject suffering from a psoriasis disease type, to receive a psoriasis therapeutic treatment that comprises administering to the subject an A ₃ AR agonist, the method comprising determining the level of expression of A ₃ AR in the PBMNCs of the subject and selecting the subject to receive the psoriasis therapeutic treatment if the level is above a predetermined level. Said predetermined level may be a certain threshold level for all subjects. Said predetermined level may also be a range of levels for different patient groups, for example: for different age groups; for different disease states; for different disease histories - histories of past medication (for example, methotrexate was found to induce an increase in the level of A ₃ AR), number of years having the disease, etc. Said predetermined level may be determined through clinical studies that look for correlation between receptor expression and drug response according to one of the acceptable response criteria.

Selection of subjects suitable for psoriasis treatment may be executed by determining the level of expression of A ₃ AR in a sample of PBMNC withdrawn from said subject before treatment. The subject is selected if the determined level of A ₃ AR is above a predefined threshold.

According to one embodiment, the threshold is a certain multiple of the level of A ₃ AR expression in PBMNC of a healthy subject. According to another embodiment, the threshold is determined on the basis of the average expression level in psoriasis patients, and may be said average or a certain multiple or fraction thereof. By a further embodiment, the threshold is determined on the basis of clinical studies in human patients that are designed to determine the correlation between the level of expression and the response of the patients to said therapeutic treatment. As will be appreciated, the threshold may be different for different psoriasis disease types. As may also be appreciated, by its nature such a selection criterion is based on statistics and thus signifies a certain probability that a selected patient may respond to a treatment. Thus, as will no doubt be appreciated by a person versed in the art, such selection criteria may

not be completely predictive as to response and there may also be a certain fraction of patients selected in this was who will not respond to the treatment.

The selection method may also apply for selecting candidates for participating in clinical studies to test the efficacy of psoriasis treatments comprising administering to patients an A ₃ AR agonist, either alone or in combination with other drugs such as methotrexate or cyclosporin. As appreciated by those versed in the art, a clinical study (also known by the terms 'clinical trial' or 'clinical protocol'), is a scientific study in human volunteers to determine how a new medicine or treatment works in human subjects. Interventional trials determine whether experimental treatments or new ways of using known therapies are safe and effective under controlled environments. It is through clinical studies that physicians find new and better ways to prevent, detect, diagnose, control, and treat illnesses. The clinical studies for which patients are selected, in accordance with the invention, based on the A ₃ AR level may be Phase I, Phase II, Phase III, Phase IV or any other type of clinical study.

BRIEF DESCRIPTION OF THE DRAWINGS

In order to understand the invention and to see how it may be carried out in practice, a preferred embodiment will now be described, by way of non-limiting example only, with reference to the accompanying drawings, in which:

Fig. 1 depicts a bar graph and corresponding Western blots showing A ₃ AR protein expression level in PBMNC from 8 psoriasis patients as compared to control; and

Fig. 2 shows an agarose gel electrophoresis of mRNA from psoriasis biopsies, stained with ethidium bromide and visualized with UV illumination.

DETAILED DESCRIPTION OF EXEMPLARY EMBODIMENTS Materials and Methods Antibodies

Rabbit polyclonal antibodies against human A ₃ AR, goat polyclonal antibodies against rabbit and goat polyclonal antibodies against β-actin were all obtained from Santa Cruz Biotechnology Inc., Ca, USA, Cat. No. 13938, and stored at 4°C.

Human blood sample collection

Blood samples were withdrawn from healthy subjects and from severe psoriasis patients, which did not respond to topical agents, and were prior to treatment with systemic drugs. The study was approved by the hospital ethical committee and the patients signed an informed consent prior to blood withdrawal. As a control we used a pool of PBMNC from 5 healthy subjects. A new pool was prepared each month.

Ficoll Hypaque separation

Blood samples (20 ml) were loaded at a ratio of 1:1 on to Ficoll Hypaque with extra care. Tubes were centrifuged at 1750rρm for 20min at room temperature

(centrifugation with break). The PBMNC layer was collected and suspended with PBS and then centrifuged at 800 rpm for 10' min at room temperature in order to get rid of platelets. Then the pellet was washed twice, dried by a gentle tapping of the tube on a towel paper and frozen at -80°C until use.

Protein extract and Quantitation

Proteins were extracted by utilizing TNN lysis buffer. The cell debris was removed by centrifugation for 10 min at 14,000 rpm. The supernatant was utilized for

WB analysis. Protein concentrations in each sample was determined using the Bio-Rad protein assay dye reagent

Western blot analysis

Equal amounts of each sample (50μg) were separated by SDS-PAGE, using 12% polyacrylamide gels. Eight lanes of each gel were loaded with protein samples of patients, one lane was loaded with the pool of control and the last lane was loaded with the Marker (for protein size determination). The resolved proteins were then electroblotted onto nitrocellulose membranes. The membranes were blocked with 5% non-fat milk in TBST buffer, incubated with the relevant primary antibody (dilution 1 :1000) for 24h at 4°C. Blots were then washed and incubated with the secondary antibody for Ih at room temperature. Bands were recorded using color development kit

(Promega, Madison, WI, USA). The membrane were stripped and incubated in the presence of the house keeping protein β-actin antibody to ensure the equal loading of

protein samples. The blots were then washed and incubated with the secondary antibody for Ih at room temperature. Bands were recorded using color development kit (Promega, Madison, WI ₅ USA).

Quantitation ofAsAR level

A ₃ AR expression level was evaluated by measuring the optical density of each relevant band utilizing an image analysis system and normalized against β-actin. The number of pixels for the pooled control sample was designated as one unit and the rest of the sample values were calculated against the control.

RT-PCR analysis of formalin-fixed paraffin-embedded tissue slides

Paraffin embedded slides from lesions of a patient with psoriasis and from normal skin biopsies were de-paraffinized in xylen. The samples were then re-hydrated by washing in serial dilutions of ethanol. After re-hydration, 20 μl of solution A [1.25XPCR buffer (200 Mm Tris-HCl, 500 mM KCl), 6.25 mM MgCl ₂ , 5 U RNasin (Promega, Madison, WI), 2mM DTT, 1 U RQl RNase-free DNase (Promega)] was directly applied on the tissue sections and then scraped off the slide and collected. The samples were subjected to DNA digestion and then the Iy sate was heated to inactivate DNase and proteinase K. One Step superscript RT-PCR (Invitrogene) using the primers for A ₃ AR: 5'-ACGGTGAGGTACCACAGCTTGTG and 3'-

ATACCGCGGGATGGCAGACC was performed. The products were electrophoresed on 2% agarose gels, stained with ethidium bromide and visualized with UV illumination. The specificity of the RT-PCR reaction was confirmed by size determination on agarose gels in comparison to a negative control, from RNA extracted using standard techniques and by sequencing the RT-PCR product and comparing the sequences to that of the known sequences (ADORA3-L77729, L77730). The optical density of the bands (Et-Br) was quantified using an image analysis system.

Results The level of A ₃ AR protein expression level in PBMNC from 8 psoriasis patients is shown in Fig. 1. It can be seen that the A3 AR protein was highly expressed in comparison to that of healthy subjects. Remarkably, an increase of 16.06±6.4 fold in A3 AR expression in the psoriasis vs, healthy subjects was noted.

The level of A ₃ AR mRNA expression in PBMNC from psoriasis patients is shown in Fig. 2. Analysis of mRNA in the paraffin embedded slides from psoriasis biopsies revealed up-regulation of mRNA expression vs. lower expression in the normal skin lesions.

Conclusions

A statistically significant increase in A ₃ AR protein expression level was recorded in the PBMNC of patients with psoriasis. Among other autoimmune diseases that were screened for A3 AR, the highest receptor level was recorded in patients with psoriasis. Direct correlation was found between protein and mRNA expression level, the latter being up-regulated in skin biopsy from psoriasis vs. those from healthy subjects.