FITZ-CLARENCE, Halina (Department of Medicine, University College London Gower Street, London Greater London WC1E 6BT, GB)
THOMAS, Mark (Department of Biology, University College London Wolfson Hous, 4 Stephenson Way London Greater London NW1 2HE, GB)
CHAMBERLAIN, John (Department of Medicine, University College London Gower Street, London Greater London WC1E 6BT, GB)
FITZ-CLARENCE, Halina (Department of Medicine, University College London Gower Street, London Greater London WC1E 6BT, GB)
THOMAS, Mark (Department of Biology, University College London Wolfson Hous, 4 Stephenson Way London Greater London NW1 2HE, GB)
| Claims :
1. A method of identifying an individual having a bone disorder which is responsive to bisphosphonate, or predicting the responsiveness of an individual with a bone disorder to treatment with a bisphosphonate, the method comprising: determining in a nucleic acid sample obtained from the individual, the presence or absence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene, the presence of a variant allele at the one or more sites being indicative that the individual is responsive to bisphosphonates .
2. A method according to claim 1 wherein the one or more sites of polymorphism are single nucleotide polymorphisms.
3. A method according to claim 1 or claim 2 wherein the presence or absence of a variant allele is determined at one or more sites of polymorphism in the genomic region between nucleotides 151983001 and 152252001 of chromosome 1.
4. A method according to claim 3 wherein the one or more sites of polymorphism are single nucleotide polymorphisms shown in Table 3.
5. A method according to claim 4 wherein the one or more sites of polymorphism are single nucleotide polymorphisms shown in Table 4.
6. A method according to any one of claims 1 to 5 wherein the one or more sites of polymorphism are in the farnesyl diphosphate synthase (FDPS) gene.
7. A method according to claim 6 wherein the one or more sites of polymorphism are shown in Table 1.
8. A method according to any one of the preceding claims wherein the presence or absence of a variant allele at SNP rs2297480 or a variant allele in linkage disequilibrium therewith is determined.
9. A method according to claim 8 wherein the presence or absence of a T at SNP rs2297480 is determined.
10. A method according to claim 9 wherein the presence of a T at SNP rs2297480 is indicative that the individual is responsiveness to bisphosphonate .
11. A method according to claim 9 wherein the presence or absence of a T at SNP rs2297480 in both copies of the FDPS gene of said individual is determined.
12. A method according to claim 11 wherein the presence of a TT genotype at SNP rs2297480 is indicative that the individual is responsiveness to bisphosphonate.
13. A method according to any one of the preceding claims wherein the presence of a variant allele at the one or more sites of polymorphism is determined by amplification of all or part of the genomic region of the farnesyl diphosphate synthase (FDPS) gene.
14. A method according to any one of the preceding claims wherein the presence of a variant allele at the one or more sites of polymorphism is determined by sequencing all or part of the genomic region of the farnesyl diphosphate synthase (FDPS) gene or an amplified portion thereof.
15. A method according to any one of claims 1 to 12 wherein the presence of a variant allele at the one or more sites of polymorphism is determined by hybridisation of an allele specific probe to the genomic region of the farnesyl diphosphate synthase (FDPS) gene or an amplified portion thereof.
16. A method according to any one of the preceding claims wherein the bone disorder is osteoporosis, glucocorticoid induced osteoporosis, glucocorticoid-induced osteoporosis, osteitis deformans ("Paget's disease of bone"), bone metastasis (with or without hypercalcemia) , multiple myeloma or increased risk of bone fracture independent of osteoporosis .
17. A method according to any one of the preceding claims wherein the bisphosphonate is selected from the group consisting of alendronate, clodronate, ibandronate, pamidronate, risedronate and zoledronate.
18. Use of bisphosphonate in the manufacture of a medicament for use in the treatment of an individual having a bone disorder, wherein said individual has a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene.
19. Use according to claim 18 wherein the individual has a variant allele at SNP rs2297480 or a variant allele which is in linkage disequilibrium with a variant allele at SNP rs2297480.
20. Use according to claim 19 wherein the individual has a T allele at SNP rs2297480 or a variant allele in which is linkage disequilibrium with a T allele at SNP rs2297480.
21. Use according to claim 20 wherein the individual has the TT genotype at SNP rs2297480.
22. Use according to any one of claims 18 to 21 wherein the treatment comprises determining the presence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene in said individual.
23. Use according to any one of claims 18 to 22 wherein the bone disorder is osteoporosis, glucocorticoid induced osteoporosis, glucocorticoid-induced osteoporosis, osteitis deformans ("Paget 1 S disease of bone"), bone metastasis (with or without hypercalcemia), multiple myeloma or increased risk of bone fracture independent of osteoporosis .
24. Use according to any one of claims 18 to 23 wherein the bisphosphonate is selected from the group consisting of alendronate, clodronate, ibandronate, pamidronate, risedronate and zoledronate.
25. A method of treatment of a bone disorder in an individual having a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene, the method comprising: administering a bisphosphonate to an individual in need thereof .
26. A method according to claim 25 wherein the individual has a variant allele at SNP rs2297480 or a variant allele in which is linkage disequilibrium with a variant allele at SNP rs2297480.
27. A method according to claim 26 wherein the individual has a T allele at SNP rs2297480 or a variant allele in which is linkage disequilibrium with a T allele at SNP rs2297480.
28. A method according to claim 27 wherein the individual has the TT genotype at SNP rs2297480.
29 A method according to any one of claims 25 wherein the treatment comprises determining the presence of a variant allele at one or more sites of polymorphism in the genomic region of the FDPS gene in said individual .
30. A method according to any one of claims 25 to 29 wherein the bone disorder is osteoporosis, glucocorticoid induced osteoporosis, glucocorticoid-induced osteoporosis, osteitis deformans ( "Paget 's disease of bone") , bone metastasis (with or without hypercalcemia) , multiple myeloma or increased risk of bone fracture independent of osteoporosis .
31. A method according to any any one of claims 25 to 30 wherein the bisphosphonate is selected from the group consisting of alendronate, clodronate, ibandronate, pamidronate, risedronate and zoledronate.
32. A method of identifying a cohort of individuals for use in testing candidate compounds for the treatment of bone disorders comprising, identifying a population of individuals having a bone disorder, determining, in a genomic sample obtained from each of the individuals in said population, the presence or absence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene, and, identifying a cohort of individuals within the population who have a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene.
33. A method according to claim 32 comprising administering a candidate compound to the cohort of individuals and determining the effect of the compound on the individuals.
34. A method of identifying a compound useful in the treatment of a bone disorder comprising; treating a population of individuals having a bone disorder with a candidate compound, determining in a genomic sample obtained from each of the individuals in said population, the presence or absence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene identifying a cohort of individuals within the population who have a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene, determining the responsiveness of the individuals in said cohort to the candidate compound.
35. A method of identifying an allelic variant which is associated with the responsiveness of a bone disorder to bisphosphonate comprising; providing a population of patients having a bone disorder and undergoing treatment with bisphosphonate, identifying a first cohort of patients in said population who are responsive to bisphosphonate and a second cohort who are unresponsive to bisphosphonate, determining the presence of allelic variants in the genomic region of the farnesyl diphosphate synthase (FDPS) gene in said first and second cohorts, wherein allelic variants present or occurring predominantly in the first but not the second cohort are candidate variants for association with response to bisphosphonate.
36. A kit for identifying an individual having a bone disorder which is responsive to bisphosphonate comprising: reagents for determining the presence or absence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene in a genomic sample obtained from the individual , wherein the presence of a variant allele at the one or more sites being indicative that the individual is responsive to bisphosphonate treatment . |
Biomarkers for Bisphosphonate-Responsive Bone Disorders
This invention relates to biomarkers useful in predicting whether an individual having a bone disorder such as osteoporosis is likely to be responsive to treatment with bisphosphonate drugs.
Bone disorders, such as osteoporosis, result in a decrease in bone mass and bone density and/or an increased risk and/or incidence of fracture. Oral bisphosphonates are the commonest first-choice treatment where a reduction in osteoclasis would be beneficial, for example, for post-menopausal osteoporosis - a common condition affecting one third of post-menopausal women in the UK. There are estimated to be 1 million cases of osteoporosis in the UK, with 70000 hip, 120000 vertebral and 50000 wrist fractures yearly. In the US, up to 10 million patients have been suggested to be suffering from osteoporosis with around 1.5 million associated fragility fractures yearly. As the population demographic in industrialised societies ages the number of such fragility fractures is expected to increase threefold (Osteoporosis Int 1992; 2:285-289).
The total world market for drugs for treating bone disorders surpassed an estimated £2.76 billion in 2002 and is projected to exceed £6.35 billion by 2006. Bisphosphonates command the majority share of this market and are widely reimbursed on the basis of a favourable pharmaco-economic profile for fracture prevention. Yet around 40% of individuals treated with bisphosphonates do not fully respond to the drug. This represents a major value deficit both in terms of evident cost and adverse event associated morbidity (Gastro-intestinal intolerance, hypersensitivity reactions, headache, musculo-skeletal pain) . Such considerations impose significant limitations on the use of such bisphosphonates in the primary care market .
The present inventors have shown that polymorphism in and around the coding region of the farnesyl diphosphate synthase (FDPS) gene is
predictive of the densitometric response of patients subsequent to commencing treatment with amino-bisphosphonates .
An aspect of the inventon provides a method of identifying an individual having a bone disorder which is responsive or likely to be responsive to bisphosphonate, or predicting the responsiveness of an individual with a bone disorder to treatment with a bisphosphonate, the method comprising: determining in a nucleic acid sample obtained from the individual, the presence or absence of a variant allele at one or more sites of polymorphism in the region of the FDPS gene, the presence of a variant allele at the one or more sites being indicative that the individual is responsive to bisphosphonates .
Farnesyl diphosphate synthase (FDPS) (EC 2.5.1.10) catalyzes the formation of both geranyl diphosphate and isopentenyl diphosphate from diphosphate and trans, trans-farnesyl diphosphate in the • isoprene biosynthetic pathway. The human FDPS protein sequence has the database entry NP_001995.1 GI: 4503685. The nucleic acid sequence encoding human FDPS has the database entry NM_002004.2 GI: 41281370. The human FDPS gene is located at Iq22 and has the gene reference GenelD: 2224 and the locus tags: HGNC: 3631 and MIM 134629. The sequence of the human FDPS gene is set out between bases 5769105-5780811 of the contig sequence gi| 51458934 NT_004487.17 and between bases 5385993-5397702 of the contig sequence gi| 51460383 NT_086596.1 (positions 152092649 and 152103528 on chromosome 1).
The presence of a variant allele at the one or more sites is predictive that the individual is responsive, to bisphosphonate treatment. The variant allele may alter (i.e. reduce or increase) FDPS expression or activity in the individual relative to the wild- type allele, or may be in linkage disequilibrium with a variant allele which alters FDPS expression or activity in the individual.
A site of polymorphism may be in FDPS gene locus or in the genomic region surrounding the FDPS gene, for example in the region between positions 151983001 and 152252001 of chromosome 1. The presence of variant alleles may be determined at one, two, three, four or five or more sites of polymorphism within this region. For example, a site of polymorphism may be a SNP shown in Table 3, or, more preferably, a SNP shown in Table 4.
A site of polymorphism may be in the FDPS gene, for example in the coding region of the FDPS gene or in a non-coding region of the FDPS gene, such as an upstream (5'), intronic or downstream (3') region. The presence of variant alleles may be determined at one, two, three, four or five or more sites of polymorphism. For example, a site of polymorphism may be a SNP as shown in Table 1.
Variant alleles may include deletions, insertions or substitutions of one or more nucleotides, for example relative to a reference nucleotide sequence (e.g. the sequence of the FDPS genomic region which is set out in gi | 51458934 NT_004487.17 or gi | 51460383 NT_086596.1) . For example a variant allele may be an allele of a single nucleotide polymorphism (SNP) , small insertion/deletion polymorphism or variable number tandem repeat (VNTR) . Preferably, the variant allele is an allele of a single nucleotide polymorphism. Examples of sites of single nucleotide polymorphism at which a variant allele may be present are shown in Tables 1, 3 and 4.
Methods of the invention may comprise determining, in the sample of nucleic acid obtained from the individual, the presence or absence of a variant allele (for example A, T, G, or C) at a site of polymorphism in the genomic region of the FDPS gene, such as a SNP. More preferably, the presence or absence of the variant allele at the site may be determined in both copies of the region in the genome of the individual . The presence of the variant allele at the site in one or both copies of the genomic region of the FDPS gene
may be indicative that the individual has a bone disorder which is responsive to treatment with bisphosphonate.
In some preferred embodiments, the presence or absence of a variant allele, such as a T residue, at dbSNP refSNP ID: NCBI | rs2297480 or a variant allele which shows linkage disequilibrium therewith, may be determined.
refSNP ID: NCBI | rs2297480 is located 91 base pairs upstream of intron 1 of the FDPS gene (position 5769837 in contig gi| 51458934 NT_004487.17) or 5386725 in contig gi| 51460383 NT_086596 and consists of a G/T polymorphism (note that NCBI dbSNP refers to the complementary strand A/C) . NCBI | rs2297480 and its flanking sequences are shown in Table 2.
A variant allele which shows linkage disequilibrium with a variant allele at NCBI | rs2297480, for example a T allele, may be an allele at a site of polymorphism in proximity to NCBI | rs2297480 in the FDPS genetic sequence. For example, the presence of an allelic variant may be determined at one or more sites of polymorphism selected from the group consisting of NCBI | rsl6836819 , NCBI | rsll556436, NCBl|rsll264358 and NCBI | rsl2129895 or other SNP shown in Table 1, or an allelic variant may be determined at one or more sites of polymorphism shown in Table 4 or Table 3.
A method described herein may comprise determining the presence or absence of a T at SNP rs2297480 in the genomic nucleic acid sample obtained from the individual. More preferably, the presence or absence of a T at SNP rs2297480 may be determined in both copies of the FDPS gene in the genome of the individual. The presence of a T residue at SNP rs2297480 in both copies of the FDPS gene (i.e. a TT genotype at rs2297480) is indicative that the individual has a bone disorder which is responsive to treatment with bisphosphonate.
The sample obtained from the individual may be any sample which comprises nucleic acid, preferably genomic nucleic acid, for example
a tissue or cell sample, such as a biopsy, or a biological fluid sample, such as a blood sample or a swab.
The presence of a variant allele at one or more sites of polymorphism in the genomic region of the FDPS gene (i.e. the genotype of the individual) may be determined by detecting the presence of a FDPS nucleic acid sequence which comprises the one or more variant alleles in a nucleic acid sample obtained from an individual .
The presence of a variant allele at the one or more sites of polymorphism may be determined by any convenient technique, including amplification of all or part of the genomic region of the FDPS gene, including the FDPS gene itself, sequencing all or part of the genomic region of the FDPS gene, including the FDPS gene itself, and/or hybridisation of a probe which is specific for a variant allele.
A specific amplification reaction such as PCR using one or more pairs of primers may conveniently be employed to amplify all or part of the genomic region of the FDPS gene, including the FDPS gene itself, for example, the portion of the sequence containing or suspected of containing the one or more sites of polymorphism.
In some embodiments, the amplification may be allelic variant specific, such that the presence or absence of amplification product is indicative of the presence of a variation in the FDPS gene of the individual. In other embodiments, the amplified nucleic acid may be sequenced as above, and/or tested in any other way to determine the presence or absence of an allelic variant at the one or more sites of polymorphism.
Suitable amplification reactions include the polymerase chain reaction (PCR) . PCR comprises repeated cycles of denaturation of template nucleic acid, annealing of primers to template, and
elongation of the primers along the template. PCR is well-known in the art and is described for example in "PCR protocols; A Guide to Methods and Applications", Eds. Innis et al, 1990, Academic Press, New York, Mullis et al, Cold Spring Harbor Symp. Quant. Biol., 51:263, (1987), Ehrlich (ed) , PCR technology, Stockton Press, NY, 1989, and Ehrlich et al, Science, 252:1643-1650, (1991)). The number of cycles, the respective conditions of the individual steps, the composition of reagents within the reaction tube, or any other parameter of the reaction set-up may be varied or adjusted by the skilled person, depending on the circumstances. Additional steps (such as initial denaturing, hot-start, touchdown, enzyme time release PCR, replicative PCR) may also be employed.
Numerous variations and modifications of PCR are known in the art and may be employed by the skilled person in performing the present methods. Chemicals, kits, materials and reagents are commercially available to perform PCR reactions.
Other specific nucleic acid amplification techniques include strand displacement activation, the QB replicase system, the repair chain reaction, the ligase chain reaction, ligation activated transcription, SDA (strand displacement amplification) and TMA (transcription mediated amplification) . For convenience, and because it is generally preferred, the term PCR is used herein in contexts where other nucleic acid amplification techniques may be applied by those skilled in the art. Unless the context requires otherwise, reference to PCR should be taken to cover use of any suitable nucleic amplification reaction available in the art.
In some embodiments, the binding of a probe to genomic nucleic acid in the sample, or amplification products thereof, may be determined. The probe may comprise a nucleotide sequence which binds specifically to a nucleic acid sequence which contains a variant allele at one or more sites of polymorphism and does not bind specifically to the nucleic acid sequence which does not contain the
variant allele at the one or more polymorphic sites. For example, the probe may bind specifically to the nucleic acid sequence of Table 2 which contains a T at SNP rs2297480 and not bind to the nucleic acid sequence of Table 2 which contains a G at SNP rs2297480. The oligonucleotide probe may comprise a label and binding of the probe may be determined by detecting the presence of the label.
One or more (e.g. two) oligonucleotide probes or primers may be hybridised to the FDPS gene in the sample nucleic acid.
Hybridisation will generally be preceded by denaturation to produce single-stranded DNA. The hybridisation may be part of amplification procedure such as PCR, or may be part of a probing procedure not involving amplification. An example procedure would be a combination of PCR and low stringency hybridisation.
Binding of a probe to target nucleic acid (e.g. DNA) may be measured using any of a variety of techniques at the disposal of those skilled in the art. For instance, probes may be radioactively, fluorescently or enzymatically labelled. Other methods not employing labelling of probe include examination of restriction fragment length polymorphisms, amplification using PCR, RN'ase cleavage and allele specifi'c oligonucleotide probing. Probing may employ the standard Southern blotting technique. For instance, DNA may be extracted from cells and digested with different restriction enzymes . Restriction fragments may then be separated by electrophoresis on an agarose gel, before denaturation and transfer to a nitrocellulose filter. Labelled probe may be hybridised to the DNA fragments on the filter and binding determined.
Those skilled in the art are well-able to employ suitable conditions of the desired stringency for selective hybridisation, taking into account factors such as oligonucleotide length and base composition, temperature and so on. Suitable selective hybridisation conditions for oligonucleotides of 17 to 30 bases include hybridization
overnight at 42°C in 6X SSC and washing in 6X SSC at a series of increasing temperatures from 42°C to 65°C.
Other suitable conditions and protocols are described in Molecular Cloning: a Laboratory Manual: 3rd edition, Sambrook & Russell (2001) Cold Spring Harbor Laboratory Press NY and Current Protocols in Molecular Biology, Ausubel et al . eds . John Wiley & Sons (1992).
In some embodiments, genomic nucleic acid may be analysed using a nucleic acid array.
A nucleic acid array comprises a population of nucleic acid sequences immobilised on a support. Each sequence in the population has a particular defined position on the support. Nucleic acid arrays are well known in the art and may be produced in a number of ways. For example, the nucleic acid sequence may be amplified using the polymerase chain reaction from a cell or library of sequences, or synthesized ex situ using an oligonucleotide synthesis device, and subsequently deposited using a microarraying apparatus. Alternatively, the nucleic acid sequence may be synthesized in situ on the microarray using a method such as piezoelectric deposition of nucleotides .
The number of sequences deposited on the array generally may vary upwards from a minimum of at least 10,100, 1000, or 10,000 to between 10,000 and several million depending on the technology employed.
In some embodiments, the nucleic acid array is a genomic array comprising a population of genomic sequences from an individual having a bone disorder. In particular, a genomic tiling path array that covers the FDPS gene locus may be employed. In a tiling array, every immobilised nucleic acid, typically each the same size, corresponds to a specific genomic region, with different immobilised nucleic acids containing nucleotide sequences corresponding to shifts of one or more nucleotides relative to each other along the
genomic region. For example, a tiling array may be designed such that each nucleic acid from a stretch of genomic sequence that is on the array differs from its adjacent nucleic acid by a shift of a single base pair, so that a series of nucleic acids will represent a moving window across the stretch of genomic sequence. Thus, an array- may comprise overlapping immobilised nucleic acid sequences with as little as one nucleotide shifts and as large as the entire size of the nucleic acid, as well as non-overlapping nucleic acids.
Genomic sequences immobilised on an array may be hybridised with a labelled oligonucleotide probe using standard techniques.
In other embodiments, the nucleic acid array may comprise a population of oligonucleotide sequences which correspond to variant alleles at sites of polymorphism in the genome, in particular oligonucleotide sequences which correspond to allelic variants at sites of polymorphism in the FDPS gene locus. The immobilised oligonucleotide probes may then be hybridised with labelled genomic nucleic acid, for example restriction fragments or amplification products, comprising the all or part of the FDPS gene locus from an individual with a bone disorder.
The nucleic acid sequences on the array to which a labelled probe or nucleic acid hybridises may be determined, for example by measuring and recording the label intensity at each position in the array, for example, using an automated DNA microarray reader.
These sequences correspond to the sequence which is present at the site of polymorphism in the individual, and allow the presence of the allelic variant at the site of polymorphism to be determined.
Nucleic acid or an amplified region thereof may be sequenced to identify or determine the presence of an allelic variant at one or more sites of polymorphism in the genomic region of the FDPS gene. An allelic variant may be identified by comparing the sequence obtained with a reference genomic sequence, as described above.
Sequencing may be performed using any one of a range of standard techniques. Sequencing of an amplified product may, for example, involve precipitation with isopropanol, resuspension and sequencing using a TaqFSí Dye terminator sequencing kit. Extension products may be electrophoresed on an ABI 377 DNA sequencer and data analysed using Sequence Navigator software.
Having sequenced nucleic acid of an individual or sample, the sequence information can be retained and subsequently searched without recourse to the original nucleic acid itself. Thus, for example, scanning a database of sequence information using sequence analysis software may identify a sequence alteration or mutation.
A bone disorder as described herein is a condition associated with demineralisation or loss of bone density and/or bone quality, including, for example, osteoporosis, glucocorticoid induced osteoporosis, osteitis deformans ("Paget's disease of bone"), bone metastasis (with or without hypercalcemia) , multiple myeloma and risk of bone fracture in an individual which is independent of a diagnosis of osteoporosis.
In some preferred embodiments, the bone disorder is osteoporosis, which is a metabolic bone disease characterized by low bone mass and microarchitectural deterioration of bony tissue leading to enhanced bone fragility and a consequent increase in fracture risk. Osteoporosis may be associated with aging, particularly in postmenopausal women, and also certain conditions such as paralysis, or prolonged use of corticosteroids and other drugs.
Bone disorders such as osteoporosis may be generally diagnosed clinically by measurement of bone mineral density (BMD) using dual x-ray absorptiometry (DXA) . BMD (g/cm 2 ) is generally described in terms of the number of standard deviations (SDs) from the young normal mean (T score) . For example, a T score of less than -1.0 is
generally defined as osteopenic and a T score of less than -2.5 is generally defined as osteoporotic. An individual having a bone disorder as described herein may have a T score of less than -1.0, less than -1.5, less then -2 or less than -2.5.
The methods described herein may be useful in predicting the responsiveness of an individual with a bone disorder such as osteoporosis to treatment with a bisphosphonate. Individuals with a high probability of a positive response to treatment with a bisphosphonate may be identified. A positive response may include stabilised or increased bone density or a reduced rate of decrease in bone density. Individuals identified as responsive to bisphosphonates may be treated with a bisphosphonate i.e. bisphosphonate may be administered to an individual identified by the present methods as responsive.
The methods described herein may also be useful to identify individuals with a low probability of a positive response i.e. individuals who are unlikely to respond to treatment with bisphosphonates. Individuals identified as non-responsive to bisphosphonates may not be treated with bisphosphonate, thereby avoiding unnecessary risk of suffering side-effects associated with such treatment, and may undergo a course of treatment with other anti-osteoporosis therapies, for example anabolic agents such as teriparatide and strontium.
Bisphosphonates (also called: diphosphonates) are a class of pyrophosphate analogues that inhibit the resorption of bone and are commonly used in the prevention and treatment of bone disorders characterised by bone fragility, such as osteoporosis, osteitis deformans ("Paget's disease of bone"), bone metastasis (with or without hypercalcemia), and multiple myeloma. Examples of bisphosphonates currently in use as pharmaceuticals include alendronate, clodronate, ibandronate, pamidronate, risedronate and zoledronate.
The methods described herein may also be useful in the selection of patients for clinical trials of candidate compounds for the treatment of bone disorders, for example anti-resorptive and/or anabolic agents for bone turnover.
A method of identifying a cohort of individuals for use in testing candidate anti-resorptive and/or bone anabolic compounds, for example compounds useful in the treatment of bone disorders, may comprise, identifying a population of individuals having a bone disorder, determining, in a genomic sample obtained from each of the individuals in said population, the presence or absence of a variant allele at one or more sites of polymorphism in the region of the farnesyl diphosphate synthase (FDPS) gene as described herein, identifying a cohort of individuals within the population who have a variant allele at one or more sites of polymorphism in the region of the farnesyl diphosphate synthase (FDPS) gene.
The identified cohort may be useful in testing candidate anti- resorptive and/or bone anabolic agent, including pyrophosphate analogues such as bisphosphonates . For example, a candidate compound may be administered to the cohort of individuals and the effect of the compound on the individuals determined.
The presence of a beneficial effect on the cohort of individuals may be indicative that the compound is useful in treating individuals having a bone disorder who have a variant allele at one or more sites of polymorphism in the FDPS gene .
The methods described herein may also be useful in the analysis and stratification of the results of clinical trials of compounds for the treatment of bone disorders, for example anti-resorptive and/or anabolic agents for bone turnover.
Another aspect of the invention provides a method of identifying an anti-resorptive and/or bone anabolic compound, which may, for example be useful in the treatment of a bone disorder, comprising; treating a population of individuals with a candidate anti- resorptive and/or bone anabolic compound, determining in a genomic sample obtained from each of the individuals in said population, the presence or absence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene as described herein, identifying a cohort of individuals within the population who have a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene, determining the responsiveness of the individuals in said cohort to the candidate compound.
Another aspect of the invention provides a method of identifying an allelic variant which is associated with the responsiveness of a bone disorder to bisphosphonate comprising; providing a population of patients having a bone disorder and undergoing treatment with bisphosphonate, identifying a first cohort of patients in said population who are responsive to bisphosphonate and a second cohort who are unresponsive to bisphosphonate, determining the presence of allelic variants in the genomic region of the FDPS gene in said first and second cohorts as described herein, wherein allelic variants present or occurring predominantly in the first but not the second cohort are candidate variants for association with response to bisphosphonate.
A allelic variant may be at a site of polymorphism in the FDPS gene, for example a SNP shown in Table 1, or at a site of polymorphism in the genomic region surrounding the FDPS gene, for example a SNP shown in Table 3 or more preferably a SNP shown in Table 4.
Other aspects of the invention relate to the treatment of bone disorders in individuals having a variant allele at one or more sites of polymorphism in the FDPS gene.
A method of treatment of a bone disorder in an individual having a variant allele at one or more sites of polymorphism in the genomic region of the FDPS gene may comprise : administering a bisphosphonate to an individual in need thereof .
A bisphosphonate may be used in the manufacture of a medicament for use in the treatment of an individual having a bone disorder, wherein said individual has a variant allele at one or more sites of polymorphism in the genomic region of the FDPS gene.
A bisphosphonate may be used in the treatment of an individual having a bone disorder, wherein said individual has a variant allele at one or more sites of polymorphism in the genomic region of the FDPS gene.
Suitable variant alleles are described in more detail above.
Preferably, the individual has a variant allele at SNP rs2297480, such as a T allele, or a variant allele in linkage disequilibrium therewith. In some embodiments, the individual may have a TT genotype at SNP rs2297480.
Treatment of a bone disorder may comprise determining the presence of a variant allele at one or more sites of polymorphism in the the genomic region of the FDPS gene in said individual. In other words, the genotype of the individual at the one or more sites of polymorphism may be determined. Techniques for determining the presence of a variant allele are described above.
Bone disorders and suitable bisphosphonates are also described in more detail above.
While it is possible for the bisphosphonate to be administered alone, it is preferable to present it as a pharmaceutical composition (e.g., formulation) comprising bisphosphonate, together with one or more pharmaceutically acceptable carriers, adjuvants, excipients, diluents, fillers, buffers, stabilisers, preservatives, lubricants, or other materials well known to those skilled in the art and optionally other therapeutic or prophylactic agents.
Pharmaceutical compositions comprising bisphosphonate, for example bisphosphonate admixed together with one or more pharmaceutically acceptable carriers, excipients, buffers, adjuvants, stabilisers, or other materials, as described herein, may be used in the methods described herein. Suitable pharmaceutical compositions comprising bisphosphonate are well known in the art .
The term "pharmaceutically acceptable" as used herein pertains to compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgement, suitable for use in contact with the tissues of a subject (e.g., human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. Each carrier, excipient, etc. must also be "acceptable" in the sense of being compatible with the other ingredients of the formulation.
Suitable carriers, excipients, etc. can be found in standard pharmaceutical texts, for example, Remington's Pharmaceutical Sciences, 18th edition, Mack Publishing Company, Easton, Pa., 1990.
The formulations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the art of pharmacy. Such methods include the step of bringing the active compound into association with a carrier which may constitute one or more accessory ingredients. In general, the formulations are prepared by uniformly and intimately bringing into association the
active compound with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
Formulations may be in the form of liquids, solutions, suspensions, emulsions, elixirs, syrups, tablets, lozenges, granules, powders, capsules, cachets, pills, ampoules, suppositories, pessaries, ointments, gels, pastes, creams, sprays, mists, foams, lotions, oils, boluses, electuaries, or aerosols.
The bisphosphonate or pharmaceutical composition comprising the bisphosphonate may be administered to a subject by any suitableroute of administration, whether systemically/peripherally or at the site of desired action, including but not limited to, oral (e.g. by ingestion); topical (including e.g. transdermal, parenteral, for example, by injection, including, intravenous
Formulations suitable for oral administration (e.g., by ingestion) may be presented as discrete units such as capsules, cachets or tablets, each containing a predetermined amount of the active compound; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water-in-oil liquid emulsion; as a bolus; as an electuary; or as a paste.
A tablet may be made by conventional means, e.g., compression or molding, optionally with one or more accessory ingredients.
Compressed tablets may be prepared by compressing in a suitable machine the active compound in a free-flowing form such as a powder or granules, optionally mixed with one or more binders (e.g., povidone, gelatin, acacia, sorbitol, tragacanth, hydroxypropylmethyl cellulose); fillers or diluents (e.g., lactose, microcrystalline cellulose, calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc, silica); disintegrants (e.g., sodium starch glycolate, cross-linked povidone, cross-linked sodium carboxymethyl cellulose); surface-active or dispersing or wetting agents (e.g., sodium lauryl sulfate); and preservatives (e.g., methyl
p-hydroxybenzoate, propyl p-hydroxybenzoate, sorbic acid) . Molded tablets may be made by molding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent. The tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active compound therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating, to provide release in parts of the gut other than the stomach.
Formulations suitable for parenteral administration (e.g., by injection, including cutaneous, subcutaneous, intramuscular, intravenous and intradermal) , include aqueous and non-aqueous isotonic, pyrogen-free, sterile injection solutions which may contain anti-oxidants, buffers, preservatives, stabilisers, bacteriostats, and solutes which render the formulation isotonic with the blood of the intended recipient; and aqueous and nonaqueous sterile suspensions which may include suspending agents and thickening agents, and liposomes or other microparticulate systems which are designed to target the compound to blood components or one or more organs. Examples of suitable isotonic vehicles for use in such formulations include Sodium Chloride Injection, Ringer's Solution, or Lactated Ringer's Injection. Typically, the concentration of the active compound in the solution is from about 1 ng/ml to about 10 μg/ml , for example from about 10 ng/ml to about 1 μg/ml. The formulations may be presented in unit-dose or multi- dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilised) condition requiring only the addition of the sterile liquid carrier, for example water for injections, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets.
It will be appreciated that appropriate dosages of the active compounds, and compositions comprising the active compounds, can
vary from patient to patient. Determining the optimal dosage will generally involve the balancing of the level of therapeutic benefit against any risk or deleterious side effects of the treatments of the present invention. The selected dosage level will depend on a variety of factors including, but not limited to, the activity of the particular compound, the route of administration, the time of administration, the rate of excretion of the compound, the duration of the treatment, other drugs, compounds, and/or materials used in combination, and the age, sex, weight, condition, general health, and prior medical history of the patient. The amount of compound and route of administration will ultimately be at the discretion of the physician, although generally the dosage will be to achieve local concentrations at the site of action which achieve the desired effect without causing substantial harmful or deleterious side- effects.
Administration in vivo can be effected in one dose, continuously or intermittently (e.g., in divided doses at appropriate intervals) throughout the course of treatment . Methods of determining the most effective means and dosage of administration are well known to those of skill in the art and will vary with the formulation used for therapy, the purpose of the therapy, the target cell being treated, and the subject being treated. Single or multiple administrations can be carried out with the dose level and pattern being selected by the treating physician.
In general, a suitable dose of the bisphosphonate is in the range of about 100 μg to about 150 mg per month, per two months or per three months. Where the active compound is a salt, an ester, prodrug, or the like, the amount administered is calculated on the basis of the
* parent compound and so the actual weight to be used is increased proportionately .
Other aspects of the invention relate to kits for identifying an individual having a bone disorder which is responsive to
bisphosphonate, or predicting the responsiveness of an individual with a bone disorder to treatment with a bisphosphonate, for example using a method described above.
A kit for identifying an individual having a bone disorder which is responsive to bisphosphonate, or predicting the responsiveness of an individual with a bone disorder to treatment with a bisphosphonate may comprise: reagents for determining in a genomic sample obtained from the individual, the presence or absence of a variant allele at one or more sites of polymorphism in the genomic region of the farnesyl diphosphate synthase (FDPS) gene, wherein the presence of a variant allele at the one or more sites being indicative that the individual is responsive to bisphosphonate treatment .
Sites of polymorphism in the genomic region of the FDPS gene, for example in the FDPS gene locus or its surrounding region are described in more detail above. In some embodiments, the kit may comprise reagents for determining the presence or absence of a T at
SNP rs2297480 in the FDPS gene. As described above, the presence of a TT genotype at SNP rs2297480 is indicative that the individual is responsive to bisphosphonate treatment.
A kit may comprise amplification reagents for amplifying all or part of the FDPS gene from a genomic sample obtained from an individual . Amplification reagents may include buffers, nucleotides, taq or other polymerase and/or one or more oligonucleotide primers which bind specifically to the FDPS and are suitable for amplifying a region of the gene containing one or more sites of polymorphism, such as SNP rs2297480, for example by PCR.
A kit may comprise detection reagents for determining the presence of one or more sequence variations in the genomic region of the FDPS gene of said individual. Detection means may include labelled
oligonucleotide probe which binds to an allelic variant at a site of polymorphism in the genomic region of the FDPS gene or labels, for example for labelling amplified nucleic acid products.
A kit may comprise one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g. a swab for removing cells from the buccal cavity or a syringe for removing a blood sample (such components generally- being sterile) .
The kit may further comprise instructions for using the kit in accordance with a method described above .
A kit may further comprise control nucleic acid, for example comprising known alleles at one or more sites of polymorphism in the genomic region of the FDPS gene.
Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure. All documents mentioned in this specification are incorporated herein by reference in their entirety.
Certain aspects and embodiments of the invention will now be illustrated by way of example and with reference to the tables described below.
Table 1 shows SNPS in the FDPS gene .
Table 2 shows the sequence surrounding SNP # rs2297480.
Table 3 shows SNPs from the dbSNP database which are located in the genomic region of the FDPS gene between the local recombination hotspots at positions 151983001 and 152252001 on chromosome 1 (NCBI NC_000001 created 29/08/2002) .
Table 4 shows SNPs from the HapMap release #20 database (Jan 2006) which are located in the genomic region of the FDPS gene between the local recombination hotspots at positions 151983001 and 152252001 on chromosome 1 (NCBI NCJDOOOOl created 29/08/2002) .
Experiments
Genetic samples were obtained from subjects enrolled in an ongoing clinical programme for treatment of OP through the use of regular intravenous Pamidronate (30mg three monthly) .
The first 24 months of treatment in individuals commencing intravenous amino-bisphosphonate therapy sees a pronounced effect due to the contribution of the reduction in the remodelling space and densitometric estimates of projected bone density are described as indirectly correlating to a multi-compartment pharmacokinetic model throughout this period. In these early stages of treatment the sparse densitometric sampling associated with best clinical practice can thus be fitted to a simple linear time trajectory, thereby supporting an inter-individual comparison of therapeutic response.
By such methodology, 53 subjects (each with two densitometric estimates taken in the first 24 month of Pamidronate therapy) were respectively assigned drug response phenotypes according to their display of ongoing demineralisation ('response failure') or stable or improving mineralising ("response success') . This was achieved by comparison of derived annualised rates of change in projected densitometric estimates of total hip mineralisation. Given a coefficient of error of 1% in the dual energy X-ray absorptiometry imaging technique employed, the 95% certitude limit for 'clinically significant ' ongoing demineralisation (response failure) was maintained at standard thresholds (a densitometric change of -2.7% or greater) .
A search was made of dbSNP to identify regions of the FDPS gene containing single nucleotide polymorphisms (SNPs) with high
heterozygosity. A region containing exons 2 and 3 and a region containing exon 12 were chosen for investigation because these regions contained known SNPs with the highest heterozygocity . PCR primers were designed to amplify the above regions and, in addition, two primers were designed for DNA sequencing (see primer list below) . DNA was extracted from blood samples using standard organic phase methods and PCR amplification and DNA sequencing was carried out using standard protocols (dye-terminator sequencing using an ABI3100 automated DNA sequencer) .
NAME SEQUENCE
FDS_EX2-3_U CCTCCTTGGGGCGTAACTCA FDS_EX2-3_L GCCACAGGTGAATGCCACAC FDS_EX2-3_S1 TTTTGTTCCCTGCGT ATCC FDS-EX12-U GGAGTAGAGGATGCCTGGTATG
FDS-EXl2 -L AGGTTACACGATTATTTATTGAGAGC FDS-EXl2 -S1 GTGGGTGGCTTTGGAGAT
A G/T polymorphism was identified 97bp upstream of intron 1 of the FDPS gene that corresponded to dbSNP refSNP ID: rs2297480. A chi- squared test showed clear significance for distribution of response phenotype according to such alleles (respectively TT29 vs 2 and TG/GG 12vslO p<= 0.01) .
The odds ratio for the >-2.7 cutoff was found to be 12.0833 (95% CI: 2.2961 to 63.5874) and the odds ratio for the pos/neg cutoff, was found to be 3.1818 (95% CI: 1.0192 to 9.9327). This demonstrates the strength of the observed effect .
Table 1
TGGGGTACTT TACTCTGTAC CGCCTCCTTA CCCAGCCTTG TGCACGCCAT CTTGAAGGCA CTGAGTTCTA GCCTGTTTAT TGTAAGTGGT GATTAGTTGG GTCTCAGTCA CCCAGCCATA CTTTTTTGTT CCCTGCGTAT CCTTCCTGTA ATTGTCCCCA AGCACATTCC ACAAGAGGGA GGGGCACTCT GGGCTAAGGC [T/G]
GGGGTGGGAG TTATCTGGGG AGCTGCCACC ATGCCTCTGC CTTTGGTGCT TGCCCCTGCA GGGAGTGCTT AGTGCCCCCT CCCTATGCCA CTCCCAGGAT GCCCCTGTCC CGCTGGTTGA GATCTGTGGG GGTCTTCCTG CTGCCAGCCC CCTACTGGGC ACCCCGGGAG AGGTGGCTGG GTTCCCTACG GCGGCCCTCC
Table 2
SNP ID NO: # Position on SNP ID NO: # Position on chromosome 1 chromosome 1 rs406141 151985250 48 rs497829 152006605 rs2066981 151985452 49 rs4024046 152007214 rs2361529 151985896 50 rs5777942 152007215 rs2075571 151987179 51 rsl2028078 152007302 rs370545 151988463 52 rsl6836748 152007752 rs914615 151988965 53 rs2049805 152008053 rs6700457 151989649 54 rs6677756 152008117 rsl6836684 151991033 55 rs2974931 152008288 rs760077 151991855 56 rs28498909 152009136 rs3738808 151993539 57 rslO591798 152009231 rsl20650S4 151993963 58 rs2974930 152009790 rs2734403 151994159 59 rs2974929 152010341 rs2734402 151994227 60 rs2990245 152010535 rs2734401 151994373 61 rs3835732 152010628 rs2778496 151994440 62 rs2990246 152010675 rs2990221 151994469 63 rs2990247 152010900 rs2974935 151994916 64 rsll580040 152011295 rs2075570 151995237 65 rsl2407919 152012388 rs421050 151997440 66 rs2990217 152012671 rs421016 151997489 67 rsll264343 152012739 rs3115534 151998060 68 rsl2723761 152013397 rs3115533 151998100 69 rs3768566 152014137 rs3125562 151998311 70 rs4043 152014263 rs419697 151999024 71 rsl045253 152014308 rs3115532 151999435 72 rs28595322 152015066 rs404065 151999507 73 rs2778495 152015204 rs3125563 151999576 74 rsl0796940 152015762 rs3125564 151999577 75 rs438459 152015780 rs3125565 151999583 76 rs368793 152015783 rs3125566 151999709 77 rs438450 152015791 rs409652 151999761 78 rs368766 152015799 rs28445596 151999802 79 rs390685 152015846 rslO57941 151999815 80 rs2974926 152015910 rs3768568 152000869 81 rs567950 152016132 rs31255Sl 152001580 82 rsll264344 152016133 rs3115531 152001581 83 rs2860587 152016151 rslO64639 152001760 84 rs2361530 152016378 rslO59732 152001877 85 rs2361531 152016381 rslO64635 152001884 86 rs2361532 152016385 rslO64633 152001943 87 rs2361533 152016395 rs3119758 152002211 88 rs4024047 152016405 rs3119759 152002278 89 rs4024048 152016407 rs3115530 152002279 90 rs4024049 152016413 rs3119760 152002293 91 rs2142046 152016476 rs421585 152002953 92 rs2142045 152016503 rs2990220 152003327 93 rs3115535 152017051 rsl2120349 152005113 94 rs3916686 152017083
SNP ID NO: # Position on SNP ID NO: Position on chromosome # chromosome 1
95 rs3817647 152017278 146 rsl7405269 152023563
96 rs5777943 152017604 147 rsl7405262 152023565
97 rslO57944 152017694 148 rs2885305 152023616
98 rs28408650 152017757 149 rs2361534 152023643
99 rs394757 152017757 150 rs2361535 152023679
100 rs708606 152017767 151 rs2070679 152023714
101 rs368060 152018081 152 rsll41801 152023978
102 rsl2747811 152018151 153 rsl064640 152023990
103 rs2974924 152018243 154 rslO64638 152024006
104 rs426516 152018276 155 rslO64637 152024076
105 rs28373017 152018404 156 rslO64636 152024113
106 rsl800473 152018404 157 rsl2041778 152024910
107 rsl2752133 152018451 158 rsl2071934 152025173
108 rslO64651 152018591 159 rsl2072929 152025284
109 rs2990223 152018730 160 rs3754484 152025361
110 rs28559737 152018742 161 rsll430678 152025497
111 rsll5S8184 152019158 162 rsll264345 152026197
112 rslO64648 152019230 163 rs2990225 152026812
113 rs2230288 152019240 164 rs2990226 152026814
114 rslO64647 152019295 165 rs2990227 152026838
115 rsl7401379 152019295 166 rsl0908459 152027139
116 rsl7401372 152019307 167 rsl2034326 152027546
117 rs9628662 152019414 168 rsl0668496 152027736
118 rsl2743554 152019786 169 rs2990228 152028220
119 rslO57942 152020276 170 rsl2406363 152028335
120 rs708610 152020283 171 rsll58151 152029257
121 rs762488 152020622 172 rs2178815 152029792
122 rs2009578 152020699 173 rs2178814 152029793
123 rs28678003 152020806 174 rs2974920 152030468
124 rs381737 152021005 175 rs2072648 152030716
125 rslO64644 152021056 176 rs2075568 152031241
126 rs381427 152021070 177 rs734073 152031438
127 rs381418 152021078 178 rs734074 152031519
128 rs364897 152021079 179 rsl807042 152031751
129 rs2974923 152021256 180 rs2015296 152032254
130 rs439898 152021494 181 rsl546818 152032280
131 rsl7423233 152021494 182 rs3065766 152032677
132 rs7416991 152021720 183 rs3065762 152032677
133 rs2974922 152021746 184 rs3065758 152032677
134 rs2974921 152021793 185 rs2361536 152032698
135 rs2990224 152021794 186 rs7417746 152032749
136 rs28498204 152021838 187 rs2361537 152032887
137 rs2075569 152022433 188 rs741756 152032941
138 rsl7405276 152022782 189 rs2361538 152033041
139 rsl6836761 152022819 190 rs2361539 152033042
140 rsl6836764 152022820 191 rs2361540 152033043
141 rs3205615 152022820 192 rs2990230 152034891
142 rsll41807 152022820 193 rs2072647 152034910
143 rs3205614 152022834 194 rs2075567 152034917
144 rslO64643 152022834 195 rs2974919 152034935
145 rslO59731 152023528 196 rs2974918 152034937
SNP ID NO: # Position on SNP ID NO: Position on chromosome 1 # chromosome 1
197 rs2990231 152035194 248 rslO46188 152045147
198 rsl2748155 152035250 249 rs2990236 152045385
199 rsl2730000 152035545 250 rs3887 152045841
200 rsl2730005 152035556 251 rsl049090 152046188
201 rsl0908460 152035586 252 rs2990237 152046443
202 rsll586220 152035714 253 rs2990238 152046547
203 rsl2084530 152035726 254 rs2990239 152046643
204 rsll264346 152036080 255 rslO76556 152047894
205 rs2990232 152036663 256 rsl2044394 152047968
206 rs2974917 152036664 257 rsl2043655 152047984
207 rs2974916 152036880 258 rs760081 152048075
208 rs2075566 152037164 259 rs7355033 152048213
209 rs2974915 152037196 260 rs2008420 152048312
210 rs2242577 152037374 261 rs7417380 152048456
211 rsl2758281 152037466 262 rs4543784 152048456
212 rs3119761 152037806 263 rs3065804 152048469
213 rs878436 152038058 264 rs2008404 152048471
214 rs909108 152038098 265 rslO78699 152048566
215 rs2361541 152038737 266 rs760078 152048608
216 rs3065799 152038740 267 rs2974936 152048949
217 rs760075 152038859 268 rs6696982 152048998
218 rsll557755 152039100 269 rsll411609 152049037
219 rs2974914 152039188 270 rsll389873 152049038
220 rs2990233 152039190 271 rsll428813 152049040
221 rs909107 152040203 272 rs2990241 152049786
222 rs909106 152040212 273 rs2990242 152049955
223 rsl318328 152040224 274 rs4971069 152050130
224 rsl2402253 152040887 275 rs4971070 152050277
225 rsl2042020 152041119 276 rs4971071 152050742
226 rsll587245 152041170 277 rs2990243 152050812
227 rsl2408822 152041346 278 rs2990244 152050814
228 rsl2402578 152041509 279 rs2049804 152050855
229 rs2990234 152041828 280 rs2885306 152051680
230 rs2974913 152041830 281 rs2049803 152051683
231 rs4971068 152041936 282 rs2049802 152051685
232 rs9729564 152042295 283 rs2049801 152051691
233 rsl548224 152042459 284 rs2049800 152051693
234 rsll264347 152042839 285 rs2361543 152052697
235 rsll264348 152042988 286 rs9427191 152053066
236 rs3125560 152043010 287 rsll577338 152053150
237 rsl7857819 152043204 288 rs489016 152053538
238 rsl7845043 152043204 289 rsl2749700 152053787
239 rs3180018 152043204 290 rs28463199 152054176
240 rsll557754 152043450 291 rs2236863 152054434
241 rslO76555 152043527 292 rsl2563994 152057165
242 rs760074 152043578 293 rsl2732972 152057756
243 rsl2084873 152043640 294 rsl2732984 152057773
244 rs2990235 152043789 295 rsl0128085 152058391
245 rs2361542 152043971 296 rsl2749306 152060780
246 rs760073 152044552 297 rs28693067 152061120
247 rs2242576 152044618 298 rsll264349 152061186
SNP ID NO: # Position on SNP ID NO: # Position on chromosome 1 chromosome 1
299 rs7549276 152061648 347 rs8177983 152075712
300 rsll264350 152061913 348 rs8177982 152076259
301 rs4269766 152061981 349 rs8177981 152076457
302 rs7551854 152062070 350 rs8177980 152076483
303 rs7554780 152062771 351 rs8177979 152076503
304 rsl2044063 152063764 352 rs8177978 152076866
305 rs7367998 152064323 353 rs8177977 152076911
306 rsl2049375 152065906 354 rs8177976 152076945
307 rs7543234 152066381 355 rs8177975 152077073
308 rsll264351 152066568 356 rs8177974 152077243
309 rs7520184 152066656 357 rs8177973 152077696
310 rsl2239421 152068441 358 rs2071053 152078250
311 rsll264352 152068910 359 rs8177972 152078265
312 rsll264353 152068979 360 rs8177971 152078519
313 rsll264354 152069155 361 rs3020784 152078718
314 rsl2724449 152069304 362 rs2990219 152078720
315 rsl2402606 152070055 363 rs8177970 152078734
31S rsll264355 152070565 364 rs3020782 152079082
317 rsl2118947 152071521 365 rs2990218 152079084
318 rs3814319 152071825 366 rs8177969 152079111
319 rs3814318 152071829 367 rs8177968 152079408
320 rs8177998 152071925 368 rs8177967 152079586
321 rs8177997 152072092 369 rs8177966 152079647
322 rs8177996 152072098 370 rs8177965 152079687
323 rs8847 152072396 371 rsl2067675 152081193
324 rs8177995 152072971 372 rsl2741350 152081498
325 rs932972 152073169 373 rsll802924 152081913
326 rs8177994 152073422 374 rsll264357 152082031
327 rslO52177 152073423 375 rsl2032821 152082396
328 rsl7858737 152073456 376 rsl2040032 152082534
329 rsl7845777 152073456 377 rs3020781 152082849
330 rslO52176 152073456 378 rs8177964 152082853
331 rsl0565071 152073895 379 rs8177963 152082903
332 rs8177993 152074167 380 rs8177962 152083064
333 rs8177992 152074229 381 rs8177961 152083237
334 rs8177991 152074276 382 rs3020783 152084094
335 rs8177990 152074308 383 rs8177960 152084407
336 rs8177989 152074353 384 rs7524950 152085347
337 rs3020786 152074422 385 rsl2037847 152085624
338 rs8177988 152074722 386 rs4971072 152086942
339 rs3762272 152074850 387 rsl2726199 152087326
340 rs8177987 152075087 388 rsl2032720 152088033
341 rsll264356 152075116 389 rs7534795 152088626
342 rs3020785 152075124 390 rsl0630800 152088660
343 rs8177986 152075362 391 rsl0908461 152088800
344 rs8177985 152075487 392 rsl888929 152089247
345 rs8177984 152075676 393 rs3834761 152089456
346 rs4620533 152075686 394 rsl2033064 152090534
SNP ID NO: # Position on SNP ID NO: # chromosome Position on
1 chromosome 1 rs7552559 152090661 445 rsl2748814 152123516 rsll337029 152090931 446 rsll362270 152123657 rs6672284 152091036 447 rs28417969 152124243 rsl2043597 152091514 448 rs4644482 152124554 rs2297480 152092555 449 rs4971050 152125102 rsl6836819 152092934 450 rs4971051 152126120 rsll556436 152092972 451 rsl0477032 152126124 rsll264358 152093237 452 rs6690002 152126641 rsl2129895 152094548 453 rs6671191 152128002 rsl0458626 152094762 454 rsll417303 152128051 rs214813β 152095137 455 rsll264362 152128688 rsll556432 152095183 456 rsl2562734 152130016 rsll556437 152095197 457 rslO157264 152130184 rsll804127 152095844 458 rs3748558 152130787 rsll264359 152095902 459 rsll264363 152131381 rsl2409362 152097288 460 rs28533380 152131761 rslO796941 152097334 461 rs28718212 152131763 rsll264360 152097659 462 rs28625826 152131777 rsl0908462 152098927 463 rs28491236 152131811 rsl0908463 152099331 464 rsl2131079 152132741 rsll807340 152099509 465 rs6659005 152132955 rsl7367421 152100314 466 rs6670530 152133351 rsl409140 152100661 467 rs6670726 152133505 rsll264361 152102618 468 rsl2049455 152133565 rsl050365 152103435 469 rsl2735478 152133853 rsl2407073 152103645 470 rsl2756406 152133855 rsl6836822 152103660 471 rsl2024696 152134622 rsl2741581 152104504 472 rsl2021631 152134751 rs4971074 152104605 473 rs7523189 152134755 rsll589917 152106085 474 rsl2239114 152135215 rs874870 152106821 475 rs28465679 152135605 rs914616 152107347 476 rs6672663 152136589 rs4971075 152107845 477 rs6682261 152138803 rsl2087231 152108076 478 rsll264364 152139997 rsl20eiO20 152111091 479 rsl2029944 152140076 rs9427215 152112249 480 rs4472748 152141204 rsl2745819 152112766 481 rs28753710 152141230 rsl2728412 152112818 482 rs7415003 152141469 rs9803672 152114867 483 rs4492610 152141469 rsll294228 152115307 484 rsl2748121 152144411 rs7546549 152115324 485 rsl2753466 152145066 rsl0530618 152115349 486 rsll264365 152146067 rsll414431 152115713 487 rs7340058 152148006 rs7549232 152115796 488 rs7339988 152148103 rs6692183 152117400 489 rs7340071 152148127 rs6677385 152117654 490 rsll581222 152148260 rs6695298 152118132 491 rsll264366 152148484 rsll552268 152118363 492 rs6683631 152149097 rsl047304 152118750 493 rsl2755518 152150068 rsl6836837 152121000 494 rsl2738013 152150078
SNP ID NO: # Position on SNP ID NO: # Position on chromosome 1 chromosome 1
495 rsl2742159 152150101 543 rsl2748811 152179684
496 rsl2755S43 152150103 544 rsl2752987 152179698
497 rsl2746371 152150366 545 rsl2748817 152179706
498 rsl2746379 152150374 546 rsl2022700 152179823
499 rsll2643S7 152150411 547 rsl6836847 152180744
500 rsl2128553 152150678 548 rsl6836848 152180753
501 rsl2565122 152151286 549 rs7556102 152181276
502 rsl2087625 152155264 550 rs7536194 152182278
503 rs6656587 152157037 551 rsl2025532 152182375
504 rs5777944 152157865 552 rsl2025722 152183043
505 rs5005770 152158116 553 rs7517139 152183088
506 rsl2035771 152158714 554 rs7542252 152183980
507 rs28438500 152159644 555 rsll264370 152184520
508 rsl2078402 152159762 556 rsl0158037 152185683
509 rsl2048260 152161354 557 rsl886905 152185745
510 rsl2041057 152161459 558 rsl0796942 152187896
511 rs959485 152162311 559 rsl2121568 152188901
512 rs4622056 152162466 560 rsl0158907 152190613
513 rsl2134842 152162614 561 rsl0712023 152190728
514 rs4601578 152162619 562 rsl0618305 152191813
515 rsl2754454 152167354 563 rsl0908464 152194450
516 rsl2729287 152167355 564 rsl2738514 152194670
517 rsl2754459 152167363 565 rsl2046473 152195499
518 rsl2750270 152167364 566 rsl2093804 152195847
519 rs6659913 152168624 567 rsll345039 152198822
520 rsll588849 152168737 568 rsl2058261 152199263
521 rs6665823 152169437 569 rs6665939 152199823
522 rs7554397 152169900 570 rsl2734374 152201924
523 rsl2406331 152170109 571 rsll577694 152202413
524 rs2025669 152170682 572 rsl0908465 152202761
525 rs7541017 152171122 573 rsll442413 152204204
526 rsl0672932 152171586 574 rs28833498 152205504
527 rsll586577 152171685 575 rs28791794 152206459
528 rsl2081067 152172055 576 rs28850118 152206833
529 rsl2041011 152172073 577 rs7531890 152207843
530 rsll264368 152172358 578 rs7517777 152207959
531 rs7416976 152172523 579 rsll459295 152209996
532 rsll264369 152172903 580 rs7532714 152211169
533 rs6694257 152172953 581 rs7522660 152211316
534 rs6669502 152173145 582 rs9787192 152211318
535 rs6661389 152173509 583 rs7514174 152212365
536 rs6670014 152173651 584 rsl2025843 152214083
537 rs7527209 152174024 585 rsl2028416 152214234
538 rsl2407344 152174755 586 rsl2026638 152214333
539 rsll585174 152176872 587 rsl6836851 152215420
540 rsl2040666 152176878 588 rSl2069996 152215435
541 rs7539746 152177758 589 rs28516425 152216112
542 rsl2748798 152179670 590 rs7355130 152216204
SNP ID NO: # Position on SNP ID NO: # Position on chromosome 1 chromosome 1
591 rsl2124051 152216517 617 rs6668947 152230292
592 rsl6865367 152216921 618 rsl07S2610 152231186
593 rslO61116 152217075 619 rsl2755007 152234057
594 rsl2082169 152217087 620 rsll264374 152234585
595 rsl2082171 152217107 621 rsl2094250 152235968
596 rsl2082219 152217220 622 rsl2095569 152236692
597 rsl2564667 152217724 623 rsll264375 152237138
598 rsl2041534 152220169 624 rsl0700457 152237649
599 rsl2138411 152220515 625 rsl0701330 152237650
600 rs4971053 152221708 626 rsll264376 152239006
601 rsl3375379 152222434 627 rs6684889 152240135
602 rsl2070566 152223903 628 rsl536255 152240223
603 rs7549186 152223994 629 rs7536476 152240547
604 rsll264371 152225110 630 rsl0796945 152240761
605 rsl2086165 152225226 631 rsl2239100 152241549
606 rsl0465954 152225460 632 rs6658401 152242173
607 rsll264372 152226003 633 rsl0796946 152242563
608 rsl325908 152226377 634 rs2362361 152242772
609 rs7349067 152227021 635 rs2362362 152242774
610 rsl0796943 152227802 636 rsl0908466 152242798
611 rsl2730906 152227841 637 rs7531517 152243500
612 rsl2034526 152227886 638 rs5777945 152243765
613 rsl2037824 152228254 639 rs7529556 152246812
614 rsll588832 152228836 640 rsl2724079 152247015
615 rsl0796944 152229401 641 rs5777946 152248660
616 rsll264373 152229476 642 rsl20S7371 152250742
Table 3
P
SNP ID NO: # Position on re£_allele chromosome 1 rslO158907 152190613 A rslO452S3 152014308 C rslO52176 152073456 C rslO57941 151999815 C rsl064640 152023990 A rsl0752S10 152231186 T rslO7S556 152047894 A rslO78699 152048566 A rsl0796943 152227802 T rsl0908465 152202761 C rsll264345 152026197 T rsll264351 152066568 G rsll264352 152068910 T rsll264355 152070565 C rsll264359 152095902 A rsll264360 152097659 T rsll264361 152102618 T rsll264367 152150411 T rsll264369 152172903 T rsll264371 152225110 C rsll264372 152226003 A rsll2S4375 152237138 T rsll264376 152239006 T rsll577S94 152202413 A rsll585174 152176872 T rsll588849 152168737 C rsllS89917 152106085 C rsll807340 152099509 G rsl202S638 152214333 T rsl2029944 152140076 G rsl2032720 152088033 G rsl2032821 152082396 G rsl20330S4 152090534 T rsl2035771 152158714 T rsl2040S66 152176878 G rsl2041057 152161459 G rsl2041534 152220169 C rsl2043597 152091514 C rsl2046473 152195499 T rsl2048260 152161354 C rsl20S1020 152111091 C rsl2069996 152215435 G rsl207056S 152223903 T rsl2078402 152159762 A rsl20821S9 152217087 C rsl2082171 152217107 C rsl2082219 152217220 C rsl2087231 152108076 G rsl2093804 152195847 T rsl2118947 152071521 A rsl2131079 152132741 C rsl2134842 152162614 A rsl2138411 152220515 C rsl2239114 152135215 G rsl2239421 152068441 C rsl2407073 152103645 G rsl2407919 152012388 C rsl2724079 152247015 T rsl2726199 152087326 A rsl2730906 152227841 C rsl2738514 152194670 T rsl2741581 152104504 C rsl2748814 152123516 C rsl2750270 152167364 A rsl325908 152226377 G rsl3375379 152222434 G rslS836822 152103660 T rsl6836851 152215420 A rsl7367421 152100314 G rsl886905 152185745 T rs2049805 152008053 A rs2066981 151985452 C
rs2236863 152054434 C rs2242577 152037374 G rs2297480 152092555 A rs2362362 152242774 G rs2734403 151994159 T rs2974922 152021746 T rs2990218 152079084 T rs2990219 152078720 C rs2990227 152026838 G rs2990228 152028220 A rs2990245 152010535 C rs2990247 152010900 C rs3020781 152082849 T rs3119759 152002278 A rs3125562 151998311 C rs3180018 152043204 G rs364897 152021079 A rs3738808 151993539 T rs3748558 152130787 C rs376856S 152014137 G rs3768S68 152000869 G rs406141 151985250 C rs421585 152002953 A rs4269766 152061981 G rs438450 152015791 C rs4472748 152141204 A rs4S01578 152162619 G rs4620533 152075686 C rs4622056 152162466 T rs4644482 152124554 G rs4971050 152125102 C rs4971051 152126120 T rs4971053 152221708 T rs4971072 152086942 G rs4971074 152104605 T rs5005770 152158116 A rs6S59913 152168624 A rs6670530 152133351 G rs6672S63 152136589 T rs6684889 152240135 T rs6690002 152126641 C rs6694257 152172953 C rs6695298 152118132 T rs734073 152031438 A rs7355130 152216204 G rs7416991 152021720 T rs7529556 152246812 C rs7531517 152243500 T rs7531890 152207843 T rs7536476 152240547 A rs7539746 152177758 G rs7541017 152171122 C rs7S49186 152223994 T rs7549232 152115796 G rs7549276 152061648 G rs75S1854 152062070 G rs755S102 152181276 C rs8177960 152084407 C rs8177962 152083064 C rs8177963 152082903 T rsS177967 152079586 G rs81779e9 152079111 G rs8177973 152077696 T rs8177974 152077243 T rs8177975 152077073 G rs8177980 152076483 A rs8177981 152076457 C rs8177986 152075362 C rs8177988 152074722 G rs874870 152106821 T rs914615 151988965 A rs932972 152073169 C rs959485 152162311 G rs9628662 152019414 T
Table 4
