Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
BIOMARKER
Document Type and Number:
WIPO Patent Application WO/2019/211626
Kind Code:
A1
Abstract:
The invention relates to the use of a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1) as a biomarker for identification of Clostridium difficile

Inventors:
KEEGAN, Neil (King's Gate, Newcastle upon Tyne Tyne and Wear NE1 7RU, NE1 7RU, GB)
WIPAT, Anil (King's Gate, Newcastle upon Tyne Tyne and Wear NE1 7RU, NE1 7RU, GB)
LAWRY, Beth (King's Gate, Newcastle upon Tyne Tyne and Wear NE1 7RU, NE1 7RU, GB)
MCNEIL, Calum (King's Gate, Newcastle upon Tyne Tyne and Wear NE1 7RU, NE1 7RU, GB)
FLANAGAN, Keith (King's GateNewcastle upon Tyne, Tyne and Wear NE1 7RU, GB)
SPOORS, Julia (King's GateNewcastle upon Tyne, Tyne and Wear NE1 7RU, GB)
JOHNSON, Christopher (King's GateNewcastle upon Tyne, Tyne and Wear NE1 7RU, GB)
Application Number:
GB2019/051240
Publication Date:
November 07, 2019
Filing Date:
May 03, 2019
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIVERSITY OF NEWCASTLE UPON TYNE (King's Gate, Newcastle upon Tyne Tyne and Wear NE1 7RU, NE1 7RU, GB)
International Classes:
C07K14/33; A61P31/04; C07K16/12
Domestic Patent References:
WO2012092469A22012-07-05
WO2003011161A12003-02-13
WO1996013590A21996-05-09
WO1996029605A21996-09-26
Foreign References:
IE20020097A12003-05-28
US8986697B22015-03-24
US5202238A1993-04-13
US5204244A1993-04-20
Other References:
ALI NAZARI SHIRVAN ET AL: "Isolation of recombinant antibodies directed against surface proteins of Clostridium difficile", BRAZILIAN JOURNAL OF MICROBIOLOGY, vol. 47, no. 2, 2 March 2016 (2016-03-02), BR, pages 394 - 402, XP055610268, ISSN: 1517-8382, DOI: 10.1016/j.bjm.2016.01.017
HIBA KANDALAFT ET AL: "Targeting surface-layer proteins with single-domain antibodies: a potential therapeutic approach against Clostridium difficile-associated disease", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 99, no. 20, 5 May 2015 (2015-05-05), DE, pages 8549 - 8562, XP055536670, ISSN: 0175-7598, DOI: 10.1007/s00253-015-6594-1
J. R. TICEHURST ET AL: "Effective Detection of Toxigenic Clostridium difficile by a Two-Step Algorithm Including Tests for Antigen and Cytotoxin", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 44, no. 3, 1 March 2006 (2006-03-01), US, pages 1145 - 1149, XP055610667, ISSN: 0095-1137, DOI: 10.1128/JCM.44.3.1145-1149.2006
BRUXELLE J-F ET AL: "Immunogenic properties of the surface layer precursor ofClostridium difficileand vaccination assays in animal models", ANAEROBE, LONDON, GB, vol. 37, 24 October 2015 (2015-10-24), pages 78 - 84, XP029410094, ISSN: 1075-9964, DOI: 10.1016/J.ANAEROBE.2015.10.010
NOBUAKI MORI ET AL: "Characteristics and Immunological Roles of Surface Layer Proteins in Clostridium difficile", ANNALS OF LABORATORY MEDICINE, vol. 38, no. 3, 2 February 2018 (2018-02-02), pages 189, XP055610266, ISSN: 2234-3806, DOI: 10.3343/alm.2018.38.3.189
MICHELLE M. MERRIGAN ET AL: "Surface-Layer Protein A (SlpA) Is a Major Contributor to Host-Cell Adherence of Clostridium difficile", PLOS ONE, vol. 8, no. 11, 12 November 2013 (2013-11-12), pages e78404, XP055312583, DOI: 10.1371/journal.pone.0078404
O'BRIEN J B ET AL: "Passive immunisation of hamsters against Clostridium difficile infection using antibodies to surface layer proteins", FEMS MICROBIOLOGY LETTERS, WILEY-BLACKWELL PUBLISHING LTD, GB, vol. 246, no. 2, 15 May 2005 (2005-05-15), pages 199 - 205, XP027872067, ISSN: 0378-1097, [retrieved on 20050515]
B. M. LAWRY ET AL: "Species-Specific Detection of C. difficile Using Targeted Antibody Design", ANALYTICAL CHEMISTRY, vol. 90, no. 22, 31 October 2018 (2018-10-31), US, pages 13475 - 13482, XP055610198, ISSN: 0003-2700, DOI: 10.1021/acs.analchem.8b03349
MORRISON, S. L. ET AL., PROC. NATL. ACAD SCI. USA, vol. 81, 1984, pages 6851 - 6855
RIECHMANN, L. ET AL., NATURE, vol. 332, 1988, pages 323 - 327
NEUBERGER, M. S. ET AL., NATURE, vol. 314, 1985, pages 268 - 270
LEFRANC, M.-P., CURRENT PROTOCOLS IN IMMUNOLOGY, 2000
VAN DIJK, M. A.VAN DE WINKEL, J. G., CURR. OPIN. CHEM. BIOL., vol. 5, 2001, pages 368 - 374
JAKOBOVITS, A. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 2551 - 2555
JAKOBOVITS, A. ET AL., NATURE, vol. 362, 1993, pages 255 - 258
BRUEGGEMANN, M. D. ET AL., YEAR IMMUNOL., vol. 7, 1993, pages 33 - 40
HOOGENBOOM, H. R.WINTER, G., J. MOL. BIOL., vol. 227, 1992, pages 381 - 388
MARKS, J. D. ET AL., J. MOL. BIOL., vol. 222, 1991, pages 581 - 597
COLE, A. ET AL.: "Monoclonal Antibodies and Cancer Therapy", 1985, LISS, A. R., pages: 77
BOERNER, P. ET AL., J. IMMUNOL., vol. 147, 1991, pages 86 - 95
BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426
HUSTON ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 85, 1988, pages 5879 - 5883
HUSTON, J. S., METHODS IN ENZYMOL., vol. 203, 1991, pages 46 - 88
KHAW, B. A. ET AL., J. NUCL. MED., vol. 23, 1982, pages 1011 - 1019
ROUSSEAUX ET AL.: "Methods Enzymology", vol. 121, 1986, ACADEMIC PRESS, pages: 663 - 69
JONSSON, U. ET AL., ANN. BIOL. CLIN., vol. 51, 1993, pages 19 - 26
JONSSON, U. ET AL., BIOTECHNIQUES, vol. 11, 1991, pages 620 - 627
JOHNSSON, B. ET AL., J. MOL. RECOGNIT., vol. 8, 1995, pages 125 - 131
JOHNNSON, B. ET AL., ANAL. BIOCHEM., vol. 198, 1991, pages 268 - 277
KABAT ET AL.: "Sequences of Proteins of Immunological Interest", 1991, PUBLIC HEALTH SERVICE, NATIONAL INSTITUTES OF HEALTH
NEEDLEMAN ET AL., J. MOL. BIOL., vol. 48, 1970, pages 444 - 453
MEYERS ET AL., CABIOS, vol. 4, 1989, pages 11 - 17
HARLOWLANE: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY, pages: 555 - 612
KENNEDY, J. H. ET AL., CLIN. CHIM. ACTA, vol. 70, 1976, pages 1 - 31
H. W. M. ET AL., CLIN. CHIM ACTA, vol. 81, 1977, pages 1 - 40
E. W. MARTIN: "Remington's Pharmaceutical Sciences", 1975, MACK PUBLISHING CO
ABBAS, A.K.LICHTMAN, A.H., BASIC IMMUNOLOGY: FUNCTIONS AND DISORDERS OF THE IMMUNE SYSTEM. 2ND EDN. SAUNDERS, 2004
AHMED, A.RUSHWORTH, J.V.HIRST, N.A.MILLNER, P.A.: "Biosensors for Whole-Cell Bacterial Detection", CLINICAL MICROBIOLY REVIEWS, vol. 27, no. 3, 2014, pages 631 - 646, XP055419743, DOI: doi:10.1128/CMR.00120-13
AKERSTROM, B.BRODIN, T.REIS, K.BJORCK, L.: "Protein G: A powerful tool for binding and detection of monoclonal and polyclonal antibodies", JOURNAL OF IMMUNOLOGY, vol. 135, no. 4, 1985, pages 2589 - 2592, XP002658085
AKHTER, S.AZIZ, R.K.EDWARDS, R.A.: "PhiSpy: a novel algorithm for finding prophages in bacterial genomes that combines similarity- and composition-based strategies", NUCLEIC ACIDS RES, vol. 40, no. 16, 2012, pages el26
AL-NASSIR, W.N.SETHI, A.K.LI, Y.PULTZ, M.J.RIGGS, M.M.DONSKEY, C.J.: "Both Oral Metronidazole and Oral Vancomycin Promote Persistent Overgrowth of Vancomycin-Resistant Enterococci during Treatment of Clostridium difficile-Associated Disease", ANTIMRICROBIAL AGENTS AND CHEMOTHERAPY, vol. 52, no. 7, 2008, pages 2403 - 6
ALFA, M.J.LO, E.WALD, A.DUECK, C.DEGAGNE, P.HARDING, G.K.: "Improved eradication of Clostridium difficile spores from toilets of hospitalized patients using an accelerated hydrogen peroxide as the cleaning agent.", BMC INFECT DIS., vol. 10, 2010, pages 268 - 77
ALLISON, D.B.CUI, X.PAGE, G.PSABRIPOUR, M.: "Microarray data analysis: from disarray to consolidation and consensus", NAT REV GENET, vol. 7, no. 1, 2006, pages 55 - 65, XP009100551, DOI: doi:10.1038/nrg1749
ALTSCHUL, S.F.GISH, W.MILLER, W.MYERS, E.W.LIPMAN, D.J.: "Basic local alignment search tool", JOURNAL OF MOLECULAR BIOLOGY, vol. 215, no. 3, 1990, pages 403 - 410, XP002949123, DOI: doi:10.1006/jmbi.1990.9999
ALTSCHUL, S.F.MADDEN, T.L.SCHAFFER, A.A.ZHANG, J.ZHANG, Z.MILLER, W.LIPMAN, DJ.: "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", NUCLEIC ACIDS RESEARCH, vol. 25, no. 17, 1997, pages 3389 - 402, XP002905950, DOI: doi:10.1093/nar/25.17.3389
ARLETT, J.MYERS, E.ROUKES, M.: "Comparative advantages of mechanical biosensors", NAT NANOTECHNOL, vol. 6, no. 4, 2011, XP055116692, DOI: doi:10.1038/nnano.2011.44
AUSIELLO, C.M.CERQUETTI, M.FEDELE, G.SPENSIERI, F.PALAZZO, R.NASSO, M.FREZZA, S.MASTRANTONIO, P.: "Surface layer proteins from Clostridium difficile induce inflammatory and regulatory cytokines in human monocytes and dendritic cells", MICROBES AND INFECTION, vol. 8, no. 11, 2006, pages 2640 - 6, XP028072254, DOI: doi:10.1016/j.micinf.2006.07.009
BABAKHANI, F.BOUILLAUT, L.GOMEZ, A.SEARS, P.NGUYEN, L.SONENSHEIN, A.L.: "Fidaxomicin Inhibits Spore Production in Clostridium difficile", CLIN INFECT DIS., vol. 55, no. 2, 2012, pages 162 - 9
BARBUT, F.SURGERS, L.ECKERT, C.VISSEAUX, B.CUINGNET, M.MESQUITA, C.PRADIER, N.THIRIEZ, A.AIT-AMMAR, N.AIFAOUI, A.: "Does a rapid diagnosis of Clostridium difficile infection impact on quality of patient management?", CLINICAL MICROBIOLOGY AND INFECTION, vol. 20, no. 2, 2014, pages 136 - 144
BARRA-CARRASCO, J.HERNANDEZ-ROCHA, C.MIRANDA-CARDENAS, C.ALVAREZ-LOBOS, M.GUZMAN DURAN, A.M.PAREDES-SABJA, D.: "Diagnostic accuracy of a multiplex real-time PCR to predict Clostridium difficile ribotype 027", ANAEROBE, 2013
BARRETT, T.TROUP, D.B.WILHITE, S.E.LEDOUX, P.EVANGELISTA, C.KIM, I.F.TOMASHEVSKY, M.MARSHALL, K.A.PHILLIPPY, K.H.SHERMAN, P.M.: "NCBI GEO: archive for functional genomics data sets--10 years on", NUCLEIC ACIDS RES, vol. 39, 2011, pages D1005 - 10, XP055067018, DOI: doi:10.1093/nar/gkq1184
BARTLETT, J.G.: "Clostridium difficile: Old and New Observations", JOURNAL OF CLINICAL GASTROENTEROLOGY, vol. 41, 2007, pages S24 - S29
BARTLETT, J.G.CHANG, T.W.GURWITH, M.GORBACH, S.L.ONDERDONK, A.B.: "Antibiotic-associated pseudomembranous colitis due to toxin-producing clostridia", N ENGL J MED, vol. 298, no. 10, 1978, pages 531 - 4
BARTLETT, J.G.GERDING, D.N.: "Clinical Recognition and Diagnosis of Clostridium difficile Infection", CLIN INFECT DIS., vol. 46, no. 1, 2008, pages 12 - 28
BARTLETT, J.G.MOON, N.T.W.CHANG, T.W.TAYLOR, N.ONDERDONK, A.B.: "Role of Clostridium difficile in antibiotic-associated pseudomembranous colitis", GASTROENTEROLOGY, vol. 75, 1978, pages 778 - 782
BARTSCH, S.M.UMSCHEID, C.A.FISHMAN, N.LEE, B.Y.: "Is Fidaxomicin worth the cost? An economic analysis", CLIN INFECT DIS., 2013
BECKMANN, B.M.GRUNWELLER, A.WEBER, M.H.W.HARTMANN, R.K.: "Northern blot detection of endogenous small RNAs (-14 nt) in bacterial total RNA extracts", NUCLEIC ACIDS RES, vol. 38, no. 14, 2010, pages e147
BERGLUND, L.ANDRADE, J.ODEBERG, J.UHLEN, M.: "The epitope space of the human proteome", PROTEIN SCIENCE, vol. 17, no. 4, 2008, pages 606 - 613, XP055176015, DOI: doi:10.1110/ps.073347208
BETTELHEIM, F.BROWN, W.CAMPBELL, M.FARRELL, S.TORRES, O.: "Introduction to General, Organic and Biochemistry", 11TH EDITION EDN. CENGAGE LEARNING, 2015
BHALLA, A.ARON, D.C.DONSKEY, C.J.: "Staphylococcus aureus intestinal colonization is associated with increased frequency of S. aureus on skin of hospitalized patients", BMC INFECT DIS, vol. 7, 2007, pages 105, XP021028884, DOI: doi:10.1186/1471-2334-7-105
BIDET, P.B., FLALANDE, VBURGHOFFER, BPETIT, JC.: "Development of a new PCR-ribotyping method for Clostridium difficile based on ribosomal RNA gene sequencing", FEMS MICROBIOLOGY LETTERS, vol. 175, 1999, pages 261 - 266, XP002481178, DOI: doi:10.1111/j.1574-6968.1999.tb13629.x
BOBROVNIK, S.A.: "Determination of antibody affinity by ELISA. Theory", J BIOCHEM BIOPHYS METHODS, vol. 57, no. 3, 2003, pages 213 - 36, XP055044251, DOI: doi:10.1016/S0165-022X(03)00145-3
BOETZKES, A.FELKEL, K.W.ZEISER, J.JOCHIM, N.JUST, I.PICH, A.: "Secretome analysis of Clostridium difficile strains", ARCH MICROBIOL, vol. 194, no. 8, 2012, pages 675 - 87
BOLANOS, B.BODON, Q.JIMENEZ, T.GARCIA-MAYOL, D.LAVERGNE, J.A.DIAZ, A.M.: "Analysis by fluorescence microscopy and flow cytometry of monoclonal antibodies produced against cell surface antigens", P R HEALTH SCI J, vol. 7, no. 1, 1988, pages 35 - 8
BOONE, J.H.LYERLY, D.M.CARMAN, R.J., CLOSTRIDIUM DIFFICILE DEHYDROGENASE AND TOXIN AS A BIOMARKER, 2013
BRADSHAW, C.S.MORTON, A.N.GARLAND, S.M.HORVATH, L.B.KUZEVSKA, I.FAIRLEY, C.K.: "Evaluation of a point-of-care test, BVBlue, and clinical and laboratory criteria for diagnosis of bacterial vaginosis", J CLIN MICROBIOL, vol. 43, no. 3, 2005, pages 1304 - 8
BRADSHAW, W.J.KIRBY, J.M.THIYAGARAJAN, N.CHAMBERS, C.J.DAVIES, A.H.ROBERTS, A.K.SHONE, C.C.ACHARYA, K.R.: "The structure of the cysteine protease and lectin-like domains of Cwp84, a surface layer-associated protein from Clostridium difficile", ACTA CRYSTALLOGR D BIOL CRYSTALLOGR, vol. 70, 2014, pages 1983 - 93
BRANDT, L.J.: "Fecal Transplantation for the Treatment of Clostridium difficile Infection", GASTROENTEROL HEPATOL, vol. 8, no. 3, 2012, pages 191 - 4
BRAVO, A.CASES, M.QUERALT-ROSINACH, N.SANZ, F.FURLONG, L.I.: "A knowledge-driven approach to extract disease-related biomarkers from the literature", BIOMED RES INT, 2014, pages 253128
BRAZIER, J.S.RAYBOULD, R.PATEL, B.DUCKWORTH, G.PEARSON, A.CHARLETT, A.DUERDEN, B.I.NETWORK., H.R.M.: "Distribution and antimicrobial susceptibility patterns of Clostridium difficile PCR ribotypes in English hospitals, 2007-08", EURO SURVEILLANCE, vol. 13, no. 41, 2008, pages 19000
BRECHER, S.M.NOVAK-WEEKLEY, S.M.NAGY, E.: "Laboratory diagnosis of Clostridium difficile infections: there is light at the end of the colon", CLIN INFECT DIS, vol. 57, no. 8, 2013, pages 1175 - 81
BROCCHIERI, L.KARLIN, S.: "Protein length in eukaryotic and prokaryotic proteomes", NUCLEIC ACIDS RES, vol. 33, no. 10, 2005, pages 3390 - 400
BRYANT, K.MCDONALD, L.C.: "Clostridium difficile Infections in Children", PEDIATRIC INFECTIOUS DISEASES, vol. 28, 2009, pages 145 - 146
BUCHAN, B.W.LEDEBOER, N.A.: "Emerging Technologies for the Clinical Microbiology Laboratory", CLIN MICROBIOL REVIEW, vol. 27, no. 4, 2014, pages 783 - 822
BUCKLEY, A.M.SPENCER, J.CANDLISH, D.IRVINE, J.J.DOUCE, G.R.: "Infection of hamsters with the UK Clostridium", J MED MICROBIOL, vol. 60, 2011, pages 1174 - 80
BUFFIE, C.G.JARCHUM, I.EQUINDA, M.LIPUMA, L.GOBOURNE, A.VIALE, A.UBEDA, C.XAVIER, J.PAMER, E.G.: "Profound alterations of intestinal microbiota following a single dose of clindamycin results in sustained susceptibility to Clostridium difficile-induced colitis", INFECT IMMUN., vol. 80, no. 1, 2012, pages 62 - 73
BURNHAM, C.D.CARROLL, K.C.: "Diagnosis of Clostridium difficile Infection: an Ongoing Conundrum for Clinicians and for Clinical Laboratories", AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 26, no. 3, 2013, pages 604 - 630
BUSTIN, S.A.: "Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems", J MOL ENDOCRINOL, vol. 29, no. 1, 2002, pages 23 - 39, XP002323362, DOI: doi:10.1677/jme.0.0290023
BYRNE, B.STACK, E.GILMARTIN, N.O'KENNEDY, R.: "Antibody-Based Sensors: Principles, Problems and Potential for Detection of Pathogens and Associated Toxins", SENSORS (BASEL), vol. 9, no. 6, 2009, pages 4407 - 45, XP002714546, DOI: doi:10.3390/s90604407
CALABI, E.CALABI, F.PHILLIPS, A.D.FAIRWEATHER, N.F.: "Binding of Clostridium difficile Surface Layer Proteins to Gastrointestinal Tissues", INFECTION AND IMMUNOLOGY, vol. 70, no. 10, 2002, pages 5770 - 5778
CALABI, E.FAIRWEATHER, N.: "Patterns of sequence conservation in the S-Layer proteins and related sequences in Clostridium difficile", J BACTERIOL, vol. 184, no. 14, 2002, pages 3886 - 97
CALABI, E.WARD, S.WREN, B.PAXTON, T.PANICO, M.MORRIS, H.R.DELL, A.DOUGAN, G.FAIRWEATHER, N.: "Molecular characterization of the surface layer proteins from Clostridium difficile", MOLECULAR MICROBIOLOGY, vol. 40, no. 5, 2001, pages 1187 - 99, XP002946325, DOI: doi:10.1046/j.1365-2958.2001.02461.x
CALDERARO, A.BUTTRINI, M.MARTINELLI, M.GORRINI, C.MONTECCHINI, S.MEDICI, M.C.ARCANGELETTI, M.C.DE CONTO, F.COVAN, S.CHEZZI, C.: "Comparative analysis of different methods to detect Clostridium difficile infection", NEW MICORBIOLOGICA, vol. 36, no. 1, 2013, pages 57 - 63
CAMMAROTA, G.LANIRO, G.GASBARRINI, A.: "Fecal microbiota transplantation for the treatment of Clostridium difficile infection: a systematic review", JOURNAL OF CLINICAL GASTROENTEROLOGY, vol. 48, no. 8, 2014, pages 693 - 702
CARROLL, K.C.BARTLETT, J.G.: "Biology of Clostridium difficile: implications for epidemiology and diagnosis", ANNU REV MICROBIOL, vol. 65, 2011, pages 501 - 21, XP055192583, DOI: doi:10.1146/annurev-micro-090110-102824
CARTER, G.P.DOUCE, G.R.GOVIND, R.HOWARTH, P.M.MACKIN, K.E.SPENCER, J.BUCKLEY, A.M.ANTUNES, A.KOTSANAS, D.JENKIN, G.A.: "The Anti-Sigma Factor TcdC Modulates Hypervirulence in an Epidemic BI/NAP1/027 Clinical Isolate of Clostridium difficile", PLOS PATHOG, vol. 7, no. 10, 2011, pages e1002317
CARTMAN, S.T.HEAP, J.T.KUEHNE, S.A.COCKAYNE, A.MINTON, N.P.: "The emergence of 'hypervirulence' in Clostridium difficile", INTERNATIONAL JOURNAL OF MEDICAL MICROBIOLOGY, vol. 300, no. 6, 2010, pages 387 - 395, XP002608408, DOI: doi:10.1016/j.ijmm.2010.04.008
CARVER, T.J.RUTHERFORD, K.M.BERRIMAN, M.RAJANDREAM, M.A.BARRELL, B.G.PARKHILL, J.: "ACT: the Artemis Comparison Tool", BIOINFORMATICS, vol. 21, no. 16, 2005, pages 3422 - 3
CERQUETTI, M.MOLINARI, A.SEBASTIANELLI, A.DIOCIAIUTI, M.PETRUZZELLI, R.CAPO, C.MASTRANTONIO, P.: "Characterization of surface layer proteins from different Clostridium difficile clinical isolates", MICROBIAL PATHOGENESIS, vol. 28, no. 6, 2000, pages 363 - 372, XP002946324, DOI: doi:10.1006/mpat.2000.0356
CERQUETTI, M.SERAFINO, A.SEBASTIANELLI, A.MASTRANTONIO, P.: "Binding of Clostridium difficile to Caco-2 epithelial cell line and to extracellular matrix proteins", FEMS IMMUNOL. MED. MICROBIOL, vol. 32, 2002, pages 211 - 218
CHAMES, P.VAN REGENMORTEL, M.WEISS, EBATY, D.: "Therapeutic antibodies: successes, limitations and hopes for the future", BR J PHARMACOL, vol. 157, no. 2, 2009, pages 220 - 33, XP002714017, DOI: doi:10.1111/j.1476-5381.2009.00190.x
CHANG, J.Y.ANTONOPOULOS, D.A.KALRA, A.TONELLI, A.KHALIFE, W.T.SCHMIDT, T.M.YOUNG, V.B.: "Decreased diversity of the fecal Microbiome in recurrent Clostridium difficile-associated diarrhea", JOURNAL OF INFECTIOUS DISEASE, vol. 197, no. 3, 2008, pages 435 - 8
CHAPETONMONTES, D.CANDELA, T.COLLIGNON, A.JANOIR, C.: "Localization of the Clostridium difficile cysteine protease Cwp84 and insights into its maturation process", J BACTERIOL, vol. 193, no. 19, 2011, pages 5314 - 21
CHIODO, F.MARRADI, M.TEFSEN, B.SNIPPE, H.VAN DIE, I.PENADES, S.: "High sensitive detection of carbohydrate binding proteins in an ELISA-solid phase assay based on multivalent glyconanoparticles", PLOS ONE, vol. 8, no. 8, 2013, pages e73027
CHOUDHURI, S.: "Bioinformatics for Beginners: Genes, Genomes, Molecular Evolution, Databases and Analytical Tools", 2014, ELSIEVER
CLABOTS, C.R.JOHNSON, S.OLSON, M.M.PETERSON, L.R.GERDING, D.N.: "Acquisition of Clostridium difficile by Hospitalized Patients: Evidence for Colonized New Admissions as a Source of Infection", THE JOURNAL OF INFECTIOUS DISEASES, vol. 166, no. 3, 1992, pages 561 - 597
CLARK, L.C.LYONS, C.: "ELECTRODE SYSTEMS FOR CONTINUOUS MONITORING IN CARDIOVASCULAR SURGERY", ANNALS OF THE NEW YORK ACADEMY OF SCIENCES, vol. 102, 1962, pages 29 - 45
CLARKE, S.FOSTER, J.R.: "A history of blood glucose meters and their role in self-monitoring of diabetes mellitus", BRITISH JOURNAL OF BIOMEDICAL SCIENCE, vol. 69, no. 2, 2012, pages 83 - 93
COHEN, S.H.GERDING, D.N.JOHNSON, S.KELLY, C.P.LOO, V.G.MCDONALD, L.C.PEPIN, J.WILCOX, M.H.: "Clinical practice guidelines for Clostridium difficile infection in adults: 2010 update by the society for healthcare epidemiology of America (SHEA) and the infectious diseases society of America (IDSA", INFECTION CONTROL HOSPITAL EPIDEMIOLOGY, vol. 31, no. 5, 2010, pages 431 - 55, XP055144254, DOI: doi:10.1086/651706
COLLINS, L.E.LYNCH, M.MARSZALOWSKA, I.KRISTEK, M.ROCHFORT, K.O'CONNELL, M.WINDLE, H.KELLEHER, D.LOSCHER, C.E.: "Surface layer proteins isolated from Clostridium difficile induce clearance responses in macrophages", MICROBES INFECT, vol. 16, no. 5, 2014, pages 391 - 400
COMMICHAU, F.M.GUNKA, K.LANDMANN, J.J.STIILKE, J.: "Glutamate Metabolism in Bacillus subtilis: Gene Expression and Enzyme Activities Evolved To Avoid Futile Cycles and To Allow Rapid Responses to Perturbations of the System", J BACTERIOL, vol. 190, no. 10, 2008, pages 3557 - 64
COONS, A.H.CREECH, H.J.JONES, R.N.: "Immunological properties of an antibody containing a fluorescent group", EXPERIMENTAL BIOLOGY AND MEDICINE, vol. 47, no. 2, 1941, pages 200 - 202
COONS, A.H.KAPLAN, M.H.: "Localization of antigen in tissue cells. II. Improvements in a method for the detection of antigen by means of fluorescent antibody", THE JOURNAL OF EXPERIMENTAL MEDICINE, vol. 91, no. 1, 1950, pages 1 - 13, XP002576162, DOI: doi:10.1084/jem.91.1.1
COUCHMAN, E.C.BROWNE, H.P.DUNN, M.LAWLEY, T.D.SONGER, J.G.HALL, V.PETROVSKA, L.VIDOR, C.AWAD, M.LYRAS, D.: "Clostridium sordellii genome analysis reveals plasmid localized toxin genes encoded within pathogenicity loci", BMC GENOMICS, vol. 16, 2015, pages 392, XP021222430, DOI: doi:10.1186/s12864-015-1613-2
CRAIG, N.L.COHEN-FIX, O.GREEN, R.GREIDER, C.W.STORZ, G.WOLBERGER, C.: "Molecular Biology. Principles of Genome function", 2010, OCFORD UNIVERSITY PRESS
CROBACH, M.J.DEKKERS, O.M.WILCOX, M.H.KUIJPER, E.J.: "European Society of Clinical Microbiology and Infectious Diseases (ESCMID): data review and recommendations for diagnosing Clostridium difficile-infection (CDI", CLIN MICROBIOL INFECT, vol. 15, no. 12, 2009, pages 1053 - 66
CROOK, D.W.WALKER, A.S.KEAN, Y.WEISS, K.COMELY, O.A.MILLER, M.A.ESPOSITO, R.LOUIE, T.J.STOESSER, N.E.YOUNG, B.C.: "Fidaxomicin versus vancomycin for Clostridium difficiie infection: meta-analysis of pivotal randomized controlled trials", CLIN INFECT DIS., vol. 55, no. 2, 2012, pages 93 - 103
CULBREATH, K.AGER, E.NEMEYER, R.J.KERR, A.GILLIGAN, P.H: "Evolution of Testing Algorithms at a University Hospital for Detection of Clostridium difficile Infections", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 50, no. 9, 2012, pages 3073 - 6
DALBEY, R.E.WANG, P.VAN DIJL, J.M.: "Membrane proteases in the bacterial protein secretion and quality control pathway", MICROBIOL MOL BIOL REV, vol. 76, no. 2, 2012, pages 311 - 30
DANG, T.H.DE LA RIVA, L.FAGAN, R.P.STORCK, E.M.HEAL, W.P.JANOIR, C.FAIRWEATHER, N.F.TATE, E.W.: "Chemical probes of surface layer biogenesis in Clostridium difficile", ACS CHEM BIOL, vol. 5, no. 3, 2010, pages 279 - 85
DANG, T.H.T.FAGAN, R.P.FAIRWEATHER, N.F.TATE, E.W.: "Novel inhibitors of surface layer processing in Clostridium difficile", BIOORGANIC AND MEDICINAL CHEMISTRY, vol. 20, 2012, pages 614 - 621
DAVIES, A.H.ROBERTS, A.K.SHONE, C.C.ACHARYA, K.R.: "Super toxins from a super bug: structure and function of Clostridium difficile toxins", THE BIOCHEMICAL JOURNAL, vol. 436, no. 3, 2011, pages 517 - 26
DAVIES, K.A.BERRY, C.E.MORRIS, K.A.SMITH, R.YOUNG, S.DAVIS, T.E.FULLER, D.D.BUCKNER, R.J.WILCOX, M.H.: "Comparison of the Vidas C. difficile GDH Automated Enzyme-Linked Fluorescence Immunoassay (ELFA) with Another Commercial Enzyme Immunoassay (EIA) (Quik Chek-60), Two Selective Media, and a PCR Assay for gluD for Detection of Clostridium difficile in Fecal Samples", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 53, no. 6, 2015, pages 1931 - 4
DAWSON, L.F.VALIENTE, E.DONAHUE, E.H.BIRCHENOUGH, G.WREN, B.W.: "Hypervirulent Clostridium difficile PCR-ribotypes exhibit resistance to widely used disinfectants", PLOS ONE, vol. 6, no. 10, 2011, pages e25754
DE GRUTTOLA, V.G.CLAX, P.DEMETS, D.L.DOWNING, G.J.ELLENBERG, S.S.FRIEDMAN, L.GAIL, M.H.PRENTICE, R.WITTES, J.ZEGER, S.L.: "Considerations in the evaluation of surrogate endpoints in clinical trials. summary of a National Institutes of Health workshop", CONTROL CLIN TRIALS, vol. 22, no. 5, 2001, pages 485 - 502
DE LA RIVA, L.WILLING, S.E.TATE, E.W.FAIRWEATHER, N.F.: "Roles of Cysteine Proteases Cwp84 and Cwpl3 in Biogenesis of the Cell Wall of Clostridium difficile", JOURNAL OF BACTERIOLOGY, vol. 193, no. 13, 2011, pages 3276 - 85, XP003030989, DOI: doi:10.1128/JB.00248-11
DEJESUS, M.A.LOERGER, T.R.: "A Hidden Markov Model for identifying essential and growth-defect regions in bacterial genomes from transposon insertion sequencing data", BMC BIOINFORMATICS, vol. 14, 2013, pages 303, XP021162986, DOI: doi:10.1186/1471-2105-14-303
DELMEE, M.VAN BROECK, J.SIMON, A.JANSSENS, M.AVESANI, V.: "Laboratory diagnosis of Clostridium difficile-associated diarrhoea: a plea for culture", JOURNAL OF MEDICAL MICROBIOLOGY, vol. 54, 2005, pages 187 - 91
DEMAREST, S.J.HARIHARAN, M.ELIA, M.SALBATO, J.JIN, P.BIRD, C.SHORT, J.M.KIMMEL, B.E.DUDLEY, M.WOODNUTT, G.: "Neutralization of Clostridium difficile toxin A using antibody combinations", MABS, vol. 2, no. 2, 2010, pages 190 - 8, XP002695487, DOI: doi:10.4161/mabs.2.2.11220
DEMBEK, M.BARQUIST, L.BOINETT, C.J.CAIN, A.K.MAYHO, M.LAWLEY, T.D.FAIRWEATHER, N.F.FAGAN, R.P.: "High-throughput analysis of gene essentiality and sporulation", CLOSTRIDIUM DIFFICILE', MBIO, vol. 6, no. 2, 2015, pages e02383
DETHLEFSEN, L.HUSE, S.SOGIN, M.L.RELMAN, D.A.: "The pervasive effects of an antibiotic on the human gut microbiota, as revealed by deep 16S rRNA sequencing", PLOS BIOLOGY, vol. 6, no. 11, 2008, pages e280, XP008150420, DOI: doi:10.1371/journal.pbio.0060280
DINGLE, K.E.DIDELOT, X.ANSARI, M.A.EYRE, D.W.VAUGHAN, A.GRIFFITHS, D.IP, C.L.BATTY, E.M.GOLUBCHIK, T.BOWDEN, R.: "Recombinational Switching of the Clostridium difficile S-Layer and a Novel Glycosylation Gene Cluster Revealed by Large-Scale Whole-Genome Sequencing", JOURNAL OF INFECTIOUS DISEASE, vol. 207, no. 4, 2013, pages 675 - 86
DONALD, R.G.K.FLINT, M.KALYAN, N.JOHNSON, E.WITKO, S.E.KOTASH, C.ZHAO, P.MEGATI, S.YURGELONIS, I.LEE, P.K.: "A novel approach to generate a recombinant toxoid vaccine against Clostridium difficile", MICROBIOLOGY, vol. 159, 2013, pages 1254 - 66, XP055095934, DOI: doi:10.1099/mic.0.066712-0
DREKONJA, D.REICH, J.GEZAHEGN, S.GREER, N.SHAUKAT, A.MACDONALD, R.RUTKS, I.WILT, T.J.: "Fecal Microbiota Transplantation for Clostridium difficile Infection: A Systematic Review of the Evidence", ANN INTERN MED, vol. 162, no. 9, 2015, pages 630 - 8
DRUDY, D.CALABI, E.KYNE, L.SOUGIOULTZIS, S.KELLY, E.FAIRWEATHER, N.KELLY, C.P.: "Human antibody response to surface layer proteins in Clostridium difficile infection", FEMS IMMUNOL MED MICROBIOL, vol. 41, no. 3, 2004, pages 237 - 42
DRUDY, D.O'DONOGHUE, D.P.BAIRD, A.FENELON, L.O'FARRELLY, C.: "Flow cytometric analysis of Clostridium difficile adherence to human intestinal epithelial cells", JOURNAL OF MEDICAL MICROBIOLOGY, vol. 50, no. 6, 2001, pages 526 - 34
EASTWOOD, K.ELSE, P.CHARLETT, A.WILCOX, M.: "Comparison of Nine Commercially Available Clostridium difficile Toxin Detection Assays, a Real-Time PCR Assay for C. difficile tcdB, and a Glutamate Dehydrogenase Detection Assay to Cytotoxin Testing and Cytotoxigenic Culture Methods", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 47, no. 10, 2009, pages 3211 - 17, XP055216106, DOI: doi:10.1128/JCM.01082-09
ECKER, D.J.SAMPATH, R.MASSIRE, C.BLYN, L.B.HALL, T.A.ESHOO, M.W.HOFSTADLER, S.A.: "Ibis T5000: a universal biosensor approach for microbiology", NOT REV MICROBIOL, vol. 6, no. 7, 2008, pages 553 - 8, XP009125218
ECKERT, C.EMIRIAN, A.LE MONNIER, A.CATHALA, L.DE MONTCLOS, H.GORET, J.BERGER, P.PETIT, A.DE CHEVIGNY, A.JEAN-PIERRE, H.: "Prevalence and pathogenicity of binary toxin-positive Clostridium difficile strains that do not produce toxins A and B", NEW MICROBES AND NEW INFECTIONS, vol. 3, 2014, pages 12 - 17
EDGAR, R.DOMRACHEV, M.LASH, A.E.: "Gene Expression Omnibus: NCBI gene expression and hybridization array data repository", NUCLEIC ACIDS RES, vol. 30, no. 1, 2002, pages 207 - 10
EDGAR, R.C.: "MUSCLE: a multiple sequence alignment method with reduced time and space complexity", BMC BIOINFORMATICS, vol. 5, 2004, pages 113, XP021000496, DOI: doi:10.1186/1471-2105-5-113
EGLOW, R.POTHOULAKIS, C.ITZKOWITZ, S.ISRAEL, E.J.O'KEANE, C.J.GONG, D.GAO, N.XU, Y.L.WALKER, W.A.LAMONT, J.T.: "Diminished C. difficile toxin A sensitivity in newborn rabbit ileum is associated with decreased toxin A receptor", J CLIN INVEST, vol. 90, no. 3, 1992, pages 822 - 829
EIDHIN, D.N.RYAN, A.W.DOYLE, R.M.WALSH, J.B.KELLEHER, D.: "Sequence and phylogenetic analysis of the gene for surface layer protein, slpA, from 14 PCR ribotypes of Clostridium difficile", J MED MICROBIOL, vol. 55, 2006, pages 69 - 83
ELGERT, K.D.: "Immunology: Understanding The Immune System", 2009, WILEY-BLACKWELL
EMBL-EBI, EUROPEAN NUCLEOTIDE ARCHIVE - STATISCTICS, 14 December 2015 (2015-12-14), Retrieved from the Internet
EMERSON, D.AGULTO, L.LIU, H.LIU, L.: "Identifying and Characterizing Bacteria in an Era of Genomics and Proteomics", BIOSCIENCE, vol. 58, no. 10, 2008, pages 925 - 936
EMERSON, J.FAIRWEATHER, N.: "Surface structures of C. difficile and other clostridia: implications for pathogenesis and immunity", 2009, CAISTER ACADEMIC PRESS
EMERSON, J.E.REYNOLDS, C.B.FAGAN, R.P.SHAW, H.A.GOULDING, D.FAIRWEATHER, N.F.: "A novel genetic switch controls phase variable expression of CwpV, a Clostridium diffícile cell wall protein", MOL MICROBIOL,, vol. 74, no. 3, 2009, pages 541 - 56
ENGVALL, E.PERLMANN, P.: "Enzyme-linked immunosorbent assay (ELISA). Quantitative assay of immunoglobulin G", IMMUNOCHEMISTRY, vol. 8, 1971, pages 871 - 874, XP023936771, DOI: doi:10.1016/0019-2791(71)90454-X
ENRIGHT, A.J.OUZOUNIS, C.A.: "Biolayout--an automatic graph layout algorithm for similarity visualization", BIOINFORMATICS, vol. 17, no. 9, 2001, pages 853 - 4
ENTZIAN, C.SCHUBERT, T.: "Studying small molecule-aptamer interactions using MicroScale Thermophoresis (MST", METHODS, 2015
ETHAPA, T.LEUZZI, R.NG, Y.K.BABAN, S.T.ADAMO, R.KUEHNE, S.A.SCARSELLI, M.MINTON, N.P.SERRUTO, D.UNNIKRISHNAN, M.: "Multiple factors modulate biofilm formation by the anaerobic pathogen Clostridium difficile", J BACTERIOL, vol. 195, no. 3, 2013, pages 545 - 55
EVANS, C.T.SAFDAR, N.: "Current Trends in the Epidemiology and Outcomes of Clostridium diffícile Infection", CLIN INFECT DIS., vol. 60, no. 2, 2015, pages S66 - S71
EYRE, D.W.WALKER, A.S.GRIFFITHS, D.WILCOX, M.H.WYLLIE, D.H.DINGLE, K.E.CROOK, D.W.PETO, T.E.: "Clostridium difficile mixed infection and reinfection", J CLIN MICROBIOL.,, vol. 50, no. 1, 2012, pages 142 - 4
FAGAN, R.P.ALBESA-JOVE, D.QAZI, 0.SVERGUN, D.I.BROWN, K.A.FAIRWEATHER, N.F.: "Structural insights into the molecular organization of the S-layer from Clostridium difficile", MOLECULAR MICROBIOLOGY, vol. 71, no. 5, 2009, pages 1308 - 22
FAGAN, R.P.FAIRWEATHER, N.F.: "Clostridium difficile Has Two Parallel and Essential Sec Secretion Systems", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 286, no. 31, 2011, pages 27483 - 27493
FAGAN, R.P.JANOIR, C.COLLIGNON, A.MASTRANTONIO, P.POXTON, I.R.FAIRWEATHER, N.F.: "A proposed nomenclature for cell wall proteins of Clostridium difficile", J MED MICROBIOL, vol. 60, 2011, pages 1225 - 8
FAGERQUIST, C.K.: "Top-down proteomic identification of bacterial protein biomarkers and toxins using MALDI-TOF-TOF-MS/MS and post-source decay", REVIEWS IN ANALYTICAL CHEMISTRY, vol. 32, no. 2, 2013, pages 127 - 133
FLANAGAN, K.COCKELL, S.HARWOOD, C.HALLINAN, J.NAKJANG, S.LAWRY, B.WIPAT, A.: "A distributed computational search strategy for the identification of diagnostics targets: application to finding aptamer targets for methicillin-resistant staphylococci", J INTEGR BIOINFORM, vol. 11, no. 2, 2014, pages 242
FOGLIA, G.SHAH, S.LUXEMBURGER, C.PIETROBON, P.J.: "Clostridium difficile: Development of a novel candidate vaccine", VACCINE, vol. 30, no. 29, 2012, pages 4307 - 9, XP055060922, DOI: doi:10.1016/j.vaccine.2012.01.056
FORDTRAN, J.S.: "Colitis due to Clostridium difficile toxins: underdiagnosed, highly virulent, and nosocomial", PROC (BAYL UNIV MED CENT), vol. 19, no. 1, 2006, pages 3 - 12
FRASER, T.G.SWIENCICKI, J.F., CLOSTRIDIUM DIFFICILE, 26 May 2013 (2013-05-26), Retrieved from the Internet
FREIBERG, C.BRUNNER, N.MACKO, L.FISCHER, H.P.: "Discovering antibiotic efficacy biomarkers: toward mechanism-specific high content compound screening", MOL CELL PROTEOMICS, vol. 5, no. 12, 2006, pages 2326 - 35
FREIFELD, A.G.SIMONSEN, K.A.BOOTH, C.S.ZHAO, X.WHITNEY, S.E.KARRE, T.IWEN, P.C.VILJOEN, H.J.: "A new rapid method for Clostridium difficile DNA extraction and detection in stool: toward point-of-care diagnostic testing", JOURNAL OF MOLECULAR DIAGNOSTICS, vol. 14, no. 3, 2012, pages 274 - 9, XP008159229, DOI: doi:10.1016/j.jmoldx.2012.01.003
FRIGUET, B.CHAFFOTTE, A.F.DJAVADI-OHANIANCE, L.GOLDBERG, M.E.: "Measurements of the true affinity constant in solution of antigen-antibody complexes by enzyme-linked immunosorbent assay", J IMMUNOL METHODS, vol. 77, no. 2, 1985, pages 305 - 19, XP023974579, DOI: doi:10.1016/0022-1759(85)90044-4
GALARDINI, M.BIONDI, E.G.BAZZICALUPO, M.MENGONI, A.: "CONTIGuator: a bacterial genomes finishing tool for structural insights on draft genomes", SOURCE CODE BIOL MED, vol. 6, 2011, pages 11, XP021104143, DOI: doi:10.1186/1751-0473-6-11
GALDYS, A.L.NELSON, J.S.SHUTT, K.A.SCHLACKMAN, J.L.PAKSTIS, D.L.PASCULLE, A.W.MARSH, J.W.HARRISON, L.H.CURRY, S.R.: "Prevalence and duration of asymptomatic Clostridium difficile carriage among healthy subjects in Pittsburgh, Pennsylvania", THE JOURNAL OF CLINICAL MICROBIOLOGY, vol. 52, no. 7, 2014, pages 2406 - 2409
GAN, S.D.PATEL, K.R.: "Enzyme Immunoassay and Enzyme-Linked Immunosorbent Assay", J INVEST DERMATOL, vol. 133, no. 9, 2013, pages e12
GARDY, J.L.BRINKMAN, F.S.: "Methods for predicting bacterial protein subcellular localization", NOT REV MICROBIOL, vol. 4, no. 10, 2006, pages 741 - 51
GASTEIGER, E.GATTIKER, A.HOOGLAND, C.IVANYI, I.APPEL, R.D.BAIROCH, A.: "ExPASy: the proteomics server for in-depth protein knowledge and analysis", NUCLEIC ACIDS RESEARCH, vol. 31, 2003, pages 3784 - 3788
GEORGE, W.L.SUTTER, V.L.CITRON, D.FINEGOLD, S.M.: "Selective and differential medium for isolation of Clostridium difficile", J CLIN MICROBIOL, vol. 9, no. 2, 1979, pages 214 - 9
GERDING, D.N.JOHNSON, S.PETERSON, L.R.MULLIGAN, M.E.SILVA, J.: "Clostridium difficile-Associated Diarrhea and Colitis", INFECTION CONTROL AND HOSPITAL EPIDEMIOLOGY, vol. 16, no. 8, 1995, pages 459 - 477, XP002945322
GERDING, D.N.JOHNSON, S.PETERSON, L.R.MULLIGAN, M.E.SILVA, J.: "Clostridium difficile Infection Prevention: Biotherapeutics, Immunologics, and Vaccines", DISCOVERY MEDICINE, vol. 13, no. 68, 2012, pages 75 - 83
GERDING, D.N.MUTO, C.A.OWENS JR, R.C.: "Measures to control and prevent Clostridium difficile infection", CLIN INFECT DIS., vol. 46, 2008, pages S43 - S49
GERVER, S.MIHALKOVA, M.ABERNETHY, J.BOU-ANTOUN, S.NSONWU, 0.KAUSAR, S.WASTI, S.APRAKU, D.DAVIES, J.HOPE, R.: "Annual Epidemiological Commentary: Mandatory MRSA, MSSA and E. coli bacteroemia and C. difficile infection data", vol. 2014, 2015, PHE PUBLICATIONS GATEWAY, pages: 15
GEUIJEN, C.A.CLIJSTERS-VAN DER HORST, M.COX, F.ROOD, P.M.THROSBY, M.JONGENEELEN, M.A.BACKUS, H.H.VAN DEVENTER, E.KRUISBEEK, A.M.GO: "Affinity ranking of antibodies using flow cytometry: application in antibody phage display-based target discovery", J IMMUNOL METHODS, vol. 302, no. 1-2, 2005, pages 68 - 77, XP005008042, DOI: doi:10.1016/j.jim.2005.04.016
GHOSE, C.: "Clostridium difficile infection in the twenty-first century", EMERGING MICROBES AND INFECTIONS, vol. 2, no. 62, 2013
GILJOHANN, D.A.MIRKIN, C.A.: "Drivers of biodiagnostic development", NATURE, vol. 462, no. 7272, 2009, pages 461 - 4
GIMENEZ, D.F.CICCARELLI, A.S.: "Another type of Clostridium botulinum", ZENTRALBL BAKTERIOL ORIG, vol. 215, no. 2, 1970, pages 221 - 4
GIRINATHAN, B.P.BRAUN, S.E.GOVIND, R.: "Clostridium difficile glutamate dehydrogenase is a secreted enzyme that confers resistance to H(2)0(2", MICROBIOLOGY, vol. 160, 2014, pages 47 - 55
GODFREY, W.L.HILL, D.M.KILGORE, J.A.BULLER, G.M.BRADFORD, J.A.GRAY, D.R.CLEMENTS, I.OAKLEAF, K.SALISBURY, J.J.IGNATIUS, M.J.: "Complementarity of Flow Cytometry and Fluorescence Microscopy", MICROSCOPY AND MICROANALYSIS, vol. 11, 2005, pages 246 - 247
GOLDENBERG, S.D.BISNAUTHSING, K.N.PATEL, A.POSTULKA, A.WYNCOLL, D.SCHIFF, R.FRENCH, G.L.: "Point-of-Care Testing for Clostridium difficile Infection: A Real-World Feasibility Study of a Rapid Molecular Test in Two Hospital Settings", INFECTIOUS DISEASES AND THERAPY, vol. 3, no. 2, 2014, pages 295 - 306
GOLDENBERG, S.D.CLIFF, P.R.FRENCH, G.L.: "Glutamate Dehydrogenase for Laboratory Diagnosis of Clostridium difficile Infection", J CLIN MICROBIOL, vol. 48, no. 8, 2010, pages 3050 - 1
GOLDENBERG, S.D.FRENCH, G.L.: "lack of association of tcdC type and binary toxin status with disease severity and outcome in toxigenic Clostridium difficile", THE JOURNAL OF INFECTION, vol. 62, no. 5, 2011, pages 355 - 62
GOLDENBERG, S.D.VOLPE, H.FRENCH, G.L.: "Clinical negligence, litigation and healthcare-associated infections", J HOSP INFECT, 2012
GORIS, J.KONSTANTINIDIS, K.T.KLAPPENBACH, J.A.COENYE, T.VANDAMME, P.TIEDJE, J.M.: "DNA-DNA hybridization values and their relationship to whole-genome sequence similarities", INT J SYST EVOL MICROBIOL, vol. 57, 2007, pages 81 - 91
GOUGH, J.KARPLUS, K.HUGHEY, R.CHOTHIA, C.: "Assignment of homology to genome sequences using a library of hidden Markov models that represent all proteins of known structure", J MOL BIOL, vol. 313, no. 4, 2001, pages 903 - 19, XP004464252, DOI: doi:10.1006/jmbi.2001.5080
GRAILLE, M.STURA, E.A.CORPER, A.L.SUTTON, B.J.TAUSSIG, M.J.CHARBONNIER, J.B.SILVERMAN, G.J.: "Crystal structure of a Staphylococcus aureus protein A domain complexed with the Fab fragment of a human IgM antibody: structural basis for recognition of B-cell receptors and superantigen activity", PROC NATL ACAD SCI U S A, vol. 97, no. 10, 2000, pages 5399 - 404, XP002284947, DOI: doi:10.1073/pnas.97.10.5399
GREIN, J.D.OCHNER, M.HOANG, H.JIN, A.MORGAN, M.A.MURTHY, A.R.: "Comparison of testing approaches for Clostridium difficile infection at a large community hospital", CLINICAL MICROBIOL AND INFECTION, vol. 20, no. 1, 2014, pages 65 - 9
GRIESHABER, D.MACKENZIE, R.VOROS, J.REIMHULT, E.: "Electrochemical Biosensors - Sensor Principles and Architectures", SENSORS (BASEL), vol. 8, no. 3, 2008, pages 1400 - 58, XP055446655
GROUP., B.D.W.: "Biomarkers and surrogate endpoints: preferred definitions and conceptual framework", CLIN PHARMACOL THER, vol. 69, no. 3, 2001, pages 89 - 95
GUARNER, F.: "Enteric Flora in Health and Disease", DIGESTION, vol. 73, 2006, pages 5 - 12
GUERRERO, D.M.NERANDZIC, M.M.JURY, L.A.CHANG, S.JUMP, R.L.DONSKEY, C.J.: "Clostridium difficile infection in a Department of Veterans Affairs long-term care facility", INFECT CONTROL HOSP EPIDEMIOL, vol. 32, 2011, pages 513 - 515
GUPTA, A.KHANNA, S.: "Community-acquired Clostridium difficile infection: an increasing public health threat", INFECT DRUG RESIST, vol. 7, 2014, pages 63 - 72
HALL, I.C.O'TOOLE, E.: "INTESTINAL FLORA IN NEW-BORN INFANTSWITH A DESCRIPTION OF A NEW PATHOGENIC ANAEROBE, BACILLUS DIFFICILIS", AMERICAN JOURNAL OF DISEASES OF CHILDREN, vol. 49, no. 2, 1935, pages 390 - 402
HAMMOND, E.N.DONKOR, E.S.BROWN, C.A.: "Biofilm formation of Clostridium difficile and susceptibility to Manuka honey", BMC COMPLEMENT ALTERN MED, vol. 14, 2014, pages 329, XP021197071, DOI: doi:10.1186/1472-6882-14-329
HANCOCK, D.C.O'REILLY, N.J.: "Synthetic peptides as antigens for antibody production", METHODS IN MOLECULAR BIOLOGY, vol. 295, 2005, pages 13 - 26
HANSEN, G.BLATT, S.BRECHER, S.M.DUBBERKE, E.DORSETT, P.: "Clostridium difficile. Navigating the Testing Options for Diagnosis", CLINICAL LABORATORY NEWS: CLOSTRIDIUM DIFFICILE, vol. 36, no. 7, 2010, pages 10 - 13
HANSEN, L.B.BUUS, S.SCHAFER-NIELSEN, C.: "Identification and Mapping of Linear Antibody Epitopes in Human Serum Albumin Using High-Density Peptide Arrays", PLOS ONE, vol. 8, no. 7, 2013, pages e68902, XP055452753, DOI: doi:10.1371/journal.pone.0068902
HARPER-OWEN, R.DYMOCK, D.BOOTH, V.WEIGHTMAN, A.J.WADE, W.G.: "Detection of unculturable bacteria in periodontal health and disease by PCR", J CLIN MICROBIOL, vol. 37, no. 5, 1999, pages 1469 - 73
HARPER, C.J.HAYWARD, D.KIDD, M.WIID, I.VAN HELDEN, P.: "Glutamate dehydrogenase and glutamine synthetase are regulated in response to nitrogen availability in Myocbacterium smegmatis", BMC MICROBIOL, vol. 10, 2010, pages 138, XP021073022, DOI: doi:10.1186/1471-2180-10-138
HE, M.MIYAJIMA, F.ROBERTS, P.ELLISON, L.PICKARD, D.J.MARTIN, M.J.CONNOR, T.R.HARRIS, S.R.FAIRLEY, D.BAMFORD, K.B.: "Emergence and global spread of epidemic healthcare-associated Clostridium difficile", NAT GENET, vol. 45, no. 1, 2013, pages 109 - 13, XP055517290, DOI: doi:10.1038/ng.2478
HEAP, J.T.PENNINGTON, O.J.CARTMAN, S.T.CARTER, G.P.MINTON, N.P.: "The ClosTron: a universal gene knock-out system for the genus Clostridium", MICROBIOL METHODS, vol. 70, no. 3, 2007, pages 452 - 64, XP022212053, DOI: doi:10.1016/j.mimet.2007.05.021
HEEG, D.BURND, D.A.CARTMAN, S.T.MINTON, N.P.: "Spores of Clostridium difficile Clinical Isolates Display a Diverse Germintaion Response to Bile Salts", PLOS ONE, vol. 7, no. 2, 2012, pages e32381
HERNANDEZ-ROCHA, C.BARRA-CARRASCO, J.ALVAREZ-LOBOS, M.PAREDES-SABJA, D.GUZMAN-DURAN, A.M.: "Prospective comparison of a commercial multiplex real-time polymerase chain reaction and an enzyme immunoassay with toxigenic culture in the diagnosis of Clostridium difficile-associated infections", DIAGNOSTIC MICROBIOLOGY AND INFECTIOUS DISEASE, vol. 75, no. 4, 2013, pages 361 - 365
HIGDON, R.KOLKER, E.: "A predictive model for identifying proteins by a single peptide match", BIOINFORMATICS, vol. 23, no. 3, 2007, pages 277 - 80
HOLUB, M.LAWRENCE, D.A.ANDERSEN, N.DAVIDOVA, A.BERAN, 0.MARESOVA, V.CHALUPA, P.: "Cytokines and chemokines as biomarkers of community-acquired bacterial infection", MEDIATORS INFLAMM, 2013, pages 190145
HONG, H.A.KHANEJA, R.TAM, N.M.CAZZATO, A.TAN, S.URDACI, M.BRISSON, A.GASBARRINI, A.BARNES, I.CUTTING, S.M.: "Bacillus subtilis isolated from the human gastrointestinal tract", RES MICROBIOL, vol. 160, no. 2, 2009, pages 134 - 43, XP026002060, DOI: doi:10.1016/j.resmic.2008.11.002
HOPPERT, M.HOLZENBURG, A.: "Electron microscopy in microbiology", 1998, BIOS SCIENTIFIC PUBLISHERS
HOWE, J.HAMMER, M.U.BRANDENBURG, K.: "Calorimetric investigations of the effect of polymyxin B on different Gram-negative bacteria", THERMOCHIMICA ACTA, vol. 458, no. 1-2, 2007, pages 34 - 37, XP022063375, DOI: doi:10.1016/j.tca.2007.01.018
HOWERTON, A.PATRA, M.ABEL-SANTOS, E.: "A new strategy for the prevention of Clostridium difficile infection", J INFECT DIS, vol. 207, no. 10, 2013, pages 1498 - 504
HUDSON, M., DEATHS INVOLVING CLOSTRIDIUM DIFFICILE: ENGLAND AND WALES, 24 August 2009 (2009-08-24), Retrieved from the Internet
HUSSACK, G.ARBABI-GHAHROUDI, M.VAN FAASSEN, H.SONGER, J.G.NG, K.K.MACKENZIE, R.TANHA, J.: "Neutralization of Clostridium difficile toxin A with single-domain antibodies targeting the cell receptor binding domain", J BIOL CHEM, vol. 286, no. 11, 2011, pages 8961 - 76, XP002692187, DOI: doi:10.1074/jbc.M110.198754
IBARRA, J.A.PEREZ-RUEDA, E.CARROLL, R.K.SHAW, L.N.: "Global analysis of transcriptional regulators in Staphylococcus aureus", BMC GENOMICS, vol. 14, 2013, pages 126, XP021146381, DOI: doi:10.1186/1471-2164-14-126
JAFFREZIC-RENAULT, N.MARTELET, C.CHEVOLOT, Y.CLOAREC, J.P.: "Biosensors and Bio-Bar Code Assays Based on Biofunctionalized Magnetic Microbeads", SENSORS (BASEL), vol. 7, no. 4, 2007, pages 589 - 614, XP002522346, DOI: doi:10.3390/s7040589
JAKUPCIAK, J.P.COLWELL, R.R.: "Biological agent detection technologies", MOL ECOL RESOUR, vol. 9, 2009, pages 51 - 7, XP055134104, DOI: doi:10.1111/j.1755-0998.2009.02632.x
JANDA, J.M.ABBOTT, S.L.: "Bacterial Identification for Publication: When Is Enough Enough?", J CLIN MICROBIOL, vol. 40, no. 6, 2002, pages 1887 - 91
JANEWAY, C., A, JR.TRAVERS, P.WALPORT, M.SHLOMCHIK, M.: "Garland Science", 2001, article "Immunobiology: The Immune System in Health and Disease"
JANEZIC, S.RUPNIK, M.: "Molecular typing methods for Clostridium difficile: pulsed-field gel electrophoresis and PCR ribotyping", METHODS OF MOLECULAR BIOLOGY, vol. 646, 2010, pages 55 - 65
JARVINEN, A.K.LAAKSO, S.PIIPARINEN, P.AITTAKORPI, A.LINDFORS, M.HUOPANIEMI, L.PIIPARINEN, H.MAKI, M.: "Rapid identification of bacterial pathogens using a PCR-and microarray-based assay", BMC MICROBIOL, vol. 9, 2009, pages 161, XP021056352, DOI: doi:10.1186/1471-2180-9-161
JEMAL, A.THOMAS, A.MURRAY, T.THUN, M.: "Cancer statistics, 2002", CA CANCER J CLIN, vol. 52, no. 1, 2002, pages 23 - 47
JERABEK-WILLEMSEN, M.WIENKEN, C.J.BRAUN, D.BAASKE, P.S., D.: "Molecular Interaction Studies Using Microscale Thermophoresis", ASSAY AND DRUG DEVELOPMENT TECHNOLOGIES, vol. 9, no. 4, 2011, pages 342 - 53
JERABEK-WILLEMSENA, M.ANDREA, T.WANNERA, R.ROTHA, H.M.DUHRA, S.BAASKEA, P.BREITSPRECHER, D.: "MicroScale Thermophoresis: Interaction analysis and beyond", JOURNAL OF MOLECULAR STRUCTURE, vol. 1077, 2014, pages 101 - 113, XP029049783, DOI: doi:10.1016/j.molstruc.2014.03.009
JIN, S.G.WU, X.LI, A.X.PFEIFER, G.P.: "Genomic mapping of 5-hydroxymethylcytosine in the human brain", NUCLEIC ACIDS RES, vol. 39, no. 12, 2011, pages 5015 - 24, XP055061776, DOI: doi:10.1093/nar/gkr120
JOHNSON, E.A.: "Clostridial Neurotoxins", 2005, TAYLOR AND FRANCIS GROUP
JOHNSON, M., MOUSE ANTIBODY, 7 October 2013 (2013-10-07)
JOHNSON, S.KENT, S.A.O'LEARY, K.J.MERRIGAN, M.M.SAMBOL, S.P.PETERSON, L.R.GERDING, D.N.: "Fatal pseudomembranous colitis associated with a variant Clostridium difficile strain not detected by toxin A immunoassay", ANN INTERN MED, vol. 135, no. 6, 2001, pages 434 - 8
JONES, P.BINNS, D.CHANG, H.Y.FRASER, M.LI, W.MCANULLA, C.MCWILLIAM, H.MASLEN, J.MITCHELL, A.NUKA, G.: "InterProScan 5: genome-scale protein function classification", BIOINFORMATICS, vol. 30, no. 9, 2014, pages 1236 - 40
JUMP, R.L.PULTZ, M.J.DONSKEY, CJ.: "Vegetative Clostridium difficile survives in room air on moist surfaces and in gastric contents with reduced acidity: a potential mechanism to explain the association between proton pump inhibitors and C. difficile-associated diarrhea?", ANTIMICROB AGENTS CHEMOTHER, vol. 51, no. 8, 2007, pages 2883 - 7
JUNCKER, A.S.WILLENBROCK, H.VON HEIJNE, G.BRUNAK, S.NIELSEN, H.KROGH, A.: "Prediction of lipoprotein signal peptides in Gram-negative bacteria", PROTEIN SCI, vol. 12, no. 8, 2003, pages 1652 - 62, XP055305146, DOI: doi:10.1110/ps.0303703
KACHRIMANIDOU, M.MALISIOVAS, N.: "Clostridium difficile infection: a comprehensive review", CRITICAL REVIEWS IN MICROBIOLOGY, vol. 37, no. 3, 2011, pages 178 - 87
KALL, L.KROGH, A.SONNHAMMER, E.L.: "A combined transmembrane topology and signal peptide prediction method", J MOL BIOL, vol. 338, no. 5, 2004, pages 1027 - 36, XP004504149, DOI: doi:10.1016/j.jmb.2004.03.016
KANDALAFT, H.HUSSACK, G.AUBRY, A.VAN FAASSEN, H.GUAN, Y.ARBABI-GHAHROUDI, M.MACKENZIE, R.LOGAN, S.M.TANHA, J.: "Targeting surface-layer proteins with single-domain antibodies: a potential therapeutic approach against Clostridium difficile-associated disease", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, vol. 99, no. 20, 2015, XP055536670, DOI: doi:10.1007/s00253-015-6594-1
KARAS, J.A.ENOCH, D.A.ALIYU, S.H.: "A review of mortality due to Clostridium difficile infection", JOURNAL OF INFECTION, vol. 61, no. 1, 2010, pages 1 - 8, XP027088599
KARCZEWSKI, J.ZORMAN, J.WANG, S.MIEZEIEWSKI, M.XIE, J.SORING, K.PETRESCU, I.ROGERS, I.THIRIOT, D.S.COOK, J.C.: "Development of a recombinant toxin fragment vaccine for Clostridium difficile infection", VACCINE, vol. 32, no. 24, 2014, pages 2812 - 8
KARJALAINEN, T.SAUMIER, N.BARC, M.C.DELMEE, M.COLLIGNON, A.: "Clostridium difficile genotyping based on slpA variable region in S-layer gene sequence: an alternative to serotyping", J CLIN MICROBIOL.,, vol. 40, 2002, pages 2452 - 2458
KAUR, R.DIKSHIT, K.L.RAJE, M.: "Optimization of immunogold labeling TEM: an ELISA-based method for evaluation of blocking agents for quantitative detection of antigen", J HISTOCHEM CYTOCHEM, vol. 50, no. 6, 2002, pages 863 - 73, XP002406426
KELLY, C.P.POTHOULAKIS, C.LAMONT, J.T.: "Clostridium difficile Colitis", N ENGL J MED, vol. 330, 1994, pages 257 - 262, XP008177607, DOI: doi:10.1056/NEJM199401273300406
KEMENY, D.M.CHALLACOMBE, S.J.: "ELISA and Other Solid Phase Immunoassays: Theoretical and Practical Aspects", 1988, JOHN WILEY AND SONS
KHALIL, I.F.ALIFRANGIS, M.RECKE, C.HOEGBERG, L.C.RONN, A.BYGBJERG, I.C.KOCH, C.: "Development of ELISA-based methods to measure the anti-malarial drug chloroquine in plasma and in pharmaceutical formulations", MALAR J, vol. 10, 2011, pages 249, XP021092126, DOI: doi:10.1186/1475-2875-10-249
KIM, N.O.JUNG, S.M.NA, H.Y.CHUNG, G.T.YOO, C.K.SEONG, W.K.HONG, S.: "Enteric Bacteria Isolated from Diarrheal Patients in Korea in 2014", OSONG PUBLIC HEALTH RES PERSPECT, vol. 6, no. 4, 2015, pages 233 - 40
KING, A.M.MACKIN, K.E.LYRAS, D.: "Emergence of toxin A-negative, toxin B-positive Clostridium difficile strains: epidemiological and clinical considerations", FUTURE MICROBIOLOGY, vol. 10, no. 1, 2015, pages 1 - 4
KIRBY, J.M.AHERN, H.ROBERTS, A.K.KUMAR, V.FREEMAN, Z.: "Cwp84, a surface-associated cysteine protease, plays a role in the maturation of the surface layer of Clostridium difficile", J BIOL CHEM, vol. 284, 2009, pages 34666 - 34673
KOO, H.L.VAN, J.N.ZHAO, M.YE, X.REVELL, P.A.JIANG, Z.D.GRIMES, C.Z.KOO, D.C.LASCO, T.KOZINETZ, C.A.: "Real-time polymerase chain reaction detection of asymptomatic Clostridium difficile colonization and rising C. difficile-associated disease rates", INFECT CONTROL HOSP EPIDEMIOL, vol. 35, no. 6, 2014, pages 667 - 73
KOTIRANTA, A.HAAPASALO, M.LOUNATMAA, K.KARI, K.: "Crystalline surface protein of Peptostreptococcus anaerobius", MICROBIOLOGY, vol. 141, 1995, pages 1065 - 73
KOVACS-SIMON, A.LEUZZI, R.KASENDRA, M.MINTON, N.TITBALL, R.W.MICHELL, S.L.: "Lipoprotein CD0873 is a novel adhesin of Clostridium difficile", J INFECT DIS, vol. 210, no. 2, 2014, pages 274 - 84
KOVACS-SIMON, A.TITBALL, R.W.MICHELL, S.L.: "Lipoproteins of bacterial pathogens", INFECT IMMUN, vol. 79, no. 2, 2011, pages 548 - 61, XP055110723, DOI: doi:10.1128/IAI.00682-10
KROGH, A.LARSSON, B.VON HEIJNE, G.SONNHAMMER, E.L.: "Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes", J MOL BIOL, vol. 305, no. 3, 2001, pages 567 - 80, XP004469188, DOI: doi:10.1006/jmbi.2000.4315
KRONVALL, G.GREY, H.M.WILLIAMS, R.C.J.: "Protein A reactivity with mouse immunoglobulins. Structural relationship between some mouse and human immunoglobulins", JOURNAL OF IMMUNOLOGY, vol. 105, no. 5, 1970, pages 1116 - 23
KUEHNE, S.A.CARTMAN, S.T.HEAP, J.T.KELLY, M.L.COCKAYNE, A.MINTON, N.P.: "The role of toxin A and toxin B in Clostridium difficile infection", NATURE, vol. 467, no. 7316, 2010, pages 711 - 3, XP055073429, DOI: doi:10.1038/nature09397
KUEHNE, S.A.COLLERY, M.M.KELLY, M.L.CARTMAN, S.T.COCKAYNE, A.MINTON, N.P.: "Importance of Toxin A, Toxin B, and CDT in Virulence of an Epidemic Clostridium difficile Strain", THE JOURNAL OF INFECTIOUS DISEASES, vol. 209, no. 1, 2014, pages 83 - 6
KUFELNICKA, A.M.KIRN, T.J.: "Effective Utilization of Evolving Methods for the Laboratory Diagnosis of Clostridium difficile Infection", CLIN INFECT DIS., vol. 52, no. 12, 2011, pages 1451 - 7
KURKA, H.EHRENREICH, A.LUDWIG, W.MONOT, M.RUPNIK, M.BARBUT, F.INDRA, A.DUPUY, B.LIEBL, W.: "Sequence Similarity of Clostridium difficile Strains by Analysis of Conserved Genes and Genome Content Is Reflected by Their Ribotype Affiliation", PLOS ONE,, vol. 9, no. 1, 2014, pages e86535
KVACH, E.J.FERGUSON, D.RISKA, P.F.LANDRY, M.L.: "Comparison of BD GeneOhm Cdiff real-time PCR assay with a two-step algorithm and a toxin A/B enzyme-linked immunosorbent assay for diagnosis of toxigenic Clostridium difficile infection", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 48, no. 1, 2010, pages 109 - 14, XP055149245, DOI: doi:10.1128/JCM.01630-09
LAGUNA, M.HOLGADO, M.HERNANDEZ, A.L.SANTAMARIA, B.LAVIN, A.SORIA, J.SUAREZ, T.BARDINA, C.JARA, M.SANZA, F.J.: "Antigen-Antibody Affinity for Dry Eye Biomarkers by Label Free Biosensing. Comparison with the ELISA Technique", SENSORS (BASEL), vol. 15, no. 8, 2015, pages 19819 - 29
LALANDE, V.BARRAULT, L.WADEL, S.ECKERT, C.PETIT, J.C.BARBUT, F.: "Evaluation of a loop-mediated isothermal amplification assay for diagnosis of Clostridium difficile infections", J CLIN MICROBIOL, vol. 49, no. 7, 2011, pages 2714 - 6
LAND, M.HAUSER, L.JUN, S.R.NOOKAEW, I.LEUZE, M.R.AHN, T.H.KARPINETS, T.LUND, 0.KORA, G.WASSENAAR, T.: "Insights from 20 years of bacterial genome sequencing", FUND INTEGR GENOMICS, vol. 15, no. 2, 2015, pages 141 - 61, XP035470696, DOI: doi:10.1007/s10142-015-0433-4
LANIS, J.M.BARUA, S.BALLARD, J.D.: "Variations in TcdB activity and the hypervirulence of emerging strains of Clostridium difficile", PLOS PATHOG, vol. 6, no. 8, 2010, pages el001061
LANZAS, C.DUBBERKE, E.R.: "Effectiveness of Screening Hospital Admissions to Detect Asymptomatic Carriers of Clostridium difficile: A Modeling Evaluation", INFECTION CONTROL AND HOSPITAL EPIDEMIOLOGY, vol. 35, no. 8, 2014, pages 1043 - 1050
LARSON, H.E.PRICEA, A.B.HONOURA, P.BORRIELLOB, S.P.: "CLOSTRIDIUM DIFFIClLE AND THE ETIOLOGY OF PSEUDOMEMBRANOUS COLITIS", THE LANCET, vol. 1, no. 8073, 1978, pages 1063 - 1066
LAWLEY, T.D.CLARE, S.WALKER, A.W.STARES, M.D.CONNOR, T.R.RAISEN, C.GOULDING, D.RAD, R.SCHREIBER, F.BRANDT, C.: "Targeted restoration of the intestinal microbiota with a simple, defined bacteriotherapy resolves relapsing Clostridium difficile disease in mice", PLOS PATHOG, vol. 8, no. 10, 2012, pages 1002995, XP055077330, DOI: doi:10.1371/journal.ppat.1002995
LEADLEY, D., TRANSMISSION ELECTRON MICROSCOPY (TEM), 2010, Retrieved from the Internet
LEEKHA, S.ARONHALT, K.C.SLOAN, L.M.PATEL, R.ORENSTEIN, R.: "Asymptomatic Clostridium difficile colonization in a tertiary care hospital: Admission prevalence and risk factors", AMERICAN JOURNAL OF INFECTION CONTROL, vol. 41, no. 5, 2013, pages 390 - 393
LEENAARS, M.HENDRIKSEN, C.F.M.: "Critical Steps in the Production of Polyclonal and Monoclonal Antibodies: Evaluation and Recommendations", ILAR JOURNAL, vol. 46, no. 3, 2005, pages 269 - 279
LEIRDAL, M.SHADIDY, M.ROSOK, O.SIOUD, M.: "Identification of genes differentially expressed in breast cancer cell line SKBR3: potential identification of new prognostic biomarkers", INT J MOL MED, vol. 14, no. 2, 2004, pages 217 - 22
LI, C.VANDENBER, K.PRABHULKARA, S.ZHUA, X.SCHNEPERB, L.METHEEB, K.ROSSERD, C.J.ALMEIDEC, E.: "Paper based point-of-care testing disc for multiplex whole cell bacteria analysis", vol. 26, 2011, ELSEVIER, pages: 4342 - 4348
LI, J.ZHANG, Z.ROSENZWEIG, J.WANG, Y.Y.CHAN, D.W.: "Proteomics and bioinformatics approaches for identification of serum biomarkers to detect breast cancer", CLIN CHEM, vol. 48, no. 8, 2002, pages 1296 - 304
LIANG, Y.: "Applications of isothermal titration calorimetry in protein science", ACTA BIOCHIMICA ET BIOPHYSICA SINICA, vol. 40, no. 7, 2008, pages 565 - 576
LIEBERMAN, M.MARKS, A.D.SMITH, C.M.MARKS, D.B.: "A Clinical Approach", 2007, LIPPINCOTT WILLIAMS & WILKINS, article "Marks' Essential Medical Biochemistry"
LIU, H.WHITE, J.CRAWFORD, F.JIN, N.JU, X.LIU, K.JIANG, C.MARRACK, P.ZHANG, G.KAPPLER, J.W.: "A Rapid Method to Characterize Mouse IgG Antibodies and Isolate Native Antigen Binding IgG B Cell Hybridomas", PLOS ONE, vol. 10, no. 8, 2015, pages e0136613
LIU, J.: "The history of monoclonal antibody development - Progress, remaining challenges and future innovations", ANNALS OF MEDICINE AND SURGERY, vol. 3, 2014, pages 113 - 116
LIU, J.MAZUMDAR, D.LU, Y.: "A simple and sensitive ''dipstick'' test in serum based on lateral flow separation of aptamer-linked nanostructures", ANGEW CHEM INT ED ENGL, vol. 45, no. 47, 2006, pages 7955 - 9, XP002439585, DOI: doi:10.1002/anie.200603106
LIU, Y.LIU, N.MA, X.LI, X.MA, J.LI, Y.ZHOU, Z.GAO, Z.: "Highly specific detection of thrombin using an aptamer-based suspension array and the interaction analysis via microscale thermophoresis", THE ANALYST, vol. 140, no. 8, 2015, pages 2762 - 70
LLARRULL, L.I.FISHER, J.F.MOBASHERY, S.: "Molecular basis and phenotype of methicillin resistance in Staphylococcus aureus and insights into new beta-lactams that meet the challenge", ANTIMICROB AGENTS CHEMOTHER, vol. 53, no. 10, 2009, pages 4051 - 63
LODISH, H.BERK, A.ZIPURSKY, S.L.MATSUDAIRA, P.BALTIMORE, D.DARNELL, J.: "Molecular Cell Biology", 2000, W.H. FREEMAN
LOO, V.G.POIRIER, L.MILLER, M.A.OUGHTON, M.LIBMAN, M.D.MICHAUD, S.BOURGAULT, A.M.NGUYEN, T.FRENETTE, C.KELLY, M.: "A predominantly clonal multi-institutional outbreak of Clostridium difficile-associated diarrhea with high morbidity and mortality", N ENGL J MED, vol. 353, no. 23, 2005, pages 2442 - 9
LOUIE, T.J.MILLER, M.A.MULLANE, K.M.WEISS, K.LENTNEK, A.GOLAN, Y.GORBACH, S.SEARS, P.SHUE, Y.: "Fidaxomicin versus Vancomycin for Clostridium difficile Infection", THE NEW ENGLAND JOURNAL OF MEDICINE, vol. 364, 2011, pages 422 - 431, XP055485733, DOI: doi:10.1056/NEJMoa0910812
LOWY, I.MOLRINE, D.C.LEAV, B.A.BLAIR, B.M.BAXTER, R.GERDING, D.N.NICHOL, G.THOMAS, W.D.J.LENEY, M.SLOAN, S., TREATMENT WITH MONOCLONAL ANTIBODIES AGAINST CLOSTRIDIUM DIFFICILE TOXINS, vol. 362, no. 3, 2010, pages 197 - 205
LYERLY, D.M.BALL, D.W.TOTH, J.WILKINS, T.D.: "Characterization of cross-reactive proteins detected by Culturette Brand Rapid Latex Test for Clostridium difficile'", J CLIN MICROBIOL, vol. 26, no. 3, 1988, pages 397 - 400
LYRAS, D.O'CONNOR, J.R.HOWARTH, P.M.SAMBOL, S.P.CARTER, G.P.PHUMOONNA, T.POON, R.ADAMS, V.VEDANTAM, G.JOHNSON, S.: "Toxin B is essential for virulence of Clostridium difficile", NATURE, vol. 458, no. 7242, 2009, pages 1176 - 9, XP055043323, DOI: doi:10.1038/nature07822
MAK, T.W.SAUNDERS, M.E.: "The Immune Response: Basic and Clinical Principles", 2001, ACADEMIC PRESS
MARTIN, A.C.R.: "Protein Sequence and Structure Analysis of Antibody Variable Domains", 2010, SPRINGER
MCDONALD, L.C.KILLGORE, G.E.THOMPSON, A.OWENS, R.C.KAZAKOVA, S.V.SAMBOL, S.P.JOHNSON, S.GERDING, D.N.: "An epidemic, toxin gene-variant strain of Clostridium difficile", N ENGL J MED, vol. 353, no. 23, 2005, pages 2433 - 41
MCMASTER-BAXTER, N.L.MUSHER, D.M.: "Clostridium difficile: recent epidemiologic findings and advances in therapy", PHARMACOTHERAPY, vol. 27, 2007, pages 1029 - 1039
MERRIGAN, M.VENUGOPAL, A.MALLOZZI, M.ROXAS, B.VISWANATHAN, V.K.JOHNSON, S.GERDING, D.N.VEDANTAM, G.: "Human hypervirulent Clostridium difficile strains exhibit increased sporulation as well as robust toxin production", JOURNAL OF BACTERIOLOGY, vol. 192, no. 19, 2010, pages 4904 - 11, XP009140830, DOI: doi:10.1128/JB.00445-10
MERRIGAN, M.M.VENUGOPAL, A.ROXAS, J.L.ANWAR, F.MALLOZZI, M.J.ROXAS, B.A.GERDING, D.N.VISWANATHAN, V.K.VEDANTAM, G.: "Surfacelayer protein A (SlpA) is a major contributor to host-cell adherence of Clostridium difficile", PLOS ONE, vol. 8, no. 11, 2013, pages e78404, XP055312583, DOI: doi:10.1371/journal.pone.0078404
METTLER, M.GRIMM, F.CAPELLI, G.CAMP, H.DEPLAZES, P.: "Evaluation of Enzyme-Linked Immunosorbent Assays, an Immunofluorescent-Antibody Test, and Two Rapid Tests (Immunochromatographic-Dipstick and Gel Tests) for Serological Diagnosis of Symptomatic and Asymptomatic Leishmania Infections in Dogs", JOURNAL OF MICROBIOLOGY, vol. 43, no. 11, 2005, pages 5515 - 5519, XP002531889, DOI: doi:10.1128/JCM.43.11.5515-5519.2005
MICHAELSEN, T.E.KOLBERG, J.AASE, A.HERSTAD, T.K.HØIBY, E.A.: "The four mouse IgG isotypes differ extensively in bactericidal and opsonophagocytic activity when reacting with the P1.16 epitope on the outer membrane PorA protein of Neisseria meningitidis", SCANDINAVIAN JOURNAL OF IMMUNOLOGY, vol. 59, no. 1, 2004, pages 34 - 9
MILLER, M.A.HYLAND, M.OFNER-AGOSTINI, M.GOURDEAU, M.ISHAK, M.: "Morbidity, Mortality, and Healthcare Burden of Nosocomial Clostridium difficile-Associated Diarrhea in Canadian Hospitals", INFECTION CONTROL AND HOSPITAL EPIDEMIOLOGY, vol. 23, 2002, pages 3
MININO, A.M.XU, J.Q.KOCHANEK, K.D.: "Deaths: preliminary data for 2008", NATIONAL VITAL STATISTICS REPORT, vol. 59, no. 2, 27 August 2015 (2015-08-27), Retrieved from the Internet
MISHRA, A.K.LAGIER, J.C.ROBERT, C.RAOULT, D.FOURNIER, P.E.: "Non-contiguous finished genome sequence and description of Clostridium senegalense sp. nov", STAND GENOMIC SCI, vol. 6, no. 3, 2012, pages 386 - 95
MITCHELL, A.CHANG, H.Y.DAUGHERTY, L.FRASER, M.HUNTER, S.LOPEZ, R.MCANULLA, C.MCMENAMIN, C.NUKA, G.PESSEAT, S., THE INTERPRO PROTEIN FAMILIES DATABASE: THE CLASSIFICATION RESOURCE AFTER 15 YEARS, vol. 43, 2015, pages D213 - 21
MITTERER, G.HUBER, M.LEIDINGER, E.KIRISITS, C.LUBITZ, W.MUELLER, M.W.SCHMIDT, W.M.: "Microarray-based identification of bacteria in clinical samples by solid-phase PCR amplification of 23S ribosomal DNA sequences", J CLIN MICROBIOL, vol. 42, no. 3, 2004, pages 1048 - 57, XP002363929, DOI: doi:10.1128/JCM.42.3.1048-1057.2004
MOHAN, A.HARIKRISHNA, J.: "Biomarkers for the diagnosis of bacterial infections: in pursuit of the 'Holy Grail", INDIAN J MED RES, vol. 141, no. 3, 2015, pages 271 - 3
MONAGHAN, T.M.ROBINS, A.KNOX, A.SEWELL, H.F.MAHIDA, Y.R.: "Circulating antibody and memory B-Cell responses to C. difficile toxins A and B in patients with C. difficile-associated diarrhoea, inflammatory bowel disease and cystic fibrosis", PLOS ONE, vol. 8, no. 9, 2013, pages e74452
NATESAN, M.ULRICH, R.G.: "Protein Microarrays and Biomarkers of Infectious Disease", INT J MOLSCI, vol. 11, no. 12, 2010, pages 5165 - 83
"Deaths Involving Clostridium difficile, England and Wales", 2012, NATIONAL STATISTICS, O.F.
NEGRI, P.CHEN, G.KAGE, A.NITSCHE, A.NAUMANN, D.XU, B.DLUHY, R.A.: "Direct Optical Detection of Viral Nucleoprotein Binding to an Anti-Influenza Aptamer", ANAL CHEM, vol. 84, no. 13, 2012, pages 5501 - 8, XP055593474, DOI: doi:10.1021/ac202427e
NEWMAN, J.D.SETFORD, S.J.: "Enzyme Biosensors", MOLECULAR BIOTECHNOLOGY, vol. 32, no. 3, 2006, pages 249 - 68
NIELSEN, H.KROGH, A.: "Prediction of signal peptides and signal anchors by a hidden Markov model.", PROC INT CONF INTELL SYST MOL BIOL, vol. 6, 1998, pages 122 - 130, XP002201383
NIELSEN, H.ENGELBRECHT, J.BRUNAK, S.VON HEIJNE, G.: "Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites", PROTEIN ENGINEERING, vol. 10, no. 1, 1997, pages 1 - 6
NILSSON, H.O.TANEERA, J.CASTEDAL, M.GLATZ, E.OLSSON, R.WADSTROM, T.: "Identification of Helicobacter pylori and other Helicobacter species by PCR, hybridization, and partial DNA sequencing in human liver samples from patients with primary sclerosing cholangitis or primary biliary cirrhosis", J CLIN MICROBIOL, vol. 38, no. 3, 2000, pages 1072 - 6, XP002957916
O'BRIEN, J.A.LAHUE, B.J.CARO, J.J.DAVIDSON, D.M.: "The emerging infectious challenge of Clostridium difficile-associated disease in Massachusetts hospitals: clinical and economic consequences", INFECT CONTROL HOSP EPIDEMIOL, vol. 28, no. 11, 2007, pages 1219 - 27
O'BRIEN, J.B.MCCABE, M.S.ATHIE-MORALES, V.MCDONALD, G.S.NI EIDHIN, D.B.KELLEHER, D.P.: "Passive immunisation of hamsters against Clostridium difficile infection using antibodies to surface layer proteins", FEMS MICROBIOLOGY LETTERS, vol. 246, no. 2, 2005, pages 119 - 205, XP025394288, DOI: doi:10.1016/j.femsle.2005.04.005
O'CONNOR, J.R.JOHNSON, S.GERDING, D.N.: "Clostridium difficile Infection Caused by the Epidemic BI/NAP1/027 Strain", GASTROENTEROLOGY, vol. 136, no. 6, 2009, pages 1913 - 1924, XP026148021, DOI: doi:10.1053/j.gastro.2009.02.073
O'CONNOR, J.R.LYRAS, D.FARROW, K.A.ADAMS, V.POWELL, D.R.HINDS, J.CHEUNG, J.K.ROOD, J.I.: "Construction and analysis of chromosomal Clostridium difficile mutants", MOL MICROBIOL, vol. 61, no. 5, 2006, pages 1335 - 51
O'DONOGHUE, C.KYNE, L.: "Update on Clostridium difficile infection", CURRENT OPINION GASTROENTEROLOGY, vol. 27, 2011, pages 38 - 47, XP009184657, DOI: doi:10.1097/MOG.0b013e3283411634
ODELL, I.D.COOK, D.: "Immunofluorescence Techniques", J INVEST DERMATOL, vol. 133, no. 1, 2013, pages e4
OROSZ, F.OVADI, J.: "A simple method for the determination of dissociation constants by displacement ELISA", J IMMUNOL METHODS, vol. 270, no. 2, 2002, pages 155 - 62, XP004387994
OWEN, R.: "Techniques for Detection of Specific Organisms and Potential for DNA-Based Technologies", INTERPARM/CRC, 2003
OZDEMIR, M.S.MARCZAK, M.BOHETS, H.BONROY, K.ROYMANS, D.STUYVER, L.VANHOUTTE, K.PAWLAK, M.BAKKER, E.: "A label-free potentiometric sensor principle for the detection of antibody-antigen interactions", ANALYTICAL CHEMISTRY, vol. 85, no. 9, 2013, pages 4770 - 6, XP055170075, DOI: doi:10.1021/ac400514u
PANDEY, S.: "HYBRIDOMA TECHNOLOGY FOR PRODUCTION OF MONOCLONAL ANTIBODIES", INTERNATIONAL JOURNAL OF PHARMACEUTICAL SCIENCES REVIEW AND RESEARCH, vol. 1, no. 2, 2010, pages 88 - 94
PANTALEON, V.SOAVELOMANDROSO, A.P.BOUTTIER, S.BRIANDET, R.ROXAS, B.CHU, M.COLLIGNON, A.JANOIR, C.VEDANTAM, G.CANDELA, T.: "The Clostridium difficile Protease Cwp84 Modulates both Biofilm Formation and Cell-Surface Properties", PLOS ONE, vol. 10, no. 4, 2015, pages e0124971
PARIKH, R.MATHAI, A.PARIKH, S.CHANDRA SEKHAR, G.THOMAS, R.: "Understanding and using sensitivity, specificity and predictive values", INDIAN J OPHTHALMOL, vol. 56, no. 1, 2008, pages 45 - 50
PARKS, B.W.NAM, E.ORG, E.KOSTEM, E.NORHEIM, F.HUI, S.T.PAN, C.CIVELEK, M.RAU, C.D.BENNETT, B.J.: "Genetic control of obesity and gut microbiota composition in response to high-fat, high-sucrose diet in mice", CELL METAB, vol. 17, no. 1, 2013, pages 141 - 52
PAYNE, S.H.BONISSONE, S.WU, S.BROWN, R.N.IVANKOV, D.N.FRISHMAN, D.PASA-TOLIC, L.SMITH, R.D.PEVZNER, P.A.: "Unexpected diversity of signal peptides in prokaryotes", MBIO, vol. 3, 2012, pages 6
PECHINE, S.JANOIR, C.COLLIGNON, A.: "Variability of Clostridium difficile surface proteins and specific serum antibody response in patients with Clostridium difficile-associated disease", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 43, no. 10, 2005, pages 5018 - 25, XP003030988, DOI: doi:10.1128/JCM.43.10.5018-5025.2005
PECK, M.W.: "Clostridium botulinum", 2014, ELSEVIER PUBLICATIONS
PEDRUZZI, I.RIVOIRE, C.AUCHINCLOSS, A.H.COUDERT, E.KELLER, G.DE CASTRO, E.BARATIN, D.CUCHE, B.A.BOUGUELERET, L.POUX, S.: "HAMAP in 2015: updates to the protein family classification and annotation system", NUCLEIC ACIDS RES, vol. 43, 2015, pages D1064 - 70
PENG, Z.SOPER, S.A.PINGLE, M.R.BARANY, F.DAVIS, L.M.: "Ligase Detection Reaction Generation of Reverse Molecular Beacons for Near Real-Time Analysis of Bacterial Pathogens Using Single-Pair Fluorescence Resonance Energy Transfer and a Cyclic Olefin Copolymer Microfluidic Chip", ANALYTICAL CHEMISTRY, vol. 82, no. 23, 2010, pages 9727 - 35, XP055080298, DOI: doi:10.1021/ac101843n
PEPIN, J.VALIQUETTE, L.ALARY, M.E.VILLEMURE, P.PELLETIER, A.FORGET, K.PEPIN, K.CHOUINARD, D.: "Clostridium difficile-associated diarrhea in a region of Quebec from 1991 to 2003: a changing pattern of disease severity", CANADIAN MEDICAL ASSOCIATION JOURNAL, vol. 171, no. 5, 2004, pages 466 - 72
PETERS, A.: "The Diagnosis of Pregnancy", GLOBAL LIBRARY OF WOMENS MEDICINE, 2008, ISSN: 1756-2228
PETERSEN, T.N.BRUNAK, S.VON HEIJNE, H.: "SignalP 4.0: discriminating signal peptides from transmembrane regions", NATURE METHODS, vol. 8, 2011, pages 785 - 786
PETERSON, L.R.MANSON, R.U.PAULE, S.M.HACEK, D.M.ROBICSEK, A.THOMSON, R.B.JR, K., K.L.: "Detection of toxigenic Clostridium difficile in stool samples by real-time polymerase chain reaction for the diagnosis of C. difficile-associated diarrhea", CLIN INFECT DIS., vol. 54, no. 9, 2007, pages 1152 - 60
PETERSON, L.R.MEHTA, M.S.PATEL, P.A.HACEK, D.M.HARAZIN, M.NAGWEKAR, P.P.THOMSON, R.B., JR.ROBICSEK, A.: "Laboratory testing for Clostridium difficile infection: light at the end of the tunnel", AM J CLIN PATHOL, vol. 136, no. 3, 2011, pages 372 - 80
PETTERSEN, E.F.GODDARD, T.D.HUANG, C.C.COUCH, G.S.GREENBLATT, D.M.MENG, E.C.FERRIN, T.E.: "UCSF Chimera--a visualization system for exploratory research and analysis", J COMPUT CHEM, vol. 25, no. 13, 2004, pages 1605 - 12
PIEPENBRINK, K.H.MALDARELLI, G.A.DE LA PENA, C.F.MULVEY, G.L.SNYDER, G.A.DE MASI, L.VON ROSENVINGE, E.C.GUNTHER, S.ARMSTRONG, G.D.: "Structure of Clostridium difficile PilJ exhibits unprecedented divergence from known type IV pilins", J BIOL CHEM, vol. 289, no. 7, 2014, pages 4334 - 45
PLANCHE, T.D.DAVIES, K.A.COEN, P.G.FINNEY, J.M.MONAHAN, I.M.MORRIS, K.A.O'CONNOR, L.OAKLEY, S.J.POPE, C.F.WREN, M.W.: "Differences in outcome according to Clostridium difficile testing method: a prospective multicentre diagnostic validation study of C difficile infection", LANCET INFECTIOUS DISEASES, vol. 13, 2013, pages 936 - 945
POOJARY, N.S.RAMLAL, S.URS, R.M.SRIPATHY, M.H.BATRA, H.V.: "Application of monoclonal antibodies generated against Panton-Valentine Leukocidin (PVL-S) toxin for specific identification of community acquired methicillin resistance Staphylococcus aureus", MICROBIOL RES, vol. 169, no. 12, 2014, pages 924 - 30
POSTHUMA-TRUMPIE, G.A.KORF, J.VAN AMERONGEN, A.: "Lateral flow (immuno)assay: its strengths, weaknesses, opportunities and threats. A literature survey", ANAL BIOANAL CHEM, vol. 393, no. 2, 2009, pages 569 - 82, XP055385850, DOI: doi:10.1007/s00216-008-2287-2
POUTANEN, S.M.SIMOR, A.E.: "Clostridium difficile-associated diarrhea in adults", CMAJ, vol. 171, no. 1, 2004, pages 51 - 58
PRASSAS, I.CHRYSTOJA, C.C.MAKAWITA, S.DIAMANDIS, E.P.: "Bioinformatic identification of proteins with tissue-specific expression for biomarker discovery", BMC MED, vol. 10, 2012, pages 39, XP021095751, DOI: doi:10.1186/1741-7015-10-39
PREVENTION, T.C.F.D.C.A.: "Surveillance for community-associated Clostridium difficile - Connecticut, 2006", MORBIDITY AND MORTALITY WEEKLY REPORT, vol. 57, 2008, pages 340 - 343
PRUITT, K.BROWN, G.TATUSOVA, T.MAGLOTT, D., THE NCBI HANDBOOK, 2002
PUM, D.SCHUSTER, B.SARA, M.SLEYTR, U.B.: "Functionalisation of surfaces with Slayers", IEE PROC NANOBIOTECHNOL, vol. 151, no. 3, 2004, pages 83 - 6
QAZI, 0.HITCHEN, P.TISSOT, B.PANICO, M.MORRIS, H.R.DELL, A.FAIRWEATHER, N.: "Mass spectrometric analysis of the S-layer proteins from Clostridium difficile demonstrates the absence of glycosylation", JOURNAL OF MASS SPECTROMETRY, vol. 44, no. 3, 2009, pages 368 - 74
RABILLOUD, T.TRIBOULET, S.: "Two-dimensional SDS-PAGE fractionation of biological samples for biomarker discovery", METHODS MOL BIOL, vol. 1002, 2013, pages 151 - 65
RAHMAN, 0.CUMMINGS, S.P.HARRINGTON, D.J.SUTCILFFE, I.C.: "Methods for the bioinformatic identification of bacterial lipoproteins encoded in the genomes of gram-positive bacteria", WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, vol. 24, 2008, pages 2377 - 2382, XP019650365, DOI: doi:10.1007/s11274-008-9795-2
RAMIREZ-ROSALES, A.CANTU-LLANOS, E.: "Intrahospital mortality in patients with Clostridium difficile-associated diarrhea infection", REV GASTROENTEROL MEX, 2012
RAMNANI, P.SAUCEDOB, N.M.MULCHANDANIA, A.: "Carbon nanomaterial-based electrochemical biosensors for label-free sensing of environmental pollutants", CHEMOSPHERE, 2015
REA, M.C.O'SULLIVAN, 0.SHANAHAN, F.OTOOLE, P.W.STANTON, C.ROSS, P.H.COLIN HILL, C.: "Clostridium difficile Carriage in Elderly Subjects and Associated Changes in the Intestinal Microbiota", J. CLIN. MICROBIOL., vol. 50, no. 3, 2012, pages 867 - 875
RELLER, M.E.ALCABASA, R.C.LEMA, C.A.CARROLL, K.C.: "Comparison of two rapid assays for Clostridium difficile Common antigen and a C difficile toxin A/B assay with the cell culture neutralization assay", AM J CLIN PATHOL, vol. 133, no. 1, 2010, pages 107 - 9
REMES-TROCHE, J.M.: "Clostridium difficile-associated diarrhea infection: Is it time for us to start worrying in Mexico?", REV GASTROENTEROL MEX, 2012
RESTREPO-MONTOYA, D.VIZCAINO, C.NINO, L.F.OCAMPO, M.PATARROYO, M.E.PATARROYO, M.A.: "Validating subcellular localization prediction tools with mycobacterial proteins", BMC BIOINFORMATICS, vol. 10, 2009, pages 134, XP021047269, DOI: doi:10.1186/1471-2105-10-134
REYNOLDS, C.B.EMERSON, J.E.DE LA RIVA, L.FAGAN, R.P.FAIRWEATHER, N.F.: "The Clostridium difficile Cell Wall Protein CwpV is Antigenically Variable between Strains, but Exhibits Conserved Aggregation-Promoting Function", PLOS PATHOG, vol. 7, no. 4, 2011, pages e1002024, XP055172041, DOI: doi:10.1371/journal.ppat.1002024
RIGGS, M.M.SETHI, A.K.ZABARSKY, T.F.ECKSTEIN, E.C.JUMP, R.L.DONSKEY, C.J.: "Asymptomatic carriers are a potential source for transmission of epidemic and nonepidemic Clostridium difficile strains among long-term care facility residents", CLINICAL INFECTIOUS DISEASES, vol. 45, no. 8, 2007, pages 992 - 8
ROBINSON, J.PSTURGIS, J.LUMAR, G.L.: "Immunofluorescence", 2009
ROBOTHAM, J.WILCOX, M., UPDATE GUIDANCE ON THE DIAGNOSIS AND REPORT OF CLOSTRIDIUM DIFFICILE, 2012, Retrieved from the Internet
RODRIGUEZ-R, L.M.KONSTANTINIDIS, K.T.: "Bypassing Cultivation To Identify Bacterial Species", MICROBE, vol. 9, no. 3, 2014, pages 111 - 118
RODRIGUEZ, C.TAMINIAU, B.VAN BROECK, J.DELMEE, M.DAUBE, G.: "Clostridium difficile infection and intestinal microbiota interactions", MICROB PATHOG, vol. 89, 2015, pages 201 - 209
ROHLKE, F.STOLLMAN, N.: "Fecal microbiota transplantation in relapsing Clostridium dijticile infection", THERAP ADV GASTROENTEROL, vol. 5, no. 6, 2012, pages 403 - 20, XP055077872, DOI: doi:10.1177/1756283X12453637
RUPNIK, M.WILCOX, M.H.GERDING, D.N.: "Clostridium difficile infection: new developments in epidemiology and pathogenesis", NAT REV MICRO, vol. 7, no. 7, 2009, pages 526 - 536, XP009169073, DOI: doi:10.1038/nrmicro2164
SAADE, E.DESHPANDE, A.KUNDRAPU, S.SUNKESULA, V.C.GUERRERO, D.M.JURY, L.A.DONSKEY, C.J.: "Appropriateness of empiric therapy in patients with suspected Clostridium difficile infection", CURRENT MEDICAL RESEARCH AND OPINION, vol. 29, no. 8, 2013, pages 985 - 8
SAIKI, R.K.GELFAND, D.H.STOFFEL, S.SCHARF, S.J.HIGUCHI, R.HORN, G.T.MULLIS, K.B.ERLICH, H.A.: "Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase", SCIENCE, vol. 239, no. 4839, 1988, pages 487 - 91, XP002057159, DOI: doi:10.1126/science.2448875
SAJID, M.KAWDE, A.NDAUD, M.: "Designs, formats and applications of lateral flow assay: A literature review", JOURNAL OF SAUDI CHEMICAL SOCIETY, vol. 19, no. 6, 2015, pages 689 - 705, XP055323878, DOI: doi:10.1016/j.jscs.2014.09.001
SANGER, F.NICKLEN, S.COULSON, A.R.: "DNA sequencing with chain-terminating inhibitors", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE U.S.A, vol. 74, no. 12, 1977, pages 5463 - 7, XP008154983, DOI: doi:10.1073/pnas.74.12.5463
SAPER, C.B.: "A Guide to the Perplexed on the Specificity of Antibodies", JOURNAL OF HISTOCHEMISTRY AND CYTOCHEMISTRY, vol. 57, no. 1, 2009, pages 1 - 5, XP008103590, DOI: doi:10.1369/JHC.2008.952770
SARA, M.SLEYTR, U.B.: "S-Layer proteins", J BACTERIOL, vol. 182, no. 4, 2000, pages 859 - 68
SAUJET, L.MONOT, M.DUPUY, B.SOUTOURINA, O.MARTIN-VERSTRAETE, I.: "The key sigma factor of transition phase, SigH, controls sporulation, metabolism, and virulence factor expression in Clostridium difficile", J BACTERIOL, vol. 193, no. 13, 2011, pages 3186 - 96, XP055119042, DOI: doi:10.1128/JB.00272-11
SAVARIAU-LACOMME, M.-P. ET AL.: "Transcription and Analysis of Polymorphism in a Cluster of Genes Encoding Surface-Associated Proteins of Clostridium difficile", JOURNAL OF BACTERIOLOGY, vol. 185, no. 15, 2003, pages 4461
SCHWAN, C.KRUPPKE, A.S.NOLKE, T.SCHUMACHER, L.KOCH-NOLTE, F.KUDRYASHEV, M.STAHLBERG, H.AKTORIES, K.: "Clostridium difficile toxin CDT hijacks microtubule organization and reroutes vesicle traffic to increase pathogen adherence", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE U.S.A, vol. 111, no. 6, 2014, pages 2313 - 8
SCHWAN, C.STECHER, B.TZIVELEKIDIS, T.VAN HAM, M.ROHDE, M.HARDT, W.D.WEHLAND, J.AKTORIES, K.: "Clostridium difficile toxin CDT induces formation of microtubule-based protrusions and increases adherence of bacteria", PLOS PATHOGEN, vol. 5, 2009, pages 10
SCHWARZ, J.A.CONTESCU, C.I.PUTYERA, K.: "Dekker Encyclopedia of Nanoscience and Nanotechnology", 2004, MARCEL DEKKER, INC.
SEBAIHIA, M.WREN, B.W.MULLANY, P.FAIRWEATHER, N.F.MINTON, N.STABLER, R.THOMSON, N.R.ROBERTS, A.P.CERDENO-TARRAGA, A.M.WANG, H.: "The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome", NATURE GENETICS, vol. 38, no. 7, 2006, pages 779 - 86, XP002683863, DOI: doi:10.1038/ng1830
SEGATA, N.IZARD, J.WALDRON, L.GEVERS, D.MIROPOLSKY, L.GARRETT, W.S.HUTTENHOWER, C.: "Metagenomic biomarker discovery and explanation", GENOME BIOL, vol. 12, no. 6, 2011, pages R60, XP021106546, DOI: doi:10.1186/gb-2011-12-6-r60
SEIDEL, S.A.DIJKMAN, P.M.LEA, W.A.VAN DEN BOGAART, G.JERABEK-WILLEMSEN, M.LAZIC, A.JOSEPH, J.S.SRINIVASAN, P.BAASKE, P.SIMEONOV, A: "Microscale thermophoresis quantifies biomolecular interactions under previously challenging conditions", NATIONAL INSITUTIES OF HEALTH, vol. 59, no. 3, 2013, pages 301 - 315
SEKIROV, I.RUSSELL, S.L.CAETANO, L.ANTUNES, M.FINLAY, B.B.: "Gut Microbiota in Health and Disease", vol. 90, 2010, AMERICAN PHYSIOLOGICAL SOCIETY, pages: 859 - 904
SERDYUK, I.N.ZACCAI, N.R.ZACCAI, J.: "Structure, Dynamics, Function", 2007, CAMBRIDGE UNIVERSITY PRESS, article "Methods in Molecular biophysics"
SERVIN, A.L.: "Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens", FEMS MICROBIOLOGY REVIEWS, vol. 28, no. 4, 2004, pages 405 - 40, XP004564881
SEWELL, B.REES, E.THOMAS, I.CH'NG, C.L.ISAAC, M.BERRY, N.: "Impact on patient length of stay and costeffectiveness of rapid molecular testing for Clostridium difficile", INFECTIOUS DISEASES AND THERAPY, vol. 3, no. 2, 2014, pages 281 - 293
SHAFIQUE, S.: "Polymerase Chain Reaction", 2012, LAP LAMBERT ACADEMIC PUBLISHING
SHANHOLTZER, C.J.WILLARD, K.E.HOLTER, J.J.OLSON, M.M.GERDING, D.N.PETERSON, L.R.: "Comparison of the Vidas Clostridium difficile toxin A immunoassay with C. difficile culture and cytotoxin and latex tests", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 30, 1992, pages 1837 - 40
SHAO, Y.HE, X.HARRISON, E.M.TAI, C.OU, H.Y.RAJAKUMAR, K.DENG, Z.: "mGenomeSubtractor: a web-based tool for parallel in silico subtractive hybridization analysis of multiple bacterial genomes", NUCLEIC ACIDS RES, vol. 38, 2010, pages W194 - 200
SHARMA, S.ZAPATERO-RODRIGUEZ, J.ESTRELA, P.O'KENNEDY, R.: "Point-of-Care Diagnostics in Low Resource Settings: Present Status and Future Role of Microfluidics", BIOSENSORS, vol. 5, no. 3, 2015, pages 577 - 601
SHEARER, A.BOEHMER, M.CLOSS, M.DELA ROSA, R.HAMILTON, J.HORTON, K.MCGRATH, R.SCHULMAN, C.: "Comparison of glucose point-of-care values with laboratory values in critically ill patients", AM J CRIT CARE, vol. 18, no. 3, 2009, pages 224 - 30
SIGRIST, C.J.CERUTTI, L.HULO, N.GATTIKER, A.FALQUET, L.PAGNI, M.BAIROCH, A.BUCHER, P.: "PROSITE: a documented database using patterns and profiles as motif descriptors", BRIEF BIOINFORM, vol. 3, no. 3, 2002, pages 265 - 74
SIMON, R.ROYCHOWDHURY, S.: "Implementing personalized cancer genomics in clinical trials", NOT REV DRUG DISCOV, vol. 12, no. 5, 2013, pages 358 - 69, XP002731985, DOI: doi:10.1038/nrd3979
SIMOR, A.E.BRADLEY, S.F.STRAUSBAUGH, L.J.CROSSLEY, K.NICOLLE, L.E.: "Clostridium difficile in Long-Term-Care Facilitiesfor the Elderly", INFECTION CONTROL AND HOSPITAL EPIDEMIOLOGY, vol. 23, no. 11, 2013, pages 696 - 703
SJOBRING, U.BJORCK, L.KASTERN, W.: "Streptococcal protein G. Gene structure and protein binding properties", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 266, no. 1, 1991, pages 399 - 405
SLEYTR, U.B.MESSNER, P.: "Crystalline surface layers on bacteria", ANNU REV MICROBIOL, vol. 37, 1983, pages 311 - 39
SNAPE, A.PAPACHRISTODOULOU, D.ELLIOTT, W.H.ELLIOTT, D.C.: "Biochemistry and Molecular Biology", 2014, OXFORD UNIVERSITY PRESS
SONG, L.ZHAO, M.DUFFY, D.C.HANSEN, J.SHIELDS, K.WUNGJIRANIRUN, M.CHEN, X.XU, H.LEFFLER, D.A.SAMBOL, S.P.: "Development and validation of digital ELISAs for ultrasensitive detection and quantification of C. difficile toxins in stool", JOURNAL OF CLINICAL MICROBIOLOGY, 2015
SONG, Y.L.LIU, C.X.MCTEAGUE, M.SUMMANEN, P.FINEGOLD, S.M.: "Clostridium bartlettii sp. nov., isolated from human faeces", ANAEROBE, vol. 10, no. 3, 2004, pages 179 - 84
SONG, Z.CHEN, L.XU, D.: "Bioinformatics methods for protein identification using Peptide mass fingerprinting", METHODS MOL BIOL, vol. 604, 2010, pages 7 - 22
SOREIDE, K.: "Receiver-operating characteristic curve analysis in diagnostic, prognostic and predictive biomarker research", J CLIN PATHOL, vol. 62, no. 1, 2009, pages 1 - 5
SPIGAGLIA, P.BARKETI-KLAI, A.COLLIGNON, A.MASTRANTONIO, P.BARBANTI, F.RUPNIK, M.JANEZIC, S.KANSAU, I.: "SURFACE-LAYER (S-LAYER) OF HUMAN AND ANIMAL CLOSTRIDIUM DIFFICfLE STRAINS AND THEIR BEHAVIOUR IN ADHERENCE TO EPITHELIAL CELLS AND INTESTINAL COLONIZATION", JOURNAL OF MEDICAL MICROBIOLOGY, 2013
STALLMACH, A.HAGEL, S.LOHSE, A.W.: "Diagnostic workup and therapy of infectious diarrhea : Current standards", INTERNIST (BERL), 2015
STOJANOVIC, I.SCHASFOORT, R.B.TERSTAPPEN, L.W.: "Analysis of cell surface antigens by Surface Plasmon Resonance imaging", BIOSENS BIOELECTRON, vol. 52, 2014, pages 36 - 43
STORCH, W.B.: "Immunofluorescence in Clinical Immunology: A Primer and Atlas", 2000, SPRINGER BASEL AG
SUAREZ, S.FERRONI, A.LOTZ, A.JOLLEY, K.A.GUERIN, P.LETO, J.DAUPHIN, B.JAMET, A.MAIDEN, M.C.NASSIF, X.: "Ribosomal proteins as biomarkers for bacterial identification by mass spectrometry in the clinical microbiology laboratory", J MICROBIOL METHODS, vol. 94, no. 3, 2013, pages 390 - 6, XP028700704, DOI: doi:10.1016/j.mimet.2013.07.021
SUGIURA, T.IMAGAWA, H.KONDO, T.: "Purification of horse immunoglobulin isotypes based on differential elution properties of isotypes from protein A and protein G columns", JOURNAL OF CHROMATOGRAPHY B: BIOMEDICAL SCIENCES AND APPLICATIONS, vol. 742, no. 2, 2000, pages 327 - 334, XP004200224, DOI: doi:10.1016/S0378-4347(00)00177-8
SUNDBERG, E.J.ANDERSON, P.S.GORSHKOVA, I.I.SCHUCK, P: "Surface Plasmon Resonance Biosensing in the Study of Ternary Systems of Interacting Proteins", 2007, SPRINGER
SZAFRANSKI, S.P.WOS-OXLEY, M.L.VILCHEZ-VARGAS, R.JAUREGUI, R.PLUMEIER, I.KLAWONN, F.TOMASCH, J.MEISINGER, C.KUHNISCH, J.SZTAJER, H: "High-resolution taxonomic profiling of the subgingival microbiome for biomarker discovery and periodontitis diagnosis", APPL ENVIRON MICROBIOL, vol. 81, no. 3, 2015, pages 1047 - 58, XP055538161, DOI: doi:10.1128/AEM.03534-14
TABAN, B.M.AYTAC, S.A.AKKOC, N.AKCELIK, M.: "Characterization of antibiotic resistance in Salmonella enterica isolates determined from ready-to-eat (RTE) salad vegetables", BRAZILIAN JOURNAL OF MICROBIOLOGY,, vol. 44, 2013, pages 385 - 391
TAKEOKA, A.TAKUMI, K.KOGA, T.KAWATA, T.: "Purification and characterization of ! layer proteins from Clostridium difficile GAI 0714", J GEN MICROBIOL, vol. 137, no. 2, 1991, pages 261 - 7, XP001002642
TAM DANG, T.H.FAGAN, R.P.FAIRWEATHER, N.F.TATE, E.W.: "Novel inhibitors of surface layer processing in Clostridium difficile", BIOORGANIC & MEDICINAL CHEMISTRY, vol. 20, no. 2, 2012, pages 614 - 621
TANG, S.HEWLETT, I.: "Nanoparticle-based immunoassays for sensitive and early detection of HIV-1 capsid (p24) antigen", J INFECT DIS, vol. 201, no. 1, 2010, pages 59 - 64
TANG, Y.W.ELLIS, N.M.HOPKINS, M.K.SMITH, D.H.DODGE, D.E.PERSING, D.H.: "Comparison of Phenotypic and Genotypic Techniques for Identification of Unusual Aerobic Pathogenic Gram-Negative Bacilli", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 36, no. 12, 1998, pages 3674 - 9
TASLIM, H.: "Clostridium difficile infection in the elderly", ACTA MEDICA INDONESIA, vol. 41, no. 3, 2009, pages 148 - 51
TATTEVIN, P.BUFFET-BATAILLON, S.DONNIO, P.REVEST, M.MICHELET, C.: "Clostridium difficile infections: do we know the real dimensions of the problem?", INTERNATIONAL JOURNAL OF ANTIMICROBIAL AGENTS, 2013
TAYLOR, L.H.LATHAM, S.M.WOOLHOUSE, M.E.: "Risk factors for human disease emergence", PHILOS TRANS R SOC LOND B BIOL SCI, vol. 356, no. 1411, 2001, pages 983 - 9
TENOVER, F.C.BARON, E.J.PETERSON, L.R.PERSING, D.H.: "Laboratory diagnosis of Clostridium difficile infection can molecular amplification methods move us out of uncertainty?", JOURNAL OF MOLECUALR DIAGNOSTICS, vol. 13, no. 6, 2011, pages 573 - 82
TENOVER, F.C.NOVAK-WEEKLEY, S.WOODS, C.W.PETERSON, L.R.DAVIS, T.SCHRECKENBERGER, P.FANG, F.C.DASCAL, A.GERDING, D.N.NOMURA, J.H.: "Impact of strain type on detection of toxigenic Clostridium difficile: comparison of molecular diagnostic and enzyme immunoassay approaches", J CLIN MICROBIOL, vol. 48, no. 10, 2010, pages 3719 - 24
THERMO, S.: "Tech Tip #65", 2010, THERMO FISHER SCIENTIFIC INC., article "ELISA technical guide and protocols"
TIWARI, A.K.SRIVASTAVA, R.: "A survey of computational intelligence techniques in protein function prediction", INT J PROTEOMICS, 2014, pages 845479
TONYUSHKINA, K.NICHOLS, J.H.: "Glucose Meters: A Review of Technical Challenges to Obtaining Accurate Results", J DIABETES SCI TECHNOL, vol. 3, no. 4, 2009, pages 971 - 980
TRAYHURN, P.: "Northern blotting", PROC NUTRSOC, vol. 55, no. lb, 1996, pages 583 - 9
TREISTER, A.ROEDERER, M., AQ FLOWJO.COM., 13 October 2015 (2015-10-13), Retrieved from the Internet
TROY, D.B.BERINGER, P.: "Remington: The Science and Practice of Pharmacy", 2006, LIPPINCOTT WILLIAMS & WILKINS
TWYMAN, R.M.: "Principles of Proteomics", 2014, GARLAND SCIENCE
UBEDA, C.TAUR, Y.JENQ, R.R.EQUINDA, M.J.SON, T.SAMSTEIN, M.VIALE, A.SOCCI, N.D.VAN DEN BRINK, M.R.KAMBOJ, M.: "Vancomycin-resistant Enterococcus domination of intestinal microbiota is enabled by antibiotic treatment in mice and precedes bloodstream invasion in humans", JOURNAL OF CLINICAL INVESTIGATION, vol. 120, no. 12, 2010, pages 4332 - 41, XP055386855, DOI: doi:10.1172/JCI43918
"Reorganizing the protein space at the Universal Protein Resource (UniProt", NUCLEIC ACIDS RES, vol. 40, 2012, pages D71 - 5
VAISHNAVI, C.: "Clostridium difficile infection: clinical spectrum and approach to management", INDIAN J GASTROENTEROLOGY, vol. 30, no. 6, 2011, pages 245 - 54, XP055122526, DOI: doi:10.1007/s12664-011-0148-y
VEDANTAM, G.CLARK, A.CHU, M.MCQUADE, R.MALLOZZI, M.VISWANATHAN, V.K.: "Clostridium difficile infection: Toxins and non-toxin virulence factors, and their contributions to disease establishment and host response", GUT MICROBES, vol. 3, no. 2, 2012, pages 121 - 34
VEIGAS, B.PEDROSA, P.CARLOS, F.F.MANCIO-SILVA, L.GROSSO, A.R.FORTUNATO, E.MOTA, M.M.BAPTISTA, P.V.: "One nanoprobe, two pathogens: gold nanoprobes multiplexing for point-of-care", JOURNAL OF NANOBIOTECHNOLOGY, vol. 13, 2015, XP021224989, DOI: doi:10.1186/s12951-015-0109-1
VINDIGNI, S.M.SURAWICZ, C.M.: "C. difficile Infection: Changing Epidemiology and Management Paradigms", CLIN TRANSL GASTROENTEROL, vol. 6, 2015, pages e99
VOTH, D.E.BALLARD, J.D.: "Clostridium difficile Toxins: Mechanism of Action and Role in Disease", CLIN MICROBIOL REVIEW, vol. 18, no. 2, 2005, pages 247 - 263, XP055042158, DOI: doi:10.1128/CMR.18.2.247-263.2005
WALIGORA, A.J.HENNEQUIN, C.MULLANY, P.BOURLIOUX, P.COLLIGNON, A.KARJALAINEN, T.: "Characterization of a cell surface protein of Clostridium difficile with adhesive properties", INFECT IMMUN, vol. 69, no. 4, 2001, pages 2144 - 53
WARNY, M.PEPIN, J.FANG, A.KILLGORE, G.THOMPSON, A.BRAZIER, J.FROST, E.MCDONALD, L.C.: "Toxin production by an emerging strain of Clostridium difficile associated with outbreaks of severe disease in North America and Europe", THE LANCET, vol. 366, no. 9491, 2005, pages 1079 - 1084, XP025277768, DOI: doi:10.1016/S0140-6736(05)67420-X
WATERHOUSE, A.M.PROCTER, J.B.MARTIN, D.M.CLAMP, M.BARTON, G.J.: "Jalview Version 2--a multiple sequence alignment editor and analysis workbench", BIOINFORMATICS, vol. 25, no. 9, 2009, pages 1189 - 91
WATTAM, A.R.ABRAHAM, D.DALAY, O.DISZ, T.L.DRISCOLL, T.GABBARD, J.L.GILLESPIE, J.J.GOUGH, R.HIX, D.KENYON, R.: "PATRIC, the bacterial bioinformatics database and analysis resource", NUCLEIC ACIDS RESEARCH, vol. 42, no. D1, 2014, pages D581 - D591
WIENKEN, C.J.BAASKE, P.ROTHBAUER, U.BRAUN, D.S., D.: "Protein-binding assays in biological liquids using microscale thermophoresis", NATURE COMMUNICATIONS, vol. 1, no. 100, 2010
WIJAYA, E.LENAERTS, C.MARICOT, S.HASTANIN, J.HABRAKEN, S.VILCOT, J.-P.BOUKHERROUB, R.SZUNERITS, S.: "Surface plasmon resonance-based biosensors: From the development of different SPR structures to novel surface functionalization strategies", CURRENT OPINION IN SOLID STATE AND MATERIALS SCIENCE, vol. 15, no. 5, 2011, pages 208 - 224, XP028238029, DOI: doi:10.1016/j.cossms.2011.05.001
WILCOX, M., UPDATED GUIDANCE ON THE MANAGEMENT AND TREATMENT OF CLOSTRIDIUM DIFFICILE INFECTION.CROWN, 2013
WILCOX, M.H.FAWLEY, W.N.: "Hospital disinfectants and spore formation by Clostridium difficile", THE LANCET, vol. 356, no. 9238, 2000, pages 1324, XP004821310, DOI: doi:10.1016/S0140-6736(00)02819-1
WILSON, K.H.SILVA, J.FEKETY, R.: "Fluorescent-Antibody Test for Detection of Clostridium difficile in Stool Specimens", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 16, no. 3, 1982, pages 464 - 468
WOESE, C.R.FOX, G.E.: "Phylogenetic structure of the prokaryotic domain: The primary kingdoms", PNAS, vol. 74, no. 11, 1977, pages 5088 - 5090
WU, S.ZHANG, Y.: "LOMETS: a local meta-threading-server for protein structure prediction", NUCLEIC ACIDS RES, vol. 35, no. 10, 2007, pages 3375 - 82
WIIST, J.SULLIVAN, N.M.HARDEGGER, U.WILKINS, T.D.: "Investigation of an outbreak of antibiotic-associated colitis by various typing methods", JOURNAL OF CLINICAL MICROBIOLOGY, vol. 16, no. 6, 1982, pages 1096 - 101
YANG, Z.RAMSEY, J.HAMZA, T.ZHANG, Y.LI, S.YFANTIS, H.G.LEE, D.HERNANDEZ, L.D.SEGHEZZI, W.FURNEISEN, J.M.: "Mechanisms of protection against Clostridium difficile infection by the monoclonal antitoxin antibodies actoxumab and bezlotoxumab", INFECTION AND IMMUNITY, vol. 83, no. 2, 2015, pages 822 - 31
YOUSEF, M.NAJAMI, N.ABEDALLAH, L.KHALIFA, W.: "Data Mining for Bioinformatics Applications", JOURNAL OF INTELLIGENT LEARNING SYSTEMS AND APPLICATIONS,, vol. 6, no. 4, 2014, pages 153 - 161
YU, N.Y.WAGNER, J.R.LAIRD, M.R.MELLI, G.REY, S.LO, R.DAO, P.SAHINALP, S.C.ESTER, M.FOSTER, L.J.: "PSORTb 3.0: improved protein subcellular localization prediction with refined localization subcategories and predictive capabilities for all prokaryotes", BIOINFORMATICS, vol. 26, no. 13, 2010, pages 1608 - 15
ZEGERS, N.D.BOERSMA, W.J.A.CLAASSEN, E.: "Immunological Recognition of Peptides in Medicine and Biology", 1995, CRC PRESS
ZHANG, F.WU, X.CHEN, J.Y.: "Integrative Bioinformatics", 2014, SPRINGER, article "Computational Biomarker Discovery. Towards the Virtual Cell' Chen, M. and Hofestadt, R. Approaches", pages: 355 - 386
ZHANG, S.XING, P.GUO, G.LIU, H.LIN, D.DONG, C.LI, M.FENG, D.: "Development of microbeads of chicken yolk antibodies against Clostridium difficile toxin A for colonic-specific delivery", DRUG DELIVERY, 2015, pages 1 - 8
ZHANG, Y.: "l-TASSER server for protein 3D structure prediction", BMC BIOINFORMATICS, vol. 9, 2008, pages 40, XP021031919
ZHANG, Y.SKOLNICK, J.: "SPICKER: a clustering approach to identify near-native protein folds", J COMPUT CHEM, vol. 25, no. 6, 2004, pages 865 - 71
ZHAO, W.CHEN, J.J.FOLEY, S.WANG, Y.ZHAO, S.BASINGER, J.ZOU, W.: "Biomarker identification from next-generation sequencing data for pathogen bacteria characterization and surveillance", BIOMARK MED, vol. 9, no. 11, 2015, pages 1253 - 64
ZHENG, Z.KATOH, S.HE, Q.ORITANI, K.MIYAKE, K.LESLEY, J.HYMAN, R.HAMIK, A.PARKHOUSE, R.M.FARR, A.G.: "Monoclonal antibodies to CD44 and their influence on hyaluronan recognition", J CELL BIOL, vol. 130, no. 2, 1995, pages 485 - 95
ZHOU, Q.SON, K.LIU, Y.REVZIN, A.: "Biosensors for Cell Analysis", ANNUAL REVIEW OF BIOMEDICAL ENGINEERING, vol. 17, 2015
ZILLNER, K.JERABEK-WILLEMSEN, M.DUHR, S.BRAUN, D.LANGST, G.P., B.: "Microscale Thermophoresis as a Sensitive Method to Quantify Protein: Nucleic Acid Interactions in Solution", METHODS IN MOLECULAR BIOLOGY, vol. 815, 2012, pages 241 - 52
Attorney, Agent or Firm:
HGF LIMITED (Document Handling - York, 1 City Walk, Leeds Yorkshire LS11 9DX, LS11 9DX, GB)
Download PDF:
Claims:
CLAIMS

1 . Use of a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) as a biomarker for identification of Clostridium difficile.

2. An antibody or antigen binding fragment thereof that binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

3. An antibody or antigen binding fragment thereof that specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide

AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

4. The antibody or antigen binding fragment thereof of claim 3, wherein the antibody specifically binds to a peptide comprising an amino acid sequence STKEDQLVDA (SEQ ID NO:3) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

5. The antibody or antigen binding fragment thereof of claim 3, wherein the antibody specifically binds to a peptide comprising an amino acid sequence KEDQLVDALA (SEQ ID NO:4) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1).

6. An antibody or antigen binding fragment thereof that binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) comprising a heavy chain variable domain of SEQ ID NO:5 and a light chain variable domain of SEQ ID NO:6.

7. An antibody or antigen binding fragment thereof that binds to the peptide

AKDGSTKEDQLVDALA (SEQ ID NO:1 ) comprising: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9; and a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12.

8. The antibody or antigen binding fragment thereof of any one of claims 2 to 7, wherein said antibody is a murine antibody. 9. The antibody or antigen binding fragment thereof of any one of claims 2 to 7, wherein said antibody is a humanized antibody or a human antibody.

10. The antibody or antigen binding fragment thereof of any one of claims 2 to 9, wherein said antibody fragment is a Fab fragment or an ScFv.

1 1. The antibody or antigen binding fragment thereof of any one of claims 2 to 10, wherein said antibody or fragment is conjugated to a detectable agent.

12. The antibody or antigen binding fragment thereof of any one of claims 2 to 10, wherein said antibody or fragment is conjugated to a cytotoxic or therapeutic agent.

13. Use of an antibody or antigen binding fragment thereof of any one of claims 2 to 12 in the identification of Clostridium difficile.

14. A method of diagnosing a Clostridium difficile infection in a patient comprising: determining the presence of a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) in a sample isolated from the patient,

wherein the presence of the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) in the patient sample identifies the patient as having a Clostridium difficile infection or wherein the absence of the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) in the patient sample identifies the patient as not having a Clostridium difficile infection.

15. The method according to claim 14, wherein the presence of a peptide having the amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) is determined using an antibody according to any one of claims 2 to 1 1 .

16. An antibody according to claim 12 for use as a medicament.

17. An antibody according to claim 12 for use in treating a Clostridium difficile infection.

18. A kit for diagnosing a Clostridium difficile infection in a patient comprising:

i) a detectably labelled agent that specifically binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ); and

ii) reagents for performing a diagnostic assay.

19. A kit for diagnosing a Clostridium difficile infection comprising an assay device comprising a first antibody which specifically binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ); and (2) a second, different antibody which binds to either the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1) or to the first antibody and which is conjugated to a detectable agent.

20. Use of a biomarker according to claim 1 in the identification of Clostridium difficile.

Description:
Biomarker

This invention relates to a unique biomarker for identification of Clostridium difficile. Additionally, the invention relates to antibodies that specifically bind to a unique biomarker for identification of Clostridium difficile and the use of such antibodies in diagnosis and therapy.

BACKGROUND

Clostridium difficile ( C . difficile ) is a Gram-positive, spore forming, anaerobic bacillus, which causes C. difficile infection (CDI) (Hernandez-Rocha et al., 2013). In developed countries, CDI is the foremost source of nosocomial diarrhoea (Evans and Safdar, 2015) and, in many areas, C. difficile has a greater mortality and morbidity rate than methicillin-resistant Staphylococcus aureus (MRSA) (Miller et al., 201 1 ; Magill et al., 2014; Public Health England, 2016). The economic burden of CDI is huge, in the United States alone it has been estimated at over $3 billion per year (Howerton et al., 2013).

The symptoms of CDI can range from mild self-limiting diarrhoea, cramping or fever through to life threatening Pseudomembranous colitis (PMC) (Loo et al., 2005). CDI can infrequently progress to fulminant CDI (FCDI), at a rate of around 1 -3 % of total CDI (McMaster-Baxter and Musher, 2007). FCDI includes, developing colonic perforation and toxic megacolon, an acute form of colon distension, which has a high mortality rate of 38 % to 80 % (Foglia et al., 2012). The symptoms of FCDI include severe abdominal pain, dehydration, hypotension, oliguria or anuria, and marked leucocytosis (McMaster-Baxter and Musher, 2007).

C. difficile is spread via the faecal-oral route, either through vegetative cells or resilient spores (Cohen et al., 2010). C. difficile, in either form, is excreted in carriers’ faeces, transmitted by person-person or person-object contact, and re-enters the gut via ingestion. The key reservoirs for C. difficile are colonised people, either asymptomatic or CDI patients, and inanimate objects, on which spores can survive for months (Gerding et al., 1995; Fordtran, 2006). C. difficile is identified as the most common cause of antibiotic associated diarrhea. Since 2000, there has been a dramatic increase in the rates and severity of CDI particularly in North America and Europe. The primary risk factor for the development of CDI is the use of antibiotics disrupting the normal enteric bacterial flora enabling an overgrowth of ingested or endogenous C. difficile (Voth and Ballard, 2005). However, the population at risk of suffering from CDI includes not only patients on antimicrobial and other therapies that can alter the balance of the gut microbiota, but also the immunocompromised (such as a consequence of disease or medical treatment) and the elderly. Other increased risk factors for CDI include length of hospital stay, use of feeding tubes, mechanical ventilation, invasive cannulae or catheters, and underlying co-morbidity. Accounts of relapse or re infection of C. difficile in susceptible individuals is also documented with 15-35% of patients suffering relapse within the first 2 months post treatment.

Currently, there is not a single CDI diagnostic test that is used as the worldwide standard as there is variance in the accuracy, cost and operational speed of the differing tests (Hansen et al., 2010). The two key factors for any diagnosis are sensitivity and specificity. Sensitivity is the accuracy in which the method can detect those with CDI. Specificity is the accuracy in which the method determines those that are 'disease-free' (Parikh et al., 2008). Since non-toxigenic strains do not cause CDI, C. difficile can be present within samples without infection (Kachrimanidou and Malisiovas, 201 1 ). Therefore, to diagnose CDI, determining the presence of C. difficile is not enough, either toxin A or B needs to be identified too (Brobach et al., 2009). However, tests that utilise a biomarker for C. difficile, such as the Glutamate dehydrogenase, can have a high negative predictive value in a screening algorithm.

An accurate and rapid diagnostic system would reduce the rates of morbidity, mortality and costs associated with CDI (Barbut et al., 2014).

BRIEF SUMMARY OF THE DISCLOSURE

In one aspect, the invention provides the use of a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) as a biomarker for identification of Clostridium difficile. In another aspect, the invention provides an antibody or antigen binding fragment thereof that binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

In another aspect, the invention provides an antibody or antigen binding fragment thereof that specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

Optionally, the antibody or antigen binding fragment thereof specifically binds to a peptide comprising an amino acid sequence STKEDQLVDA (SEQ ID NO:3) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

Optionally, the antibody or antigen binding fragment thereof specifically binds to a peptide comprising an amino acid sequence KEDQLVDALA (SEQ ID NO:4) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

In another aspect, the invention provides an antibody or antigen binding fragment thereof that binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) comprising a heavy chain variable domain of SEQ ID NO:5 and a light chain variable domain of SEQ ID NO:6.

In another aspect, the invention provides an antibody or antigen binding fragment thereof that binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1) comprising: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9; and a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12.

Optionally, said antibody or antigen binding fragment thereof is a murine antibody or antigen binding fragment thereof.

Optionally, said antibody or antigen binding fragment thereof is a humanized antibody (or antigen binding fragment thereof) or a human antibody (or antigen binding fragment thereof). Optionally, said antibody fragment is a Fab fragment or an ScFv.

Optionally, said antibody or fragment is conjugated to a detectable agent.

Optionally, said antibody or fragment is conjugated to a cytotoxic or therapeutic agent.

In another aspect, the invention provides the use of an antibody or antigen binding fragment thereof of the invention in the identification of Clostridium difficile.

In another aspect, the invention provides a method of diagnosing a Clostridium difficile infection in a patient comprising:

determining the presence of a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) in a sample isolated from the patient,

wherein the presence of the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) in the patient sample identifies the patient as having a Clostridium difficile infection or wherein the absence of the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) in the patient sample identifies the patient as not having a Clostridium difficile infection.

Optionally, the presence of a peptide having the amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) is determined using an antibody according to the invention.

In another aspect, the invention provides an antibody of the invention for use as a medicament.

In another aspect, the invention provides an antibody of the invention for use in treating a Clostridium difficile infection. In another aspect, the invention provides a kit for diagnosing a Clostridium difficile infection in a patient comprising:

i) a detectably labelled agent that specifically binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ); and

ii) reagents for performing a diagnostic assay.

In another aspect, the invention provides a kit for diagnosing a Clostridium difficile infection comprising an assay device comprising a first antibody which specifically binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ); and (2) a second, different antibody which binds to either the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) or to the first antibody and which is conjugated to a detectable agent.

In another aspect, the invention provides the use of a biomarker of the invention in the identification of Clostridium difficile.

BRIEF DESCRIPTION OF THE DRAWINGS

Embodiments of the invention are further described hereinafter with reference to the accompanying drawings, in which:

Figure 1 shows the structure of the Gram-positive C. difficile cell surface. A lipid bilayer forms the cytoplasmic membrane which is surrounded by a thick peptidog lycan cell wall. The entire cell is encapsulated with the S-layer which is made mainly from the mature LMW and HMW SLPs that are cleaved from SlpA. The S-Layer also contains some other cell wall proteins.

Figure 2 shows BLASTP search for similarity of the SlpA biomarker

AKDGSTKEDQLVDALA to other protein sequences within the NCBI database (28/06/12). The biomarker was 100 % conserved within C. difficile strains.

Figure 3 shows the combined results from the surface localisation tools and an

InterProScan of the sequence to show the domains and biomarker location on C. difficile 630 SlpA. The cleavage site of SlpA into the mature LMW AND HMW SLPs was taken from the literature. Figure 4 shows a Jalview image of the alignments of SlpA sequences from the 13 SLTS and C. difficile 630. Amino acids are coloured according to percentage identity, with the dark purple representing >80 % identity, purple >60 % and light purple >40 % sequence identity. The biomarker is denoted by the black box and displays 100 % sequence identity across all 14 C. difficile strains, SLTS Ox1 121 , Ox1342, Ox1 192c, Ox1523, Ox1533, Ox1424, Ox160, Ox1437a, Ox1896, Ox575, Ox1396, Ox858, Ox1 145 and the reference strain 630. Figure 5 shows Chimera images of the five HMW SLP structures predicted using I- TASSER. The PDB files were loaded, the surface of the protein was displayed in white, and the biomarker sequence highlighted in red. All five models displayed the biomarker as being surface -accessible. Model A had the greatest confidence score of -2.68, closely followed by B with -2.78. The confidence scores for the remaining three models were -3.01 (C), -3.10 (D) and -4.55 (E)

Figure 6 shows PCR products from the SlpA amplification, separated by agarose gel electrophoresis (A) and the sequence data of the purified PCR products, with the biomarker underlined (B).

Figure 7 shows SDS-PAGE gel of the extracted surface layer proteins from C. difficile R002, R050 and 630. The HMW SLP varies in size and along with the LMW SLP is labelled. There are several other surface proteins present within the samples. Figure 8 shows dot blots with Ab521 (A) and Ab652 (B) of low pH glycine extracted surface proteins (S) and the residual pellet, post extraction (P) for C. difficile 630 and C. sordellii ATCC 9714. The primary antibody was directly blotted on to the membrane as a positive control. The biomarker regions of the antibody epitopes are indicated below the blot. Figure 9 shows dot blots with Ab370 (A), Ab498 (B) against low pH glycine extracted surface proteins (S) and the residual pellet, post extraction (P) for C. difficile 630 and C. sordellii AT CC 9714. The primary antibody was directly blotted on to the membrane as a positive control. The biomarker regions of the antibody epitopes are indicated below the plot.

Figure 10 shows a western blot (right) and concomitant SDS-PAGE gel (left) with Ab521 (A) and Ab652 (B) against the low pH glycine extracted surface proteins (S) and residual pellet (P) of C. difficile 630 and the closely related strains C. sordellii ATCC 9714 and P. anaerobius VP I 4330.

Figure 1 1 shows absorbance readings from an ELISA of antibodies Ab491 , Ab493, Ab521 and Ab652 binding to whole cells of C. difficile (C. diff) R002, R050. 630, 118497G,

128703G and 994535, and closely related species P. anaerobius VPI 4330 and C. sordellii ATCC 9714. The error bars show the standard deviation of the two replicates for each sample. Figure 12 shows a chromatograph from the purification of Ab521 from cell culture media using a protein G agarose column on the AKTA Start chromatography system (A). The low pH elution buffer is added at elution fraction 1 , eluting the antibody from the protein G column, as represented by the peak in the UV absorbance (blue line). The elution fractions that are predicted to contain antibody were separated on an SDS-PAGE gel to determine the presence and purity of antibody (B). Both Ab521 and Ab652 were separated on the reducing gel and show protein bands at around 55 kDa and 25 kDa.

Figure 13 shows a SDS-PAGE gel (10%) of the fractions from the nickel column purification of the recombinant C. difficile 630 LMW SLP. All fractions were in 25 mM Tris/HCI, 200 mM NaCI, pH 7.5 buffer and the stated imidazole concentration. The LMW SLP eluted from the column with 50 mM imidazole and separated on the gel at around between 25 and 35 kDa.

Figure 14 shows a SDS-PAGE gel 10 % and corresponding Western blot using Ab521 , 5 mg/ml. The samples separated on the gel were the low pH extracted surface layer proteins of eight C. difficile S-Layer type strains and the recombinant C. difficile 630 LMW SLP. The Ab521 binds specifically to the HMW SLP from all SLTS.

Figure 15 shows a SDS-PAGE gel 10 % and corresponding Western blot using Ab652, 5 mg/m|. The samples separated on the gel were the low pH extracted surface layer proteins of eight C. difficile S-Layer type strains and the recombinant C. difficile 630 LMW SLP. The Ab521 binds specifically to the HMW SLP from all SLTS.

Figure 16 shows Western blots and the corresponding SDS-PAGE gels using Ab521 at 5 mg/ml against the whole cell extracts of all 14 C. difficile SLTS and the closely related strains, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330. Ab521 binds to the HMW SLP in all C. difficile SLTS and does not bind to proteins in the whole cell lysates of the closely related strains.

Figure 17 shows Western blots and the corresponding SDS-PAGE gels using Ab652 at 5 mg/ml (top) and 10 mg/ml (bottom) against the whole cell extracts of all 14 C. difficile SLTS and the closely related strains, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330. Ab652 binds to the HMW SLP in all C. difficile SLTS and does not bind to proteins in the whole cell lysates of the closely related strains. Figure 18 shows most similar BLASTP result of the Ab493 epitope 'VDALAAAPIA' searched within P. anaerobius. Eight out of the ten amino acids are matched to a surface protein within the organism.

Figure 19 shows whole cell dot blots of all 14 C. difficile SLTS, C. difficile 630, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330. The cells were bound directly to the membrane at differing dilutions, the closely related strains were all applied undiluted. Positive controls were used of the primary antibody and low pH glycine extracted surface layer proteins from C. difficile 630, bound directly to the membrane. The blots were probed with 5 mg/ml Ab521 (A) and Ab652 (B) followed by HRP conjugated anti- mouse IgG.

Figure 20 shows absorbance readings at 450 nm for the Ab521 ELISA at concentrations 5 mg/ml to 100 ng/ml, with whole cells from all 14 C. difficile SLTS, C. difficile 630 and the closely related species, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P.

anaerobius VPI 4330. The error bars show the standard deviation seen between the two replicates of each sample.

Figure 21 shows absorbance readings at 450 nm for the Ab521 ELISA at concentrations 100-0.1 ng/ml, with whole cells from all 14 C. difficile SLTS, C. difficile 630 and the closely related species, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330. The error bars show the standard deviation seen between the two replicates of each sample.

Figure 22 shows Absorbance readings at 450 nm for the Ab521 ELISA from

concentrations 5 mg/m| to 0.1 ng/ml , with whole cells from all 14 C. difficile SLTS (Ox...),

C. difficile 630 and the closely related species, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius \/PI 4330. The Ab521 concentrations 5 mg/m| to 0.1 ng/ml are along the x-axis and each line on the graph denotes the absorbance values for a bacterial strain. The closely related species are grouped at the lower absorbance values whereas, the C. difficile strains are grouped and increase in absorbance as the antibody

concentration increases. The mean of the two repeats were used and the standard deviation was not shown for ease of visualisation of the curves. Figure 23 shows absorbance readings at 450 n for the Ab652 ELISA at concentrations 0.1 -10 mg/ml, with whole cells from all 14 C. difficile SLTS, C. difficile 630 and the closely related species, C. hiranonis DSM-13275, C. sordellii AT CC 9714 and P. anaerobius VP I 4330. The error bars show the standard deviation seen between the two replicates of each sample.

Figure 24 shows fluorescence intensity histograms of Alexa Fluor 594 conjugated anti mouse IgG, bound to Ab521 , which in turn was bound to paraformaldehyde fixed, whole C. difficile SLTS cells. Controls (red line) are of C. difficile cells incubated with the conjugated anti-mouse IgG but not Ab521 . All three histograms, A, B and C were performed under the same experimental conditions but with different C. difficile strains, which are labelled in the relative key.

Figure 25 shows Fluorescence intensity histograms of Alexa Fluor 594 conjugated anti mouse IgG, bound to Ab652, which in turn was bound to whole C. difficile SLTS, paraformaldehyde fixed cells. Controls (red line) are of C. difficile cells incubated with the conjugated.

Figure 26 shows Fluorescence intensity histogram of the closely related strains, C.

hiranonis DSM-13275, C. sordellii AT CC 9714, and P. anaerobius VPI 4330 with C. difficile 630 as a positive reference. All cells have been incubated with Alexa Fluor 594 anti-mouse

IgG and Ab521 (A) or Ab652 (B). C. difficile 630 has much higher fluorescence values than the closely related strains. Therefore showing binding of the mAbs to C. difficile 630 and not to the closely related strains. Figure 27 shows Immunofluorescence microscopy images of Ox1396 incubated with Alexa Fluor 594 anti-mouse IgG and Ab521 , brightfield image (A), mCherry filter (B). Alexa Fluor 594 anti-mouse IgG and Ab652 brightfield image (E), mCherry filter (F). Control of Ox1396 with Alexa Fluor 594 anti-mouse IgG and no primary antibody brightfield image (C), mCherry filter (D).

Figure 28 shows Immunofluorescence microscopy images of Ox1342 incubated with Alexa Fluor 594 anti-mouse IgG and Ab521 , brightfield image (A), mCherry filter (B). Alexa Fluor 594 anti-mouse IgG and Ab652 brightfield image (E), mCherry filter (F). Control of Ox1342 with Alexa Fluor 594 anti-mouse IgG and no primary antibody brightfield image (C), mCherry filter (D). Figure 29 shows Immunofluorescence microscopy images of C. sordellii incubated with Alexa Fluor 594 anti-mouse IgG and Ab521 brightfield (A) mCherry (B) or Ab6521 brightfield (C) mCherry (D).

Figure 30 shows Transmission electron microscope image of C. difficile 630 (A) and Ox575 (B) incubated with Ab521 and gold conjugated anti-mouse IgG. The white arrows indicate gold nanoparticles that are within the more dense region of the cell and are therefore more difficult to see. The S-layer completely encapsulates the bacterium and is at the same position as the cell wall at the surface of the rod shaped cells. Figure 31 shows Transmission electron microscope image of C. difficile 630 incubated with Ab652 and gold conjugated antimouse IgG. The white arrows indicate gold nanoparticles that are within the more dense region of the cell and are therefore more difficult to see.

The S-layer completely encapsulates the bacterium and is at the same position as the cell wall at the surface of the rod shaped cells.

Figure 32 shows Transmission electron microscope image of C. difficile 630 without primary antibody and incubated with only gold conjugated anti-mouse IgG. There are no gold nanoparticles displayed on the cells. Figure 33 shows Transmission electron microscope image of C. sordellii incubated with Ab521 (A) and Ab652 (B) and gold conjugated anti-mouse IgG.

Figure 34 shows sequence coverage of 1 13AA that are expected to be present from DNA sequencing data. AA in red are those that were detected. AA in blue +underlined were detected with chemical modification. AA in green are not usually observable with common techniques, however confirmation of the N-terminal amino acids with such accuracy confirms the DNA sequencing is accurately assigning the CDR regions.

Figure 35 shows a western blots with Ab652 (A) and Ab521 (B) against the low pH glycine surface layer proteins (S) and remaining pellet (P) of C. difficile 630 and R002, S. aureus ATCC 29213 and B. subtilis BSB1. Figure 36 shows the amino acid sequence of the invention in which SEQ ID NO:1 is a unique SlpA biomarker of the invention; SEQ ID NO:2 is an advantageous epitope within the SlpA biomarker of the invention; SEQ ID NO:3 is an antigen comprising the

advantageous epitope of SEQ ID NO:2; SEQ ID NO:4 is an antigen comprising the advantageous epitope of SEQ ID NO:2; SEQ ID NO:5 is the polypeptide sequence of the heavy chain variable domain of the Ab521 antibody of the invention; SEQ ID NO:6 is the polypeptide sequence of the light chain variable domain of the Ab521 antibody of the invention; SEQ ID NO:7 is the polypeptide sequence of the VH CDR1 of the Ab521 antibody of the invention; SEQ ID NO:8 is the polypeptide sequence of the VH CDR2 of the Ab521 antibody of the invention; SEQ ID NO:9 is the polypeptide sequence of the VH CDR3 of the Ab521 antibody of the invention; SEQ ID NO:10 is the polypeptide sequence of the VL CDR1 of the Ab521 antibody of the invention; SEQ ID NO:1 1 is the polypeptide sequence of the VL CDR2 of the Ab521 antibody of the invention; SEQ ID NO:12 is the polypeptide sequence of the VL CDR3 of the Ab521 antibody of the invention.

DETAILED DESCRIPTION

The inventors have surprisingly identified a unique biomarker for Clostridium difficile, not present in other bacterial species. The 16 amino acid biomarker is found within the surface layer protein, SlpA and is, advantageously, located on the external surface of the SlpA protein. The surface expression of the biomarker allows for identification of whole C. difficile cells or of the glycine extracted C. difficile surface envelope. Moreover, the inventors have demonstrated that the biomarker is conserved across all C. difficile species. Additionally, the inventors have generated antibodies against the unique biomarker. Antibodies directed to epitopes that are fully conserved within the biomarker of the invention were shown to bind to native C. difficile species without the need for any pre treatment of samples. Moreover, the antibodies demonstrated specific binding against C. difficile.

Equally, antibodies directed to epitopes that are fully conserved within the biomarker of the invention can bind to the surface envelope of C.difficile, such as glycine extracts from the surface envelope of C.difficile. For example, a test could encompass a crude surface extraction, or just focus on material in the supernatant. Biomarkers

Specifically, it has surprisingly been found that a unique protein biomarker found within SlpA and having the sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) is expressed on the cell surface of C.difficile. The identification of this unique surface expressed sequence provides advantages over known biomarkers and diagnostic assays and overcome at least some of the problems known in the art.

The C. difficile surface layer (S-layer) is a paracrystalline structure that completely coats the outer surface of vegetative cells (Reynolds et al., 201 1). Unlike other bacterial S- layers, which are made of one protein, the C. difficile S-layer consists of two proteins, the high molecular weight (HMW) and the low molecular weight (LMW) surface layer proteins (SLPs) (Fagan and Fairweather, 201 1 ). These are post-translationally cleaved from a single precursor protein, SlpA (Dang et al., 2012). The precursor protein is encoded by the SlpA gene which, after translocation to the cell surface (Calabi et al., 2001 ), is post- translationally cleaved by the cysteine protease Cwp84 to form the individual LMW and HMW SLPs (Kirby et al., 2009; Dang et al., 2012). The site of cleavage has been shown to be highly conserved across C. difficile strains (Calabi et al., 2001 ). Post-cleavage, the two SLPs associate into heterodimers and form a large percentage of the S-layer (Drudy et al., 2004). A diagram of the C. difficile cell surface, with the LMW and HMW SLPs forming the S-layer is provided in figure 1. The cytoplasmic membrane is surrounded by a thick peptidoglycan cell wall and the entire cell is encapsulated with the S-layer which is mainly made from the mature LMW and HMW SLPs that are cleaved from SlpA. The S-layer also contains some other cell wall proteins such as the adhesion protein Cwp66 (Dingle et al., 2013).

The HMW SLP is formed from the more conserved C-terminal end of SlpA, whereas, the highly variable N-terminal forms the LMW SLP after cleavage (Cerquetti et ai., 2000). Both SLPs vary in sizes between variant C. difficile strains, with LMW SLP ranging between 36- 45kDa and HMW SLP 48-56 kDa (Calabi et al., 2001 ; Karjalainen et ai., 2002).

The SLPs are involved in the mechanism of gut colonisation and in the process of adhesion to the intestinal mucosa (Cerquetti et al., 2002). Calabi and colleagues showed strong and specific binding of purified SLPs to human epithelial cells and gastrointestinal tissues, with recombinant HMW SLP binding with a much higher affinity than the LMW SLP. When anti- HMW antibodies were introduced the binding of the SLPs to human cells was reduced (Calabi et al., 2002). Importantly, when identifying a biomarker for identification of C. difficile, SlpA is the most highly expressed protein in C. difficile, accounting for 10-15 % of total cellular protein. Moreover, it has been shown that SlpA is also highly expressed in all stages of growth (Savariau-Lacomme, 2003; Fagan and Fairweather, 201 1 ).

Accordingly, in a first aspect the invention provides use of a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ) as a biomarker for identification of C. difficile infection. The biomarker has particular use in predictive medicine. As used herein, the terms "biomarker" refers to a biological molecule, such as, for example, a nucleic acid, peptide, protein or the like, the presence or concentration of which can be detected and correlated with a known condition, such as a disease state, i.e C.difficile infection. It can also be used to refer to a differentially expressed gene whose expression pattern can be utilized as part of a predictive, prognostic or diagnostic process in healthy conditions or a disease state, or which, alternatively, can be used in methods for identifying a useful treatment or prevention therapy.

As used herein“Clostridium difficile infection” refers to conditions or symptoms associated with an infection of C. difficile. The infection can be in any system, organ, tissue or area of the subject, such as but not limited to, gastrointestinal tract including upper and/or lower portions thereof. In some embodiments, the infection is a C. difficile infection of the Gl tract. In one embodiment, the infection is a first-time gastrointestinal (Gl) infection of C. difficile, while in another embodiment, the infection is a recurring (Gl) infection of C.

difficile. As used herein, a recurring infection is an infection wherein the infection or the symptoms thereof occurs at an additional point in time, including more than once.

The C. difficile infection (CDI) can be a mild case, moderate case, or a severe case.

Symptoms of lesser cases include watery diarrhea, three or more times a day for several days, with abdominal pain or tenderness. Symptoms of more severe CDI include: watery diarrhea (for example, up to 15 times each day); severe abdominal pain; loss of appetite; fever; blood or pus in the stool; and/or weight loss. CDI can also lead to a hole in the intestines, which can be lethal if not treated immediately. Antibodies

In a further aspect the invention provides an antibody or antigen binding fragment thereof that binds to a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

The terms“antibody” or“antibodies” as used herein refer to molecules or active fragments of molecules that bind to known antigens, particularly to immunoglobulin molecules and to immunologically active portions of immunoglobulin molecules, i.e. molecules that contain a binding site that immunospecifically binds an antigen. The immunoglobulin according to the invention can be of any class (IgG, IgM, IgD, IgE, IgA and IgY) or subclass (e.g. lgG1 , lgG2, lgG3, lgG4, lgA1 and lgA2) or subclasses (isotypes) of immunoglobulin molecule (e.g. IgG in lgG1 , lgG2, lgG3, and lgG4, or IgA in lgA1 and lgA2).

Within the scope of the present invention the terms “antibody” or“antibodies” include monoclonal, polyclonal, chimeric, single chain, bispecific, human and humanized antibodies as well as active fragments thereof. Examples of active fragments of molecules that bind to known antigens include Fab, F(ab')2, scFv and Fv fragments, including the products of an Fab immunoglobulin expression library and epitope-binding fragments of any of the antibodies and fragments mentioned above.

As used herein, the term “monoclonal antibody” refers to an antibody that is mass produced in the laboratory from a single clone and that recognizes only one antigen. Monoclonal antibodies are typically made by fusing a normally short-lived, antibody- producing B cell to a fast-growing cell, such as a cancer cell (sometimes referred to as an “immortal” cell). The resulting hybrid cell, or hybridoma, multiplies rapidly, creating a clone that produces large quantities of the antibody. For the purpose of the present invention, “monoclonal antibody” is also to be understood to comprise antibodies that are produced by a mother clone which has not yet reached full monoclonality.

As used herein, the term“chimeric antibody” refers to a monoclonal antibody comprising a variable region, i.e., binding region, from mouse and at least a portion of a constant region derived from a different source or species, usually prepared by recombinant DNA techniques. Chimeric antibodies comprising a mouse variable region and a human constant region are exemplary embodiments. Such mouse/human chimeric antibodies are the product of expressed immunoglobulin genes comprising DNA segments encoding mouse immunoglobulin variable regions and DNA segments encoding human immunoglobulin constant regions. Other forms of “chimeric antibodies” encompassed by the present disclosure are those in which the class or subclass has been modified or changed from that of the original antibody. Such“chimeric” antibodies are also referred to as “class-switched antibodies." Methods for producing chimeric antibodies involve conventional recombinant DNA and gene transfection techniques now well known in the art. See, e.g., Morrison, S. L, et al., Proc. Natl. Acad Sci. USA 81 (1984) 6851 -6855; U.S. Pat. No. 5,202,238 and U.S. Pat. No. 5,204,244.

As used herein the term“humanized antibody” or“humanized version of an antibody” refers to antibodies in which the framework or“complementarity determining regions” (CDR) have been modified to comprise the CDR of an immunoglobulin of different specificity as compared to that of the parent immunoglobulin. In some exemplary embodiments, the CDRs of the VH and VL are grafted into the framework region of human antibody to prepare the“humanized antibody.” See e.g. Riechmann, L., et al., Nature 332 (1988) 323-327; and Neuberger, M. S., et al., Nature 314 (1985) 268-270. The heavy and light chain variable framework regions can be derived from the same or different human antibody sequences. The human antibody sequences can be the sequences of naturally occurring human antibodies. Human heavy and light chain variable framework regions are listed e.g. in Lefranc, M.-P., Current Protocols in Immunology (2000)— Appendix 1 P A.1 P.1 -A.1 P.37 and are accessible via IMGT, the international ImMunoGeneTics information System® (http://imgt.cines.fr) or via http://vbase.mrc-cpe.cam.ac.uk, for example. Optionally the framework region can be modified by further mutations. Exemplary CDRs correspond to those representing sequences recognizing the antigens noted above for chimeric antibodies. In some embodiments, such humanized version is chimerized with a human constant region. The term“humanized antibody” as used herein also comprises such antibodies which are modified in the constant region to generate the properties according to the disclosure, especially in regard to C1q binding and/or FcR binding, e.g. by “class switching” i.e. change or mutation of Fc parts (e.g. from lgG1 to lgG4 and/or lgG1/lgG4 mutation).

As used herein the term“human antibody” is intended to include antibodies having variable and constant regions derived from human germ line immunoglobulin sequences. Human antibodies are well-known in the state of the art (van Dijk, M. A., and van de Winkel, J. G., Curr. Opin. Chem. Biol. 5 (2001 ) 368-374). Human antibodies can also be produced in transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire or a selection of human antibodies in the absence of endogenous immunoglobulin production. Transfer of the human germ-line immunoglobulin gene array in such germ-line mutant mice results in the production of human antibodies upon antigen challenge (see, e.g., Jakobovits, A., et al., Proc. Natl. Acad. Sci. USA 90 (1993) 2551 - 2555; Jakobovits, A., et al., Nature 362 (1993) 255-258; Brueggemann, M. D., et al., Year Immunol. 7 (1993) 33-40). Human antibodies can also be produced in phage display libraries (Hoogenboom, H. R., and Winter, G., J. Mol. Biol. 227 (1992) 381 -388; Marks, J. D., et al., J. Mol. Biol. 222 (1991 ) 581 -597). The techniques of Cole, A., et al. and Boerner, P., et al. are also available for the preparation of human monoclonal antibodies (Cole, A., et al., Monoclonal Antibodies and Cancer Therapy, Liss, A. R. (1985) p. 77; and Boerner, P., et al., J. Immunol. 147 (1991 ) 86-95). As already mentioned, according to the instant disclosure the term “human antibody” as used herein also comprises such antibodies which are modified in the constant region to generate the properties according to the disclosure, for example in regard to C1 q binding and/or FcR binding, e.g. by “class switching” i.e. change or mutation of Fc parts (e.g. from lgG1 to lgG4 and/or lgG1/lgG4 mutation).

As used herein“single chain antibody” refers to single chain Fv molecules (scFv), wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site (Bird et al., 1988, Science 242:423-426 , Huston et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:5879-5883 or a bispecific single chain Fv (WO 03/1 1 161 ).

As used herein the term“bispecific antibodies” refers to antibodies that bind to two (or more) different antigens.

As used herein the term“antibody fragments” refers to a portion of a full length antibody, for example possibly a variable domain thereof, or at least an antigen binding site thereof. Examples of antibody fragments include diabodies, single-chain antibody molecules, and multispecific antibodies formed from antibody fragments. scFv antibodies are, e.g., described in Huston, J. S., Methods in Enzymol. 203 (1991 ) 46-88. Antibody fragments can be derived from an antibody of the present invention by a number of art-known techniques. For example, purified monoclonal antibodies can be cleaved with an enzyme, such as pepsin, and subjected to HPLC gel filtration. The appropriate fraction containing Fab fragments can then be collected and concentrated by membrane filtration and the like. For further description of general techniques for the isolation of active fragments of antibodies, see for example, Khaw, B. A. et al. J. Nucl. Med. 23:101 1 -1019 (1982); Rousseaux et al. Methods Enzymology, 121 :663-69, Academic Press, 1986.

Most preferably, an antibody of the invention specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ). Even more preferably, the antibody is a monoclonal antibody or antigen binding fragment thereof that specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

As used herein the term“specific” and“specifically” are used interchangeably to indicate that other biomolecules do not significantly bind to the antibody that is specifically binding to the biomolecule of interest (a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 )). In some embodiments, the level of binding to a biomolecule other than a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) results in a negligible (e.g., not determinable) binding affinity by means of ELISA or an affinity determination.

By“negligible binding” a binding is meant, which is at least about 85%, particularly at least about 90%, more particularly at least about 95%, even more particularly at least about 98%, but especially at least about 99% and up to 100% less than the binding to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide

AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

The binding affinity of an antibody to a peptide or epitope may be determined with a standard binding assay, such as surface plasmon resonance technique (BIAcore®, GE- Healthcare Uppsala, Sweden). The term "surface plasmon resonance," as used herein, refers to an optical phenomenon that allows for the analysis of real-time biospecific interactions by detection of alterations in protein concentrations within a biosensor matrix, for example using the BIAcore system (Pharmacia Biosensor AB, Uppsala, Sweden and Piscataway, N.J.). For further descriptions, see Jonsson, U., et al. (1993) Ann. Biol. Clin.

51 : 19-26; Jonsson, U., et al. (1991 ) Biotechniques 1 1 :620-627; Johnsson, B., et al. (1995) J. Mol. Recognit. 8: 125-131 ; and Johnnson, B., et al. (1991) Anal. Biochem. 198:268-277. As used herein the term“epitope” refers to a site on a target molecule (e.g., an antigen, such as a protein, for example a peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 )) to which an antigen-binding molecule (e.g., an antibody or antibody fragment) binds. Epitopes can be formed both from contiguous or adjacent noncontiguous residues (e.g., amino acid residues) of the target molecule. Epitopes formed from contiguous residues (e.g., amino acid residues) typically are also called linear epitopes. An epitope typically includes at least 5 and up to about 12 residues, mostly between 6 and 10 residues (e.g. amino acid residues). Preferably, the epitope of the present invention is a linear epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ), for example an antigen comprising an amino acid sequence KEDQLVDALA (SEQ ID NO:4) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) or an antigen comprising an amino acid sequence STKEDQLVDA (SEQ ID NO:3) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1).

In one embodiment the antibody of the invention or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises: a heavy chain variable domain having an amino acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide of SEQ ID NO:5; and a light chain variable domain an amino acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide of SEQ ID NO:6. More preferably the antibody binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ). Most preferably the antibody specifically binds to a peptide comprising an amino acid sequence STKEDQLVDA (SEQ ID NO:3) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ). Preferably, the antibody is a monoclonal antibody.

Preferably, the heavy chain variable domain has an amino acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide of SEQ ID NO:5 and comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR's: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9; and light chain variable domain an amino acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide of SEQ ID NO:6 and comprises at least one, particularly at least two, more particularly at least 3 of the light chain CDR's: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising an amino acid sequence STKEDQLVDA (SEQ ID NO:3) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises: a heavy chain variable domain having an amino acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide of SEQ ID NO:5 and comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR’s: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9; and a light chain variable domain having an amino acid sequence that is 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide of SEQ ID NO:6 and comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR’s: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody.

Most preferably, the antibody specifically binds to a peptide comprising an amino acid sequence STKEDQLVDA (SEQ ID NO:3) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises a heavy chain variable domain of SEQ ID NO:5 and a light chain variable domain of SEQ ID NO:6. Preferably, the antibody is a monoclonal antibody.

As used herein, the term“CDR” refers to the hypervariable region of an antibody. The term “hypervariable region”, “HVR”, or“HV”, when used herein refers to the regions of an antibody variable domain which are hypervariable in sequence and/or form structurally defined loops. Generally, antibodies comprise six hypervariable regions; three in the VH (H1 , H2, H3), and three in the VL (L1 , L2, L3). A number of hypervariable region delineations are in use and are encompassed herein. The Kabat Complementarity Determining Regions are based on sequence variability and are the most commonly used (Kabat et al., Sequences of Proteins of Immunological Interest, 5th Ed. Public Health Service, National Institutes of Health, Bethesda, Md. (1991 )). The letters“HC” and“LC” preceding the term“CDR” refer, respectively, to a CDR of a heavy chain and a light chain.

As used herein, the terms “homology” and “identity” are used interchangeably. Calculations of sequence homology or identity between sequences are performed as follows.

To determine the percent identity of two amino acid sequences, or of two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 75%, 80%, 82%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid“identity” is equivalent to amino acid or nucleic acid “homology”). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman et al. (1970) J. Mol. Biol. 48:444-453) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a BLOSUM 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. A particularly preferred set of parameters (and the one that should be used if the practitioner is uncertain about what parameters should be applied to determine if a molecule is within a sequence identity or homology limitation of the invention) are a BLOSUM 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.

Alternatively, the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of Meyers et al. (1989) CABIOS 4:1 1 -17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. In a further embodiment, the invention relates to an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises a heavy chain variable domain comprising a polypeptide sequence having at least 1 , 2, 3, 4 or 5 conservative substitutions compared to a polypeptide sequence of SEQ ID NO: 5; and a light chain variable domain of SEQ ID NO:6. Preferably, the antibody or antigen binding fragment thereof comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR’s: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

In a further embodiment, the invention relates to an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises a heavy chain variable domain comprising a polypeptide sequence having at least 1 , 2, 3, 4 or 5 conservative substitutions compared to a polypeptide sequence of SEQ ID NO: 5; and a light chain variable domain comprising a polypeptide sequence having at least 1 , 2, 3, 4 or 5 conservative substitutions compared to a polypeptide sequence of SEQ ID NO: 6. Preferably, the antibody or antigen binding fragment thereof comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR’s: a VH

CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having

SEQ ID NO:9. Preferably, the antibody or antigen binding fragment thereof comprises at least one, particularly at least two, more particularly at least 3 of the light chain CDR's: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody or antigen binding fragment thereof comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR's: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9 and at least one, particularly at least two, more particularly at least 3 of the light chain CDR's: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

In a further embodiment, the invention relates to an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises a heavy chain variable domain of SEQ ID NO: 5; and a light chain variable domain comprising a polypeptide sequence having at least 1 , 2, 3, 4 or 5 conservative substitutions compared to a polypeptide sequence of SEQ ID NO: 6. Preferably, the antibody or antigen binding fragment thereof comprises at least one, particularly at least two, more particularly at least 3 of the light chain CDR’s: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

As used herein the term "conservative amino acid substitution" refers to replacement of an amino acid residue with an amino acid residue having a similar side chain. Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains ( e.g ., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta- branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).

In a further embodiment the invention provides an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR's: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

In a further embodiment the invention provides an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises at least one, particularly at least two, more particularly at least 3 of the light chain CDR’s: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ). In a further embodiment the invention provides an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises at least one, particularly at least two, more particularly at least 3 of the heavy chain CDR’s: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9 and at least one, particularly at least two, more particularly at least 3 of the light chain CDR’s: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

In a further embodiment the invention provides an antibody or antigen binding fragment thereof specifically binds to the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ) and comprises the heavy chain CDR’s: a VH CDR1 having SEQ ID NO:7, a VH CDR2 having SEQ ID NO:8 and a VH CDR3 having SEQ ID NO:9 and the light chain CDR’s: a VL CDR1 having SEQ ID NO:10, a VL CDR2 having SEQ ID NO:1 1 and a VL CDR3 having SEQ ID NO:12. Preferably, the antibody is a monoclonal antibody. Preferably, the antibody specifically binds to a peptide comprising the epitope KEDQLVDA (SEQ ID NO:2) within the peptide AKDGSTKEDQLVDALA (SEQ ID NO:1 ).

Diagnostic and Prognostic Assays

As disclosed and described herein, the antibodies, antigens and epitopes provided herein are of significant value in research, therapeutic and diagnostic applications. In one aspect the invention provides use of a biomarker of the invention (e.g. SEQ ID NO:1 ) in the identification of Clostridium difficile.

In one aspect the invention relates to the use of an antibody of the invention or antigen binding fragment thereof in the identification of Clostridium difficile.

The presence, level or absence of the SlpA biomarker of the invention (SEQ ID NO:1 ) in a biological sample can be determined by obtaining a biological sample from a patient and contacting the biological sample with a compound or an agent capable of detecting an SlpA biomarker of the invention (SEQ ID NO:1 ). As used herein, the term "biological sample" and“sample isolated from a patient” are used interchangeably to refer to tissues, cells and biological fluids isolated from a patient, as well as tissues, cells and fluids present within a patient. The biological sample can be a faecal, urine, or blood sample. A preferred sample is a faecal sample, e.g. a stool sample. The stool sample can be obtained from a subject having or has recently had diarrhea (e.g. within 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, hours or days) .

As used herein "patient” refers to an individual, e.g., a human, having or at risk for having a C. difficile infection

Any known protein detection methods may be used to detect the presence, level or absence of the SlpA biomarker of the invention (SEQ ID NO:1 ) in a sample.

Generally, protein detection methods comprise contacting an agent that selectively binds to the SlpA biomarker of the invention (SEQ ID NO:1 ), for example an anti-SEQ ID NO:1 antibody, with a patient sample to determine the level of SEQ ID NO:1 polypeptide in the sample.

The level of SEQ ID NO:1 polypeptide in a sample may be determined by techniques known in the art, such as enzyme linked immunosorbent assays (ELISAs), immunoprecipitation, immunofluorescence, enzyme immunoassay (EIA), radioimmunoassay (RIA), and Western blot analysis. A detailed description of these assays is, for example, given in Harlow and Lane, Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory, New York 1988 555-612, WO96/13590 to Maertens and Stuyver, Zrein et al. (1998) and WO96/29605.

For in situ detection of SEQ ID NO:1 polypeptide, a labeled anti-SEQ ID NO:1 antibody may be introduced into a patient. Such an antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques. The antibody or any active and functional part thereof may be administered to the organism to be diagnosed by methods known in the art such as, for example, intravenous, intranasal, intraperitoneal, intracerebral, intraarterial injection such that a specific binding between an antibody according to the invention with the polypeptide of SEQ ID NO:1 can occur. The antibody/antigen complex may conveniently be detected through a label attached to the antibody or a functional fragment thereof or any other art- known method of detection. Preferably, the agent or antibody is labeled, for example with a detectable label. As used herein the term "labeled", refers to direct labeling of the agent or antibody by coupling (i.e., physically linking) a detectable substance to the agent or antibody, as well as indirect labeling of the agent or antibody by reactivity with a detectable substance.

The immunoassays used in diagnostic applications typically rely on labelled antigens, antibodies, or secondary reagents for detection. These proteins or reagents can be labelled with compounds generally known to those of ordinary skill in the art including enzymes, radioisotopes, and fluorescent, luminescent and chromogenic substances including, but not limited to colored particles, such as colloidal gold and latex beads. Of these, radioactive labelling can be used for almost all types of assays and with most variations. Enzyme-conjugated labels are particularly useful when radioactivity must be avoided or when quick results are needed. Fluorochromes, although requiring expensive equipment for their use, provide a very sensitive method of detection.

The aforementioned antibodies of the invention are specifically useful in the assays described herein. Antibodies of the invention may be labelled indirectly by reaction with labelled substances that have an affinity for immunoglobulin, such as protein A or G or second antibodies. The antibodies of the invention may be conjugated with a second substance and detected with a labelled third substance having an affinity for the second substance conjugated to the antibody. For example, the antibody may be conjugated to biotin and the antibody-biotin conjugate detected using labelled avidin or streptavidin. Similarly, the antibody may be conjugated to a hapten and the antibody-hapten conjugate detected using labelled anti-hapten antibody.

Those of ordinary skill in the art will know of these and other suitable labels which may be employed in accordance with the present invention. The binding of these labels to antibodies or fragments thereof can be accomplished using standard techniques commonly known to those of ordinary skill in the art. Typical techniques are described by kennedy, j. H ., et al., 1976 (clin. Chim. Acta 70:1 -31 ), and schurs, a. H. W. M., et al. 1977 (clin. Chim acta 81 :1 -40). Coupling techniques mentioned in the latter are the glutaraldehyde method, the periodate method, the dimaleimide method, and others, all of which are incorporated by reference herein.

For direct detection using the antibodies of the invention the labeling group can be selected from any known detectable marker groups, such as dyes, luminescent labeling groups such as chemoluminescent groups, e.g. acridinium esters or dioxetanes, or fluorescent dyes, e.g. fluorescein, coumarin, rhodamine, oxazine, resorufin, cyanine and derivatives thereof. Other examples of labeling groups are luminescent metal complexes, such as ruthenium or europium complexes, enzymes, e.g. as used for ELISA or for CEDIA (Cloned Enzyme Donor Immunoassay), and radioisotopes. Metal chelates which can be detected by electrochemoluminescence are also in one embodiment signal-emitting groups used as detectable labels, with particular preference being given to ruthenium chelates. Indirect detection systems using the antibodies of the invention comprise, for example, that the detection reagent, e.g. the detection antibody, is labeled with a first partner of a binding pair. Examples of suitable binding pairs are hapten or antigen/antibody, biotin or biotin analogues such as aminobiotin, iminobiotin or desthiobiotin/avidin or streptavidin, sugar/lectin, nucleic acid or nucleic acid analogue/complementary nucleic acid, and receptor/ligand, e.g., steroid hormone receptor/steroid hormone. In one embodiment the first binding pair member is selected from hapten, antigen and hormone. In one embodiment the hapten is selected from digoxin and biotin and analogues thereof. The second partner of such binding pair, e.g. an antibody, streptavidin, etc., usually is labeled to allow for direct detection, e.g., by the labels as mentioned above.

In one embodiment an immunoassay is used to detect the presence, level or absence of the SlpA biomarker of the invention (SEQ ID NO:1 ) in a sample, the method comprising the steps of incubating a sample with an antibody according to the present disclosure, whereby if the SlpA biomarker of the invention (SEQ ID NO:1 ) is present in the sample binding of said antibody to said biomarker takes place and the biomarker bound to the anti antibody in said sample is detected.

In one embodiment an immunoassay of the invention utilizes a double antibody method for detecting level or absence of the SlpA biomarker of the invention (SEQ ID NO:1 ), wherein. the antibody is labeled indirectly by reactivity with a second antibody that has been labeled with a detectable label. The second antibody is preferably one that binds to antibodies of the animal from which the monoclonal antibody is derived, e.g. if the monoclonal antibody is a mouse antibody, then the labeled, second antibody is an anti-mouse antibody. In such an assay of the invention, this label is preferably an antibody-coated bead, particularly a magnetic bead. For the antibody to be employed in the immunoassay described herein, the label is preferably a detectable molecule such as a radioactive, fluorescent or an electrochemiluminescent substance.

In an alternative double antibody system of the invention, a fast format system may also be employed. The system requires high affinity between at least one antibody and the SlpA biomarker of the invention (SEQ ID NO:1 ). According to one embodiment of the present invention, the presence of the SlpA biomarker of the invention (SEQ ID NO:1 ) is determined using a pair of antibodies, wherein at least one of the pair of antibodies is specific for the SlpA biomarker of the invention (SEQ ID NO:1 ). One of said pairs of antibodies is referred to herein as a“detector antibody” and the other of said pair of antibodies is referred to herein as a“capture antibody”. Where only one of the pair of antibodies is specific for the SlpA biomarker of the invention (SEQ ID NO:1 ), the antibody which is specific for the SlpA biomarker of the invention (SEQ ID NO:1) is the detector antibody. For example the detector antibody may be a monoclonal antibody, specific for the SlpA biomarker of the invention (SEQ ID NO:1 ), and the capture antibody may be a polyclonal antibody against the SlpA biomarker of the invention (SEQ ID NO:1 ) or against SlpA. Optionally, each of the antibodies is specific for the SlpA biomarker of the invention (SEQ ID NO:1 ). The monoclonal antibodies of the present invention can be used as either a capture antibody or a detector antibody. The monoclonal antibodies of the present invention can also be used as both capture and detector antibody, together in a single assay.

In some aspects the diagnostic assays of the invention include an additional step of administering a treatment for CDI to the subject if the SlpA biomarker of the invention (SEQ ID NO:1) is present.

In addition, the assays described herein provided methods for monitoring the efficacy of a treatment for a Clostridium difficile infection (CDI), in a subject, e.g., a subject suspected of have a C. difficile infection. Such methods include determining a first level of the SlpA biomarker of the invention (SEQ ID NO:1 ) in a sample, e.g. a stool sample suspected of comprising C. difficile isolated from the subject; administering a treatment for CDI to the subject; determining a second level of the SlpA biomarker of the invention (SEQ ID NO:1 ) in a sample, e.g. a stool sample, obtained after administration of the treatment to the subject; and comparing the first and second levels of biomarker, wherein a decrease in the level or presence of biomarker after treatment indicates that the treatment has been effective in treating the CDI in the subject, and an increase or no change indicates that the treatment has not been effective in treating the CDI in the subject.

In some embodiments, the treatment comprises administration of one or more doses of one or more antibiotic compounds, such as metronidazole, vancomycin, fidaxomicin, or rifaximin.

In some embodiments, the treatment comprises non-antibiotic therapy, e.g., fecal bacteriotherapy, probiotics, or monoclonal antibodies.

Kits

The present invention also relates to a diagnostic kit for detecting the SlpA biomarker of the invention (SEQ ID NO:1 ) in a biological sample comprising a detectably labelled agent, for example an antibody of the invention as defined above. Moreover, the present invention relates to the latter diagnostic kit which, in addition to a composition as defined above, also comprises reagents for performing a diagnostic assay, such as a detection reagent. The term“diagnostic kit” refers in general to any diagnostic kit known in the art.

In one embodiment the kit is an immunoassay kit and includes a container holding one or more antibodies according to the present invention and instructions for using the antibodies for the purpose of binding to the SlpA biomarker of the invention (SEQ ID NO:1 ) to form an immunological complex and detecting the formation of the immunological complex such that presence or absence of the immunological complex correlates with presence or absence of the SlpA biomarker of the invention (SEQ ID NO:1 ). In one embodiment the antibody is bound to an assay device. Preferably the kit further comprises a second, different antibody which binds to i) the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1 ); ii) the SlpA polypeptide; or iii) the first antibody , and which is conjugated to a detectable agent.

Where the kit further comprises a second, different antibody which binds to the peptide having an amino acid sequence AKDGSTKEDQLVDALA (SEQ ID NO:1) or the SlpA polypeptide, only one of the pair of antibodies need be specific for the SlpA biomarker of the invention (SEQ ID NO:1 ). The first antibody may be a monoclonal antibody, specific for the SlpA biomarker of the invention (SEQ ID NO:1 ), and the second, different antibody may be a polyclonal antibody against the SlpA biomarker of the invention (SEQ ID NO:1 ). The second antibody may bind to the peptide at one or more sites which is located away from the amino acid sequence of SEQ ID NO:1 . Optionally, each of the antibodies may be specific for the SlpA biomarker of the invention (SEQ ID NO:1 ) and may be used together in a single assay.

Therapeutic Methods and Compositions

In one aspect, the invention provides the antibodies of the invention for use as a medicament.

In a further aspect the invention provides use of the antibodies of the invention as a medicament.

In a still further aspect the invention provides the invention for use in the treatment of a C. difficile infection.

In a still further aspect the invention provides a method of treating a C.difficile infection comprising administering to a patient in need thereof an effective amount of an antibody of the invention.

The invention also provides a pharmaceutical composition comprising an antibody in accordance with the invention together with a pharmaceutically acceptable excipient, diluent or carrier. The term "pharmaceutically-acceptable carrier" as used herein means one or more compatible solid or liquid fillers, diluents or encapsulating substances that are suitable for administration into a human. When administered, the pharmaceutical compositions of the present invention are administered in pharmaceutically acceptable preparations. Such preparations may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, cytokines and optionally other therapeutic agents, preferably agents for use in wound healing such as growth factors, peptides, proteolytic inhibitors, extracellular matrix components, steroids and cytokines. The term "carrier" denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The term "pharmaceutically acceptable" means a non-toxic material that does not interfere with the effectiveness of the biological activity of the active ingredients. The term "physiologically acceptable" refers to a non-toxic material that is compatible with a biological system such as a cell, cell culture, tissue, or organism. As used herein, a pharmaceutically acceptable carrier includes any conventional carrier, such as those described in Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co, Easton, PA, 15th Edition (1975).

In a further aspect there is provided a pharmaceutical composition in accordance with the invention for use as a medicament, for example, for use in treating C. difficile infection.

The compositions or antibodies of the invention are administered / for administration in effective amounts. An "effective amount" is the amount of a composition or synthetic retinae that alone, or together with further doses, produces the desired response. The compositions or antibodies used in the foregoing methods preferably are sterile and contain an effective amount of the active ingredient for producing the desired response in a unit of weight or volume suitable for administration to a patient. The response can, for example, be measured by measuring the physiological effects of the composition or antibodies upon the rate of or extent of C. difficile infection.

The invention provides a method of treating C. difficile infection in a subject in need thereof comprising administration of a pharmaceutical composition of the invention to the subject in an amount effective to decrease the level or presence of C. difficile in the patient.

In some embodiments, the antibodies of the invention are conjugated with drugs to form antibody-drug conjugates (ADCs). Generally, conjugation is done by covalent attachment of a drug moiety to the antibody, and generally relies on a linker, often a peptide linkage. The drug moiety of the ADC can be any number of agents, including but not limited to cytotoxic agents such as chemotherapeutic agents, growth inhibitory agents, toxins (for example, an enzymatically active toxin of bacterial, fungal, plant, or animal origin, or fragments thereof), or a radioactive isotope (that is, a radioconjugate). The generation of Antibody-drug conjugate compounds can be accomplished by any technique known to the skilled artisan. Briefly, the Antibody-drug conjugate compounds can include an antibody of the invention, a drug, and optionally a linker that joins the drug and the binding agent. Conjugates of antibodies of the invention and one or more small molecule toxins, such as a maytansinoids, dolastatins, auristatins, a trichothecene, calicheamicin, and the derivatives of these toxins that have toxin activity, are contemplated. As used herein treatment and therapy are used to provide a positive therapeutic response with respect to a disease or condition. By "positive therapeutic response" is intended an improvement in the disease or condition, and/or an improvement in the symptoms associated with the disease or condition. For example, a positive therapeutic response would refer to one or more of the following improvements in the C. difficile infection: (1 ) a reduction in the number of C. Difficile bacteria present in a patient and / or (2) relief from one or more symptoms associated with C. difficile infection. Treatment according to the present invention includes a "therapeutically effective amount" of the antibodies or compositions of the invention used. A "therapeutically effective amount" refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired positive therapeutic response. A therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the patient, and the ability of the antibodies or compositions of the invention to elicit a desired positive therapeutic response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the antibody or antibody portion are outweighed by the therapeutically beneficial effects. The antibodies and compositions of the invention may be administered orally, intravenously, subcutaneously, buccally, rectally, dermally, nasally, tracheally, bronchially, by any other parenteral route, as an oral or nasal spray or via inhalation. The c antibodies and compositions may be administered in the form of pharmaceutical preparations comprising prodrug or active compound either as a free compound or, for example, a pharmaceutically acceptable non-toxic organic or inorganic acid or base addition salt, in a pharmaceutically acceptable dosage form. Depending upon the disorder and patient to be treated and the route of administration, the compositions may be administered at varying doses. As used herein, the terms "patient" and“subject” are used interchangeably and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.

In a preferred embodiment of the invention, the patient to be treated is a human patient and the antibody of the invention is a human, humanized or chimeric antibody, fragment thereof or ADC. Throughout the description and claims of this specification, the words“comprise” and “contain” and variations of them mean“including but not limited to”, and they are not intended to (and do not) exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Features, integers, characteristics, compounds, chemical moieties or groups described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein unless incompatible therewith. All of the features disclosed in this specification (including any accompanying claims, abstract and drawings), and/or all of the steps of any method or process so disclosed, may be combined in any combination, except combinations where at least some of such features and/or steps are mutually exclusive. The invention is not restricted to the details of any foregoing embodiments. The invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including any accompanying claims, abstract and drawings), or to any novel one, or any novel combination, of the steps of any method or process so disclosed.

The reader's attention is directed to all papers and documents which are filed concurrently with or previous to this specification in connection with this application and which are open to public inspection with this specification, and the contents of all such papers and documents are incorporated herein by reference.

Examples

1. Biomarker identification and characterization

The 16 amino acid SlpA biomarker‘AKDGSTKEDQLVDALA’ (SEQ ID NO:1 ) was identified by the inventors to be the most promising biomarker for differentiating whole C. difficile cells from other bacteria. Selection of this biomarker was due to several reasons. Firstly, the protein in which the biomarker resides, SlpA, was predicted by the five subcellular localisation tools to be surface associated. Secondly, the biomarker sequence is found within all sequenced C. difficile strains, including all SLTS that represent the entire C. difficile species. Also, this biomarker, was classed as‘unique' to C. difficile as it was not entirely located within other species and was different to the closest related species by five amino acids. Finally, the biomarker was predicted to be on the surface of SlpA, which is expressed in all stages of growth and completely encapsulates the cell, therefore, a great number of biomarker epitopes are predicted for recognition molecules to bind to. The combination of all of these results provides information that the SlpA biomarker was the most promising.

1.1 Determining the uniqueness of the SlpA biomarker The SlpA biomarker 'AKDGSTKEDQLVDALA' (SEQ ID NO:1 ) was searched for similarity using NCBI BLASTP, which searches the protein database using a protein sequence. The search showed the biomarker located in its entirety within C. difficile only, with the top hits all being C. difficile proteins (Figure 2). A minimum difference of four amino acids between any possible biomarker and the closest related sequence, located in an organism not located within the GOI, was selected. This difference is the 'uniqueness threshold’ of the biomarker and was selected at four amino acids as it would be highly unlikely that biomarker specific detection molecules would bind to similar sequences with more than four residue differences. Due to the highly specific nature of antibodies and aptamers it would be unlikely that these molecules would maintain specificity with less than four amino acid difference. It has been previously shown that both antibodies and aptamers lose epitope specificity with even a single amino acid change (Zegers et al., 1995; Zheng et al., 1995; Negri et al., 2012). However, as a precaution for this work, a difference of four residues was selected.

The closest similarity to the SlpA biomarker, which was much further down the hits seen within Figure 2 and was not located within C. difficile, was found in the two-component LuxR family transcriptional regulator from the Gram-negative species Novosphingobium nitrogenifigens ( N . nitrogenifigens). There were five differences between the two amino acid sequences and therefore the SlpA biomarker was still classed as unique to C. difficile. 1.2 Structural prediction of SlpA and location of the biomarker

1.2.1 The SlpA domains

InterProScan (Jones et al., 2014) was utilised to analyse the SlpA protein sequence, by comparing it to the protein signatures and predictive models contained within the InterPro Consortium (Mitchell et al., 2015). The InterPro Consortium employs several databases, including PROSITE (Sigrist et al., 2002), HAMAP (Pedruzzi et al., 2015) and SUPERFAMILY (Gough et al., 2001 ), to gain the required protein signatures and predictive models. Figure 3 integrates the subcellular localisation results of an InterProScan version 5 analysis of C. difficile 630 SlpA, and the literature which states the LMW and HMW SLP cleavage position (Calabi et al., 2001 ). The domains are mapped on to the SlpA sequence, with the biomarker also highlighted at its amino acid position, which is predicted to be within a putative cell wall binding domain.

1.2.2 Predicting the structure of the HMW SLP and the surface location of the biomarker

The hydrophobicity view within Jalview (Figure 4) was used to predict the largely hydrophilic biomarkers location on the surface of the protein. However, further evidence of the location was required to show that the biomarker is accessible to potential PoN sensors. A search of the protein data bank, RSCB PDB for SlpA structures revealed that the protein structure for only LMW SLP had been solved, PDB ID:3CVZ (Fagan et al., 2009). The HMW SLP, which contains the biomarker, or the whole complex had not been structurally solved and subsequently, tools to predict protein structure were used. The HMW portion of SlpA was sent to the l-TASSER protein structure and function predictor (Zhang, 2008), which constructs five full-length atomic models of the sequence. Each model has a confidence score (C-score) that estimates the quality of the prediction and usually ranges from -5 to 2. These models were then observed using the viewing platform UCSF Chimera, developed by the Resource for Biocomputing, Visualization, and Informatics at the University of California, San Francisco (supported by NIGMS P41 - GM10331 1 ) (Pettersen et al., 2004). The view was selected to show the surface of the protein and the biomarker was coloured red on the resulting images. All five models predicted the biomarker to be surface exposed (Figure 5) and therefore if would likely be accessible to detection molecules. Model A had the greatest C-score with -2.68 and is therefore indicated to be the most likely structure of the HMW SLP. The C-scores of the remaining four models were as follows, -2.78 (B), -3.01 (C), -3.10 (D) and -4.55 (E).

1.2.2 Surface Layer type clades

A project led by Dr Kate Dingle, Nuffield Department of Clinical Medicine, used large-scale, whole genome sequencing to determine the diversity and evolution of the SlpA gene within 57 C. difficile strains. Using the SlpA sequences, the researchers were able to group strains within the C. difficile species into 13 surface layer type (SLT) clades (Dingle et al., 2013). Currently, all sequenced C. difficile strains fall in to these 13 clades which therefore, represent the known SlpA diversity within the C. difficile species. To enable additional analysis of the possible SlpA biomarker, Kate Dingle kindly sent sequences of the surface- layer type strains (SLTS) from each of the 13 groups. The SlpA gene from each SLTS and C. difficile 630 was translated into an amino acid sequence using Artemis genome browser, aligned with MUSCLE, and the resulting alignment was viewed with Jalview. The amino acids were coloured via their percentage identity with dark purple defining >80 % identity across the sequences. The biomarker is denoted by the black box and is shown to be 100 % conserved across all 14 C. difficile strains (Figure 4).

1.3 Discussion

1.3.1 SlpA is expressed

Data from microarray experiments was used to provide an idea of the expression of SlpA protein. The data shows that the slpA gene is one of the most highly expressed genes in C. difficile 630. The high slpA expression was shown at two different time points, 4 h and 10 h growth and also within a mutant strain lacking SigH, an alternative sigma factor, which is a key element in the initiation of sporulation (Saujet et al., 201 1 ). The main evidence for SlpA protein expression however, was provided with a thorough literature search. The SlpA protein forms the C. difficile S-layer that completely coats the outer surface of vegetative cells (Reynolds et al., 201 1 ). Therefore, a high rate of protein synthesis is required to maintain the intact S-layer (Sleytr and Messner, 1983). There is a very high rate of SlpA synthesis in uninhibited cells (Dang et al., 2012) and Fagan and Fairweather (201 1 ) state that it is the most highly expressed protein in C. difficile, with expression occurring in all stages of growth (Savariau-Lacomme, 2003; Fagan and Fairweather, 201 1 ). Researchers have shown that SlpA is vital for cell growth (Dembek et al., 2015) and it has not been possible to create SlpA mutants (Dang et al., 2010; Fagan and Fairweather, 201 1 ). SlpA being an essential protein would explain why SlpA is highly expressed in all stages of growth and in mutants. The literature fairly conclusively shows that SlpA is expressed, providing the evidence required to continue with SlpA as a potential biomarker. Additionally, since SlpA is one of the most expressed proteins and is on the outside of the cell, the literature also highlights the suitability of the protein to provide a biomarker for a PoN sensor. The evidence suggests that any biomarker within the SlpA protein will be produced in abundance, presenting many epitopes for detection molecules to bind to. 1.3.2 The biomarker is located on the surface of SlpA

The SlpA protein is post-translationally cleaved into the LMW and HMW SLP (Dang et a!., 2012). The SlpA biomarker is located within the HMW SLP and therefore, to determine the location of the biomarker, the HMW SLP structure was required. I-TASSER predicted the structure and the biomarker was forecast to be completely accessible on the surface of the protein in all five of the models. All five models predicted the biomarker surface location, including model A with the highest C-score, it is therefore highly likely that the biomarker is exposed on the surface of the protein. 1.3.3 Determining the presence of the biomarker within three C. difficile strains

The SlpA protein was predicted to contain the unique biomarker shown of the invention SEQ ID NO:1 The preliminary laboratory work was implemented to determine if the biomarker was present within three C. difficile strains 630, R002 and R050. DNA was extracted from these C. difficile strains and PCR was performed using specific primers to amplify a region of the surface layer protein gene (SlpA) that contained the biomarker. The PCR products were separated using agarose gel electophoresis to determine their size. As shown in (Figure 6A) the PCR products were all around the expected length, which was 1468 for C. difficile 630 and 1469 for C. difficile R002 and R050. Table 1 The sequence predicted using the TokenDB and bioinformatics workflow to be a unique biomarker for C. Difficile. The PCR products were cleaned up using a Qiagen QIAquick PCR Purification Kit and sent for sequencing by Geneius Laboratory. The resulting sequences were translated into amino acid sequences using ExPASY translate (Gasteiger et al., 2003) and the biomarker was shown to be present in all three of the sequenced C. difficile strains (Figure 6B).

1.3.4 Analysis of the surface layer proteins of C. difficile

SlpA is post-translationally cleaved into the LMW and HMW SLP, with the biomarker (SEQ ID N01 ) residing within the latter. To determine expression of the HMW SLP, the surface layer proteins from three C. difficile strains, 630, R002 and R050 were extracted with low pH glycine and run on an SDS-PAGE gel (Figure 7). C. difficile 630 and R002 displayed two distinct protein bands, with a relatively high concentration of protein at the HMW and LMW SLP sizes. C. difficile R050 on the other hand, revealed a single band, containing a relatively high protein concentration, which was smaller in size than observed in the other C. difficile strains however, it remained within the HMW SLP size range (see discussion). The R050 LMW SLP was at the same size as the LMW SLP in R002 and 630 however, in comparison it had a smaller amount of protein.

2. Antibody production

2.1 Production of HMW SLP monoclonal antibodies mAbs were produced against the C. difficile biomarker (Table 1 ). To produce the mAbs, synthetic linear peptides, 10 amino acids in length, were used as the antigen. Several SlpA epitope sequences were selected and used to produce mouse mAbs, via the hybridoma technique. The eight mAbs that were produced are listed, alongside their ten amino acid epitope sequence (Table 2).

Table 2 The C. difficile antibodies produced and their corresponding epitope sequences. The region contained within the C. difficile biomarker is highlighted in yellow.

Two of the mAbs, Ab491 and Ab493, were produced against epitopes which overlapped the boundaries of the biomarker of the invention. Whilst it was realised that the specificity of these peptides may not be retained, these mAbs were kept and used for an exploratory exercise. Further analysis of the two mAbs was required as it was still possible that they could bind to the epitope region conserved within the biomarker and, if not, they served to inform about the design criteria for future applications of this technique.

2.2 Determining mAb binding to the surface layer proteins of C. difficile

Initial experiments were performed to screen the eight mAbs for successful binding to the surface layer proteins of C. difficile. Preliminary testing was accomplished using dot blots, a basic immunoblotting technique used to identify the presence or absence of a biomolecule that particular Abs are raised against. The surface layer proteins were extracted from samples using the low pH glycine method. The C. difficile reference strain, C. difficile 630, was used to determine positive binding and the closely related species,

C. sordellii, was used as a negative control. The extracted surface proteins (s) were dotted on to the membrane as were the remaining cell pellet, post surface protein extraction (p). the cell pellet was also used in case the low pH glycine method did not generate high yields of protein for the C. sordellii control. Additionally, to provide a positive control the mabs were bound directly to the membrane. The membranes were probed with the mabs and incubated with the secondary, horseradish peroxidase (hrp) conjugated, anti-mouse IgG.

Figure 8 shows examples of two mAbs, Ab521 (A) and Ab652 (B) successfully bound to C. difficile. The dark dots indicate binding, which is not seen for the negative control, C. sordellii. The positive control of the primary antibody produced a clear mark. Within the dot blots, the remaining four mAbs produced negative binding with two examples, Ab370 (A) and Ab498 (B), shown in Figure 9. All four of these mAbs do not bind to either the C. difficile or C. sordellii surface layer proteins or residual pellet and were excluded from further analysis.

2.3 Binding of the mAbs to proteins within C. difficile and the closely related strains

Western blots were performed with the extracted SLPs (S) and the residual pellet (P), of C. difficile 630 and the closely related species C. sordellii and P. anaerobius (Figure 10). Concomitant SDS-PAGE gels of the samples were run to show the loading of the proteins and if the low pH glycine method extracts any proteins from the closely related species All four of the mAbs, Ab491 , Ab493, Ab521 and Ab652 showed binding to proteins in both the extracted surface layer proteins and pellet of C. difficile. The mAbs bound strongly to a protein around 50 kDa in size, there was no signal displayed for any of the four mAbs with the closely related species. Two of the Western blots for Ab521 and Ab652, are shown in Figure 6-7, A and B respectively.

2.4 Binding of the four mAbs to proteins within commensal bacteria that are also found within faecal samples

Western blots were used to determine binding of the mAbs to denatured proteins from two C. difficile strains, 630 and R002, and the Gram-positive commensals, S. aureus ATCC 29213 and B. subtilis BSB1. Similarly to the previous Western blots, both the surface extracted proteins and the residual pellets were used.

All four mAbs, Ab491 , Ab493, Ab521 and Ab652 produced positive signals for both C. difficile strains and not against the commensal strains. The Western blots for two of these mAbs, Ab521 and Ab652 are shown in Figure 35.

2.5 Discussion

2.5.1 Binding of mAbs to the native SLPs of C. difficile

Dot blots were used to ascertain if the mAbs bound to the C. difficile surface layer proteins. However, dot blots do not convey information about the size of the biomolecule to which the mAbs bind to, nor about the specificity of antibody binding to individual proteins. Therefore this technique was used as an indicator for the successful antibody recognition of C. difficile proteins.

The results from the dot blots displayed four mAbs that successfully recognised and bound to C. difficile proteins and not to C. sordellii. Within these four Abs there was Ab491 and Ab493 which have epitopes that are not fully conserved within the biomarker and Ab521 and Ab652 which do (Figure 8). The remaining four mAbs, Ab370, Ab498, AbB31 and AbB84 did not display clear binding to C. difficile and were therefore disregarded from further experiments (Figure 9). The unsuccessful dot blots demonstrated the need for positive controls, which showed that the technique was successfully working and the lack of binding was not due to error within the experiment. Perhaps the reason for the lack of binding was due to the dot blots being performed on proteins in their native state whereas, the mAbs were produced against linear epitopes. Consequently, the mAbs may not fit the conformational structure of the protein thus binding cannot occur. For a point of need (PoN) sensor to be as rapid and as easy to use as possible, it is important that the mAbs bind to the native C. difficile proteins. This native binding would perhaps enable detection without the need for pre-treatment of samples.

The four positive mAbs showed binding to both the surface extracted proteins and the residual bacterial pellet. Since HMW SLP is one of the most abundant C. difficile proteins, it is likely that some of this protein is retained by the cell pellet, post low-pH glycine extraction, providing the mAb its epitope.

2.5.2 Binding of mAbs to the HMW SLP and not to species related to C. difficile

Two closely related species were used for the laboratory analysis of the mAbs. These species were P. anaerobius, chosen due to its similarity to the SlpA protein, and C. sordellii which shows some similarity to the biomarker. Western blots were used to determine mAb binding to denatured proteins in C. difficile and closely related strains. SDS-PAGE gels were run concomitantly to the Westerns so that the size of the protein to which the mAb binds to, could be established. Unlike dot blots, Western blots can be used with a molecular marker to ascertain the size of the antigen. The SDS-PAGE gels also provided information about the loading of the samples, showing that the low pH glycine, surface protein extraction, provided proteins in the supernatant for C. difficile but not for C. sordellii and only a small amount for P. anaerobius. This lack of protein is evidence for using the cell pellet as well as the extracted proteins, allowing the mAbs to be tested for non-specific binding to the majority of proteins within the cell. It is unknown if C. sordellii has an S-layer however, Couchman and co-workers predict that C. sordellii does (Couchman et al., 2015). Since there is no clear evidence that c. sordellii has an s-layer, there is also no extraction method or evidence that the low pH glycine method would provide proteins. P. anaerobius on the other hand, has a defined s-layer and is likely to be the proteins that were successfully extracted with the low pH glycine method (Kotiranta et al., 1995; Bradshaw et al., 2014).

All four western blots demonstrate that the four mAbs bind to C. difficile at a protein size corresponding to the HMW SLP, around 50 kDa (figure 10). As well as the C. difficile binding, all four of the mAbs show no binding to the closely related strains.

When analysed using the ExPASy compute pl/Mw tool (Gasteiger et al., 2003) the amino acid sequence for the HMW SLP of C. difficile 630 was calculated to be 39.45 kDa. This weight is considerably lower than what the protein migrates to on the SDS-PAGE gel, at around 50 kDa. This difference in size has been noted in the literature and other studies suggesting that it is due to aberrant migration of the protein within the gels (Calabi et al., 2001 ). Qazi and colleagues showed that although the HMW SLP runs at a larger size on SDS-PAGE gels, the actual mass, determined using mass spectrometry, was the same as predicted with ExPASy (Qazi et al., 2009).

2.5.3 Specificity of mAbs to denatured C. difficile proteins

The four mAbs successfully bound to the two C. difficile strains, 630 and R002 at a band corresponding to the HMW SLP and to some smaller proteins that may have been produced from degradation of the HMW SLP (Figure 35). Additionally, all four mAbs did not bind to S. aureus or B. subtilis, which are in the same phylum as Clostridium. S. aureus was chosen for testing as it is a common commensal bacterium and also a facultative human pathogen that can be found in human faeces (Bhalla et al., 2007; Ibarra et al., 2013; Kim et al., 2015). Although B. subtilis was traditionally viewed as a soil microbe it has also been shown to reside in the gastrointestinal tract (Hong et al., 2009) and was therefore also tested for mAb binding. None of the four mAbs bound to either S. aureus or B. subtilis and although many more bacterial species would need to be tested for non specific binding, it is promising start. For use in PoN sensors, it is vital that the mAbs detect C. difficile only as non-specific binding would cause false positives which, could lead to misdiagnosis and mistreatment Since the four mAbs, Ab491 , Ab493, Ab521 and Ab652 all bound to the HMW SLP and did not bind to any of the four non C. difficile species, they were progressed to the next stage of binding analysis.

3. Characterisation of the relative binding efficiency of Ab491 , Ab493, Ab521 and Ab652

3.1 Relative binding of the four mAbs Direct ELISAs were performed with whole cells of C. difficile R002 and R050, clinical isolates 1 18497G, 128703G, 994535 and the reference strain 630. The closely related strains, C. sordellii ATCC 9714 and P. anaerobius VPI 4330 were also used as controls.

All cells were bound, at equal concentrations, directly to the wells of the ELISA plate, providing the analyte. The cells were incubated in duplicate with one of the four C. difficile mAbs, all at a 1 in 800 dilution, and the protocol was followed as in methods section. This duplication of cells provided an average binding result of the fours mAbs to each strain. All figures discussed in this section are based on the average of the two readings.

The ELISA results were read at absorbance 450 nm and show that the two closely related species, P. anaerobius and C. sordellii provided very low absorbance readings for Ab491 , Ab521 and Ab652 (Figure 1 1 ). The low absorbance readings indicate that there was little binding to these species. When incubated with P. anaerobius, Ab521 had the lowest absorbance reading with Ab652 and Ab491 displaying slightly higher values. Ab493 on the other hand, bound to P. anaerobius at a rate that was double of that seen with the other three mAbs. This measurement was greater than the absorbance of Ab493 against four out of the six C. difficile strains, 630, R050, 1 18497G, and 994535. Therefore, Ab493 displayed binding to a closely related species better than it did to the majority of C. difficile strains thus lacking specificity Upon incubation with C. sordellii, Ab521 and Ab652 gave the highest absorbance values of the four mAbs. The difference, however, was small and in comparison to the readings seen when incubated with C. difficile, they are very low. The difference in absorbance between the C. difficile and closely related strains was, depending on the strain, four to eight times greater for Ab652 and eight to twenty -one times greater for Ab521 .

Within the C. difficile strains, Ab521 and Ab652 had the greatest absorbance values. Ab521 gave the highest C. difficile absorbance values, with the exception of strain 630 where Ab652 was greater. For five of the six C. difficile strains, R002, R050, 630, 1 18497 and 128703G, Ab491 and Ab493 displayed absorbance measurements that were less than half of those seen with Ab521 These ELISA results show that Ab521 and Ab652 bind with better efficiency and more specificity to C. difficile than Ab491 and Ab493. Due to these ELISA results, Ab491 and Ab493 were disregarded and the remainder of the project was performed focussing on the two more promising mAbs, Ab521 and Ab652. 3.2 Production, purification and isotyping of the mAbs

The mAbs were isotyped with a Rapid Mouse Isotyping Kit - Gold Series (Cambridge Bioscience), resulting in isotypes lgG2b for Ab521 and lgG1 for Ab652. The mAbs were purified from the cell culture supernatant, using an AKTA Start system and a protein G column. Around 3 ml of each mAb was purified at concentrations of 2.45 mg/ml for Ab521 and 0.27 mg/ml for Ab652. An example of the chromatograph produced with the AKTA and Unicorn start software is provided in Figure 12 A and an SDS-PAGE gel of Ab521 and Ab652 is shown in Figure 12 B. The gel displays protein bands for both mAbs at around 55 kDa and 25 kDa, which approximately equate to the heavy and light chains of the antibodies, respectively.

3.3 Production of recombinant C. difficile 630 LMW SLP

An E. coli Rosetta strain that had been transformed with a pET28 plasmid containing the C. difficile 630 LMW SLP, E. coli Rosetta pLMW1 -262-1 , was provided by Professor Neil Fairweather. The recombinant C. difficile 630 LMW SLP was produced to aid characterisation of the mAbs. Since the HMW SLP had not been successfully made by recombinant methods, the HMW/LMW SLP complex was required for particular methods to determine mAb binding to the native protein. However, since the LMW SLP would also be present in the complex, a control of the LMW SLP was required to verify that the mAbs were binding to the HMW SLP and not the LMW SLP. The E. coli Rosetta pLMW1 -262-1 strain was grown and the recombinant protein was determined to be in the soluble fraction. Large quantities of bacteria were grown and the media was purified using immobilised metal affinity chromatography with a nickel column Figure 13. This plasmid produces a stable, truncated LMW SLP that is 262 amino acids in length and has a molecular weight of 28 kDa. As seen with the native HMW and LMW SLPs, the recombinant LMW SLP runs aberrantly on SDS-PAGE gels with an apparent molecular weight of 33 kDa. 3.4 Specificity of the mAbs to the HMW SLP from the 14 SLTS

As described above all currently sequenced C. difficile strains can be grouped into 13 SLT clades. Dr Kate Dingle not only provided the sequences of the 13 SLTS for the

bioinformatics work but also kindly donated the corresponding strains for use within the laboratory experiments. A 14th SLTS was also sent, Ox2404, which resides in SLT clade 2, along with Ox858. Although the SlpA sequences of the two strains were the same, there were differences in other SLPs. Ox2404 lacks Cwp10 and Ox858 lacks the 5' Cwp84, both of which are cell wall proteins and therefore may influence binding of the mAbs.

Furthermore, Cwp84 is the protease that cleaves SlpA into the mature LMW and HMW SLPs (Pantaleon et al., 2015) and consequently any alterations to this protein may directly affect the structure of the HMW SLP and thus mAb binding. For these reasons, all 14 SLTS were used throughout the cell mAb binding analysis.

Western blot analysis was performed with 5 mg/ml of both Ab521 and Ab652, against 5 mg of low pH glycine extracted SLPs, from eight of the SLTS. Although the LMW SLP is present within all of the SLTS, recombinant LMW SLP from C. difficile 630 was also tested as an extra control, to identify if the mAbs non-specifically bound to this protein. Along with the HMW, the LMW SLP is the most prevalent protein within the SLPs and, therefore, it is important to test for non-specific antibody binding. As shown in Figure 14, Ab521 bound specifically to the HMW SLP of all eight SLTS, and did not bind to either naturally occurring or the recombinant LMW SLP. There were however, some double bands within these Western blots, corresponding approximately to the molecular weight of the HMW SLP (Figure 14). The SLTS Ox1 145 had a clear double band whereas, Ox575 and Ox2404 displayed fainter double bands. The extra Ox1 145 band can also be seen on the SDS- PAGE gel, therefore, the band contains enough protein to be detected by the coomassie stain. The molecular weight of the additional band is marginally lower than that of the HMW SLP and therefore could be indicative of degradation of this protein.

Ab652 also bound specifically to the HMW SLP within the extracted surface layer proteins, and did not bind to any of the LMW SLPs (Figure 15). As seen for Ab521 , there were also some double bands visible for strains Ox1 145, Ox575 and Ox2404 within the Ab652 Western blot. Rather than test the mAbs against the SLPs of the remaining six SLTS, the whole cell lysates for all fourteen SLTS were tested for mAb binding. These results would not only determine binding to the HMW SLP in all fourteen SLTS, but they would also provide evidence that the mAbs do not non-specifically bind to proteins present within whole cell lysates.

3.5 Specificity of Ab521 and Ab652 to proteins within whole cell lysates

It was important to test the mAbs against as many proteins as possible from the closely related strains. For this reason, whole cell lysates were used as the samples within Western blots. C. hiranonis DSM-13275, which displays reasonably high similarity to the SlpA protein and to the biomarker, was included as one of the closely related strains. Also used were C. sordellii ATCC 9714 and P. anaerobius VPI 4330, along with whole cell lysates from all fourteen SLTS. The Western blots were used to test for binding with both Ab521 and Ab652. As shown in Figure 16, Ab521 at 5 mg/ml binds to the HMW SLP within all fourteen SLTS and not to any proteins within the closely related strains. Furthermore, the positive binding occurs in one clear band, demonstrating the specificity to the HMW SLP and that the previous Western blot (Figure 14) may have shown some degradation of the HMW SLP.

As seen with Ab521 , Ab652 also binds specifically to the fourteen SLTS, with one clear band, and does not show binding to the closely related strains (Figure 17). The results for the Western blot against Ox160 - Ox1424 was performed with 5 mg/ml Ab652, which showed clear binding but not as strong as seen with Ab521 , although binding was not quantified. Therefore, to verify that non-specific binding to the closely related strains was not occurring, the Western blot with these strains was performed with Ab652 at a higher concentration of 10 mg/ml.

3.6 Discussion

3.6.1 Ab521 and Ab652 are the most promising of the four mAbs

The absorbance values from the whole cell ELISA (Figure 1 1), are directly proportional to the amount of primary antibody bound to the whole cell antigens. For PoN sensors it is important that the antibodies bind to the organism of interest, with high affinity, allowing rapid and clear detection (Ahmed et al., 2014). Weak binding may not clearly identify bacteria from complex samples, such as faecal samples tested for CDI. Thus, the results show that due to their stronger binding, Ab521 and Ab652 are the most promising of the four mAbs for C. difficile detection. Furthermore, both of these mAbs show very little binding to the closely related species, C. sordellii ATCC 9714 and P. anaerobius VPI 4330 - up to 21 times less - when compared to the C. difficile strains. Thus, Ab521 and Ab652 would be highly unlikely to cause false positives by interacting with these two organisms (Owen, 2003). In contrast, Ab493 bound to P. anaerobius with greater efficiency than to four out of the six tested C. difficile strains. Therefore, accurate diagnosis would not be possible, as this binding would produce false positives, at least to this species, within a diagnostic sensor setting. The low rate of Ab493 binding to the C. difficile strains also limits the use of this molecule within a PoN sensor. Ab493 would be unlikely to detect C. difficile strains with similarity to R050, 630, 1 18497G and 994535, causing any sensor to have poor sensitivity. Although slightly higher than Ab493, poor binding to the C. difficile strains was also displayed with Ab491. This lack of binding is evidence that neither Ab491 nor Ab493 would be useful for use as detection molecules within PoN sensors. One possible reason for the difference in mAb binding could be due to the 10 amino acid epitope against which they were produced. Ab521 and Ab652 displayed elevated binding, and both have epitopes that are 100 % conserved within the predicted C. difficile biomarker. Whereas, the epitopes for Ab491 and Ab493 are only partially found within the unique biomarker (Table 3).

Table 3 . The antibody ID and corresponding epitope to which the mAb was produced. The region found within the predicted C. difficile biomarker is highlighted.

Only the regions that are fully conserved within the biomarker are predicted to be unique and surface exposed. Therefore, regions of the Ab491 and Ab493 epitopes that are not located within the biomarker may not be fully surface accessible, causing the lower rate of antibody binding. The Jalview hydrophobicity view of the sequences, within the bioinformatics results showed that the ten amino acid epitope for Ab493 has only two amino acids that are hydrophilic: D and P. Consequently, the epitope may not be completely exposed on the surface of the HMW SLP and could be the reason for the low antibody binding to the C. difficile strains. The epitope for Ab491 on the other hand has seven amino acids that are hydrophilic, which could explain the stronger binding to C. difficile than Ab493. Although the number of hydrophilic residues could indicate surface exposure of the epitope, Ab521 has seven hydrophilic residues and Ab652 has less, yet both mAbs have much greater binding efficiency than Ab493. Therefore, the hydrophilic nature of the amino acids is not the only factor in antibody binding to its antigen. The lower binding efficiency of Ab491 could perhaps be due to the inability of Ab491 to bind completely to the native protein.

The regions outside of the biomarker may not be unique to C. difficile and could cause cross-reactivity of the mAbs with other organisms. A BLASTP search of the Ab493 epitope identified that eight from the ten amino acid sequence are located within a surface protein of P. anaerobius (Figure 18). Therefore, it is possible that Ab493 recognised this sequence within P. anaerobius, causing the non-specific binding. The BLASTP results for Ab491 , Ab521 and Ab652 epitopes did not identify sequences with a high percentage identity within P. anaerobius. This lack of sequence identity was predicted, as there was little binding of the three mAbs to P. anaerobius.

3.6.2 Purification of Ab521 and Ab652

The cell lines for two of the mAbs, Ab521 and Ab652, were grown in large quantity and cell death was permitted to produce antibody. Upon isotyping, Ab521 was found to be lgG2b and Ab652 was lgG1 . Since Protein A has extremely poor reactivity with mouse lgG1 (Kronvall et al., 1970), Protein G was chosen as the affinity chromatography protein. For both Ab521 and Ab652, 260 ml of culture supernatant was purified, producing 3 ml at 2.45 mg/ml and 0.27 mg/ml respectively. Therefore, the minimum starting concentration of the mAbs within the hybridoma supernatant was 28 mg/ml for Ab521 and 3 mg/ml for Ab652, which are within the expected range of 1 -60 mg/ml (Pandey, 2010).

3.6.3 Specific binding of the mAbs to HMW SLP in all 14 SLTS

For the initial Western blots, the extracted SLPs of the SLTS were used as the protein samples, with both mAbs displaying binding to more than one band on some of the strains. The same protein samples were used in the Western blots for both mAbs, therefore, it seems likely that the extra bands were due to HMW SLP degradation rather than non specificity of the mAbs. The Western blots performed with whole cell lysates were immediately loaded onto an SDS-PAGE gel, to reduce the likelihood of any degradation. Within these Western blots, both Ab521 and Ab652 bound to a single band at the corresponding HMW SLP size for all fourteen SLTS. This binding showed specificity to the HMW SLP and consequently established that the previous double bands were due to degradation.

The SDS-PAGE gels for the extracted C. difficile SLPs and the whole cell lysates all displayed the HMW and LMW SLP, apart from Ox1523, which only had a single

predominant band consistent with the HMW SLP. As described in section 6.3.2, C. difficile strains, such as ribotype 167, have been shown in the literature to contain a single dominant band (Calabi and Fairweather, 2002). To determine their similarity, the R167 SlpA sequence was taken from NCBI and aligned with the SlpA sequence for Ox1523. Only 2 out of 610 amino acids were different so, R167 belongs to SLT clade 1 1 along with Ox1523, with this similarity displaying that the single dominant band was not an anomaly. Whilst Kate Dingle and colleagues were creating the SLT clades they determined that R050 also belongs within SLT clade 1 1 (Dingle et al., 2013). As seen with Ox1523 and R167, R050 also displayed a single dominant band, shown in the SDS-PAGE gel within Figure 7

Using the sequences from the full C. difficile genome, the biomarker was shown to be unique to the HMW SLP and not present within any other C. difficile proteins. As predicted the mAbs produced against this biomarker bound solely to the HMW SLP. The mAbs did not bind to the 28 SlpA paralogs that are present within C. difficile (Sebaihia et al., 2006) showing specificity to the HMW SLP even when compared to closely related C. difficile proteins. These proteins were denatured and so the Western blots do not provide evidence for HMW SLP specificity with native C. difficile proteins. For the whole cell Western blots with SLTS Ox160 to Ox1424, both mAbs were used at 5 mg/ml. The signal for Ab652 appears weaker compared to Ab521 however, the signals were not quantified because more accurately quantifiable tests will be used to determine relative binding. When the Ab652 concentration was increased to 10 mg/ml for the whole cell Western blot of Ox1437a to Ox2404 and the control strains, the signal seemed to be similar to that seen in the same Western blot for Ab521 used at a concentration of 5 mg/rnl. This concentration difference indicates that Ab521 may have a better binding efficiency than Ab652.

All of the C. difficile strains, which have currently had their genome sequenced, fall within one of the 13 SLT clades, therefore, the SLTS represent the entire C. difficile species. Both Ab521 and Ab652 bind to all of the SLTS, indicating that the mAbs would bind to the denatured HMW SLP of any C. difficile strain. This detection of all strains within the species is pivotal in preventing false negatives within a PoN sensor. The next step was to determine whether Ab521 and Ab652 could detect strains from all of the native SLTS. The lack of binding to the closely related strains, as shown by the mAbs, is also vital, as it will help prevent false positives in a PoN sensor. There were three closely related strains tested for mAb binding, P. anaerobius, C. sordellii and C. hiranonis.

4. Specific whole cell binding of Ab521 and Ab652 to the C. difficile SLTS

4.1 Qualitative whole cell binding of Ab521 and Ab652 to the SLTS Whole cells from all 14 C. difficile SLTS, C. difficile 630 and the three closely related species, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330, were directly bound to PVDF membrane. The C. difficile cells were applied in a serial dilution from undiluted to 1/1000 whereas, the closely related species were all applied undiluted. The membrane was incubated with 5 mg/ml Ab521 (A) or Ab652 (B) followed by HRP conjugated secondary (Figure 19). To ensure all aspects of the experiment were working, positive controls of the primary antibody and surface extracted proteins of C. difficile 630 were bound directly to the membrane. Both Ab521 and Ab652 produced a signal for the two positive controls. The two mAbs also generated positive signals against the whole cells of all 14 SLTS and C. difficile 630, indicating successful binding. Neither Ab521 nor Ab652 appeared to bind to the three closely related species. The Ab521 signal for the undiluted cells of SLTS Ox160, was much weaker than the more dilute samples.

The Ab521 signal for all but Ox160 and Ox858 was positive across all of the cell dilutions whereas, Ab652 had strong positive signals for the undiluted cells and when cells were diluted 1 in 100. However, the signal was much weaker for the 1 in 1000 dilution of all C. difficile strains. This difference in binding between the two mAbs indicates that Ab521 has a stronger binding affinity than Ab652.

4.2 Semi-quantitative whole cell binding of mAbs to the C. difficile species Whole cells of C. difficile 630, the 14 SLTS and three closely related species, C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330 were directly bound to a 96 well plate and whole cell ELISA was performed following the protocol described herein. Cells were checked for adherence to the ELISA plate using an inverted microscope, however quantitative analysis of cell adhesion could not be performed. Since the required mAb concentration for the whole cell lysate Western blots described herein was 5 mg/ml for Ab521 and 10 mg/ml for Ab652, these concentrations were used as starting points within these ELISAs. Decreasing concentrations of mAb were used, with 5 mg/ml to 0.1 ng/ml for Ab521 and 10 mg/ml to 100 ng/ml for Ab652. Although the concentration of the HMW SLP was not known, the OD of the cells was kept constant and the same samples were used for both ELISAs, enabling semi-quantitative comparative analysis of the two mAbs. All ELISA results were observed with the plate reading spectrophotometer set at 450 nm. Statistical analysis of the results was performed using the, IBM SPSS version 21 , and a one-way ANOVA with Bonferroni and Tukey post hoc tests. A statistical significance value of P= < 0.05 was used throughout the analysis. Unless stated, the P value provided is from both the Bonferroni and Tukey tests. For Ab521 there was a significant difference in absorbance values between all of the C. difficile strains and the closely related species, for concentrations 5 mg/ml to 100 ng/ml, P = < 0.05 (Figure 20). The lower concentrations, 100 ng/ml and 1 mg/ml showed almost no binding to the closely related species. There was some binding of Ab521 at 5 mg/ml to the closely related species, however, even the species with the greatest absorbance, P.

anaerobius, showed binding that was significantly lower than the C. difficile strains.

Therefore, Ab521 showed specificity to C. difficile when tested against C. hiranonis DSM- 13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330. The Ab521 dilutions provided very similar readings for each C. difficile strains, with 5-0.1 mg/ml showing very little difference in absorbance. The binding displayed across the C. difficile strains was quite uniform, with a difference of around 25 % between the strain with the maximum

absorbance, Ox160, and the C. difficile strain with the minimum, Ox1396. On account of this clear binding to all C. difficile strains, Ab521 demonstrated its potential for sensitive detection of whole C. difficile cells. Since Ab521 at 5-0.1 mg/ml bound to C. difficile cells at an apparently similar saturating load, further dilutions of the antibody were tested, down to 0.1 ng/ml. Ab521 produced a significant difference in absorbance, P= < 0.05, between C. difficile and the closely related strains at concentrations as low as 1 ng/ml (Figure 21 ). The absorbance results of each Ab521 concentration from the whole cell ELISAs, from 5 mg/ml to 0.1 ng/ml, were plotted on a graph for each bacterial strain (Figure 22). At 0.1 ng/ml the absorbance values are very similar for all strains, displaying why P= > 0.05 at this antibody concentration. The three closely related strains, C. hiranonis, C. sordellii and P. anaerobius are grouped together at the lower absorbance values, across the antibody dilutions. Conversely, the C. difficile strains are grouped together with increasing absorbance values as the antibody concentration increases. The graph shows an apparent antibody saturating load at concentrations of 100 ng/ml to 5 mg/ml, however, an increase in absorbance is still seen with Ox1396 between these concentrations. The Ab521 concentration at which the absorbance difference between the closely related species and the C. difficile strains is at its greatest is 100 ng/ml. Although, there remains a clear differentiation between these groups at the lower concentrations of 1 -10 ng/ml.

The absorbance values for the whole cell ELISA when performed with Ab652, are substantially lower for the C. difficile strains than those seen for Ab521 (Figure 23). Even at a higher starting concentration of 10 mg/ml, the absorbance readings were around 45 % less than Ab521 with means of lower than one absorbance unit. There was a marked decrease in absorbance for each C. difficile strain as the antibody concentration decreased, with values for 100 ng/ml less than half of those seen for 10 mg/ml.

There was a clear difference in values between the controls and the C. difficile strains, for 10, 5 and 1 mg/ml, although, the difference was smallest with Ox1396. There was no significant difference between SLTS Ox1396 and P. anaerobius at any Ab652 dilution, P = > 0.05. Although, the difference in absorbance for the other C. difficile strains was significant at 1 -10 mg/ml. When the Ab652 concentration was reduced to 100 ng/ml there was no significant difference in absorbance between the C. difficile strains and the closely related species P = > 0.05. Similar to Ab521 , a graph was produced from the absorbance values for each strain at differing Ab652 concentrations along the x-axis. The three closely related species are consistently at the lowest absorbance values, however, there are also C. difficile strains close to these readings. The bacterial strains that are grouped at the higher absorbance readings are all C. difficile strains, demonstrating increased antibody binding to these strains. There is not the clear differentiation between all C. difficile strains and the closely related species, as displayed by the Ab521 results.

4.3 Analysing whole cell interactions of Ab521 and Ab652 using flow cytometry Flow cytometry was applied to further investigate the binding of the mAbs to whole cells. Both Ab521 and Ab652 were incubated with paraformaldehyde fixed whole cells, followed by Alexa Fluor 594 conjugated, anti-mouse IgG. In order to determine antibody interaction across the C. difficile species, all 14 SLTS and reference strain 630 were used. Controls of C. difficile without primary antibody but with secondary antibody were used. The closely related species were incubated with both primary and secondary antibodies to ascertain any non-specific antibody binding of Ab521 or Ab652. The fluorescence intensities for each flow cytometry sample were analysed using FlowJo version 7.6 and plotted on to histograms using the % of max, which normalises the data to percentage of maximum cell counts, when overlaying results.

The peaks for C. difficile 630 and all 14 SLTS have a marked increase in fluorescence intensity when they are incubated with Ab521 and the secondary antibody, than the cells incubated with the secondary antibody alone (Figure 24). All C. difficile strains were tested with the secondary antibody only and there was almost no fluorescence for all, with median, as calculated with the FlowJo software, peaks of around zero fluorescence intensity (AU). To avoid repetition, only the peaks for the controls of C. difficile 630, Ox1 145, Ox1437a (Figure 24) are shown.

The C. difficile SLTS Ox1 192c has the lowest fluorescence intensity peak for both Ab521 and Ab652, with a median fluorescence intensity peak of 730 AU and 264 AU respectively (Table 4). For Ab521 , the fluorescence intensity peaks ranged from the low of Ox1 192c to the high of Ox1 145, which had a median value of 4257 AU, over five times as much as Ox1 192c. The flow cytometry results were statistically analysed with IBM SPSS version 21. Mann-Whitney U and Wilcoxon Signed Ranks tests were performed between the fluorescence values of the C. difficile strains and the closely related species. When incubated with both Ab521 and the secondary antibody, the P values for both tests were < 0.05 and therefore the results were significantly different. When the same tests were performed with the closely related species, incubated with both antibodies, and the C. difficile strains incubated with only the secondary antibody, there was no significant difference between the values P = > 0.05. Therefore, all controls provided similar fluorescence readings which were around 0 AU.

Table 4 Fluorescence intensity values provided with flow cytometry for all 14 C. difficile SLTS, C. difficile 630 and the closely related species C. hiranonis DSM-13275, C. sordellii ATCC 9714 and P. anaerobius VPI 4330. The bacterial cells were fixed and incubated with either Ab521 or Ab652 followed by the secondary antibody Alexa Fluor 594 conjugated anti-mouse IgG. The median fluorescence intensity is given as well as the robust coefficient of variance. Table 4

The flow cytometry results for whole cells, incubated with Ab652 (Figure 25), were similar to the results for incubation with Ab521 . The plots displayed a distinct difference in fluorescence values between the C. difficile cells incubated with Ab652 and Alexa Fluor 594, anti-mouse IgG, compared to the cells without Ab652 incubation. However, the median fluorescence intensity values for all strains incubated with Ab652 were lower than those incubated with Ab521 with a summary of median fluorescence intensity peaks being displayed in Table 4. For example Ox1 145 had the highest median fluorescence for both mAbs, yet there was a large difference between them, with Ab521 having a value of 4257 AU and Ab652 just 1660 AU. Another observation was the difference in the width of the fluorescence peaks for both mAbs, with Ab652 having wider peaks, which are quantitatively displayed by the larger percentage of robust coefficient of variation (%rCV), than Ab521 (Table 4). The %rCV, calculated with FlowJo software, was used because it is not as skewed by outlying values as the coefficient of variation (CV). “%rCV = 100 * 1/2( lntensity[at 84.13 percentile] - Intensity [at 15.87 percentile] ) / Median” (Treister and Roederer, 2015)

All strains incubated with Ab652 had a larger dispersion of fluorescence values as measured by the %rCV, than those with Ab521 . For example for Ab652 and Ab521 , Ox1396 had a %rCV of 240 and 152 respectively, Ox1533 had 166 and 106 and finally Ox1896 had 1 14 and 73.4 respectively.

The closely related species, C. hiranonis and P. anaerobius had a median fluorescence of around zero when incubated with either Ab521 (A) or Ab652 (B), and the secondary antibody (Figure 26). Furthermore, Ab521 also had a median fluorescence intensity of zero for C. sordellii, whereas Ab652 had a slightly increased positive median value of 26.8 AU and what appeared to be a larger %rCV however, this could not be quantified due the negative fluorescence values within the population. Although the median fluorescence value for Ab652 with C. sordellii was positive it remained 10 % less than the C. difficile strain with the lowest median value when incubated with Ab652, Ox160. The C. sordellii value was less than 1 .5 % of the highest median fluorescence intensity displayed by a C. difficile strain incubated with Ab652, which was Ox1533. Statistical analysis was performed on the flow cytometry data and a Mann-Whitney test confirmed that the fluorescence values of all of the C. difficile strains, for both Ab521 and Ab652, are significantly difference to the fluorescence values displayed in the closely related species, P = < 0.05. 4.4 IF imaging of the interaction of Ab521 and Ab652 with whole cells

To gain images of the mAbs interacting with whole cells, IF microscopy was performed. Whole cells were paraformaldehyde fixed and incubated with Ab521 or Ab652, and the secondary antibody Alexa Flour 594, anti-mouse IgG. The resulting images displayed clear fluorescence at the surface of the C. difficile cells, demonstrating positive binding of both Ab521 (B) and Ab652 (F) with Ox1396 (Figure 27), however, the fluorescence intensity for Ab652 (F) was lower than Ab521 (B) for SLTS Ox1342 (Figure 28). Both of these figures also show images of the C. difficile strains when incubated with the fluorescently labelled secondary antibody only and not the mAbs. The images were displayed with brightfield (C) to reveal presence of the cells and mCherry filter (D), which showed a lack of fluorescence in both C. difficile strains without either Ab521 or Ab652. A total of six C. difficile strains and three closely related strains were tested for mAb binding using IF microscopy and an overview of the results are provided in Table 5.

The closely related species, C. sordellii (Figure 29), C. hiranonis and P. anaerobius (Appendix Figure 10 and 1 1 ) did not display fluorescence when incubated with Ab521 (B) or Ab652 (D) and the secondary antibody (Figure 29 D). The actual fluorescent values are provided in For Table 5 the average cell fluorescence was calculated using ImageJ. The fluorescence values were used from a minimum of five random cells from C. difficile or the closely related species and the average was calculated. The background fluorescence was also calculated from a minimum of five areas, which were the same size as the cells that were analysed. The background for the cells incubated with the secondary antibody only and not the mAbs were calculated, again using ImageJ. The cells were marked on the brightfield image and the markers were transferred to the corresponding fluorescence image, enabling calculation of fluorescence values at the specific cell site.

Table 5 and show that the there is some slight binding of Ab652 to C. sordellii. However, the binding is negligible, as the value is a minimum of four times lower than the

fluorescence value of Ab652 with the C. difficile strains. For the other two closely related species and all three for Ab521 the resulting fluorescence is less than 1.5 AU. The non specific binding is insignificant when compared to binding with C. difficile, which the lowest value is seen with Ox8585 and is 366.19 AU for Ab652 and 548.27 AU for Ab521 .

4.5 TEM analysis of Ab521 and Ab652 with C. difficile and C. sordellii

TEM enables cells to be seen at great magnification and was used with indirect immunogold labelling to image antibody interaction with whole C. difficile and C. sordellii cells. The cells were paraformaldehyde fixed and incubated with either Ab521 or Ab652 and the secondary, gold conjugated, anti-mouse IgG.

When incubated with Ab521 , both C. difficile 630 (A) and Ox575 (B) displayed gold nanoparticles, which can be seen as dense, dark, uniform circles, attached to the surface of the cells (Figure 30). To assist with visualisation of some of the more difficult to see nanoparticles, they were marked with white arrows. There are several factors affecting the ability to see the gold nanoparticles firstly, they can only be seen when the focus of the electron beam is nearby. Secondly, the sample being viewed must not be too dense and finally, the negative stain, used to enable visualisation of the cells, must not be too dark.

Gold nanoparticles were also seen on C. difficile 630 cells when incubated with Ab652 (Figure 31 ). However, it was noted that there were fewer particles with Ab652 than on the cells incubated with Ab521 (Figure 30). Quantification of the gold nanoparticles was not performed and consequently, the particle number was purely observational.

For a negative control, C. difficile 630 was incubated with the secondary antibody only and no primary antibody. These cells did not display gold nanoparticles attached to the surface of the cells (Figure 32) and therefore showed that the gold conjugated anti-mouse IgG does not non-specifically bind to C. difficile.

C. sordellii was also incubated with either Ab521 (A) or Ab652 (B) and the gold conjugated anti-mouse IgG, and viewed using TEM (Figure 33). Although one or two gold

nanoparticles were seen on the images, they were not on the surface of the organism, which was completely clear of gold particles.

4.6 Discussion

4.6.1 Dot blots indicate that mAbs bind to whole C. difficile cells

Whole cell binding of the mAbs is advantageous for their integration into rapid PoN sensors (Ahmed et al., 2014) as it would reduce the need for time consuming pre treatment, such as lysis of cells. The dot blots displayed positive signals for both Ab521 and Ab652, binding to all 14 SLTS and C. difficile 630. Since these 14 SLTS are representatives of the 13 SLT clades that all C. difficile strains can be clustered into, theoretically, Ab521 and Ab652 should bind to the C. difficile species as a whole, at least with dot blot analysis. For SLTS Ox160, the signal for the undiluted cells, with Ab521 , was much weaker than the more dilute samples.

The signal for Ab521 remained strong with the C. difficile cells at a dilution of 1 in 1000, whereas, Ab652 displayed poor binding, implying that Ab521 may bind to C. difficile with greater affinity than Ab652. Neither Ab521 nor Ab652 produced a positive signal for any of the three closely related strains, C. sordellii, C. hiranonis or P. anaerobius, indicating that the mAbs do not bind to whole cells from these control species. The closely related species were used to test for non-specific binding of the mAbs, since they have sequences that are similar to C. difficile or SlpA and thus are more likely to interact with the antibodies. Since dot blots provide only semi-quantitative information and are not sensitive enough to draw conclusions from alone (Jin et al., 201 1 ), complementary methods of examining positive and non-specific binding were pursued.

4.6.2 Ab521 binds to whole C. difficile cells with greater efficiency than Ab652 To gain semi -quantitative evidence of whole cell binding, the mAbs were tested using whole cell ELISAs. The results for Ab521 showed that when incubated with each of the 15 C. difficile strains, the absorbance values were saturated between with 100 ng/ml of antibody and 5 mg/ml. At 0.1 mg/ml, Ab521 distinguished between all C. difficile strains and the closely related species with a significance of P = 0.000. Since the tested SLTS represent the entire C. difficile species, in the context of SlpA, the significant binding of Ab521 to all of these strains indicate that the antibody would bind to all C. difficile strains. This binding indicates the high sensitivity of Ab521 , which would be useful for a PoN sensor. Even at 1 ng/ml Ab521 there remained a significant difference P = < 0.05 between all of the C. difficile strains and the closely related species.

In contrast, Ab652 displayed a significant decline in binding to the C. difficile strains as the antibody concentration reduced from 10-0.1 mg/ml. Even at 10 mg/ml, Ab652 bound to the cells with an efficiency that was around 40 % less than Ab521. The lowest concentration of Ab652 which displayed a significant binding difference between most C. difficile strains and the controls was 1 mg/ml, ten times more concentrated than Ab521. Furthermore, at all concentrations, Ab652 did not display a significant difference between the binding with C. difficile SLTS Ox1396, compared with the closely related species, P. anaerobius.

These results corroborated the initial findings from the dot blots, that Ab521 has a higher binding efficiency to C. difficile than Ab652.

Within a PoN sensor it is recognised that the samples would not be pure C. difficile and would include other organisms and faecal matter.

4.6.3 Quantitative evidence that Ab521 binds to whole C. difficile cells at a greater efficiency than Ab652

Flow cytometry enables the quantitative analysis of antibody binding to individual cells, whilst also providing information on antibody binding to the population as a whole (Abbas and Lichtman, 2004). Both mAbs bound to all 14 SLTS and C. difficile 630 with clear, positive results when compared to the controls, including C. difficile with no mAb and the closely related species with both antibodies. This binding was shown by the significant increase in median fluorescence intensity, which was caused by Ab521/Ab652 binding to whole C. difficile cells and the subsequent binding of Alexa Fluor 594 secondary antibody. The lack of fluorescence for the C. difficile strains without mAb incubation showed that there was no non-specific binding of the secondary Alexa Fluor 594 antibody to C. difficile and that the mAbs are necessary to gain a positive fluorescent signal. The median fluorescence values for all C. difficile strains were greater for Ab521 than Ab652, corresponding with the ELISA and dot blot results. These quantitative flow cytometry results determine that Ab521 binds with higher efficiency to C. difficile cells than Ab652. Unlike the whole cell ELISA results, binding of the mAbs to Ox1396 was not substantially less than the binding to other C. difficile strains. In fact the peak fluorescence for Ox1396 was greater than that of five C. difficile strains for Ab521 and three for Ab652. As a result of this binding observed in a sample of 1 ,000,000 cells, it was noted that the lack of binding to Ox1396 within the ELISA results, was likely due to either the technique itself or the poor adhesion of Ox1396 to the ELISA plate.

The three control strains, C. hiranonis, C. sordellii and P. anaerobius were incubated with either Ab521 or Ab652 and anti-mouse Alexa Fluor 594. All three strains for both mAbs were within the fluorescence intensity range of negative binding, close to zero. These results demonstrate the specificity of both Ab521 and Ab652 to C. difficile when compared to the three closely related species. When incubated with C. sordellii, Ab652 produced a slightly increased median fluorescence intensity of 26.8 AU. Although this fluorescence value is higher than those seen with the other control strains, it remains significantly lower than any fluorescence value observed with C. difficile, P = < 0.05.

4.6.4 Visualisation of the antibody binding to whole cells using IF microscopy

To enable visualisation of the mAb binding to C. difficile cells, IF microscopy was used.

The resulting images clearly displayed fluorescence on the surface of the C. difficile strains, when incubated with both Ab521 and Ab652. There were six C. difficile strains that were tested, the reference strain 630 and the SLTS Ox858, Ox1396, Ox1342, Ox1437a and Ox1533. When incubated with Ab521 , all six of these strains displayed greater fluorescence than when incubated with Ab621 , providing yet more evidence of the stronger binding affinity of Ab521 .

Similarly to the flow cytometry results, IF microscopy also displayed clear binding of both mAbs to Ox1396. From the six C. difficile strains, Ox1396 showed the second highest fluorescence value for both Ab521 and Ab652. This binding provided visual confirmation that the ELISA results for Ox1396 were not an accurate depiction of antibody binding to this strain. Furthermore, the IF images also confirmed the flow cytometry results for the closely related species, agreeing that the mAbs did not bind to C. hiranonis and P.

anaerobius, although, Ab652 did show some, albeit slight, binding to C. sordellii. The clear binding to C. difficile and absence of binding to the closely related strains, allow the specificity of Ab521 and Ab652, and the surface localisation of the binding to be visualised.

4.6.5 Specific surface binding of the mAbs at the epitope site

TEM enables visualisation of the antibody epitope sites, using gold nanoparticles to mark the binding, at greater magnification than is possible with IF microscopy. Although not quantified, a greater number of nanoparticles were observed when C. difficile 630 was incubated with Ab521 than with Ab652. This binding further supports the increased binding capability of Ab521 and reveals the specific surface localisation of this binding, which coincides with the, HMW SLP containing, S-Layer.

The TEM images within this project were gained using whole cells, however, thin cross- sections of the cells could be used for future work. As shown by Emerson and colleagues, when immunogold labelling surface proteins in whole C. difficile cells, cross sections enable the clear visualisation of the presence of antigen on the external surfaces only (Emerson et al., 2009). This technique would be useful for future TEM analysis of the mAb interactions with whole cells, as it should enable the visualisation of the gold nanoparticles specifically to the cell surface only

5. Materials and Methods

5.1 Bacterial storage and growth

All C. difficile strains were cultured in brain heart infusion (BHI) (Sigma) or cooked meat broth (Sigma) and on plates made from C. difficile agar base (Sigma) with C. difficile C.D.M.N. - selective supplement (Oxoid), 1 vial to every 500ml C. difficile agar, and 7 % sheep’s blood. C. sordellii and P. anaerobius were cultured in BHI or on soy-tryptone agar (15 g/l tryptone, 5 g/l soytone, 5 g/l NaCI, 15 g/l agar) supplemented with 7 % sheep’s blood. C. hiranonis was cultured in PY + X medium (Table 6 and Table 7). All incubations were anaerobic, using anaerobic jars and Anaerocult A gas packs (Merck), at 37°C. The broths were incubated for 12-16 h and the agar plates were incubated for 48 h.

Table 6 PY + X medium for growth of C. hiranonis

Table 7 Salt solution used in the PY + X medium for C. hiranonis culture

For short term storage, cultures were anaerobically kept on agar plates at room temperature. For long term storage, liquid cultures were grown to exponential phase (OD600 0.4-0.6) and mixed with sterile glycerol to a final concentration of 25 % and stored at -80°C.

5.2 Bacterial strains

Table 8 List of bacterial strains used throughout this disclosure

C. difficile strains marked with an asterisk were kindly donated by Dr Kerry Hill from the Freeman Hospital, Newcastle upon Tyne. The C. difficile Oxford strains (Ox), are the 14 S- Layer type strains, which were kindly donated by Dr Kate Dingle, Nuffield Department of Medicine, Oxford. The E. coli Rosetta pLMW1 -262-1 was kindly donated by Professor Neil Fairweather, Imperial College London, and was used to produce the recombinant LMW SLP.

5.3 DNA Extraction

Cultures of bacteria were grown as described, 50 ml overnight and DNA extraction was performed with a DNeasy Blood and Tissue kit (Qiagen), following the protocol for Gram positive bacteria, with the volume of elution buffer decreased to 30 mI. The DNA was quantified using a NanoDrop3 spectrophotometer. 5.4 Polymerase chain reaction (PCR)

Clone Manager Version 9Table 3-4 and the designed primers: 4 was used to model PCR primers. The 'PCR clone wizard’ tool was followed, with differing inputs depending on the target. The presence of primers, in all C. difficile genomes, was checked using Jalview in ‘clustalx’ view. The extracted DNA was amplified using Phusion polymerase (NEB), the conditions shown in table 9.

Forward SlpA - ATG AGT AT AG CT CCAGTT G C

REVERSE SLPA - ATCTTCATCACCATCTCCTGC

Table 9 PCR conditions used with Phusion polymerase

5.5 Agarose Gel Electrophoresis

The PCR products were separated on a 0.8 % w/v agarose/TAE buffer gel with 0.5 mI/ 10 ml agarose Safe View (NBS biologicals), at 90 v for 1 h, with a 1 kb DNA ladder (Promega), to determine the product’s size.

5.6 DNA Sequencing

The PCR product was purified using a Qiagen QIAquick PCR Purification Kit and quantified using the Nano-Drop spectrophotometer with ND1000 V3.7.1 software. Samples with values over 40 ng/mI were sent for sequencing by Geneius Laboratory5 with the primers: Forward SlpA - ATGAGTATAGCTCCAGTTGC

REVERSE SLPA - ATCTTCATCACCATCTCCTGC

5.7 Low pH glycine, surface protein extraction

Cells from O/N, 50 ml liquid cultures were harvested via centrifugation at 2700 x g for 15 min 4oC and washed in 10 ml 0.1 M PBS. The cell pellet was resuspended in 500 mI, 0.2 M glycine pH 2.2 and incubated at RT for 30 min. Finally, the solution was centrifuged at 2700 x g for 15 min and the supernatant was removed and neutralised with 2 M Tris, pH 7. 5.8 Determination of protein concentration

An indication of protein concentration was gained using a Nano-Drop spectrophotometer with ND1000 V3.7.1 software.

To determine protein concentrations more accurately, a bicinchoninic acid (BCA) assay kit (Thermo scientific) was used, as per the manufacturer's instructions, using BSA as the standard protein. If required, samples were diluted to get the absorbance values within the range of the standard curve.

5.9 Sodium Dodecyl Sulphate-polyacrylamide gel electrophoresis

Proteins were separated according to their molecular weights by discontinuous sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE). Briefly, samples were mixed 2:1 with loading buffer (1.8 ml 10 % SDS (w/v), 1 .8 ml 50 % glycerol (v/v), 0.5 ml 1 M Tris/HCI pH 6.8, 0.1 % bromophenol blue (w/v) and 0.5 ml b-mercaptoethanol), boiled for 10 min and pulse spun in a centrifuge prior to being loaded onto a polymerised acrylamide gel at 10 % (v/v). The gels were used in a BioRad gel tank system and a voltage of 80-150 V was applied for 1 -2 h, with a lower voltage being applied as the samples migrate through the 'stacking gel’. The recipe for the stacking and separating gels are shown in Table 2-4. Gels were then stained, with constant agitation, in coomassie staining solution (1 g/L coomassie brilliant blue R250, 50 % methanol (v/v), 40 % ddH20 (v/v) and 10 % acetic acid (v/v)) for 1 h and destained in destaining solution (30 % methanol (v/v), 60 % ddH20 (v/v) and 10 % acetic acid (v/v)) until background was cleared.

Table 10 SDS-PAGE recipe for both the stacking and resolving part of two gels.

1 Buffer I, 1 .5 M Tris/HCI, pH 8.8; Buffer II, 0.5 M Tris/HCI, pH 6.8.

2 Acrylamide

5.10 Scanning of SDS-PAGE gels

Gels were placed inside a plastic wallet and scanned using an Epson Perfection V350 scanner and professional software package. 5.11 Western blot

Proteins were separated by SDS-PAGE and transferred on to pre-activated Amersham hybond PVDF blotting membrane (GE Healthcare) using a BioRad wet-blot system. The membrane was activated upon submersion in methanol for 15 s and equilibration in transfer buffer (20 mM Tris, 192 mM glycine, 0.1 % SDS (w/v), 20 % methanol (v/v)).

Transfer occurred on ice with transfer buffer, at 350 mA for 1 h. The PVDF membrane was incubated overnight at 4°C with blocking buffer (0.1 M PBS, 5 % non-fat milk powder (w/v) and 0.05 % tween-20 (v/v)). The membrane was then incubated with the primary antibody diluted in blocking buffer at RT for 1 .5 - 2 h. The membrane was then washed with blocking buffer 4 times for 5 min each. The membrane was then incubated at RT for 1 h with peroxidase-conjugated goat anti-mouse IgG (Fc specific) (Sigma), diluted 1 :120,000 in blocking buffer. The membrane was washed for 15 min with PBS with 0.05 % tween-20 (v/v) and then another 4 x 5 min with PBS only. For visualisation of antibody binding, the membrane was treated with the Enhanced Chemiluminescence (ECL) kit from Amersham, GE Healthcare, as per manufacturer’s instructions. The bands were viewed using an ImageQuant LAS4000mini biomolecular imager (GE Healthcare) and processed with the accompanying software and ImageJ.

5.12 Hybridoma culture and production of antibody

All cell culture reagents were purchased from Sigma. Hybridoma cells were grown at 37°C in a 5% C02 incubator, in basic media (RPM1 1640, 10 % foetal calf serum (FCS) (v/v), 100 mg/I penicillin-streptomycin and 2 mM glutamine (w/v)), initially with the addition of 10 % Condimed (v/v) to aid recovery. When cells were fully confluent they were grown in media with reducing FCS content until they were able to grow efficiently in serum free media (10 %, 5 %, 2 %, 0.5 %, serum free). Large scale growth of the cells was performed in specialist media, EX -CELL® 610-HSF Serum-Free Medium for Hybridoma Cells, Low- protein, with L-glutamine, to which 100 mg/I penicillin-streptomycin was added. Cells were left in this media for 8-10 days until many of the cells are dead, the supernatant is then harvested at 13000 rpm for 5 mins.

5.13 Antibody purification via affinity chromatography

Antibody purification is performed with an AKTA start and a HiTrap Protein G HP, 1 ml column (GE Healthcare Life Sciences) and all solutions must be filtered and degassed. The column is flushed > 10 ml of wash buffer (20 mM phosphate pH 7.2) and a minimum of 260 ml cell culture supernatant was added to the column at a 4:5 ratio with 100 mM Na phosphate, pH 7.2. The column was washed with 20 ml wash buffer and eluted with 10 ml, 100 mM glycine/HCI, pH 2.0 in 1 ml fractions. UV absorbance chromatograms for the purification were collected using a chart recorder and OD280 was of the purified antibody was determined via NanoDrop spectrophotometer.

5.14 Isotyping of mAbs Rapid Mouse Isotyping Kit - Gold Series (Cambridge Bioscience) was used to type the mAbs according to the manufacturer’s instructions. Briefly, 40 mI cell culture supernatant was added to lateral flow strip 1 in order to indicate the Ig type. If IgG was indicated then the second strip was utilised, again with 40 mI cell culture supernatant, to indicate the IgG type and if the light chains were Kappa or Lambda. The strips were read within 15 min of testing. 5.15 Whole cell Enzyme-linked immunosorbent assay

Overnight bacterial cultures were grown to an OD600 0.6 and 8 ml of culture was centrifuged at 2700 x g for 10 min and washed three times with 0.1 M PBS. The cells were resuspended in 6m 1 50m M carbonate/bicarbonate buffer, pH 9.6 and 150 mI was added to the wells of a Nunc Maxisorp 96 well, flat-bottomed plate (Affymetrix eBioscience) and left overnight at 4°C. The cell solution was removed and washed 3 x with 0.1 M PBS, 0.05 % tween pH 7.4 (PBS-T), the plate was then blocked in blocking buffer (PBS-T with 5 % non fat milk), for either 2 h at room temperature or O/N at 4°C. The blocking buffer was removed and the plate was washed twice with PBS-T. The mAbs were diluted to differing concentrations in blocking buffer and 100 mI was added to the wells and incubated O/N at 4°C. The plate was washed 4 x PBS-T before the secondary antibody, peroxidase- conjugated goat anti-mouse IgG (Fc specific) (Sigma), was diluted 1 :20,000 in blocking buffer and added to the wells. The plate was incubated for 2 h at RT before removing and washing the plate 4 x PBS-T. One Ophenylenediamine (OPD) tablet was added to 50 ml substrate buffer (0.05 M citric acid, 0.05 M Na2HP04, pH 5) and then 50 mI of 30 % hydrogen peroxide (v/v) was added. To each of the wells, 150 mI of the OPD/substrate solution was added, developed for 30 min and the absorbance read at 450 nm with a plate reading spectrophotometer. Alternatively, the OPD reaction was stopped with 100 mI stop solution (2 M H2S04) and the absorbance read at 490 nm.

5.16 Overproduction of recombinant C. difficile 630 LMW-SLP

E. coli Rosetta containing pET 28a pLMW1 -262-1 , was kindly donated by Neil Fairweather, Imperial College London and was grown aerobically, O/N at 37°C in either LB agar or LB broth, both with 50 mg/I kanamycin and 12.5 mg/I chloramphenicol (kan/chl).

For large scale expression, 20 ml LB broth, 50 mg/I kanamycin and 12.5 g/I

chloramphenicol was inoculated with E. coli Rosetta pLMW1 -262-1 and grown O/N at 37°C with constant agitation at 200 x rpm. This 20 ml culture was used to inoculate 1 I LB broth kan/chl and grown at 30°C until OD600 0.6. Protein expression was induced with the addition of IPTG to a final concentration of 1 mM and the culture was grown for 5 h at 30°C. To determine solubility of protein 1 ml aliquots were removed pre-induction and hourly upon induction. The cells were pelleted, the supernatant was removed and the cells were resuspended in 1 ml 25 mM Tris/HCI, 200 mM NaCI, pH 7.5. DNase (Sigma) and protease inhibitor cocktail (Sigma) was added to both the resuspended cells and the supernatant before the cells were lysed following the sonication method. Both the lysed cells and supernatant were analysed via SDS-PAGE to determine the location of the majority of the expressed protein. 5.17 Immobilised metal affinity chromatography (IMAC)

IMAC was used to purify recombinant C. difficile 630, LMW SLP. The recombinant LMW SLP protein was labelled with a 6 x His-tag and therefore, purification was performed with a gravity column of affinity resin with bound bivalent nickel. The E. coli Rosetta containing pET 28a pLMW1 -262-1 cell supernatant was harvested at 10000 x g for 20 min at 4°C. The nickel column was washed with equilibration buffer (25 mM Tris/HCI, 200 mM NaCI, 5 mM imidazole, pH 7.5) and the cell supernatant was loaded on to the column at a 1 :1 dilution with equilibration buffer. The column was then washed with wash buffer (25 mM Tris/HCI, 200 mM NaCI, 20 mM imidazole pH 7.5) and elution was performed stepwise with additions of imidazole (50 - 300 mM imidazole) in elution buffer (25 mM Tris/HCI, 200 mM NaCI, x mM imidazole pH 7.5). The protein containing fraction was dialysed into 10 mM HEPES pH 7.5, 150 mM NaCI.

5.18 Sonication of bacterial cells

DNase and protease inhibitor cocktail (both Sigma) were added to the cell solution pre lysis and sonication was performed on ice. Cells were disrupted with a digital sonifier (Branson) using 10 % increments in sonication power (10 % - 40 %) for 30 s on and 1 min off cycles.

5.19 Fluorochrome labelling of bacteria

Bacteria were grown to exponential phase OD600 0.5, 3 ml was washed with 0.1 M PBS and fixed in 4 % paraformaldehyde for 20 min at RT. The cells were washed 3 x PBS and to quench the remaining PFA, the pellet was resuspended in 1 ml of 20 mM NH4CI2 for 15 min. The cells were pelleted and again washed in 3 x PBS. The pellet was resuspended in 0.5 ml PBS, 2 % BSA and 5 mg/ml mAb at RT for 1 h. Cells were washed 3 x PBS and resuspended in 0.5 ml PBS, 2 % BSA and 1 drop Alexa Fluor 594, goat anti-mouse IgG (life technologies) and incubated for 30 min at RT in the dark. Cells were washed 3 x PBS and resuspended in 100 mI PBS and for IF microscopy or 500 mI for flow cytometry. 5.20 Immunofluorescent microscopy

Glass slides were prepared with 1 % (w/v) agarose in sterile water and 500 mI molten agarose was pipetted onto a Hendley-Essex multispot microscope slide with a plain glass microscope slide (VWR) placed on top to spread out the agarose, which was allowed to solidify for 2 min. The top slide was slid off to reveal a smooth layer of agarose and 1 mI of fixed immunofluorescent cells added to each spot and covered with a cover slip.

Microscopy was performed using a Nikon M200 inverted microscope and Nikon 100x 1 .30 oil objective coupled to a Photometries CoolSNAP HQ CCD camera. The system was controlled and images acquired with MetaMorph v7.7.80 software, aided using the Nikon Ultimate Focus plugin. Phase contrast images were obtained using an exposure time of 100 ms, and 1000 ms for fluorescence images with ET -mCherry filter (Chroma 49008 ET560/40X).

5.21 Flow Cytometry

Fluorochrome labelled cells were produced as above and analysed using a Fortessa X20 flow cytometer with a Yellow/Green laser 561 nm, band pass filter 610/20. A laser beam with an optimal wavelength of 590nm is required for excitation of Alexa Fluor 594, which upon excitation, emits maximum fluorescence at 617nm. The operational software package that was used with the Fortessa X20 flow cytometer was BD FACSDiva. For each sample 100,000 to 1 ,000,000 events were recorded, and a dot plot display of forward scatter (FSC) versus side scatter (SSC) was used to gate the negative sample of just fixed cells with no fluorescence. FlowJo software version 7.6 was used to analyse the flow cytometry data. Briefly, the data was viewed using a histogram plot with the 561 610/20 fluorescence on the x-axis. The event count was normalised when overlaying results to display the % of max on the y-axis. To achieve the % of max, the fluorescence value which has the largest cell count, for each sample, is changed to 100 % and therefore, samples containing different numbers of cells, when normalised, all have a peak at 100 % of max (Treister and Roederer, 2015). This normalisation allows the fluorescence intensity and distribution of cell percentage across this intensity, for each sample, to be easily compared. The median and percentage robust coefficient of variance (% rCV) were calculated using the FlowJo analysis software. The median is the relative intensity value below which 50 % of the events are found; i.e., it is the 50th percentile. In general, the median is a more robust estimator of the central tendency of a population than the mean.

The %rCV = 100 * 1/2( lntensity[at 84.13 percentile] - Intensity [at 15.87 percentile] ) / Median. The robust CV is not as skewed by outlying values as the CV.

The flow cytometry results were subjected to statistical analysis, see the section on Statistical analysis below. 5.22 Immunogold labelling and transmission electron microscopy

C. difficile and C. sordellii cultures were grown O/N to OD600 0.5 and 1 5ml was removed, washed in 0.1 M PBS and fixed in 1 ml 4 % paraformaldehyde (PFA) at RT. The cells were washed 3 x PBS and to quench the remaining PFA, and the pellet was resuspended in 1 ml of 20 mM NH4CI2 for 15 min. The cells were pelleted and again washed 3 x PBS. The pellet from each tube was resuspended in 200 mI H20 and immediately 5 mI of cell suspension was added to on 200 mesh, carbon -coated, plasma etched grid for 5 min before excess liquid was removed with filter paper, by touching edge for 10 s. Grids were then rinse in 10 mI PBS 3 x 5 min before blocking with 10 mI normal goat serum 1 :10 in PBS, 1 % BSA for 30 min. Rinse again with 10 mI PBS 3 x 5 min before incubating with 10 mI C. difficile mAb, diluted 1 :25 in PBS, 1 % BSA for 1 h, RT. Grids were rinsed in 10 mI PBS 3 x 5 min before adding 10 mI anti-mouse IgG, 9-1 1 nm gold conjugated (Sigma), diluted 1 :20 in PBS, 1 % BSA and incubating for 1 h at RT. Rinse grids 4 x 5 min with PBS and then 5 x 5 min with H20, allow grids to air dry and negatively stain with 1 .5 % phosphotungstic acid. The grids were viewed using a Philips CM100 TEM with

Compustage and high resolution digital image capture, at varying magnifications.

5.23 Dot Blot Dots were marked on to Amersham hybond PVDF blotting membrane (GE Healthcare) in pencil, to mark where to add the analyte. The membrane was activated upon submersion in methanol for 15 s and equilibration in transfer buffer (20 mM Tris, 192 mM glycine, 0.1 % SDS, 20 % methanol). Either serial dilutions of whole cells or low-pH glycine extracted SLPs were added in 6— 10 mI dots and left to dry for a minimum of 2 h. The membrane was blocked in with blocking buffer (0.1 M PBS, 5 % non-fat milk powder and 0.05 % tween-20) for 1 h. The membrane was then incubated at RT for 45 min with the C. difficile mAbs, at 2.5 - 10 mg/ml, diluted in blocking buffer. The membrane was then washed with 3 x PBS-T for 5 min each. The membrane was then incubated at RT for 30 min with peroxidase-conjugated goat anti-mouse IgG (Fc specific) (Sigma), diluted 1 :120,000 in blocking buffer. The membrane was washed for 15 min with PBS-T and then twice for 5 min with PBS only. For visualisation of antibody binding, the membrane was treated with the Enhanced Chemiluminescence (ECL) kit from Amersham, GE Healthcare, as per manufacturer’s instructions. The positive signals were viewed using an ImageQuant LAS4000mini biomolecular imager (GE Healthcare) and processed with the accompanying software and ImageJ. 5.24 Size exclusion chromatography to purify the SLP-complex

The SLPs from C. difficile 630 were extracted using the low-pH glycine technique {Calabi, 2001 #79}. The LMW/HMW SLP complex was purified from the SLPs using a

Superdex200 HiLoad 16/600 size exclusion column (GE Healthcare) and an Akta Prime+ system (GE Healthcare). All solutions were filtered (0.45 mm) and degassed. The column was washed with 1 .5 x volume H20 prior to equilibration with 1 .5 x volume 10 mM HEPES pH 7.5, 150 mM NaCI. The flow rate used was 1 ml/min with fractions of 1 ml or 2 ml collected and analysed by SDS-PAGE for protein content and purity and then BCA assay for concentration.

5.25 Microscale thermophoresis (MST)

MST was used to analyse the interactions of the mAbs and the purified C. difficile 630 LMW/HMW SLP complex. The protocol was carried out as per manufacturer’s instructions and as described in (Jerabek-Willemsen et al., 201 1 ) using a Monolith NT.1 15TM series MST machine.

The purified SLP complex was fluorescently tagged, as per manufacturer’s (Nanotemper) instructions, using the amine reactive dye (NT-647 N-hydroxysuccinimide (NHS)). Before beginning the experiment, the concentration of fluorescent protein, LED power and capillary coating (standard, hydrophobic, hydrophilic, and premium) was optimised to provide the required 200-1500 fluorescent units. The LED power used was 90 % and the capillary coating was standard. The unlabelled mAb was serially diluted 1 :1 , 16 times, in 0.1 M PBS with 0.05 % Tween, to a total of 10 mI, before 10 mI of fluorescent dye was added, taking into account the dilution effect of combining the labelled and un labelled proteins. An initial 'Cap scan’ was completed to measure the fluorescence of each sample and determine any anomalous samples. Experiments were performed using a Monolith NT.1 15TM series, MST machine and the resulting temperature jump and subsequent thermophoresis data was used to trace unlabelled ligand concentration against normalised fluorescence trace (FNorm). The dissociation constant (Kd) was estimated using the Nanotemper Analysis software.

5.26 Gold conjugation of IgG

The antibody was diluted to 15 mg/ml in 5mM TES buffer, 1 % SDS (w/v), 5 mM EDTA and 10 mM Tris-HCI, pH 7.4. A 1 ml aliquot of 20nm (BBI solutions) was centrifuged for 20 min at 13,000 rpm. The supernatant was removed and the gold pellet was resuspended in 1 ml of the pre-prepared antibody solution and incubated at RT for 2 h before adding 100 mI 200 mg/ml BSA in dH20, vortexed and incubated for a 1 .5 h. The sample was then centrifuged for 20 min at 13,000 rpm. The supernatant was removed and the pellet resuspended in X ml PBS, pH 7.4 with 0.05 % tween (v/v) and 2 % BSA (w/v) until and OD280 of around 5 was achieved.

6. Hybridoma Sequencing

6.1 Hybridoma details

6.2. Hybridoma sequencing Hybridoma sequencing was performed by one of two proprietary methods. Brief details are given below. In both RNA and mRNA was extracted and reverse transcription performed to obtain cDNA for the antibody heavy and light chains.

6.2.1 Hybridoma Sequencing Materials and Methods

6.2.1.1 V-region PCR

The variable heavy and variable light chains were amplified using degenerate forward primers that bound either in the signal peptide or framework region 1 and a reverse primer that bound in the antibody constant region. The amplified genes were cloned and sequenced following a standard approach.

6.2.1.2 5’ RACE

cDNA was generated by reverse transcription and a homopolymeric tail added to the 3’ end of the cDNA. The antibody variable domain genes were then amplified using gene specific primers followed by a standard cloning and sequencing approach.

6.2.1.3 DNA sequencing and analysis

DNA was sequenced by conventional Sanger sequencing and data analysed using DNASTAR Lasergene software. Signal peptide and variable domain sequences were identified by comparison with known sequences in the IMGT database.

6.3 Variable heavy domain sequencing

Alignment of the DNA sequence of the start of the CH1 domain with appropriate germ line sequences confirms that the antibody has a mouse lgG2B heavy chain. A BLAST search of the DNA sequence of the identified VH domain shows that the identified sequence is novel. However, the variable domain has a stop codon (TAG) at the start. This sequence has been isolated from 20 individual clones with the same stop codon identified every time.

If the nucleotide sequence started CAG rather than TAG this would give a start amino acid sequence of QVQ, which is highly common for VH domains. It is therefore anticipated that the gene that has been identified is a non-functional duplicate of the original and still fully functional VH gene. It would appear that the version of the gene that has been sequenced is highly abundant at the mRNA level making identification of a full functional gene sequence challenging.

6.4 Variable light domain sequencing

The light chain gene for CD521 was successfully isolated and sequenced by V-Region PCR. See figure 2 in the appendix section for the sequencing chromatogram. Alignment of the DNA sequence of the start of the CL domain with appropriate germ line sequences confirms that the antibody has a mouse Kappa light chain. A BLAST search of the DNA sequence of the identified VL domain shows that the identified sequence is novel. Analysis of the protein sequence of the identified VL domain is consistent with that expected for a functional light chain.

6.5 Proteomic analysis of the heavy chain complementarity determining region of 521 antibody

Protein samples for Ab521 were obtained from SDS-Page gel slices, followed by Lys and Arg tryptic digest to generate peptides for Mass Spectrometry analysis. The 1 13 aa sequence of the variable heavy domain was used as a reference data set to the peptides genearted and matches were identifed.

6.5.1 Sequence coverage of the antibody

The sequence coverage obtained in a tryptic digest of the antibody sample is outlined in Figure 34. This is the mass spec data generated on antibody 521 . The data is complementary to DNA sequencing. This data was generated so we can be confident in the sequences that have been obtained from DNA sequencing runs on ab521 .The spurious stop codon can’t practically be“real” in the ab521 clone as we produce fully functional antibody that displays the intended interaction with SLPA. The mass spec tryptic digest data quite clearly identifies the n-terminal heavy chain CDRs as matching the DNA sequencing with 100 % accuracy. This level of additional mass spec data confirms the DNA sequencing results are accurate, with the exception of the stop codon. The DNA sequencing must be a non functional duplicate, at the mRNA level, which although it contains a spurious stop matches the mass spec data with 100 % accuracy at the N- termianl. The combined DNA sequencing and tryptic digest mass spec data allow confidence that the six CDR sequences are correctly assigned.

References