BIOSENSORS FOR RAS-DEPENDENT SIGNALING PATHWAYS AND USE

THEREOF

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims the benefit of U.S. provisional application serial No. 61/818.166, filed on May 1 , 2013, which is incorporated herein by reference in its entirety.

TECHNICAL FIELD

The present invention generally relates to biosensors, and more specifically to biosensors for RAS-dependent signaling pathways and uses thereof, for example for the identification of agents that modulate protein-protein interactions involved in the RAS-dependent signalling pathway.

BACKGROUND ART

Dysregulation of the RAS-RAF-MEK-ERK pathway is conducive to tumour formation ¹ ' ² . While activating mutations in the RAS genes (H, K, NRAS) are the most recurrent lesions driving oncogenic RAS/ERK signalling, gain-of-function mutations in BRAF are arguably the second leading cause ³ ' ⁴ . Under normal conditions, RAF activation is initiated at the plasma membrane by the binding to growth factor-stimulated RAS GTPases. This triggers the sequential phosphorylation and activation of MEK and ERK. Active ERK then phosphorylates a diverse set of substrates eliciting various cell-specific responses, including proliferation and survival. Mutations causing constitutive activation of Ras genes (H-Ras, K-Ras or N-Ras) occur in a large proportion of human cancers (at least 33% according to the Cosmic database). Ras genes encode small GTPases that cycle between an inactive (GDP-bound) and an active (GTP- bound) state. The most frequently occurring mutation consists of a glycine to valine substitution at position 12 (G12V) (Q61 L are the second predominant classes of mutations) that abrogates the GTPase activity of Ras, causing it to be constitutively GTP-loaded and therefore, to interact with and signal through its downstream effectors. The main direct effectors of RAS proteins are 1 ) the RAF kinases (ARAF, BRAF and CRAF), 2) the catalytic PI3K ^p110 subunits and 3) Guanine nucleotide Exchange Factors (GEFs) for the small GTPase Ral, such as RAL-GDS, RGL, RGL2 and RGL3. Each of these effector molecules turns on specific downstream signaling pathways that control various aspects leading to tumor onset, proliferation, survival and invasion.

Downstream of RAS activation, a plethora of interactions serve to guide substrate phosphorylation within the ERK signaling axis. At the level of RAF, combinations of homo- and hetero-dimerization of RAF family members are required for the activation of RAF. The latter interaction can be selectively modulated genetically by mutations of the side-to-side dimerization interface or pharmacologically by ATP-competitive inhibitors of RAF. Mammals express three RAF paralogs (A, B, CRAF) and two distantly related proteins (KSR1 , 2) herein referred to as RAF family members ⁵ . A recently discovered feature of RAS-mediated RAF activation involves the protein-protein interaction (homo or hetero) of the kinase domain of RAF family members through a conserved side-to-side interface ^6"9 . The mechanism by which dimerization induces catalytic activity has not been elucidated, but likely involves allosteric switching of the respective protomers ⁷ .

MEK phosphorylation by RAF requires docking of the substrate MEK to its kinase RAF. This interaction, although transient, must occur in order for the signal to be properly transmitted. In addition to its poorly characterized physical interaction with RAF proteins (ARAF, BRAF and CRAF), MEK also interacts with KSR proteins (KSR1 and 2) in a stable and easily traceable fashion. The crystal structure of a MEK1/KSR2 heterodimer has been solved and therefore may constitute a useful model to understand how RAF/MEK interactions are mediated. The KSR/MEK interaction and the ill-defined RAF/MEK interfaces thus represent promising protein/protein interactions targets in the treatment of human cancer.

Current methods for monitoring RAF protein-protein interaction are based on low throughput assays ^6"9 that are ill-adapted for surveying numerous samples/conditions or for screening large libraries. Sensitive and quantitative methods and tools could prove useful in identifying RAS-signalling events. There is a correlated need to identify chemical compounds/factors modulating RAS signalling through the use of optimized identification methods.

Given the involvement of RAF in tumorigenesis, several RAF inhibitors have been developed ¹⁰ . Selective inhibitors of BRAF ^V600E (a frequent BRAF oncogenic variant) are now available and resounding clinical activity against BRAF ^V600E -dependent metastatic melanomas has been observed with one of these known as vemurafenib (PLX4032) ¹¹ ' ¹² . Regrettably, two shortcomings have emerged. Firstly, virtually all inhibitors tested to date promote RAS- dependent RAF dimerization and, in a dose-dependent manner, increase to variable degrees ERK signalling and cell growth ^13"15 . Apparently, drug-bound RAF protomers dimerize with and transactivate drug-free protomers leading to enhanced signalling ¹⁶ . This situation warns against using current RAF inhibitors to treat RAS-dependent cancers. Secondly, resistance to vemurafenib invariably develops within a year and one frequent mechanism driving resistance relies on RAF dimerization ¹⁷ ' ¹⁸ .

To date, no successful inhibitors of RAS activity have been developed. However, various groups have approached the problem by targeting RAS/effector protein-protein interactions (PPI). The RAS/RAF interaction, central to the initiation of RAS/ERK signaling, has been targeted by many groups but few drugs have been pursued following these efforts. Amongst them, MCP compounds have been discovered using a yeast Two-Hybrid strategy and were shown to disrupt RAF membrane recruitment by RAS. On the other hand, the RAS/PI3K and the RAS/RALGDS axes have been the subject of very few drug discovery initiatives. There is thus a need for the development of novel systems and methods for identification of modulators of RAS-dependent signaling pathways.

The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety. SUMMARY OF THE INVENTION

In an aspect, the present invention provides a resonance energy transfer (RET)-based biosensor for detecting the interaction between members of the RAS signaling pathway.

In another aspect, the present invention provides a RAS/RAS effector molecule interaction biosensor comprising: a cell expressing: (a) a first fusion molecule comprising: (i) a polypeptide comprising a RAS-binding domain (RBD) of a RAS effector molecule; (ii) a donor fluorescent or bioluminescent protein having an emission spectrum, covalently linked to said polypeptide; and (b) a second fusion molecule comprising: (i) a RAS polypeptide; and (ii) an acceptor fluorescent protein having an excitation spectrum, covalently linked to said RAS polypeptide, wherein the emission spectrum of said donor fluorescent or bioluminescent protein overlaps with the excitation spectrum of said acceptor fluorescent protein.

In an embodiment, the RAS effector molecule is a RAF protein, a p1 10 subunit of PI3K, or a RALGDS protein. In a further embodiment, the p1 10 subunit is p1 10a or ρ1 10γ. In an embodiment, the RAF protein is BRAF. In an embodiment, the RAS polypeptide is a KRAS, HRAS or NRAS polypeptide.

In an embodiment, the donor fluorescent or bioluminescent protein is N-terminal relative to said polypeptide comprising a RBD.

In an embodiment, the RAS effector molecule is a RAF protein or a p1 10 subunit of PI3K, and said acceptor fluorescent protein is N-terminal relative to said RAS polypeptide. In another embodiment, the RAS effector molecule is a RALGDS protein, and said acceptor fluorescent protein is C-terminal relative to said RAS polypeptide.

In another aspect, the present invention provides a kinase dimerization biosensor comprising: (a) a first fusion molecule comprising: (i) a first kinase domain (KD1 ) of a first kinase regulated by kinase domain dimerization; (ii) a donor fluorescent or bioluminescent protein having an emission spectrum (a FRET or BRET donor), covalently linked to said KD1 ; (iii) a first targeting moiety (TM1 ) covalently linked to said KD1 or said donor fluorescent or bioluminescent protein; (b) a second fusion molecule comprising: (i) a second kinase domain (KD2) of a second kinase regulated by kinase domain dimerization; (ii) an acceptor fluorescent protein having an excitation spectrum, covalently linked to said KD2, wherein the emission spectrum of said donor fluorescent or bioluminescent protein overlaps with the excitation spectrum of said acceptor fluorescent protein (a FRET or BRET acceptor); and (iii) a second targeting moiety (TM2) covalently linked to said KD2 or said acceptor fluorescent or bioluminescent protein. In an embodiment, the above-mentioned donor fluorescent or bioluminescent protein is N-terminal relative to said KD1 . In an embodiment, the above-mentioned acceptor fluorescent protein is N-terminal relative to said KD2.

In an embodiment, the above-mentioned TM1 is C-terminal relative to said KD1 . In an embodiment, the above-mentioned TM2 is C-terminal relative to said KD2.

In an embodiment, the above-mentioned TM1 and TM2 are the same.

In an embodiment, the above-mentioned TM1 and/or TM2 is/are a plasma membrane targeting moiety, in a further embodiment the plasma membrane targeting moiety comprises a CAAX domain, wherein C = cysteine, A = aliphatic residue and X = any amino acid.

In an embodiment, the above-mentioned first and second kinases are the same. In an embodiment, the above-mentioned first and/or second kinase belong(s) to the RAF family. In an embodiment, the second kinase is BRAF or CRAF, preferably BRAF.

In an embodiment, KD1 and/or KD2 comprises an amino acid sequence corresponding to residues 444 to 723 of human BRAF.

In an embodiment, the first and/or second kinase belong(s) to the elF2a family. In a further embodiment, the first and/or second kinase is PERK.

In an embodiment, the donor fluorescent or bioluminescent protein is a donor bioluminescent protein. In a further embodiment, the above-mentioned donor bioluminescent protein is a luciferase, in a further embodiment a Renilla luciferase, such as Renilla luciferase variant II comprising the amino acid sequence of SEQ ID NO:35.

In an embodiment, the above-mentioned acceptor fluorescent protein is a Green Fluorescent Protein (GFP), in a further embodiment GFP10 comprising the amino acid sequence of SEQ ID NO:36.

In an embodiment, the biosensor further comprises a cell expressing the first and second fusion molecules.

In another aspect, the present invention provides a kit comprising a first nucleic acid encoding the first fusion molecule defined above and a second nucleic acid encoding the second fusion molecule defined above.

In another aspect, the present invention provides a cell expressing the first and second fusion molecules defined above (comprising the first and second nucleic acids defined above.

In an embodiment, the cell is a human cell line, in a further embodiment an HEK293T cell line.

In another aspect, the present invention provides a method for determining whether a test agent modulates kinase dimerization, said method comprising: (a) providing the cell defined above in the presence or absence of said test agent; and (b) measuring the fluorescence signal emitted by said acceptor fluorescent protein in said cell; wherein a higher fluorescence signal measured in the presence of the test agent is indicative that said test agent increases kinase dimerization, and a lower fluorescence signal measured in the presence of the test agent is indicative that said test agent inhibits kinase dimerization.

In another aspect, the present invention provides a method for determining whether a test agent modulates the interaction between RAS and a RAS effector molecule, said method comprising: (a) providing the biosensor defined above in the presence or absence of said test agent; and (b) measuring the fluorescence signal emitted by said acceptor fluorescent protein in said cell; wherein a higher fluorescence signal measured in the presence of the test agent is indicative that said test agent increases the interaction between RAS and the RAS effector molecule, and a lower fluorescence signal measured in the presence of the test agent is indicative that said test agent inhibits the interaction between RAS and the RAS effector molecule.

In an embodiment, the above-mentioned first fusion molecule comprises a donor bioluminescent protein, and wherein said method further comprises contacting the cell with a substrate for said donor bioluminescent protein. In an embodiment, the substrate is a luciferin, in a further embodiment a coelenterazine such as Coelenterazine 400A (DeepBlueC™).

In an embodiment, the above-mentioned method further comprises (c) measuring the fluorescence or bioluminescent signal emitted by said donor fluorescent or bioluminescent protein, and (d) determining the ratio [acceptor fluorescence signal / donor fluorescence or bioluminescence signal]; wherein a higher ratio measured in the presence of the test agent is indicative that said test agent increases kinase dimerization or the interaction between RAS and the RAS effector molecule, and a lower ratio measured in the presence of the test agent is indicative that said test agent inhibits kinase dimerization or the interaction between RAS and the RAS effector molecule.

In an embodiment, the donor fluorescence or bioluminescent signal is detected at about 400 nm to about 480 nm. In an embodiment, the acceptor fluorescence signal is detected at about 510 nm to about 530 nm.

Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

In the appended drawings:

FIGs. 1A to F show the development of BRET-based RAF dimerization biosensors; FIG. 1A shows BRET titration curves of membrane-targeted (CAAX box) CRAF _K D biosensor. The Rlucll and GFP10 moieties are inserted at the N-terminus of CRAF _K D- The blue open square denotes the Rlucll donor construct, whereas the green open square denotes the GFP10 acceptor construct. The non-interacting Rlucll-KRAS ^G12V / GFP10-CRAF _{KD CAA} X pair was used as a reference for non-specific BRET signals; FIG. 1 B shows titration curves of wild-type (WT) versus BRAF _K D_R509H BRET probes. The BRAF _K D BRET probes used the same configuration as the one shown for CRAF _K D in (a). The R509H mutation, which impairs side-to-side dimerization, augments BRET ₅₀ values and reduces BRET _MAX values. Double asterisks (**) denote F-test p-values smaller than 1 *10 ^~3 . Similar protein expression levels were obtained for each Rlucll or GFP10 probes (FIG. 8A); FIG. 1C shows the modulation of BRAF _K D biosensor signals upon addition (333 nM) of the indicated RAF inhibitors as assessed in titration experiments. Single asterisks (*) denote F-test p-values smaller than 1 10 ³ and double asterisks (**) smaller than 1 *10 ^~4 ; FIG. 1 D shows mutations of the kinase domain gatekeeper residue (T529M) or the side-to-side dimerization interface (R509H) impede GDC-0879-induced BRET signals. Dose-response experiments were conducted using the indicated drug concentrations; FIG. 1 E shows induction kinetics of the BRAF _K D BRET signal using 33 nM of GDC-0879. The R509H mutant was insensitive to the drug at this concentration; FIG. 1 F shows the BRAFKD homodimerization BRET assay exhibits highly reproducible signal induction (Z- factor = 0.72) upon GDC-0879 treatment (33 nM). Each experiment was repeated at least two times. Where error bars are presented, they correspond to mean values ± s.d. of biological triplicates;

FIGs. 2A to D show the profiling RAF inhibitors using RAF dimerization biosensors. FIGs. 2A and B show that the indicated BRET donor probes (within the rectangles) were systematically tested in titration experiments using BRAF _K D (FIG. 2A) or CRAF _K D (FIG. 2B) as acceptor probes. BRET ₅₀ and BRET _max values are shown in Table 1 ; FIG. 2C and 2D show dose response curves conducted with increasing concentrations of GDC-0879 (FIG. 2C), AZ- 628 (FIG. 2C), PLX4720 (FIG. 2D) and Sorafenib (FIG. 2D) (see FIG. 1 1 and Table 2) were log ₂ -transformed and converted into heatmaps. Black saturation represents positive effects on BRET signals, whereas asterisks denote negative impacts. The residue homologous to R509 of BRAF was mutated in each family member and used as negative control. Each experiment was repeated at least two times;

FIGs. 3A to D show the development of a RAS-dependent CRAF / BRAF dimerization biosensor; FIG. 3A shows titration experiment using full-length CRAF (CRAF _FL ) donor (Rlucll) probe and WT or mutant full-length BRAF (BRAF _F i_) acceptor (GFP10) probe ± mCherry-tagged KRAS ^G12V , KRAS ^Q61H , or KRAS ^S17N . The mCherry tag was used for monitoring KRAS expression. Its excitation and emission spectra do not overlap with that of our BRET donor or acceptor constructs ²⁰ . BRET ₅₀ and BRET _max values are shown in Table 3; FIG. 3B shows drug- induced BRET signals for the CRAF _FL /BRAF _FL biosensor depends on an intact dimerization interface. ND denotes not determined; FIGs. 3C and D show co-expression of mCherry-tagged KRAS ^Q61H potentiates drug-induced dimerization as measured by a decrease of the EC ₅₀ for each RAF inhibitor tested. Dose-response experiments with the indicated RAF inhibitors on the CAAX-boxed CRAF _K D/BRAF _K D biosensor produced EC _50s nearly identical to those obtained with the RAS-induced CRAF _F L/BRAF _F L biosensor. Because of their distinct intensities (for instance, biosensors in the presence of co-expressed KRAS ^Q61H yield significantly higher signals), BRET signals were normalized from 0.0 (vehicle-treated cells) to 1.0 (maximal effect of a given compound). This facilitated the comparison of the response of distinct BRET pairs to specific compounds. Each experiment was repeated at least two times. Where error bars are presented, they correspond to mean values ± s.d. of biological triplicates.

FIGs. 4A to G show that a high-throughput chemical screen (HTS) using the CRAFKD/BRAFKD biosensor identifies novel modulators of RAF dimerization; FIG. 4A shows the distribution of the compound activities in a HTS performed on 1 10,000 drug-like compounds. UM01 19603 was the most potent inducer of CRAF _K D/BRAF _K D dimerization; FIG. 4B shows that like GDC-0879, UM01 1 9603 induces the CRAF _K D/BRAF _K D BRET signal (10μΜ), but does not alter the BRET produced by the KSR1 _K D/MEK1 pair. FIG. 4C shows dose-response experiments performed with a range of SB202190 and SB203580 concentrations. Mutations of the side-to- side dimerization interface (R509H) abolished the effect of each inhibitor. GDC-0879 was used as an internal standard. EC ₅₀ value calculated for each compound is shown. FIG. 4D and E show the two p38 inhibitors (SB202190 and SB203580) induce the formation of full-length BRAF/CRAF and BRAF/BRAF dimers as demonstrated by co-immunoprecipitation (SB202190 and SB203580 were used at 10 μΜ while GDC-0879 was used at 1 μΜ). FIG. 4F shows that p38 inhibitors induce ERK phosphorylation in RAF-expressing HEK293T cells (SB202190 and SB203580 were used at 2 μΜ, while GDC-0879 was used at 1 μΜ); FIG. 4G shows dose- response experiments show that a T529M gatekeeper mutant of BRAF reduces BRAF _K D homodimerization induced either by SB202190 or SB203580. Western blots were cropped to increase clarity of the message. Each experiment was repeated at least two times. Where error bars are presented, they correspond to mean values ± s.d. of biological triplicates;

FIGs. 5A to G show that the screening of a kinase inhibitor library reveals widespread off-target effects on RAF dimerization; FIG. 5A shows the unsupervised clustering of the response of a panel of RAF dimerization BRET biosensors tested against a library of kinase inhibitors (left panel; see Table 7). For comparison, a heatmap depicting previously published in vitro RAF kinase inhibition ³⁶ is shown. Gray bars denote data not available. The right panel shows enlarged areas comprising BRET inducers; FIG. 5B shows a confirmation of the dimerization-inducing potential of selected kinase inhibitors. FLAG-BRAF was co-expressed with CRAF-Rlucll and luciferase activity was monitored in anti-Flag immunoprecipitates. Data were from triplicates and normalized to DMSO. Error bars correspond to standard deviations; FIG. 5C shows data obtained using HCT-116 cells treated (2 hrs) with increasing concentrations of the indicated compounds. pERK levels (FIG. 17) were normalized to DMSO, log ₂ -transformed and converted into heatmaps. FIG. 5D shows a correlation between concentrations causing maximal pERK levels (FIG. 5C and FIG. 17) and the BRET EC ₅₀ s for the same compounds against the CRAF _K D/BRAF _K D pair (FIG. 16); FIG. 5E shows that analytical ultracentrifugation demonstrates the ability of type I and type II p38 inhibitors to promote BRAF _K D dimerization in vitro. In contrast, the ATP analog AMP-PNP inhibits BRAF _K D dimerization. The respective position of monomeric and dimeric BRAF _K D is indicated by by the left and right lines. Peaks at or below 2 svedbergs represent artifacts of the refractive index detector system that is evident at low protein concentrations. Peak heights are not protein concentration-dependent and UV analysis did not reveal any species below 2 svedbergs;

FIGs. 6A to D show experiments aimed at probing the binding mode of RAF dimer inducers with BRAF mutant biosensors; FIG. 6A shows models for Type I (top) and Type II (bottom) kinase inhibitor-induced RAF dimerization; FIG. 6B shows that BRAF _K D R-spine (F595R or F595G) mutants can distinguish Type I from Type II inhibitors by the capacity of the latter to selectively induce the dimerization of R-spine mutant variants as monitored by BRET; FIG. 6C shows BRET saturation curves that also demonstrate the distinct ability of Type II inhibitors (AZ-628 and Nilotinib) over Type I inhibitors (GDC-0879 and SB590885) to promote dimerization of a BRAF R-spine mutant (F595R); FIG. 6D shows that co-immunoprecipitation of full-length BRAF_F595R is selectively induced by Type II, but not by Type I inhibitors. Each experiment was repeated at least two times. Where error bars are presented, they correspond to mean values ± s.d. of biological triplicates;

FIG. 7A shows the inhibition of cellular prenylation machinery after addition of GGTI- 298 and FTI-277 causes a three-fold reduction in BRAF _K D BRET signals. Cells were treated with the prenylation inhibitors for 48h at the indicated concentrations;

FIG. 7B shows that BRAF donor (Rlucll) and acceptor (GFP10) levels were not affected by prenylation inhibitors as evaluated by western blotting;

FIG. 7C shows that the BRET signal produced by the BRAF _K D biosensors was moderately fluctuating upon varying the total amount of the BRET probes, while leaving constant (5:1 ) the donor/acceptor ratios, consistent with the formation of specific BRAF _K D homodimers. In addition, the BRET signal remained high at low expression levels. In contrast, the non-interacting KRAS ^G12V BRET probes produced a weak signal that largely depended on expression levels of the probes;

FIG. 7D shows total GFP10 and Rlucll levels (two top panels) with their associated

RFU/RLU and BRET ratios (two bottom panels) as a function of specific amounts (ng) of GFP10-BRAFKD and Rlucll-BRAF _KD probes. These data are related to FIG. 2B and show that the GFP10 or Rlucll probes for BRAF _K D WT or R509H express to comparable levels, but produce distinct BRET signals;

FIGs. 8A and B show the effect of BRAF mutations on MEK phosphorylation and

BRAFKD homodimerization; FIG. 8A shows that BRAF _KD R509H and S721A mutants have a reduced capacity to induce MEK phosphorylation compared to WT. Control lanes correspond to untransfected cells; FIG. 8B shows that the S729A mutation in BRAF _K D increases the BRET ₅₀ and lowers the BRET _MAX , which is consistent with reduced dimerization. One asterisk (*) denotes p-values smaller than 1x 10 ³ and double asterisks (**) represent p-values smaller than 1x 10 ^~4 ;

FIGs. 9A and B show that RAF kinase inhibitors do not perturb intrinsic GFP10 fluorescence or luciferase activity. Rlucll-BRAFKD and GFP10-BRAF _K D constructs were co- transfected in HEK293T cells and treated with either GDC-0879 (FIG. 9A) or AZ-628 (FIG. 9B) at the indicated concentrations for 2 hrs. Intrinsic GFP fluorescence (RFU; relative fluorescence unit) and luciferase activity (RLU; relative light unit) were determined and found not to fluctuate according to the drug concentrations. Similar observations were made for the [Acceptor]/[Donor] ratios (right panels);

FIG. 10 shows that RAF family members have distinct activities towards MEK. Compared to plain HEK293T cells (control), expression of donor (Rlucll) or acceptor (GFP10) fusions of RAFKD family members described in FIGs. 2A-C induces endogenous MEK phosphorylation to variable degrees;

FIGs. 11 A to D show dose-response behaviour of BRAF _K D, CRAF _K D and

KSR1 KD/MEK1 biosensors upon treatment with ATP-competitive RAF inhibitors; FIGs. 11 A and B show dose-response curves of the BRAF _K D and CRAF _K D biosensors exposed to various concentrations (0.1 - 10 ⁴ nM) of four selected RAF inhibitors; FIG. 1 1 C shows the development of a KSR1 KD/MEKI dimerization assay. To ascertain the non-specific impact of RAF inhibitors on the BRET assay system, an assay based on the strong, constitutive association of KSR1 _K D with full-length MEK1 was developed. The optimal BRET ratio for this interaction was obtained in a configuration involving KSRIKD-RIUCI I with no CAAX box with full-length GFP10-MEK1. This assay was further validated by titration and competition experiments with the alpha G helix MEK1_F31 1 S or KSR1_W694R mutants that disrupt the KSR1 /MEK1 association in a yeast- two-hybrid assay. A recent publication describing the KSR2/MEKI crystal shows that both MEK1_F31 1 and the residue orthologous to SR1_W694 appear involved in the formation of the KSR1/MEK1 complex ³⁶ . FIG. 11 D a pharmacological perturbation of the KSR1 _K D/MEK1 assay. RAF inhibitors had no detectable effect on the KSR1 _K D/MEK1 dimer, excepted for Sorafenib, which had a marginal impact only at high doses (EC ₅₀ = 4.5 μΜ);

FIGs. 12A to D show the effect of RAF inhibitors on the RAF dimerization network.

FIG. 12A shows a schematic representation of the EC ₅₀ values listed in Table 2 for the four indicated compounds. The thickness of the lines linking two RAF family members is inversely correlated to the EC ₅₀ value observed in dose-response experiments for the induced dimers. EC ₅₀ s equal to or higher than 200 nM are not depicted. FIGs. 12B to D show the BRET _max and BRET ₅₀ parameters of the three biosensors are modulated upon addition (333 nM) of the compounds. Asterisks (*) denote a F-test p-value smaller than 10 ^~3 and double asterisks (**) smaller than 1x10 ^"4 . The dose response experiments shown in FIG. 2C enabled the detection of drug-induced BRET signal variations, which reflect changes in the way the BRET probes interact. However, they did not allow the distinction induced dimerization from conformational changes. To determine whether the compounds promote dimerization, titration experiments were conducted for three BRAF _KD pairs, namely, ARAF _K D/BRAF _K D (FIG. 12B), (c) CRAFKD/RAFKD (FIG. 12C) and KSR1 _K D/BRAF _kd (FIG. 12D) ± drug treatment. In every case where specific BRET signal induction had been detected, significant BRET ₅₀ reduction was observed, thus indicating induced dimerization;

FIG. 13 shows the dose-dependency of RAS-mediated CRAF _FL /BRAF _FL BRET signals. Titration curve experiments showing the indicated BRET pairs tested in the presence of increasing amounts of mCherry-tagged KRAS ^G12V . 250 ng = upper line; 0 ng = bottom line;

FIGs. 14A to C show that two p38 inhibitors related to RAF inhibitors promote RAF dimerization. FIG. 14A shows the structure of the p38 inhibitors SB202190 (UdeM chemical collection #: UM01 19603) and SB203580 and of two structurally-related RAF inhibitors: L779450 and SB590885; FIGs. 14B and C show a comparison of co-crystal structures of BRAF and SAPK2 (p38), respectively, with the SB590885 (PDB ID #: 2FB8) and SB203580 (PDB ID #: IA9U) structural analogs. The two compounds show a similar pose within the ATP-binding site of the respective kinase domains;

FIGs. 15A to F show the chemical structure of kinase inhibitors displaying off-target effects on RAF dimerization. The inhibitors are classified according to their primary targets. The inhibitors classified as Type 1 are SB590885, GDC-0879, PLX4720, PLX4032, SB203580, PD169316, SB202190, p38 MAPK inhibitor, SKF-86002 and Dasatinib; Type II inhibitors are AZ-628, Sorafenib, BIRB796, Imatinib, Nilotinib, Tivozanib and VEGFR inhibitor II. Available PDB structures that include the displayed inhibitors are listed besides the structures. The RAF dimer-inducing activity for inhibitors with an asterisk was validated by co-immunoprecipitation (LUMIER assay; FIG. 5B) and BRET dose-response experiments (FIG. 16). Inhibitors with double asterisks were also confirmed by analytical ultracentrifugation (FIG. 5E and FIG. 19). 1 Co-structure was obtained using close structural analogues of the depicted compounds;

FIG. 16A and B show BRET-based dose-response curves for kinase inhibitors displaying off-target effects on RAF dimerization. FIG. 16A shows dose-response experiments respectively performed on WT/WT (upper curves) and WT/R509 (bottom curves) Rlucll- CRAF _KD /GFP10-BRAFKD biosensors. FIG. 16B shows the EC ₅₀ s (nM) determined from the dose-response experiments shown in FIG. 16A. ND (not determined);

FIG. 17 shows that kinase inhibitors with off-target effects on RAF dimerization exhibit paradoxical ERK activation specifically in KRAS mutant cells. KRAS mutant cells (HCT-1 16) and BRAF mutant cells (COL0205) were treated with a range of concentrations of the indicated compounds. Two hours upon treatment, phospho-ERK (pERK) levels were determined. Data are normalized to DMSO alone controls. Although more weakly than in KRAS mutant cells TWS1 19 shows some paradoxical ERK activation in BRAF mutant cells.

FIGs. 18A to F show that kinase inhibitors with off-target effects on RAF dimerization directly bind the RAF catalytic cleft in vitro. FIG. 18A shows that the saturation of the TR-FRET signal between LANCE® Europium-coupled anti-His antibody (Perkin Elmer®) and the Alexa Fluor® 647-labeled kinase tracer (Invitrogen) is obtained by increasing amounts of His-tagged BRAF kinase domain, but not with the two unrelated His-tagged proteins, BUD32 and HRIab. FIGs. 18B to E show dose-response experiments used to determine the IC ₅₀ of four RAF inhibitors (FIG. 18B), three p38 inhibitors (FIG. 18C), three BCR-ABL inhibitors (FIG. 18D), and two VEGFR inhibitors as well as a GSK3 (TWS1 19) and an MNK1 inhibitor (FIG. 18E). The MEK inhibitor U0126 and DMSO were used as negative controls (b). FIG. 18F shows a correlation between TR-FRET-based IC ₅₀ s for the binding of the indicated drugs to RAF and their BRET EC ₅₀ s as determined with the BRAF/BRAF biosensors;

FIGs. 19A and B show that kinase inhibitors promote BRAF kinase domain dimerization in vitro. Analytical ultracentrifugation (AUC) experiments demonstrate the ability of the indicated kinase inhibitors to promote the formation of BRAF dimers in vitro using various concentrations (shown to the left in FIG. 19A) of purified human BRAF kinase domain proteins. In contrast, ADP prevents BRAF dimerization. The respective position of monomeric and dimeric BRAF is indicated by the left and right lines. Peaks at or below 2 svedbergs represent artifacts of the refractive index detector system that is evident at lower protein concentrations. Peak heights are not protein concentration-dependent and UV analysis did not reveal any species below 2 svedbergs.

FIGs. 20A and 20B show available co-crystal structures (PDB number is shown in parenthesis) for Type 1 (FIG. 20A) and type II (FIG. 20A) inhibitors that were identified for their ability to promote RAF dimerization (FIG. 5);

FIG. 21 shows that Type 1 and Type II kinase inhibitors can both promote the alignment of the catalytic (C) and regulatory (R) spines. Co-crystal structures of BRAF with a Type 1 inhibitor (SB590885; PDB ID#: 2FB8) and a Type II inhibitor (Sorafenib; PDB ID#: 1 UWJ).

FIG. 22A to D show models explaining the behavior of specific RAF mutants in response to Type 1 or type II kinase inhibitor treatment. FIG. 22A shows that The F595G and F595R mutations in BRAF _K D biosensors reduce dimerization-dependent BRET signals compared to WT. FIG. 22B shows a model of the predicted response of R-spine F595G RAF mutant to Type 1 versus Type II inhibitors. FIGs. 22C and D show that the binding of Type 1 and Type II inhibitors to WT and F595G BRAF was monitored using a drug-binding assay exploiting TR-FRET; FIG. 23 shows a 3.1 A structure of BRAF in complex with BIRB796. BIRB796 occupies the ATP binding site of BRAF using a Type II binding mode. Boxed region shows in stereo, a close-up the ATP binding cleft. Note F595 adopts the DFG-out configuration;

FIG. 24 shows that compound 39 promotes PERK kinase domain dimerization in vitro. Analytical ultracentrifugation (AUC) experiments demonstrate the ability of compound 39, a PERK inhibitor, to promote the formation of PERK dimers in vitro using various concentrations (shown to the left) of purified murine PERK kinase domain proteins. In contrast, ADP weakly induces PERK dimerization. The respective position of monomeric and dimeric PERK is indicated by the left and right lines. Peaks at or below 2 svedbergs represent artifacts of the refractive index detector system that is evident at low protein concentrations. Peak heights are not protein concentration-dependent and UV analysis did not reveal any species below 2 svedbergs;

FIGs. 25A to E show the amino acid sequences of RAF family members ARAF (FIG. 25A, SEQ ID NO: 37, UniprotKB No. P10398, RBD = about residues 19-91 ), BRAF (FIG. 25B, SEQ ID NO: 38, UniprotKB No. P15056, RBD = about residues 155-227), CRAF (FIG. 25C, SEQ ID NO: 39; UniprotKB No. P04049, RBD = about residues 56-131 ), KSR1 (FIG. 25D, SEQ ID NO: 40, UniprotKB No. Q8IVT5) and KSR2 (FIG. 25E, SEQ ID NO: 41 , UniprotKB No. Q6VAB6);

FIGs. 26A to D show the amino acid sequences of eukaryotic translation initiation factor 2-alpha (elF2a) family members PERK (FIG. 26A, SEQ ID NO: 42), GCN2 (FIG. 26B,

SEQ ID NO: 43), PKR (FIG. 26C, SEQ ID NO: 44) and HRI (FIG. 26D, SEQ ID NO: 45);

FIGs. 27A to C show the amino acid sequences of human RALGDS isoform 1 (FIG.

27A, UniprotKB No. Q12967-1 , SEQ ID NO: 50), isoform 2 (FIG. 27B, UniprotKB No. Q12967-2,

SEQ ID NO: 51 ) and isoform 3 (FIG. 27C, UniprotKB No. Q12967-3, SEQ ID NO: 52). The putative RBD spans about residues 798 to 885 of SEQ ID NO: 50;

FIGs. 28A and B show the amino acid sequences of human RGL1 isoform A

(UniprotKB No. Q9NZL6-1 , SEQ ID NO: 53) and isoform B (FIG. 28B, UniprotKB No. Q9NZL6-

2, SEQ ID NO: 54). The putative RBD spans about residues 648 to 735 of SEQ ID NO: 53; FIG.

28C shows the amino acid sequence of human RalGDS-like 2 (RGL2) (FIG. 28A, UniprotKB No. 01521 1 , SEQ ID NO: 55). The putative RBD spans about residues 648 to 735: 56; FIGs.

28D and E show the amino acid sequences of human RalGDS-like 3 (RGL3) isoform 1 (FIG.

28D, UniprotKB No. Q3MIN7-1 , SEQ ID NO: 56) and isoform 2 (FIG. 28E, UniprotKB No.

Q3MIN7-2, SEQ ID NO: 57). The putative RBD spans about residues 613 to 700 of SEQ ID NO:

56;

FIGs. 29A and B show the amino acid sequences of human HRAS isoform 1 (FIG.

29A, UniprotKB No. P01 1 12-1 , SEQ ID NO: 58) and isoform 2 (FIG. 29B, UniprotKB No. P01 1 12-2, SEQ ID NO: 59); FIG. 29C shows the amino acid sequence of human NRAS (UniprotKB No. P01 1 1 1 , SEQ ID NO: 60); FIGs. 29D and E show the amino acid sequences of human KRAS isoform 2A (FIG. 29D, UniprotKB No. P01 1 16-1 , SEQ ID NO: 61 ) and isoform 2B (FIG. 29E, UniprotKB No. P01 1 16-2, SEQ ID NO: 62). The putative RBD spans about residues 217 to 309;

FIG. 30A shows the amino acid sequence of human phosphatidylinositol 4,5- bisphosphate 3-kinase catalytic subunit gamma isoform (ρ1 10γ) (UniprotKB No. P48736), SEQ ID NO: 63). The putative RBD spans about residues 217 to 309; FIG. 30B shows the amino acid sequence of human phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform (p1 10a) (UniprotKB No. P42336), SEQ ID NO: 64). The putative RBD spans about residues 187 to 289;

FIG. 31 shows RAS/effector protein-protein interactions as described herein. RAS proteins are GTPases that, under physiological conditions, cycle between two conformational states: active RAS is bound to GTP while inactive RAS is bound to GDP. These transitions are regulated by RAS-GTPase activating proteins (RAS-GAPs) and RAS-guanine nucleotide exchange factors (RAS-GEFs). Once bound to GTP, active RAS proteins physically interact with downstream effectors that in turn control distinct signaling pathways. RAS effectors include RAF kinases, RALGDS and the p1 10 catalytic subunits of PI3K (ρ1 10α, ρ1 10β and ρ1 10γ). These three classes of effector proteins comprise a similar domain named the RAS-Binding Domain (RBD) that interacts with the effector loop region of RAS proteins. Activating mutations in any of the three RAS proteins (HRAS, KRAS or NRAS) are detected in approximately 30% of human cancers (KRAS mutations comprise 86% of all RAS mutations). The most frequent tumorigenic RAS mutations are found at residues G12, G13 and Q61. They invariably impair the GTPase cycle by impeding their sensitivity to RAS-GAP and RAS-GEF action thereby inducing a permanently active GTP-bound state that constitutively signals to downstream pathway components;

FIG. 32 shows the general principle of the BRET assay and design of the RAS-effector probes developed herein. The RAS proteins are fused at their N-terminus with a Rlucll (donor constructs), while the effectors (either RBD or full length) were cloned in GFP-tagged receptor constructs. Construct boundaries for each donor and acceptor construct as well as the orientation (N- or C-terminal) of Rlucll and GFP10 tags are given in Table 5. RAS proteins can be either of HRAS, NRAS or KRAS. The effector used as an acceptor construct can comprise either a RAF family protein, RALGDS or a p1 10 catalytic subunits of PI3K;

FIGs. 33A to C show that BRET allows the specific detection of the RAS-effector interaction with the BRAF ^RBD . FIG. 33A shows the interaction between the BRAF ^RBD and the three constitutively activated oncogenic RAS proteins (HRAS ^G12V , NRAS ^G12V and KRAS ^G12V ). FIG. 33B shows that BRET detects perturbations of the RAS GTP cycle. KRAS ^G12V (the active form) has the highest ability to associate with BRAF ^RBD compared with wild-type KRAS, which has intermediate binding strength and KRAS ^S17N (the dominant negative form), which does not interact and thereby produces background signals. FIG. 33C shows that various oncogenic KRAS mutations bind with BRAF ^RBD in a similar manner;

FIGs. 34A to F show a characterization of the BRET probes detecting the interaction between RAS and acceptor constructs comprising the isolated BRAF ^RBD or the full-length BRAF protein. BRET titration curves allow the detection of a strong and specific signal for the interaction between HRAS ^G12V and BRAF ^RBD (FIG. 34A) and with BRAF ^FL (FIG. 34B). Similar results were obtained using Rlucll-KRAS ^G12V as the donor construct (FIGs. 34C and D). Introducing the R188L point mutation in the BRAF ^RBD significantly altered the BRET signal. This mutation was previously shown to abrogate the RAS-RAF interaction. Similarly, expression of _KRAS si7N _{Qr H RAS} si7N _{does not sustain the} interaction with either BRAF ^RBD or BRAF ^FL as measured by BRET. FIG. 34E shows that type II BRET analysis confirms that interaction between KRAS ^G12V and BRAF ^RBD probes is specific and does not result from a non-specific signal due to protein crowding at the cell membrane. Even transfected with a small amount of both donor and acceptor plasmids, the pair of KRAS ^G12V / BRAF ^RBD probe gives a signal stronger than a non-interacting pair (here KRAS ^G12V / BRAF ^RBD with the R188L mutation). FIG. 34E shows that competitive assay also confirms the specificity of the KRAS ^G12V / BRAF ^RBD BRET signal. This probe's signal can be inhibited by co-expression of an excess of cold mCherry-CRAF but not of mCherry-MEK1. Western blotting shows that the expression levels of the BRET probes are not affected by co-expression of mCherry-tagged proteins;

FIGs. 35A to F show a characterization of the BRET probes detecting the interaction between RAS and acceptor constructs comprising the isolated RALGDS ^RBD or the full-length RALGDS protein. BRET titration curves allow the detection of a strong and specific signal for the interaction between HRAS ^G12V and RALGDS ^RBD (FIG. 35A) and with RALGDS ^FL (FIG. 35B). Similar results were obtained using Rlucll-KRAS ^G12V as the donor construct (FIGs. 35C and D). Introducing a point mutation that abrogates the RAS-RALGDS interaction in the RALGDS ^RBD (K835E) significantly reduced the BRET signal. Similarly, expression of KRAS ^S17N or HRAS ^S17N does not sustain the interaction with either RALGDS ^RBD or RALGDS ^FL as measured by BRET signal. FIG. 35E shows that type II BRET analysis confirms that interaction between KRAS ^G12V and RALGDS ^RBD probes is specific and does not result from a non-specific signal due to protein crowding at the cell membrane. Even transfected with a small amount of both donor and acceptor plasmids, the pair of KRAS ^G12V / RALGDS ^RBD probe gives a signal stronger than a non- interacting pair (here KRAS ^G12V / RALGDS ^RBD with the K835E mutation). FIG. 35F shows that competitive assay also confirms the specificity of the KRAS ^G12V / BRAF ^RBD BRET signal. This probe's signal can be inhibited by co-expression of an excess of cold mCherry-CRAF but not of mCherry-MEK1. Western blotting shows that the expression levels of the BRET probes are not affected by co-expression of mCherry-tagged proteins; FIGs. 36A to D show a characterization of the BRET probes detecting the interaction between RAS and acceptor constructs comprising the RAS-binding domain or full-length p1 10 subunits (α, β and γ) of PI3K. BRET titration experiments between HRAS ^G12V and p1 10a ^RBD (FIG. 36A), p1 10β ^ΚΒΟ (FIG. 36B) and p1 10γ ^ΚΒΟ (FIG. 36C). Only p1 10a ^RBD and p1 10y ^RBD show a specific BRET signal in this setup; the p1 10β subunit was recently shown to be devoid of RAS- binding activity and rather signals in a Rho GTPase-dependent manner (Ref. 55). Introducing the K227E and K255E point mutations in the p1 10a ^RBD (FIG. 36A) and p1 10y ^RBD (FIG. 36C) significantly reduced the observed BRET signals. These mutations were previously shown to abrogate these proteins' interaction with RAS (Ref. 56). FIG. 36D shows that BRET allows the detection of the interaction between HRAS ^G12V and p1 10y ^FL . Expression of dominant negative HRAS ^S17N does not sustain this interaction as judged with BRET titration curves.

FIG. 37 shows the screening tier employed to identify specific modulators of the KRAS/BRAF ^RBD interaction by high-throughput chemical screening. Representation of a typical BRET screening tier. Primary screen hits were counter-screened with unrelated BRET assays and re-confirmed in tetraplicates. The 133 compounds that passed these criteria were analyzed by medicinal chemists. Finally, 27 confirmed hits were reordered from commercial vendors and tested in dose-response experiments in the BRET assay (see FIG. 38). Secondary assays to validate hits include co-immunoprecipitation (co-IP) experiments on exogenous and endogenous RAS/RAF complexes as well as phospho-MAPK and proliferation assays in cancer cell lines;

FIGs. 38A to C show the secondary assays confirm the activity of four compounds identified by high-throughput chemical screening of the KRAS/BRAF BRET probe FIGs. 38A and B show that compounds 2, 8, 17 and 23 inhibit the KRAS ^G12V / BRAF ^RBD and KRAS ^G12V / BRAF ^FL BRET interactions in a dose-dependent manner. The effect of the four compounds appears specific as the dimerization between BRAF ^KD and CRAF ^KD was not significantly modulated. FIG. 38C show that a co-immunoprecipitation confirms that the hits identified using BRET biosensors can alter endogenous BRAF interaction with transfected flag-tagged KRAS ^G12V . The complexes were immunoprecipitated with anti-FLAG antibody, separated by SDS-PAGE and revealed using the protocol described below.

Table 1 : BRETmax and BRET50 values of RAF family dimerization biosensors. BRET _max and BRET ₅₀ parameters were obtained from the data displayed in FIGs. 2A-B by fitting the saturation curves with a one-site-binding hyperbolic function using the Prism™ 5.04 software

(GraphPad™ Software). Donor Acceptor BRET^ BRET _M R square

ARAFKD BRAFKD 1.89 ± 0.07 1.07 ± 0.11 0.975

BRAF _KD BRAF _KD 4 43 ± 0.11 0.24 ± 0.03 0.968

CRAFKD BRAFKD 2.43 ± 0.09 0.27 ± 0.04 0.921

KSR1 KD BRAFKD 2 06 ± 0.08 0.89 ± 0.10 0 958

KSR2«D BRAFKD 1.30 ± 0.08 0.84 ± 0.14 0.969

ARAF KD CRAFKD D 92 ± 0.02 0.43 ± 0.04 0.989

BRAFKD CRAFKD D.45 ± 0.02 0.07 ± 0.01 0.945

CRAF KD CRAFKD D 89 ± 0 02 0.09 ± 0 01 0 968

KSR1 D CRAFKD D.99 ± 0.01 0.38 ± 0.02 0.992

KSR2KD CRAFKD D 78 ± 0.03 0.33 ± 0.05 0 961

Table 2: RAF inhibitors exhibit distinct dimer-promoting ability as determined using BRET biosensors. The calculated maximum BRET fold increase (expressed in Log ₂ ) and EC ₅₀ values derived from experiments shown in FIG. 2C and FIG. 1 1 are listed for each individual BRET pair treated with the four indicated RAF inhibitors. EC ₅₀ s were calculated using a log(agonist) versus response fitting with the Prism™ 5.04 analysis package (GraphPad™

Software).

Donor Acceptor Max Log ₂ (fold increase) EC^ (nM) R square

Inhibitor

GDC-0879

ARAFKD BRAFKD 0,84 129,00 0,996

BRAFKD BRAFKD 0,82 16,24 0,998

CRAFKD BRAFKD 1 ,25 60,90 0,996

KSRI KD BRAFKD 0,47 3,32 0,949

KSR2KD BRAFKD 0, 14 ND ND

ARAFKD CRAFKD 1 ,03 531,10 0,997

BRAFKD CRAFKD 2,47 7,00 0,944

CRAFKD CRAFKD 1 ,98 103,00 0,998

KSRI KD CRAFKD 0,57 30,69 0,984

KSR2RD CRAFKD 0,11 ND ND

KSR1 MEK1 0,00 ND ND

AZ-628

ARAFKD BRAFKD 0,54 84,34 0,994

BRAFKD BRAFKD 0,77 20,49 0,997

CRAFKD BRAFKD 1 ,08 9,68 0,993

KSRI KD BRAFKD 0,20 ND ND

KSR2 D BRAFKD -0,02 ND ND

ARAFKD CRAFKD 0,61 225,70 0,992

BRAFKD CRAFKD 2,41 4,71 0,956

CRAFKD CRAFKD 1 ,42 14,31 0,993

KSRI KD CRAFKD 0,48 31 ,43 0,991

KSR2KD CRAFKD 0,12 193,40 0,970

KSR1 MEK1 -0,02 ND ND

PLX4720

ARAFKD BRAFKD 0,45 ND ND

BRAFKD BRAFKD 0,44 ND ND

CRAFKD BRAFKD 1 ,23 577,20 0,992

KSRI KD BRAFKD 0,14 ND ND

KSR2KD BRAFKD 0,07 ND ND

ARAFKD CRAFKD 0,19 ND ND

BRAFKD CRAFKD 2,88 184,80 0,989

CRAFKD CRAFKD 1 ,29 132,40 0,997

KSRI KD CRAFKD 0, 15 ND ND

KSR2KD CRAFKD -0,02 ND ND

KSR1 MEK1 0,02 ND ND

Sorafenib

ARAFKQ BRAFKD 0,45 3522,00 0,951

BRAFKD BRAFKD 0,86 401 ,40 0,998

CRAFKD BRAFKD 1 ,03 227,50 0,992

KSRI KD BRAFKD ND ND ND

KSR2KD BRAFKD ND ND ND

ARAFKD CRAFKD 0,27 3298,00 0,948

BRAFKD CRAFKD 1 ,42 64,42 0,914

CRAFKD CRAFKD 0,66 113,40 0,990

KSRI KD CRAFKD 0,30 853,80 0,978

KSR2KD CRAFKD 0,24 ND ND

KSR1 MEK1 0,27 4561 ,00 0,939 Table 3: BRET _max and BRET ₅₀ values of RAF family dimerization biosensors. BRET _max and BRET ₅₀ parameters were obtained by fitting the saturation curve data shown in FIG. 3A with a one-site-binding hyperbolic fitting using the Prism™ 5.04 software (GraphPad™ Software).

Donor Acceptor m Cherry B ET _max BRET 50 R square

CRAF FL BRAF FL - 0,83 ± 0,09 2,73 ± 0,57 0,966

CRAF FL BRAF FL KRAS ^G12V 0,68 ± 0,03 0,14 ± 0,02 0,950

CRAF FL BRAF FL KRAS ^W1H 0,72 ± 0,02 0,18 ± 0,02 0,959

CRAF FL BRAF FL KRAS ^S17N 0,80 ± 0,09 2,90 ± 0,57 0,981

CRAF FL BRAF FL ^R5D9H RAS ^G12V 0,78 ± 0,03 0,60 ± 0,05 0,989

CRAF FL BRAF FL ^K1B8L KRAS ^G1ZV 0,40 ± 0,03 1 ,32 ± 0,21 0,980 DISCLOSURE OF INVENTION

In the studies described herein, the present inventors have developed sensitive and reproducible BRET-based biosensors and related assays that permit the real-time monitoring of interactions between proteins of the RAS signaling pathway, notably the dimerization of kinase domains of RAF family members and the interaction between RAS and RAS effector molecules, in living cells. They have shown that this biosensor and related assay are useful to assess the effect of mutations or agents (e.g., small molecules) on RAS/RAF activity, and thus may be useful to identify modulators of the RAS-RAF-MEK-ERK pathway. The data disclosed herein further provides evidence that the approach disclosed herein may be suitable to monitor the dimerization of other kinases that are regulated by dimer-induced allosteric mechanism, such as kinases of the elF2a kinase family (e.g., PERK kinase).

Accordingly, in a first aspect, the present invention provides a resonance energy transfer (RET)-based biosensor, e.g., a fluorescence or bioluminescence resonance energy transfer (FRET or BRET)-based biosensor, for quantitative detection of protein-protein interaction (e.g., dimerization) of kinases whose activity is regulated by dimerization (e.g., dimer-induced allosteric mechanism) in a living cell.

In another aspect, the present invention provides a resonance energy transfer (RET)- based biosensor, e.g., a fluorescence or bioluminescence resonance energy transfer (FRET or BRET)-based biosensor for quantitative detection of the interaction (e.g., dimerization) between RAS and RAS effector molecules in a living cell.

In another aspect, the present invention provides a RAS/RAS effector molecule interaction biosensor comprising: a cell expressing: (a) a first fusion molecule comprising: (i) a polypeptide comprising a RAS-binding domain (RBD) of a RAS effector molecule; (ii) a donor fluorescent or bioluminescent protein having an emission spectrum, covalently linked to said polypeptide; and (b) a second fusion molecule comprising: (i) a RAS polypeptide; and (ii) an acceptor fluorescent protein having an excitation spectrum, covalently linked to said RAS polypeptide, wherein the emission spectrum of said donor fluorescent or bioluminescent protein overlaps with the excitation spectrum of said acceptor fluorescent protein. In another aspect, the present invention provides a kinase dimerization biosensor comprising: (a) a first fusion molecule comprising: (i) a first kinase domain (KD1 ) of a first kinase regulated by kinase domain dimerization; (ii) a donor fluorescent or bioluminescent protein having an emission spectrum, covalently linked to said KD1 ; (iii) a first targeting moiety (TM1 ) covalently linked to said KD1 or said donor fluorescent or bioluminescent protein; (b) a second fusion molecule comprising: (i) a second kinase domain (KD2) of a second kinase regulated by kinase domain dimerization; (ii) an acceptor fluorescent protein having an excitation spectrum, covalently linked to said KD2, wherein the emission spectrum of said donor fluorescent or bioluminescent protein overlaps with the excitation spectrum of said acceptor fluorescent protein; and (iii) a second targeting moiety (TM2) covalently linked to said KD2 or said acceptor fluorescent or bioluminescent protein. In an embodiment, the biosensor further comprises a cell expressing the above-mentioned first and/or second fusion molecules.

Dimerization (protein-protein interaction) as used herein includes both homodimerization (i.e., dimerization between two identical proteins, e.g., two identical kinase domains) as well as heterodimerization (i.e., dimerization between two different proteins, e.g., two different kinase domains).

The term "biosensor" as used herein refers to a type of biomolecular probe that allows the assessment of the presence or concentration of biological molecules, biological structures, activity state etc., by translating a biochemical interaction at the probe surface into a quantifiable physical signal such as light or electric pulse.

Resonance energy transfer (abbreviated RET) is a mechanism describing energy transfer between two chromophores, having overlapping emission/absorption spectra. When the two chromophores (the "donor" and the "acceptor"), are within a short distance (e.g., 10-100 Angstroms) of one another and their transition dipoles are appropriately oriented, the donor chromophore is able to transfer its excited-state energy to the acceptor chromophore through non-radiative dipole-dipole coupling. One type of RET is Bioluminescence Resonance Energy Transfer (BRET) that is based on the non-radiative transfer of energy between a donor bioluminophore (bioluminescent enzyme such as luciferase) and an acceptor fluorophore (ex: GFP or YFP). Another type of RET is Fluorescence Resonance Energy Transfer (FRET) involves the transfer of energy from an excited donor fluorophore to an adjacent acceptor fluorophore. For example, CFP and YFP, two color variants of GFP, can be used as donor and acceptor, respectively.

The term "kinases regulated by kinase domain dimerization" refers to kinases whose activity is modulated or regulated through dimerization of their kinase domain. Examples of such kinases include kinases of the RAF family such as ARAF, BRAF, CRAF (RAF1 ), KSR1 and KSR2 as well as kinases of the eukaryotic translation initiation factor 2-alpha (elF2a) family such as EIF2AK1 (HRI), EI F2AK2 (PKR), EIF2AK3 (PERK) and EIF2AK4 (GCN2). The term "kinase domain" as used herein refers to the domain in a protein kinase that is responsible for the kinase activity, i.e. to catalyse the transfer of phosphate, usually from ATP, to a substrate such as a protein (protein phosphorylation). The kinase domain in protein kinases are known and/or may be identified (e.g., by sequence similarity/comparison to known kinase domains) by the skilled person. The putative residues defining the kinase domain of various kinases regulated by kinase domain dimerization, according to UniProtKB, are depicted below:

In an embodiment, the kinase domain of ARAF comprises about residues 301 -606. In an embodiment, the kinase domain of BRAF comprises about residues 448-766. In an embodiment, the kinase domain of CRAF comprises about residues 340-648. In an embodiment, the kinase domain of KSR1 comprises about residues 602-921. In an embodiment, the kinase domain of KSR2 comprises about residues 657-950.

The term kinase domain encompasses variants and fragments of native kinase domains that retain the ability to dimerize. In embodiments, the kinase domain comprises a region or fragment of at least 100, 150, 200, 250, 300, 350 or 400 amino acids of the native kinase domains, e.g., the native kinase domains defined above. "Variant" as used herein refers to a kinase domain in which one or more of the amino acids of the native kinase has/have been modified, but which retains the ability to dimerize. The modification may be, for example, a deletion of one or more consecutive or non-consecutive amino acids, a substitution of amino acids, one or more substitution(s) of a naturally occurring amino acid (L-amino acid) by a corresponding D-amino acid, an extension of the sequence by e.g., one, two, three or more amino acids. In an embodiment, the above-mentioned substitution(s) are conserved amino acid substitutions. As used herein, the term "conserved amino acid substitutions" (or sometimes "conservative amino acid substitutions") refers to the substitution of one amino acid for another at a given location in the native kinase domain polypeptide, where the substitution can be made without substantial loss of the relevant function. In making such changes, substitutions of like amino acid residues can be made on the basis of relative similarity of side-chain substituents, for example, their size, charge, hydrophobicity, hydrophilicity, and the like, and such substitutions may be assayed for their effect on the function (dimerization) of the native kinase domain polypeptide by routine testing. In an embodiment, the above-mentioned construct comprises the full-length native kinase (i.e. comprising the kinase domain as well as the other domains of the native protein) or a fragment/variant thereof, e.g. a kinase having the sequences depicted in FIGs. 25A-E or 26A-D (SEQ ID NOs: 37-45), or a fragment/variant thereof.

In an embodiment, the variant and/or fragment has an identity or similarity of at least 60% with a native kinase or native kinase domain polypeptide and retains the ability to dimerize. In further embodiments, the variant and/or fragment has a similarity or identity of at least 65, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% with a native kinase or native kinase domain polypeptide and retains the ability to dimerize. In other embodiments, the variant and/or fragment has an identity or similarity of at least 60, 65, 70, 75, 80, 85, 90, 91 , 92, 93, 94, 95, 96, 97, 98 or 99% with the native kinase or native kinase domains defined above (FIGs. 25A-E or 26A-D, SEQ ID NOs: 37-45).

"Similarity" and "identity" refers to sequence similarity/identity between two polypeptide molecules. The similarity or identity can be determined by comparing each position in the aligned sequences. A degree of similarity or identity between amino acid sequences is a function of the number of matching or identical amino acids at positions shared by the sequences. Optimal alignment of sequences for comparisons of similarity or identity may be conducted using a variety of algorithms, such as the local homology algorithm of Smith and Waterman, 1981 , Adv. Appl. Math 2: 482, the homology alignment algorithm of Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443, the search for similarity method of Pearson and Lipman, 1988, Proc. Natl. Acad. Sci. USA 85: 2444, and the computerized implementations of these algorithms (such as GAP, BESTFIT, FASTA and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, Madison, Wis., U.S.A.). Sequence similarity or identity may also be determined using the BLAST algorithm, described in Altschul et al., 1990, J. Mol. Biol. 215: 403-10 (using the published default settings). Software for performing BLAST analysis may be available through the National Center for Biotechnology Information web site (http://www.ncbi.nlm.nih.gov/). The BLAST algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. Initial neighborhood word hits act as seeds for initiating searches to find longer HSPs. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when the following parameters are met: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program may use as defaults a word length (W) of 1 1 , the BLOSUM62 scoring matrix (Henikoff and Henikoff, 1992, Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10 (or 1 or 0.1 or 0.01 or 0.001 or 0.0001 ), M=5, N=4, and a comparison of both strands. One measure of the statistical similarity between two sequences using the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. In alternative embodiments of the invention, nucleotide or amino acid sequences are considered substantially identical if the smallest sum probability in a comparison of the test sequences is less than about 1 , preferably less than about 0.1 , more preferably less than about 0.01 , and most preferably less than about 0.001.

Furthermore, the term also encompasses any fusion of a kinase domain or full length/native kinase (or a functional variant/fragment thereof), with another polypeptide.

The term "RAS-binding domain (RBD) of a RAS effector molecule" as used herein refers to the domain in a RAS effector molecule that is responsible for the protein-protein interaction with RAS. The RBD in RAS effector molecules are known and/or may be identified (e.g., by sequence similarity/comparison to known RBD) by the skilled person. The putative residues defining the kinase domain of various RAS effector molecules, according to UniProtKB, are depicted below:

In an embodiment, the RBD of BRAF comprises about residues 146-237. In an embodiment, the RBD of RALGDS comprises about residues 788-893. In an embodiment, the RBD of ρ1 10γ comprises about residues 193-322. In an embodiment, the RBD of p1 10a comprises about residues 163-302.

The term RAS-binding domain (RBD) encompasses variants and fragments of the native RBD that retain the ability to bind to RAS. Variants and fragments are as defined above in respect of the kinase domain. The polypeptide comprising a RAS-binding domain (RBD) of a RAS effector molecule may comprise only the RBD (or a functional variant/fragment thereof), or the full length/native RAS effector molecule (or a functional variant/fragment thereof), or any fragment/portion of the full length/native RAS effector molecule that comprises the RBD (or a functional variant/fragment thereof). Furthermore, the term also encompasses any fusion of RBD or full length/native RAS effector molecule (or a functional variant/fragment thereof), with another polypeptide.

The term "RAS effector molecule" refers to molecules that interact with RAS and activate a RAS effector pathway (see, e.g., FIG. 31 ). A first family of RAS effector molecules is the RAF family of proteins (RAF-1 , ARAF, and BRAF) that are serine/threonine kinases that bind to the effector region of RAS-GTP, thus inducing translocation of the protein to the plasma membrane. Once there, RAF proteins are activated and phosphorylated by different protein kinases. Active RAF phosphorylates MEK that, in turn, phosphorylates and activates extracellular signal-regulated kinases 1 and 2 (ERK1/2). A second family of RAS effector molecules is phosphoinositide 3-kinases (PI3Ks), and more specifically class I PI3Ks. When active, PI3K converts phosphatidylinositol (4,5)-bisphosphate (PIP ₂ ) into phosphatidylinositol (3,4,5)-trisphosphate (PIP ₃ ). PIP ₃ , in turn, binds the pleckstrin homology (PH) domain of Akt/PKB, stimulating its kinase activity, resulting in the phosphorylation of a host of other proteins that affect cell growth, cell cycle entry, and cell survival. The p1 10γ and p1 10a subunits of class I PI3Ks are known to interact with RAS. Another RAS effector pathway involves Ral- GEF proteins. RalGEF members, which include RalGDS, RGL, RGL2, and RGL3, link RAS proteins to activation of the RalA and RalB small GTPases. Other molecules that have been shown to specifically interact with RAS are Tiaml , p120GAP, NF1 , MEKK1 , Rin1 , AF-6, PKC-ζ, Norel and Canoe. In an embodiment, the RAS effector molecule is a RAF protein, RalGDS or a p1 10 subunit (e.g., p1 10γ or p1 10a).

The term "RAS polypeptide" has used herein refers to a protein binding to GDP/GTP, possessing intrinsic GTPase activity and capable of activating effector molecules in the RAS pathway. It includes native HRAS, NRAS and KRAS, as well as active fragments/variants thereof that maintain the ability to activate effector molecules in the RAS pathway. It includes for example activated GTP-locked RAS that comprises substitutions at position 12 (e.g., G12V) or 61 (e.g., Q61 L , Q61 K, Q61 I, Q61V) relative to native RAS.

As used herein, the term "fluorescent protein" refers to any protein that becomes fluorescent upon excitation at an appropriate wavelength. A broad range of fluorescent proteins have been developed that feature fluorescence emission spectral profiles spanning almost the entire visible light spectrum. Non-limiting examples of green Fluorescent Protein include EGFP, GFP10, Emerald, Superfolder GFP, Azami Green, mWasabi, TagGFP, TurboGFP, AcGFP, ZsGreen and T-Sapphire. Non-limiting Examples of blue fluorescent protein include EBFP, EBFP2, Azurite and mTagBFP. Non-limiting examples of Cyan Fluorescent proteins include ECFP, mECFP, Cerulean, mTurquoise, CyPet, AmCyanl , Midori-lshi Cyan, TagCFP, mTFP1 (Teal). Non-limiting examples of Yellow fluorescent proteins include EYFP, Topaz, Venus, mVenus, mCitrine, mAmetrine, YPet, TagYFP, PhiYFP, ZsYellowl and mBanana. Non-limiting Examples of orange fluorescent proteins include Kusabira Orange, Kusabira Orange2, mOrange, mOrange2, dTomato, dTomato-Tandem, TagRFP, DsRed, DsRed2, DsRed-Express (T1 ), DsRed-Monomer and mTangerine. Non-limiting Examples of red fluorescent proteins include mRuby, mApple, mStrawberry, AsRed2, mRFP1 , JRed, mCherry, HcRedl , mRaspberry, dKeima-Tandem, HcRed-Tandem, mPlum and AQ143.

Overlap" as used in the context of the present invention refers to the ability of the emitted light from a donor fluorescent protein or a luminescent enzyme (e.g., luciferase) to be of a wavelength capable of excitation of a fluorophore (acceptor fluorescent protein) placed in close proximity, usually within about 10-100 A (about 1-10 nm). Accordingly, the donor fluorescent or luminescent protein and the acceptor fluorescent protein are selected so as to enable the transfer of energy from the donor fluorescent or luminescent protein, attached to the first kinase domain, to the acceptor fluorescent protein attached to the first kinase domain, when the first and second kinase domains are in close proximity (i.e., in the form of a dimer). Such transfer of energy is commonly referred to as "Fluorescence (or Forster) Resonance Energy Transfer" or "FRET" (if the donor protein is a fluorescent protein), or "Bioluminescence Resonance Energy Transfer" or "BRET" (if the donor protein is a bioluminescent protein). Thus, any combination of donor fluorescent or luminescent protein and acceptor fluorescent proteins may be used in accordance with the present invention as long as the above criteria are met. Such combinations are typically referred as FRET or BRET pairs. The choice of a suitable fluorophore for use in a BRET assay will be known to one of skill in the art. In one embodiment, fluorophores include green fluorescent protein - wild type (GFP-wt), yellow fluorescent protein (YFP), Venus, Topaz, ZsYellowl , mOrange2, mKeima, blue fluorescent protein (BFP), cyan fluorescent protein (CFP), Tsapphire, mAmetrine, green fluorescent protein-2 (GFP2) and green fluorescent protein-10 (GFP10), or variants thereof. Fluorescent proteins having an excitation peak close to 400 nm may be particularly suitable. More particular examples of fluorophores include mAmetrine, cyan fluorescent protein (CFP), and GFP10. Representative examples of FRET pairs include BFP/CFP, BFP/GFP, BFP/YFP, BFP/DsRed, CFP/GFP, CFP/YFP, CFP/mVenus, GFP/YFP, GFP2/YFP, GFP/DsRed, Tag B F P/Tag G F P2 , TagGFP2/TagRFP and the like (see, e.g., Muller et al., Front. Plant Sci., 4: 413, 2013). Representative examples of BRET pairs include luciferase (Luc)/GFP, Luc/Venus, Luc/Topaz, Luc/GFP-10, Luc/GFP-2, Luc/YFP and the like.

As used herein, the term "luciferase" refers to the class of oxidative enzymes used in bioluminescence and which is distinct from a photoprotein. One example is the firefly luciferase (EC 1.13.12.7) from the firefly Photinus pyralis (P. pyralis luciferase). Several recombinant luciferases from several other species including luciferase from Renilla reniformis (GENBANK: AAA29804) and variants thereof (e.g., a stable variant of Renilla Luciferase e.g., Rlucll (GENBANK : AAV52877.1 ), Rluc8 (GENBANK: EF446136.1 ) and Gaussia Luciferase (Glue, GENBANK: AAG54095.1 ) are also commercially available. Any luciferase can be used in accordance with the present invention as long as it can metabolize a luciferase substrate such as luciferins. Luciferins are a class of light-emitting heterocyclic compounds that are oxidized in the presence of luciferase to produce oxyluciferin and energy in the form of light. Non-limiting examples of luciferins include D-luciferin, imidazopyrazinone-based compounds such as coelenterazine (coelenterazine 400A (DeepBlueC™) and coelenterazine H), ViviRen™ (from Promega), Latia luciferin ((E)-2-methyl-4-(2,6,6-trimethyl-1-cyclohex-1-yl)-1-buten-1- ol formate), bacterial luciferin, Dinoflagellate luciferin, etc. Luciferase substrates may have slightly different emission spectra and will thus be selected to favor the optimal energy transfer to the acceptor. In an embodiment, the luciferase is wild-type (or native) Renilla Lucificerase. In an embodiment, the luciferase is the stable variant of Renilla luciferase Rluc8. In another embodiment, the luciferase is Gaussia luciferase (GLuc). In a specific embodiment, the luciferase is Renilla Luciferase II (Rlucll) and the luciferin is coelenterazine 400A.

In an embodiment, one of the following BRET configurations is used in the biosensors and methods described herein: BRET1 that comprises coelenterazine-h (coel-h) and a YFP (YFP) or a GFP from Renilla (RGFP); BRET2 that comprises coelenterazine-400a (coel-400a) and a UV-excited (uvGFP); or BRET3 that comprises coel-h and the monomeric orange FP (mOrange). In a further embodiment, RLucll is used in the above-noted BRET configurations. In another embodiment, one of the following BRET configurations is used in the biosensors and methods described herein: Rlucll/coel-400a/enhanced blue (EB) FP2, Rlucll/coel-400a/ super cyan fluorescent protein (SCFP3A), Rlucll/coel-400a/mAmetrine or Rlucll/coel-400a/GFP10.

The term "targeting moiety" as used herein refers to a moiety or domain that permits to target the fusion molecules to a particular localization in the cell (e.g., a particular cellular component, organelles, etc.), thereby increasing the effective concentration of the fusion molecules in a bidimensional space. Peptide sequences that permit to target molecules to specific cellular component and organelles are known in the art, and include, for example, endoplasmic reticulum (ER) signal peptide or ER-retrieval sequence, nuclear localization signal (NLS) peptide, mitochondrial localization signal (MLS) peptides, membrane localization signal peptides (e.g., consensus sequence for protein fatty acylation such as myristoylation or palmitoylation, CAAX motif).

In an embodiment, the targeting moiety is a membrane targeting moiety. In an embodiment, the membrane targeting moiety comprises a CAAX motif (C is cysteine residue, AA are two aliphatic residues, and X represents any amino acid. CAAX motifs are found in "CAAX proteins" that are defined as a group of proteins with a specific amino acid sequence at C-terminal that directs their post translational modification. CAAX proteins encompass a wide variety of molecules that include nuclear lamins (intermediate filaments) such as prelamin A, lamin B1 and lamin B2, Ras and a multitude of GTP-binding proteins (G proteins) such as Ras, Rho, Rac, and CDC42, several protein kinases and phosphatases, etc. (see, e.g., Gao et ai, Am J TransI Res. 2009; 1 (3): 312-325). The proteins that have CAAX motif or box at the end of the C-terminal typically need a prenylation process before the proteins are sent to plasma membrane or nuclear membrane and exert different functions. Protein prenylation is post- translational lipid modification process of adding of either farnesyl (15-carbon moiety added by a farnesyltransferase) or more commonly geranylgeranyl (20-carbon moiety added by a geranylgeranyltransferase) isoprenoids to cysteine residues of the CAAX box at or near the C terminus of intracellular proteins. In an embodiment, the CAAX box is derived from a human RAS family protein, for example HRAS, NRAS, KRAS4A or KRAS4b. The last 20 C-terminal residues of RAS, NRAS, KRAS4A or KRAS4b (referred to as the hypervariable region or HVR) are depicted below, with the minimal plasma membrane targeting region in italics and the CAAX box underlined (Ahearn et ai, Nature Reviews Molecular Cell Biology 13: 39-51 , January 2012):

HRAS: KLNPPDESGPGCMSCKCVLS (SEQ ID NO: 46);

NRAS: KLNSSDDGTQGCMGLPCWM (SEQ ID NO: 47);

KRAS4A: KISKEEKTPGCVK/KKC//M (SEQ ID NO: 48);

KRAS4A: KMSKDG KKKKKKSKTKCVIM (SEQ ID NO: 49).

In an embodiment, the membrane targeting moiety comprises the last 4 residues of SEQ ID NO: 46, 47, 48 or 49. In a further embodiment, the membrane targeting moiety comprises the last 10 residues of SEQ ID NO: 46, 47, 48 or 49. In an embodiment, the membrane targeting moiety comprises the C-terminal portion (e.g., about the last 10-30 or 15- 25 amino acids) of a CAAX protein, for example a human RAS family protein, e.g., about the last 10-30, 15-25 or 20 amino acids of a human RAS family protein.

In the above-noted fusion molecules of the kinase domain dimerization biosensor, the kinase domain, the fluorescent or bioluminescent protein and the targeting moiety may be in any configuration, for example (from N to C-terminal):

(i) kinase domain - fluorescent or bioluminescent protein - targeting moiety;

(ii) kinase domain - targeting moiety - fluorescent or bioluminescent protein;

(iii) fluorescent or bioluminescent protein - kinase domain - targeting moiety;

(iv) fluorescent or bioluminescent protein - targeting moiety - kinase domain;

(v) targeting moiety - fluorescent or bioluminescent protein - kinase domain; (vi) targeting moiety - kinase domain - fluorescent or bioluminescent protein.

In an embodiment, the targeting moiety is C-terminal relative to the kinase domain and/or the fluorescent or bioluminescent protein. In a further embodiment, the targeting moiety is C-terminal relative to the kinase domain and the fluorescent or bioluminescent protein.

In an embodiment, the fluorescent or bioluminescent protein is N-terminal relative to the kinase domain and/or targeting moiety. In a further embodiment, the fluorescent or bioluminescent protein is N-terminal relative to the kinase domain and the targeting moiety. In an embodiment, the first fusion molecule has the following configuration: donor fluorescent or bioluminescent protein - kinase domain - targeting moiety. In an embodiment, the second fusion molecule has the following configuration: acceptor fluorescent protein - kinase domain - targeting moiety.

The above-noted first and second fusion molecules of the RAS/RAS effector molecule interaction biosensor may be in any configuration, for example (from N to C-terminal):

(i) RAS-binding domain (RBD) - donor fluorescent or bioluminescent protein;

(ii) donor fluorescent or bioluminescent protein - RAS-binding domain (RBD);

(iii) RAS-binding domain (RBD) - acceptor fluorescent protein:

(iv) acceptor fluorescent protein - RAS-binding domain (RBD):

Other domains or linkers may be present at the N-terminal, C-terminal or within the above-noted fusion molecules. In an embodiment, the first and/or second fusion molecule(s) of the RAS/RAS effector molecule interaction biosensor further comprises a targeting moiety (N- terminal, C-terminal or within the above-noted fusion molecules) as defined above.

In embodiments, the components of the fusion molecules may be covalently linked either directly (e.g., through a peptide bond) or "indirectly" via a suitable linker moiety, e.g., a linker of one or more amino acids (e.g., a polyglycine linker) or another type of chemical linker (e.g., a carbohydrate linker, a lipid linker, a fatty acid linker, a polyether linker, PEG, etc. In an embodiment, one or more additional domain(s) may be inserted before (N-terminal), between or after (C-terminal) the components defined above. In an embodiment, the components of the fusion molecules are covalently linked through a peptide bond. In another embodiment, one or more of the components of the fusion molecules are linked through a peptide linker. Linkers may be employed to provide the desired conformation of the BRET/FRET label chromophores within the labeled compound, e.g., including the separation between chromophores in a BRET/FRET pair. The linkers may be bound to the C-terminal, the N-terminal, or at an intermediate position. In one embodiment, the linkers are peptide linkers, typically ranging from 2 to 30 amino acids in length. The composition and length of each of the linkers may be chosen depending on various properties desired such as flexibility and aqueous solubility. For instance, the peptide linker may comprise relatively small amino acid residues, including, but not limited to, glycine; small amino acid residues may reduce the steric bulk and increase the flexibility of the peptide linker. The peptide linker may also comprise polar amino acids, including, but not limited to, serine. Polar amino acid residues may increase the aqueous solubility of the peptide linker. Furthermore, programs such as Globplot 2.3 (Linding et al., GlobPlot: exploring protein sequences for globularity and disorder, Nucleic Acid Res 2003 - Vol. 31 , No.13, 3701-8), may be used to help determine the degree of disorder and globularity, thus also their degree of flexibility. In another aspect, the present invention provides a nucleic acid encoding the above- defined first and/or second fusion molecule(s). In an embodiment, the nucleic acid is present in a vector/plasmid, in a further embodiment an expression vector/plasmid. Such vectors comprise a nucleic acid sequence capable of encoding the above-defined first and/or second fusion molecule(s) operably linked to one or more transcriptional regulatory sequence(s), such as promoters, enhancers and/or other regulatory sequences.

The term "vector" refers to a nucleic acid molecule, which is capable of transporting another nucleic acid to which it has been linked. One type of preferred vector is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Preferred vectors are those capable of autonomous replication and/or expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". A recombinant expression vector of the present invention can be constructed by standard techniques known to one of ordinary skill in the art and found, for example, in Sambrook et al. (1989) in Molecular Cloning: A Laboratory Manual. A variety of strategies are available for ligating fragments of DNA, the choice of which depends on the nature of the termini of the DNA fragments and can be readily determined by persons skilled in the art. The vectors of the present invention may also contain other sequence elements to facilitate vector propagation and selection in bacteria and host cells. In addition, the vectors of the present invention may comprise a sequence of nucleotides for one or more restriction endonuclease sites. Coding sequences such as for selectable markers and reporter genes are well known to persons skilled in the art.

A recombinant expression vector comprising a nucleic acid sequence of the present invention may be introduced into a cell (a host cell), which may include a living cell capable of expressing the protein coding region from the defined recombinant expression vector. The living cell may include both a cultured cell and a cell within a living organism. Accordingly, the invention also provides host cells containing the recombinant expression vectors of the invention. The terms "cell", "host cell" and "recombinant host cell" are used interchangeably herein. Such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

Vector DNA can be introduced into cells via conventional transformation or transfection techniques. The terms "transformation" and "transfection" refer to techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or calcium chloride co- precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation, microinjection and viral-mediated transfection. Suitable methods for transforming or transfecting host cells can for example be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2 ^nd Edition, Cold Spring Harbor Laboratory press (1989)), and other laboratory manuals.

"Transcriptional regulatory sequence/element" is a generic term that refers to DNA sequences, such as initiation and termination signals, enhancers, and promoters, splicing signals, polyadenylation signals which induce or control transcription of protein coding sequences with which they are operably linked. A first nucleic acid sequence is "operably- linked" with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably-linked to a coding sequence if the promoter affects the transcription or expression of the coding sequences. Generally, operably-linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in reading frame. However, since for example enhancers generally function when separated from the promoters by several kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be operably- linked but not contiguous.

In another aspect, the present invention provides a kit comprising a first nucleic acid encoding the first fusion molecule and a second nucleic acid encoding the second fusion molecule.

In another aspect, the present invention provides a cell comprising or expressing the above-defined first and/or second fusion molecule(s). In an embodiment, the cell has been transfected or transformed with a nucleic acid encoding the above-defined first and/or second fusion molecule(s). The invention further provides a recombinant expression system, vectors and cells, such as those described above, for the expression of the fusion molecule(s) of the invention, using for example culture media and reagents well known in the art. The cell may be any cell capable of expressing the first and second fusion molecules defined above.

Suitable host cells and methods for expression of proteins are well known in the art.

Any cell capable of expressing the fusion molecules defined above may be used. For example, eukaryotic host cells such as mammalian cells may be used (e.g., rodent cells such as mouse, rat and hamster cell lines, human cells/cell lines). In another embodiment, the above-mentioned cell is a human cell line, for example an embryonic kidney cell line (e.g., HEK293 or HEK293T cells).

In another aspect, the present invention also provides a method for determining whether a test agent modulates kinase dimerization, said method comprising: (a) providing the above-defined cell in the presence or absence of said test agent; and (b) measuring the fluorescence signal emitted by said acceptor fluorescent protein in said cell; wherein a higher fluorescence signal measured in the presence of the test agent is indicative that said test agent increases kinase dimerization, and a lower fluorescence signal measured in the presence of the test agent is indicative that said test agent inhibits kinase dimerization. In other aspects, the present invention also provides a fluorescence or bioluminescence resonance energy transfer (FRET or BRET)-based biosensor for quantitative detection of protein-protein interaction of protein elements of the RAS-dependent signalling pathway in a living cell. Advantageously, the biosensor recapitulates known genetic and pharmacological perturbations of RAF dimerization with specificity, sensitivity and robustness. Pairwise assays revealed discrete dimerization capabilities for each RAF family member.

Advantageously, the biosensor for RAS-dependent signaling pathway can be used for determining the biological outcome of an agent or factor that modulates protein-protein interaction of protein elements of the RAS-dependent signalling pathway in a living cell. By "agent" or "factor" it is meant here, for example, the presence of a compound, presence of RNAi (e.g., siRNA or shRNA), presence of microRNA, protein overexpression, presence of antibody, and the like. The person of skill will be able to implement methods of determining the biological outcome of such factor without undue effort.

RNAi may be used to create a pseudo "knockout", i.e. a system in which the expression of the product encoded by a gene or coding region of interest is reduced, resulting in an overall reduction of the activity of the encoded product in a system. As such, RNAi may be performed to target a nucleic acid of interest or fragment or variant thereof, to in turn reduce its expression and the level of activity of the product which it encodes. Such a system may be used for functional studies of the product, as well as to treat disorders related to the activity of such a product. RNAi is described in for example Hammond et al. (2001 ), Sharp (2001 ), Caplen et al. (2001 ), Sedlak (2000) and published US patent applications 20020173478 (Gewirtz; published November 21 , 2002) and 20020132788 (Lewis et al.; published November 7, 2002), all of which are herein incorporated by reference. Reagents and kits for performing RNAi are available commercially from for example Ambion Inc. (Austin, TX, USA) and New England Biolabs Inc. (Beverly, MA, USA).

RNAi may be effected by the introduction of suitable in vitro synthesized siRNA or siRNA-like molecules into cells. RNAi may for example be performed using chemically- synthesized RNA (Brown et al., 2002). Alternatively, suitable expression vectors may be used to transcribe such RNA either in vitro or in vivo. In vitro transcription of sense and antisense strands (encoded by sequences present on the same vector or on separate vectors) may be effected using for example T7 RNA polymerase, in which case the vector may comprise a suitable coding sequence operably-linked to a T7 promoter. The in v/iro-transcribed RNA may in embodiments be processed (e.g. using E. coli RNase III) in vitro to a size conducive to RNAi. The sense and antisense transcripts are combined to form an RNA duplex which is introduced into a target cell of interest. Other vectors may be used, which express small hairpin RNAs (shRNAs) which can be processed into siRNA-like molecules. Various vector-based methods are described in for example Brummelkamp et al. (2002), Lee et al. (2002), Miyagashi and Taira (2002), Paddison et al. (2002) Paul et al. (2002) Sui et al. (2002) and Yu et al. (2002). Various methods for introducing such vectors into cells, either in vitro or in vivo (e.g. gene therapy) are known in the art.

As used herein, microRNAs (microRNAs) are small (e.g., 18-25 nucleotides in length), noncoding RNAs that influence gene regulatory networks by post-transcriptional regulation of specific messenger RNA (mRNA) targets via specific base-pairing interactions. This ability of microRNAs to inhibit the production of their target proteins results in the regulation of many types of cellular activities, such as cell-fate determination, apoptosis, differentiation, and oncogenesis.

In other aspects, the present invention also provides a method for selecting an agent or factor that modulates protein-protein interaction of protein elements of the RAS-dependent signalling pathway in a cell, comprising: (a) providing the cell, the cell comprising a fluorescence or bioluminescence resonance energy transfer (FRET / BRET)-based biosensor for quantitative detection of the protein-protein interaction of protein elements of the RAS-dependent signalling pathway, (b) determining activity from the biosensor in presence of a candidate agent or factor and activity from the biosensor in absence of the candidate agent or factor, and (c) selecting the agent or factor that modulates protein-protein interaction of protein elements of the RAS- dependent signalling pathway based on a change in the activity from the biosensor in the presence of the candidate agent or factor relative to the activity from the biosensor in the absence of the candidate agent or factor. In one non-limiting embodiment, the protein elements of the RAS-dependent signalling pathway are selected from RAS, RAF (ARAF, BRAF or CRAF), PIK3 ^p110 , RALGDS, MEK1 , MEK2, KSR1 , KSR2, and the like. The person of skill will readily recognize that the findings described herein can be generalized to other kinase proteins which are allosterically regulated by kinase domain dimerization. For example, the present application provides a model whereby ATP-competitive inhibitors mediate kinase dimerization, for example RAF dimerization, by stabilizing a rigid closed conformation of the kinase domain. In one non- limiting embodiment, the biosensor for RAS-dependent signaling pathway can be used in a method to identify novel drug-like molecules that modulate the binding of constitutively active RAS proteins (H, K or N-RAS) to its downstream interacting partners, preferably proteins containing a RAS-binding domain.

In one non-limiting embodiment, the biosensor for RAS-dependent signaling pathway can be used in a method to monitor the RAS-RAF, the RAS-PIK3 ^p110 and the RAS-RALGDS interactions. Advantageously, the biosensor for RAS-dependent signaling pathway can be used for dissecting the mode of binding and action of existing RAF-binding small molecules and cellular partners. In one non-limiting embodiment, the biosensor for RAS-dependent signaling pathway includes a biosensor based on KSR/MEK or RAF/MEK interaction interfaces. This biosensor can be used to identify novel drug-like molecules that modulate the binding of MEK (MEK1 or MEK2) to its partners in the RAF (ARAF, BRAF or CRAF) or KSR families (KSR1 or KSR2).

Advantageously, the biosensor for RAS-dependent signaling pathway is capable of providing information based on a relatively rapid snapshot of the complex and the varied effects that compound inhibitors may have on the RAF dimerization network. The person of skill will recognize that such information may be useful to predict a compound's in vivo consequences. For example, use of the biosensor in a high-throughput setting may unveil unforeseen off-target effects of diverse ATP-competitive kinase inhibitors on RAF dimerization.

A - BRET biosensors to study the RAS pathway

1) RAS interaction BRET biosensors

According to another non-limiting aspect of the invention, there is provided a method to detect RAS (KRAS, NRAS or HRAS) interaction with proteins containing a RAS-binding domain (RBD). These can be either of RAF family members (ARAF, BRAF or CRAF), p1 10 catalytic subunits (PI3KCA, PIK3CB, PIK3CG) or RAL GEFs (RALGDS, RGL, RGL2, RGL3) proteins.

RAS fusion proteins

The RAS proteins are N-terminally tagged with either of GFP10 or rlucll. The C- terminal CAAX-box of RAS proteins is modified by cleavage and prenylation.

In one example, the BRET pair comprises WT RAS (HRAS, NRAS or KRAS). In another example, the BRET pair comprises mutant RAS (activated GTP-locked RAS: G12V or Q61 L; inactivated GDP-locked RAS: S17N,) and RAS is either one of NRAS, HRAS or KRAS (comprising the KRAS4a and KRAS4b isoforms). GTP-locked forms of RAS interact constitutively with their effectors while GDP-locked forms do not interact with their downstream effectors.

RAS-interacting fusion proteins

The RAS interactors can either be full-length proteins including the RBD and other domains or isolated RBD domains. They can be N- or C-terminally tagged with either GFP10 or rlucll. In yet another example, the RBD domain of the RAS-interacting protein (RAF, p1 10 or RALGDS) is mutated to abrogate RAS binding to be used as a negative control. These can include RAF mutations such as BRAF: R188L; CRAF: R89L, p1 10 mutations such as PIK3CA: K227A or RAL-GDS mutations.

(2) RAF dimerization BRET biosensors

According to another non-limiting aspect of the invention, there is provided a method to detect the protein-protein interaction of RAF family members comprising a kinase domain. These can be ARAF, BRAF, CRAF, KSR1 or KSR2. The RAF protein can be a full length protein.

According to another aspect, the RAF protein can comprise only the kinase domain with or without a C-terminal CAAX-box. In one example, the RAF protein is WT RAF (ARAF, BRAF, CRAF, KSR1 or KSR2). In another example, the RAF biosensor comprises one or more mutations. The mutation can be (i) a side-to-side dimerization mutant of RAF such as BRAF: R509H; (ii) a Gatekeeper mutation, such as BRAF: T529M that affects ATP-competitive inhibitor binding in certain cases; (iii) a mutation affecting the alignment of the regulatory spine of the BRAF kinase domain (F595G, F595R, L505A, L505I); (iv) a mutation affecting the salt bridge between K483 and E501 of BRAF (K483S, K483E, E501 K).

In an embodiment, the full-length RAF dimerization biosensor is either co-expressed with a RAS protein that can be untagged or tagged with FLAG, myc, V5, pyo, mCherry or mOrange2; or co-expressed with a MEK protein that can be untagged or tagged with FLAG, myc, V5, pyo, mCherry or mOrange2.

In yet another embodiment, the kinase domain RAF dimerization biosensor, with or without a CAAX-box, is co-expressed with a RAS protein that is untagged or tagged with FLAG, myc, V5, pyo, mCherry or mOrange2.

3) Interaction of MEK with RAF family members

According to another non-limiting aspect of the invention, there is provided a method to detect the interaction of MEK1 or MEK2 proteins with RAF family members (ARAF, BRAF, CRAF, KSR1 or KSR2) by BRET. The MEK constructs comprise the full-length proteins with suitable bioluminescent and/or fluorescent proteins, for example an N-terminal GFP10 or Rlucll moiety. In an embodiment, the RAF protein is a full length protein. In another example, the RAF protein comprises only the kinase domain with or without a C-terminal CAAX-box. In one example, the RAF protein is WT RAF (ARAF, BRAF, CRAF, KSR1 or KSR2). In another example, the biosensor comprises one or more mutations. The RAF protein family member can be a mutant of the MEK interaction interface in the alphaG helix of the kinase domain such as KSR1 : WXXR; BRAF: F667R. In one example, MEK1 and MEK2 are WT proteins BRET fusions. In another example, the MEK component of the biosensor can comprise a mutation. This MEK mutation, either alone or in combination, can be: (i) at the RAF interaction interface in the alphaG helix of the kinase domain such as MEK1 : F31 1 S; (ii) at the activation loop also interacting with RAF such as MEK1 : M219V or N221Y. In another embodiment, the full-length RAF-MEK interaction biosensor is co-expressed with a RAS protein that is untagged or tagged with FLAG, myc, V5, pyo, mCherry and mOrange2.

B- Methods to monitor the modulation of the BRET biosensors

1) Pharmacological modulation by incubating the BRET biosensors in the presence of test compounds

An example of a factor that modulates protein-protein interaction of protein elements of the RAS-dependent signalling pathway in a living cell can be a test compound, for example that is incubated at various concentrations with a cell comprising the BRET biosensor. The BRET signals can be read using a Mithras (Berthold technologies) reader and dose-response curves can be drawn by plotting the log ₁₀ (test compound concentration in nM) against the BRET ratio. The modulatory compounds can be an existing validated therapeutic compound targeting one of the members of the BRET pairs. In one example, the compound is a RAS-effector interaction inhibitor such as MCP1 10, a RAF inhibitor such as SB590885, GDC0879, Sorafenib, AZD628 or Vemurafenib, a PIK3 inhibitor, or a MEK inhibitor such as AZD8330 or U0126. In yet another example, the modulatory compounds can be compounds with unknown actions. For example, the biosensors can be used to screen small molecule libraries in a high-throughput setup. In one example, the library is an unbiased compound library. In another example, the library is a focused compound library (kinase inhibitors).

The BRET biosensors can be transiently or stably expressed from transfected cells.

2) Modulation by depletion of endogenous proteins by RNA interference (RNAi)

Another example of a factor that modulates protein-protein interaction of protein elements of the RAS-dependent signalling pathway in a living cell can be presence of RNA interference, for example with either siRNA transfection or shRNA transduction with lentivirus.

In one example, the RNAi target is a RAF family member such as ARAF, BRAF, CRAF,

KSR1 or KSR2. In another example, the RNAi target is MEK (MEK1 or MEK2). In yet another example, the RNAi target is one of the RAS proteins (HRAS, KRAS or NRAS).

In yet another example, the siRNAs or shRNAs is a collection or library for RNA interference in human cells.

3) Modulation by co-expression (over-expression) of interacting proteins

Another example of a factor that modulates protein-protein interaction of protein elements of the RAS-dependent signalling pathway in a living cell can be over-expression of a third protein.

Among potential modulatory proteins that can be used, one can mention RAS (HRAS, NRAS or KRAS), MEK (MEK1 or MEK2) or p85 (PIK3R1 , etc.). Another possible set of modulating proteins are RAS GEFs and RAS GAPs to be co-expressed with wild-type Ras in order to monitor their activities.

In another example, the overexpressed modulatory protein is part of a lentiviral collection.

In one example, this third protein is either untagged or tagged with a myc, FLAG, pyo or V5 tags and their expression can be followed by Western blotting. This modulatory protein can be preferably tagged with mCherry, a red-shifted fluorescent protein allowing to follow the expression of this third protein using a standard fluorescent reader (FlexStation ; Ex : 580 nm Em : 635 nm). Also preferably, the modulatory protein can be tagged with a mOrange2 moiety. The expression of this modulatory protein can be followed using a standard fluorescent reader (FlexStation; Ex : 540 nm Em : 575 nm). In another example, a combination of mCherry-tagged and mOrange2-tagged proteins can be expressed along with the BRET biosensor. The BRET biosensor is therefore co- expressed with two protein modulators: a mCherry-tagged and a mOrange-tagged protein. The spectra of emission of the BRET pair, the mCherry and the mOrange fluorescent proteins do not interfere with one another. GFP10 (Ex : 400 nm Em :510 nm) mCherry (Ex : 580 nm Em : 635 nm) and mOrange2 (Ex : 540 nm Em : 575 nm) levels can be read using a Flexstation (Molecular Devices), Envision (Perkin Elmer) or any other plate reader equipped with the proper filters.

MODE(S) FOR CARRYING OUT THE INVENTION

The present invention is illustrated in further details by the following non-limiting examples.

Example 1 : Materials and Methods

Plasmids. All constructs were introduced in pCDNA3.1 -based vectors (Invitrogen). The CAAX box of human KRAS (last 20 amino acids) was added to ARAF ^301"606 , BRAF ^448"766 , CRAF ^340"648 , KSR1 ^{602 921} or KSR2 ^657"950 kinase domains by PCR and BRET fusions were generated by inserting these kinase domains or full-length BRAF and CRAF proteins between Kpn\ and Xba\ in a pCDNA3.1/Hygro plasmid already containing a N- or C-terminal cassette containing either the GFP10 or Renilla luciferase II (Rlucll) cDNA ²⁰ (oligonucleotides used are listed in Table 4). FLAG-tagged BRAF was generated by PCR and cloned in the same plasmid backbone between Kpn\ and Xba\ sites. KRAS, HRAS and NRAS mCherry fusions were also cloned between Kpn\ and X£>al and were site-directed mutagenized by PCR using standard procedures. BRAF ^444"723 , used in AUC analysis and crystallography was cloned with 16 solubilization mutations ²⁸ (I543A, I544S, 1551 K, Q562R, L588N, K630S, F667E, Y673S, A688R, L706S, Q709R, S713E, L716E, S720E, P722S, K723G), referred to as BRAF _16mut, into pPROEX-HTa (Invitrogen) between Nco\ and Not\ sites. Murine PERK ^577"1082 with flexible loop residues 661-875 removed (here after referred to as PERK) was cloned into a SUMO-cleavable GST fusion vector. The RAS/RAS effector BRET fusions described in Table 5 were generated by inserting the listed fragments between Kpn\ and Xba\ in a pCDNA3.1/Hygro plasmid already containing a N- or C-terminal cassette containing either the GFP10 or Renilla luciferase II cDNA ²⁰ . The mCherry fusions were generated with a similar cloning strategy. When specified, the constructs were site-directed mutagenized by PCR using standard procedures.

Table 4: Oligonucleotides used in the studies described herein

Name Sequence SEQ

ID NO:

5'hARAF_KD G GG GTACCATGTATTACTGG G AG GTGCCACCCAGTG AG GT 1

GCAGCTGC

3'hARAF KD CA GCTCTAGAttacataattacacactttgtctttgacttctttttcttctttttaccatct ttgctc 2 AX atcttAG G CACAAGG CGG GCTG CG CTG AG

5'hBRAF KD G G GGTACCATG G ATG ATTG GG AG ATTCCTG ATG G G C 3 'hBRAF KD CA GCTCTAGAttacataattacacactttgtctttgacttctttttcttctttttaccatct ttgctc 4 AX atcttGTGGACAGGAAACGCACCATA

5'hCRAF KD G G GTACCATGTATTATTG GG AAATAG AAG CC 5 'hCRAF KD CA GCTCTAGAttacataattacacactttgtctttgacttctttttcttctttttaccatct ttgctc 6 AX atcttGAAGACAGGCAGCCTCGGGGA

3'hCRAF KD G CTCTAG ACTAG AAG ACAG G CAG CCTCGGGGA 7

5'hKSR1 KD G GG GTACCATGCCCATCTCTCG CAAGG CCAG CCAG 8 'hKSR1 KD CA GCTCTAGAttacataattacacactttgtctttgacttctttttcttctttttaccatct ttgctc 9 AX atcttCAACTCAGCTGACTTCCAGAAG

5'hKSR2 KD G GG GTACCATG AGCTTCCCACG CAAG G CCAG CCAG 10 'hKSR2 KD CA GCTCTAGAttacataattacacactttgtctttgacttctttttcttctttttaccatct ttgctc 1 1 AX atcttCAG CTCTG CAG ACTTCCAG AAATG

'hARAF_R362H GAATGAGATGCAGGTGCTCAGGAAGACGCATCATGTCAAC 12

ATCTTGCTG I I I ATGGGCT

'hARAF_R362H AG CCC ATAAACAG CAAG ATGTTG ACATG ATG CGTCTTCCTG 13

AGCACCTGCATCTCATTC

'hBRAF_R509H AATGAAGTAGGAGTACTCAGGAAAACACATCATGTGAATAT 14

CCTACTCTTC ATG GG C

'hBRAF_R509H GCCCATGAAGAGTAGGATATTCACATGATGTGTTTTCCTGA 15

GTACTCCTACTTCATT

'hCRAF_R401 H G G AATG AG GTG G CTGTTCTGCG CAAAACACATCATGTG AAC 16

ATTCTGC I I I I CATGGGGTAC

'hCRAF_R401 H GTACCCCATGAAAAGCAGAATGTTCACATGATGTGTTTTGC 17

G CAG AAC AG CCACCTCATTCC

'hKSR1_R528H GAAAGAGGTGATGAACTACCGGCAGACGCATCATGAGAAC 18

GTGGTGCTCTTCATGGGG

'hKSR1_R528H CCCCATGAAGAGCACCACGTTCTCATGATGCGTCTGCCGG 19

TAGTTCATCACCTC I M C

'hKSR2_R689H AG CG G G AGGTG ATGGCCTACAG G CAG ACACATC ATG AG AA 20

CGTGGTGC I I I I CATGGGTGC

'hKSR2_R689H GCACCCATGAAAAGCACCACGTTCTCATGATGTGTCTGCCT 21

GTAGGCCATCACCTCCCGCT

'hBRAF_T529M CTATTCCACAAAGCCACAACTGGCTATTGTTATGCAGTGGT 22

GTG AG G GCTCCAG CTTGTATCA

'hBRAF_T529M TG ATACAAG CTG GAG CCCTCAC ACCACTG CAT AACAATAG C 23

CAGTTGTGGC I I I GTGGAATAG

'hBRAF_S729A CGCTCATTGCCAAAAATTCACCGCAGTGCAGCCGAACCCTC 24

CTTGAATCGGGCTGG I I I CC

'hBRAF_S729A G G AAACCAG CCCG ATTCAAG G AGGGTTCGG CTG CACTG CG 25

GTGAATTTTTGGCAATGAGCG

'hBRAF_F595G CCTCACAGTAAAAATAGGTG ATG G CG GTCTAG CTACAGTG A 26

AATCTCG

'hBRAF_F595G CG AG ATTTCACTGTAG CTAG ACCG CCATCACCTATTTTTACT 27

GTGAGG

'hBRAF_F595R CCTCACAGTAAAAATAGGTGATCGTGGTCTAGCTACAGTGA 28

AATCTCG

'hBRAF_F595R CGAGATTTCACTGTAGCTAGACCACGATCACCTATTTTTACT 29

GTGAGG

'hBRAF FL + GGGGTACCATGGCGGCGCTGAGCGGTGGCGGT 30 start-HL

3'hBRAF FL - G CTCTAG AGTG G ACAG G AAACGC ACCATA 31 stop-HL

'hBRAF FL + G CTCTAG ATCAGTGG ACAG G AAACG CACCATA 32 stop-HL

'hCRAF FL + G G GGTACCATG GAG CACATACAG GG AG CTTGG 33 start-HL

'hCRAF - stop- GCTCTAGAGAAGACAGGCAGCCTCGGGGA 34 HL

Table 5: RAS / RAS effector constructs described herein

Reagents, cell culture, transfection and preparation for BRET assays. HEK293T and COLO-205 cells were maintained in DMEM supplemented with 10% FBS and Penicillin/Streptomycin. HCT-1 16 cells were cultured in McCoy's medium with 10% FBS and Penicillin/Streptomycin. For titration curves, 3 X 10 ⁵ cells were seeded in 6-well plates and transfected the next day with polyethylenimine (PEI) ⁵⁰ at 1 μς/μΙ. For dose-response curves, 2.5x 10 ⁶ cells were seeded in 100 mm plates and transfected with a total of 4 μς of DNA. 48 hours post-transfection, cells were washed, resuspended in Tyrode's buffer (10 mM Hepes, 137 mM NaCI, 2.68 mM KCI, 0.42 mM NaH ₂ P0 ₄ , 1.7 mM MgCI ₂ , 1 1.9 mM NaHC0 ₃ , 5 mM glucose), counted and transferred to white opaque microtiter plates (BD Biosciences). A similar procedure was conducted for the high-throughput chemical screening except that cells were cultured in CellStacks (Corning).

BRET measurements. BRET signals and luciferase activity were read 15 minutes post- addition of 2.5 μΜ Coelenterazine 400a (Biotium) using a Mithras LB940 plate reader (Berthold Technologies) equipped with BRET1 emission filter set (donor: 480nm ± 20 nm; acceptor: 530 nm ± 20 nm) or BRET2 emission filter set (donor: 400 nm ± 20 nm; acceptor: 510 nm ± 20 nm). BRET signals emitted by Rlucll / GFP10 pairs (BRET2 probes) can be read with either BRET1 or BRET2 filter sets ²⁰ . The main difference is that the calculated BRET ratio is higher with BRET1 filters than with BRET2 filters (donor: 400 nm ± 20 nm; acceptor: 510 nm ± 20 nm) since only the shoulder of the Rlucll emission spectrum is captured, while the full peak of Rlucll would be detected with a 400 nm filter. In addition, the BRET1 filter set produced slightly better Z- factors. BRET signals correspond to the light emitted by the GFP10 acceptor constructs (530 nm ± 20 nm) upon addition of Coelenterazine 400a divided by the light emitted by the Rlucll donor constructs (480 nm ± 20 nm). Specific BRET signals referred to as BRET in the text and figures correspond to total BRET signals measured from donor/acceptor-transfected samples minus background BRET signals measured from donor-transfected (Rlucll constructs) alone samples. Total GFP10 or mCherry levels were detected on a FlexStation II (Molecular Devices) with excitation and emission peaks set at 400 and 510 nm, and 580 and 635 nm, respectively. Total intrinsic GFP10 (expressed as Relative Fluorescence Unit; RFU) and Rlucll (Relative Luminescence Unit; RLU) signals were used as proxy to ensure that similar protein expression levels between comparable probes were used in titration experiments. In titration experiments whereby GFP10 acceptor constructs are titrated in, BRET signals (Y-axis) were plotted in relation to the increasing ratio of total GFP10 signal (RFU) / total luciferase signal (RLU) (X-axis: [Acceptor]/[Donor]). BRET-based dose-response experiments were expressed as BRET fold increase and were calculated by dividing the BRET of compound-treated cells by the BRET of control DMSO-treated cells. Finally, for high-throughput chemical screening (see Table 5), BRET measurements were acquired using a SpectramaxL® luminometer (Molecular Devices®) and GFP10 signals were read on an Envision® (Perkin Elmer®) plate reader. Data for the chemical screen were expressed as percent of BRET induction and were calculated as follows: (100 X (BRETCOMPOUND / BRET _DMS o)) - 100; where BRET _CO MPOUND corresponds to the BRET signals obtained for the compound-treated cells and BRET _DM so corresponds to the BRET signals obtained for control DMSO-treated cells. The BRET procedures were performed as described in Lavoie et al., Nat Chem Biol. 2013 Jul;9(7):428-36).

Table 6: Small molecule screening data for the high-throughput screen for modulators of CRAF _K D/BRAF _K D heterodimer

Category Parameter Description

Assay Type of assay Cell-based.

Target The protein-protein interaction between

CRAF (NP 002871.1 ) and BRAF

(NP_004324.2 )

Primary measurement Bioluminescence Resonance Energy

Transfer (BRET).

Key reagents Coelenterazine 400A (Gold

Biotechnologies); HEK293T cells; DNA constructs;

Assay protocol "Procedure 3: high-throughput screening with RAF/RAF BRET biosensors"

Library Library size 1 16,079

Library composition Drug-like molecules.

Source - Chembridge DiverSet : 60,000 compounds

(chembridge.com);

- Maybridge HitFinder™ : 16,000

compounds;

- Maybridge (selected) : 16,000 compounds (maybridge.com);

- SPECS (selected) : 16,000 compounds (specs.net)

- Microsource Discovery Spectrum : 2,000 compounds (msdiscovery.com)

- Biomol (natural products) : 500 compounds (biomol.com)

- Prestwick (commercialized products) : 1 ,120

compounds (prestwickchemical.fr)

- SIGMA Lopac™ : 1 ,280 compounds (sigmaaldrich.com)

- In-house library (synthesized at UdeM) : 3,000 compounds

- InhibitorSelect™ 384-Well Protein Kinase Inhibitor Library I from Calbiochem®: 160 compounds. All were at least 95% pure as determined by HPLC.

- Miscellaneous kinase inhibitors from LC- Laboratories™: Erlotinib, Gefitinib,

Roscovitine, Vatalanib, Imatinib, Lapatinib, Dasatinib, Mubritinib, Bosutinib, Tandutinib, Dovitinib, Vandetanib, Pazopanib,

Tofacitinib, Sunitinib, Tozasertib, Nilotinib, VX-702 and Masitinib. All were at least 95% pure as determined by HPLC and TLC.

Screen Format 384-well (white opaque).

Concentration(s) tested 10 μΜ compound, 0,5% DMSO.

Plate controls DMSO and GDC-0879 (100nM).

Reagent/ compound 384 V&P Scientific Pin tool (adapted for dispensing system Beckman Biomek®).

Detection instrument and BRET measurements were acquired using a software SpectramaxL® luminometer (Molecular

Devices) and GFP10 signals were read on an EnVision® reader (PerkinElmer®).

Assay validation/QC Z-factor and GDC-0879 BRET induction.

Correction factors Percent induction was calculated from the

DMSO controls and background BRET signal with the following formula:

(100 X ((BRETCOMPOUND / BRET _DMS o)) - 100

Normalization None

Post-HTS analysis Hit criteria Based on the distribution of screening

results. Three standard deviations from the mean of DMSO controls.

Hit rate 0,43%

Additional assay(s) Hits were retested in the primary assay and in three BRET counter-screening assays; dose-response experiments were performed on the most promising hits.

Confirmation of hit purity Compounds were repurchased and and structure retested.

Co-immunoprecipitation, Western blotting and AlphaScreen® assays. Co- immunoprecipitation and western blotting procedures were essentially conducted as follows. To prepare cell lysates, cells were washed once in cold 1X phosphate-buffered saline (PBS) and then directly lysed on plates by adding 1 ml of IGEPAL® lysis buffer (20 mM Tris at pH 8.0, 137 mM NaCI, 10% glycerol, 1 % IGEPAL® CA-630, 2 mM EDTA, 1X phosphatase inhibitor cocktail (Sigma), 1 mM sodium vanadate, 20 μΜ leupeptin, aprotinin (0.15 U/ml), 1 mM phenylmethylsulfonyl fluoride (PMSF)). Lysing cells were incubated for 10 min at 4°C with gentle rocking, collected and spun at 14,000g, 4°C for 10 min. For co-immunoprecipitations, primary antibodies were added to fresh cell lysates and incubated at 4°C for 1 h. Protein A/G agarose beads (Santa Cruz Biotechnology) were then added, and gently rocked at 4°C for an additional 3 h. Immunoprecipitates were washed three times with cold lysis buffer. FLAG-tagged complexes were eluted with 3XFLAG peptide (Sigma) prior to gel electrophoresis. Cell lysates or immunoprecipitated proteins were resolved on 8% SDS-PAGE, transferred to nitrocellulose membranes (Dupont) and probed using appropriate primary antibodies. All antibodies were diluted in Tris-buffered saline (TBS) supplemented with 0.2% Tween™. Anti-Ren; ^' //a luciferase 5B1 1.2 (Millipore), anti-GFP clones 7.1/13.1 (Roche), anti-mCherry (Clontech®), anti-actin, anti- tubulin, anti-BRAF (Santa Cruz®), anti-phosphoERK1/2 (Sigma), anti-phosphoMEK (Cell Signaling Technology) and anti-MEK1 (610121 ; BD Biosciences) were used at a 1 :2000 dilutions. Anti-FLAG M2 (Sigma®) was used at a 1 :5000 dilution. Secondary anti-mouse and anti-rabbit-HRP (Santa Cruz Biotechnology®) were used at a 1 :10000 dilution in TBS-0.2% Tween®. Phospho-ERK analysis was conducted on 40,000 cells cultured overnight in 96-well plates and treated with the indicated compound concentrations for two hours. Phospho-ERK1/2 AlphaScreen® (PerkinElmer) assays were performed according to the manufacturer's specifications.

Test compounds. PLX4720, GDC-0879 and AZ-628 were obtained from Axon Medchem®. Sorafenib, Imatinib, Dasatinib, Nilotinib, Pazopanib and Tivozanib were purchased from LC laboratories. SB202190 and SB203580, BIRB796, SB590885 were from Selleck Chemicals®. TWS1 19, MNK1 inhibitor and VEGFR inhibitor II were from Calbiochem®. All compounds were at least 95% pure as evaluated by HPLC (Table 7). For dose-response experiments, serial dilutions of all drugs were prepared in DMSO and 1 :100 dilution were prepared in Tyrode's buffer prior to addition to 90 μΙ of cell suspensions in Tyrode's buffer (1 10 ⁶ cells/ml) at a 1 :10 dilution for the indicated time. GGTI-298 and FTI-277 (Sigma-Aldrich) were also prepared in DMSO. The compound library used for high-throughput screening is available through the IRIC HTS facility and was obtained from various sources. The focused kinase inhibitor library was assembled from the EMD chemicals InhibitorSelect® library and various other inhibitors obtained from LC-Laboratories (Tables 6 and 8). The GSK2606414 analog referred to as Compound 39 (5-(1-{[3-Fluoro-5-(trifluoromethyl)phenyl]acetyl}-2,3- dihydro-1 H-indol-5-yl)-7-methyl-7H-pyrrolo[2,3-d]pyrimidin-4-amine) was provided by Dr. David Uehling (OICR, Toronto).

Table 7: Chemical characterization of the compounds used in the studies described herein. Compound Primary Supplier Cat# Lot Purity NMR CAS« Pubchem target (Method) (CID)

Dasatinib BCR-ABL

1 matin ib BCR-ABL

Nilotinib BCR-ABL

GSK3b inhibitor IX GS 3b

- TWS119

MNK1 inhibitor MNK1

SB203580 p3B

SB202190 p38

BIRB796 p3B

GDC-0879 RAF

PLX4720 RAF

AZ-628 RAF

Sorafenib RAF

SBS90885 RAF

VEGFR inhibitor II VEGFR

Pazopanib VEGFR

Tivozanib VEGFR

Protein purification. TEV-cleavable 6XHis-tagged BRAF _16m ut was expressed in BL21 (DE3)-RIL bacterial expression cells, purified with nickel affinity chromatography, TEV- cleaved overnight and purified through gel filtration chromatography into a final buffer of 15 mM Hepes pH 7.5, 200 mM NaCI, 10 mM DTT and 5% glycerol. SUMO protease-cleavable GST tagged PERK was expressed in BL21 (DE3)-RIL cells, purified by glutathione affinity chromatography, treated with SUMO protease overnight and purified through gel filtration chromatography into a final buffer of 100 mM Hepes pH 7, 100 mM NaCI and 1 mM TCEP. Following gel filtration, protein fractions corresponding to greater than 95% purity were pooled and concentrated to 20 mg/ml_, then flash frozen in liquid nitrogen.

Protein crystallization and Structural Analysis. 156 μΜ (5mg/ml_) BRAF i6mut was co- crystallized with 230 μΜ BIRB796 at 4°C in 0.1 M BisTris propane pH 8 and 30% PEG 3350 using the hanging drop method. X-ray diffraction data was collected on a flash frozen crystal cryo protected in mother liquor containing 22% glycerol at the Advanced Photon Source® (NECAT beamline 24-ID). Data reduction was performed using HKL2000® (HKL Research Inc.). The BRAF _16m ut-BIRB796 co-structure was solved by molecular replacement using PDB 3C4C as a search model in Phaser ⁵¹ . Model refinement was performed using Phenix® 1.7.1 ⁵ .

Analytical ultracentrifugation (AUC). Sedimentation velocity analytical ultracentrifugation was performed with a Beckman ProteomeLab® XL-I at 42,000 rpm. Data was obtained after 7.5 h of centrifugation at 20°C by monitoring the relative refractive index between sample and blank. Various concentrations of BRAF _16m ut, ranging from 0.78 μΜ to 25 μΜ, were tested minimally in duplicate in AUC buffer (BRAF _16m ut: 15 mM Hepes pH 7, 200 mM NaCI, 3 mM DTT; PERK: 20 mM Hepes pH 7.5, 150 mM NaCI, 1 mM TCEP) in the presence or absence of 40 μΜ inhibitor compound, or 200 μΜ AMP-PNP with 200 μΜ MgCI ₂ , or 200 μΜ ADP with 200 μΜ MgCI ₂ . AUC analyses of PERK employed identical conditions as per BRAF _16m ut with the exception that ADP analyses were performed with 500 μΜ ADP with 2 mM MgCI ₂ . The AUC experimental conditions for BRAF _16m ut _, were extensively optimized to maximize protein stability for the duration of the AUC analysis, and differed from those employed previously for a shorter BRAF construct ⁷ in temperature (4°C), duration of centrifugation (14 days per sedimentation equilibrium analysis) and buffer composition (20 mM Tris pH 7.0, 200 mM NaCI, 5% glycerol and 1.5 mM TCEP).

Drug-binding assay by TR-FRET. For drug-binding assays, a procedure similar to the LanthaScreen™ Eu Kinase Binding Assay for BRAF (Invitrogen) was used. Purified 6XHis- tagged BRAF ^444"723 kinase domain (50 nM final concentration) was co-incubated with 2 nM LANCE® Europium-coupled anti-His antibody (PerkinElmer), 60 nM Alexa Fluor® 647-labeled kinase tracer (Invitrogen) and varying concentrations of kinase inhibitors for 1 h at room temperature in Kinase Buffer (50 mM Hepes pH7.5, 100 mM NaCI, 3mM DTT, 10 mM MgCI ₂ , 1 mM EDTA, 0.01 % Brij-35). Each experiment included control wells (triplicates) containing the LANCE ^® antibody and Alexa Fluor ^® 647-labeled kinase tracer alone; the average signal of the blank wells was subtracted from each data point. TR-FRET was read on an Envision (PerkinElmer) plate reader with a 340±30 nm excitation filter. The emission of Alexa Fluor® 647 signal was monitored with a 665±10 nm filter and the Europium emission signal was acquired using a 615± 10 nm filter. The TR-FRET signal was calculated by dividing the emission signal at 665nm by the emission at 615 nm. The relative reduction in TR-FRET signal was calculated by normalizing each data point to the DMSO vehicle-treated wells.

Data analysis and structure rendering. BRET titration curves allow extrapolation of two key parameters, namely BRET ₅₀ and BRET _max , which can be used to assess pharmacological or genetic alterations of interacting proteins. The BRET ₅₀ corresponds to the ratio of acceptor construct over donor construct required to attain 50% of the maximum BRET signal. It is essentially dictated by the relative affinity of interacting BRET pairs and their propensity to co- localize. On the other hand, the BRET _max represents the maximum BRET signal strength obtained with saturating amounts of the acceptor probe. This parameter depends on the distance between BRET pairs, their relative orientation as well as the proportion of donor proteins engaged in a given protein-protein interaction ¹⁹ ' ⁵² . Raw data was analysed using the Prism™ 5.04 software (GraphPad™ Software). BRET _max and BRET ₅₀ parameters were derived from a one-site binding hyperbolic fitting of the data and EC ₅₀ s were calculated using a log(agonist) versus response fitting. Significance in BRET ₅₀ and BRET _max differences between BRAF mutants and after drug treatments was assessed using an F-test. Heatmap displays were generated using the Treeview™ program (available from the Lawrence Berkeley National Lab). All protein structure representations were prepared using PyMol™ (Schrodinger). AUC data was processed using SEDFIT (National Institute of Health) to calculate a continuous c(s) distribution. Solute partial specific volume, buffer density and buffer viscosity were calculated using Sednterp (Thomas Laue).

Example 2: Engineering RAF dimerization biosensors

RAF dimerization biosensors were developed using the BRET2 system, which allows real-time monitoring of protein-protein interactions in living cells ¹⁹ . Isolated RAF kinase domains have the propensity to form dimers in solution in a RAS-independent manner ⁷ . We thus used the CRAF kinase domain (CRAF _K D) as a starting point, which we fused to the N- or C-terminus of Renilla luciferase variant II (Rlucll; donor moiety) or GFP10 (acceptor moiety) ²⁰ ' ²¹ . To improve the BRET signal output, we added a membrane-targeting CAAX box to the C-terminus of the fusion proteins to increase the effective concentration of the interacting pairs in a bi-dimensional space. CAAX box-containing CRAF _K D constructs with N-terminal donor and acceptor fusions led to higher BRET signals that were saturable in titration experiments, unlike non-interacting probes, which served as a reference for non-specific interactions (FIG. 1A). Membrane-targeted BRAFKD constructs also produced saturable BRET signals (FIG. 1 B-C; for simplicity, the term CAAX is omitted in the construct names described hereafter) that clearly depended on membrane targeting (FIGs. 7A and B) and did not fluctuate linearly in response to the total amount of the interacting probes (FIG. 7C) as generally observed for non-specific interactors ²² . Example 3: RAF biosensors detect perturbations of dimerization

We next sought to ascertain whether the dimerization signature detected with the BRET assay depended on the side-to-side dimer interface ⁷ ' ¹³ ' ¹⁵ . Mutation of R509, which lies on the BRAFKD dimerization surface, was shown to reduce dimer formation and to lower kinase activity ^7,17,23 . Introduction of the R509H mutation in GFP10-BRAF _KD did not affect protein expression levels (FIGs. 7D and 8A) but impeded kinase activity (FIG. 8A) and significantly reduced BRET output (FIG. 1 B). Furthermore, it significantly increased the BRET ₅₀ (a proxy for affinity) and reduced the BRET _max (a proxy for total number of dimers), which together are consistent with impaired dimer formation (FIG. 1 B). Binding of 14-3-3 proteins to a C-terminal site on RAF proteins has been suggested to promote and/or stabilize RAF _K D dimer formation ^{7" 9} ' ²⁴ . Consistent with this, mutagenesis of a key residue within the 14-3-3 C-terminal binding site of BRAF (S729A) significantly elevated the BRET ₅₀ and reduced the BRET _max (FIG. 8B).

Given the induction of RAF dimerization by specific ATP-competitive inhibitors, we examined whether the BRET assay could detect the influence of a Type I (GDC-0879) and a Type II inhibitor (AZ-628) that had previously been shown to promote RAF dimerization by co- IP ^13"15 . Type I inhibitors bind their kinase target in a DFG-in, "active" configuration, whereas Type II inhibitors bind in a DFG-out, "inactive" configuration ²⁵ . Consistent with the ability of the BRET assay to detect drug-induced dimer formation, both compounds significantly reduced the BRET ₅₀ and augmented the BRET _max in titration experiments (FIG. 1 C), while leaving total luciferase and GFP10 intensities unchanged (FIGs. 9A and B). To evaluate the potency of GDC-0879 in our system, we selected construct ratios producing BRET ₈ o signals (80% of BRET _max ) and tested a range of GDC-0879 concentrations. A half-maximal effective concentration (EC ₅₀ ) of 12 nM was obtained from these experiments (FIG. 1 D), which is in the same range as the IC ₅₀ (34 nM) obtained by in vitro kinase assays ¹³ . To demonstrate that the compound-promoted BRET changes depended specifically on drug-binding to the BRAF kinase domain, we tested the "gatekeeper" mutation (T529M) in BRAF _K D, which reduces drug access to the catalytic cleft and prevents drug-induced RAF dimerization ¹⁵ ' ²⁶ . Consistent with this model, GDC-0879 increased the BRET signal with an EC ₅₀ 80-fold higher for BRAF _K D_T529M than for WT protein (FIG. 1 D). An intact dimer interface was also required as the R509H mutation increased the EC ₅₀ of GDC-0879 by 50-fold (FIG. 1 D). In agreement with previous kinetic data ¹³ , GDC-0879 activity could be detected as early as 5 minutes upon drug treatment and plateaued by 60 minutes, while the R509H mutant was insensitive at the concentration tested (33 nM; FIG. 1 E). Finally, the GDC-0879-induced BRET signal was highly reproducible and yielded a Z-factor of 0.72 in 384-well format (FIG. 1 F) ²⁷ . Together, these findings indicated that our BRET assay detects genuine dimerization of the RAF kinase domain in vivo and that it can identify compounds impinging on BRAF dimerization in a specific and sensitive manner. Example 4: RAF inhibitors distinctly affect the RAF dimer network

The ability of RAF family members to form dimers and the impact of inhibitors on their formation remains poorly understood. To investigate these issues, we generated CAAX box- containing BRET probes for the other RAF family members (ARAF, KSR1 , KSR2) as described above. In contrast to the BRAF _K D and CRAF _K D constructs, these constructs displayed no significant activity towards MEK (FIG. 10). We tested all bidirectional pairs in titration experiments and identified GFP10-BRAF _K D as the best BRET acceptor in terms of BRET _max for any RAF _K D donor (FIG. 2A, Table 1 ). Although lower BRET _max values were obtained with GFP10-CRAF _K D, this construct also gave significant BRET signals with each donor probe (FIG. 2B and Table 1 ). In contrast, the remaining combinations gave weaker BRET signals even though the fusions expressed to similar levels. Nevertheless, these results suggest that BRAF and CRAF have the capacity to engage in dimer formation with any member of the RAF family. Finally, distinct BRET _max and BRET ₅₀ values were observed for each pair. While these parameters are useful for comparing the dimerization potential of a given pair as a consequence of amino acid changes or upon drug treatment (FIG. 1 ), they cannot be used to compare altogether different pairs.

Using the full donor panel of RAF biosensors, we verified whether other dimers could form upon drug treatment and thus could predict their occurrence in vivo. We evaluated the impact of GDC-0879, AZ-628, and two other RAF inhibitors, namely, PLX4720 (a Type I inhibitor ²⁸ ) and Sorafenib (a Type II inhibitor ²⁹ ) on each RAF _K D pair using the BRAF _K D and CRAFKD acceptor probes (FIG. 2C, FIGs. 1 1A and B, Table 2). Interestingly, the inhibitors showed distinct induction profiles that depended on an intact dimer interface (FIG. 2C). Further demonstrating the specificity of the effect, the four compounds did not modulate an unrelated interacting pair (FIG. 2C and FIGs. 1 1 C and D). As summarized in FIG. 12A, PLX4720 and Sorafenib were relatively weak RAF _K D dimer inducers. In contrast, both GDC-0879 and AZ-628 were strong and broad inducers of BRAF-containing dimers and yet, each displayed differences in their ability to promote specific RAF dimers. Notably, while GDC-0879 strongly induced BRAF/KSR1 dimers, AZ-628 did not. Conversely, AZ-628 (but not GDC-0879) strongly promoted CRAF homodimers. To rule out the possibility that BRET signal variations reflected protein conformational changes rather than dimerization, we conducted titration experiments on three pairs, namely, ARAF _K D-BRAF _K D, CRAF _K D-BRAF _K D and KSR1 _K D-BRAF _kd ± drug treatment. In every case, a significant reduction of the BRET ₅₀ value was observed, supporting the notion that the inhibitors promoted RAF dimer formation (FIGs. 12B to D). Together, these data suggest that RAF inhibitors modulate the dimerization landscape of the RAF family in a complex and selective manner. Differences in induction profiles likely reflect differences in 1 ) compound affinity for and structural impact on RAF proteins; 2) compound pharmacokinetics; and 3) the inherent propensity of RAF dimerization surfaces to pair among themselves.

Example 5: RAF _K D biosensors behave as RAS-induced full-length RAF

The induction of RAF dimerization by kinase inhibitors was shown to depend on RAS activity ^13"15 . We were thus intrigued that our CAAX-boxed RAF _K D biosensors could detect dimerization in the absence of overt RAS activity. We reasoned that the CAAX box on our RAFKD biosensors mimicked the recruitment of RAF to the plasma membrane triggered by RAS activation ² . Moreover, RAS binding to RAF is thought to release an inhibitory interaction between the N-terminal regulatory region of RAF and the kinase domain, enabling kinase domain dimerization ² . By using isolated kinase domains, the propensity of our biosensors to dimerize would therefore be increased thereby bypassing the need for upstream inputs.

To verify whether our RAF _K D biosensors simulate a RAS-mediated context, we generated full-length (FL) BRAF and CRAF BRET biosensors and characterized their ability to form dimers in a RAS-dependent manner and compared their dimerization profiles upon RAF inhibitor treatment. In the absence of co-expressed RAS ^G12V , the CRAF _FL -BRAF _FL pair produced titration curves that fit a low confidence hyperbolic function, suggestive at best of weak dimerization (FIG. 3A and Table 3). In contrast, co-expression of mCherry-tagged activated KRAS (KRAS ^G12V or KRAS ^Q61H ) strongly stimulated CRAF _FL /BRAF _FL dimerization in a dose- dependent manner (FIG. 3A and FIG. 13). Demonstrating the specificity of the RAF _FL dimerization assay, a dominant-negative KRAS ^S17N as well as a RAF RBD mutation (R188L) in BRAF did not support CRAF _FL /BRAF _FL dimerization (FIG. 3A). In addition, the R509H mutation in the BRAF side-to-side interface weakened dimerization as evidenced by an increased BRET ₅₀ value (FIG. 3A and Table 3).

We next conducted RAF inhibitor dose-response experiments on the CRAF _F L/BRAF _F L probes ± RAS and compared the responses to those obtained with the CRAF _K D/BRAF _K D biosensors. Intriguingly, each inhibitor induced the CRAF _FL /BRAF _FL BRET signals in the absence of co-expressed RAS (FIGs. 3B and C), suggesting that basal RAS activity in HEK293T cells suffices to support drug-induced CRAF _FL /BRAF _FL dimerization. Alternatively, it is possible that the compounds promote full-length RAF dimerization in a RAS-independent manner, a phenomenon not detected previously, possibly due to the low sensitivity of dimerization detection methods used. At any rate, the induction was dependent on a functional side-to-side interface since the R509H mutation in the BRAF _FL probe increased the EC ₅₀ of the CRAF _FL /BRAF _FL biosensors to GDC-0879 by approximately 30-fold (FIG. 3B). Importantly, constitutive RAS activity systematically reduced the EC ₅₀ of each compound for the CRAF _FL /BRAF _FL pair to a level nearly identical to that obtained with the CRAF _K D/BRAF _K D probes (FIG. 3C) consistent with the notion that the N-terminal region of RAF represses the dimerization potential of the kinase domain in the absence of RAS activity. Together, these findings further support the importance of RAS function for the ability of RAF inhibitors to promote RAF dimerization and provide evidence that our CAAX-boxed RAF _K D biosensors mimic a RAS-induced state.

Example 6: A HTS screen for modulators of CRAF/BRAF dimers

We exploited the robustness and scalability of our RAF dimerization assay in a high- throughput screen to identify compounds that selectively modulate RAF dimerization. We selected the CRAF _K D/BRAF _K D biosensor pair and screened a library of ~ 1 15,000 small molecules assembled primarily from commercial sources. Compounds affecting Rlucll luminescence or intrinsic GFP10 fluorescence by greater than 2-fold were not considered further. We identified 503 primary hits (249 activators and 254 inhibitors) using a cut-off of three standard deviations from controls (FIG. 4A). Retesting confirmed >95% of the hits. Two alternate BRET-based interaction assays (KSRWMEK1 and KRAS ^G12V /BRAF _FL ) were then carried out to narrow down the hit list to molecules selective for the CRAF _K D/BRAF _K D biosensor. This eliminated ~ 75% of the primary hits resulting in 8 inducers and 65 suppressors of dimerization.

We initially focused our attention on the most potent inducer, namely, UM01 19603

(FIGs. 4A and B). This compound, also known as SB202190, was developed as a specific ATP- competitive inhibitor of p38 MAPK ³⁰ (FIGs. 14 and 15). Interestingly, a close structural analogue (SB203580; FIG. 14) was previously recognized as a p38-independent inducer of RAF activity ³¹ ' ³² but the mechanism of action was not known. The identification of SB202190 as an inducer of the CRAF _K D/BRAF _K D BRET signal suggested that this class of molecules stimulates RAF by promoting dimerization. Consistent with this notion, SB203580 also induced CRAFKD/BRAFKD BRET signal and both SB203580 and SB202190 required an intact RAF dimerization surface to show an effect (FIG. 4C). The higher EC ₅₀ values of SB203580 and SB202190 compared to GDC-0879 likely reflect their weaker affinity for RAF proteins. To further validate their capacity to promote RAF dimerization, we conducted co-IP experiments using full- length GFP-CRAF and Flag-BRAF. Both SB203580 and SB202190 increased BRAF/CRAF dimerization comparable to GDC-0879 stimulation (FIG. 4D). The effect of the compounds was not restricted to CRAF/BRAF heterodimers as SB202190 also induced BRAF homodimerization (FIG. 4E). Finally, consistent with their ability to promote dimerization, both compounds stimulated ERK activity in RAF-transfected cells (FIG. 4F).

We noticed a striking structural similarity between SB202190, SB203580 and two other RAF inhibitors, L779450 and SB590885, that were previously shown to induce RAF dimerization ^14,33 (FIG. 14). The binding mode of SB590885 in the catalytic cleft of BRAF ³⁴ shows the same general orientation and conformation as its structural analogue, SB203580 in its co- crystal with the p38 MAP kinase ³⁵ (FIGs. 14B and C). This implies that the p38 inhibitors may interact with RAF in a manner similar to with p38. Given its predicted binding mode in the BRAF catalytic cleft, we surmised that the gatekeeper mutation would impair inhibitor binding and thereby weaken the induction of RAF dimerization by these compounds. Indeed, the T529M_BRAF _K D biosensor pair showed an EC ₅₀ roughly four times higher than WT (FIG. 4G). These data provide compelling evidence that our biosensors can identify selective RAF dimerization modulators from compound libraries and that p38 inhibitors selectively induce RAF dimerization and downstream signalling in a manner related to known RAF inhibitors.

Example 7: Diverse kinase inhibitors induce RAF dimerization

The observation that two p38 inhibitors can induce RAF dimerization prompted us to investigate the effect of other ATP-competitive kinase inhibitors on our panel of RAF dimer biosensors. We assembled a collection of 184 compounds targeting a broad spectrum of kinases, most of which had been profiled for inhibition of in vitro kinase activity against approximately 300 kinases, including RAF proteins ³⁶ . Our analysis identified several compounds that reproducibly induced dimerization as measured by BRET (FIG. 5A and Table 7). In general, the dimer-inducing activity of the kinase inhibitors correlated with their reported ability to inhibit the in vitro kinase activity of BRAF or CRAF (FIG. 5A and Table 7). Notably, in addition to retrieving all RAF inhibitors present in the library, we identified multiple inhibitors of three distinct kinases, namely, six inhibitors of p38, three inhibitors of BCR-ABL, and four inhibitors of VEGFR (including Pazopanib, which was approved by the FDA for renal cell carcinoma and soft tissue sarcoma, and Tivozanib, which is in clinical trials for various cancer indications) as significant inducers of RAF dimerization (FIG. 5A and FIGs. 15-16). Supporting our findings, the same three BCR-ABL inhibitors (Imatinib, Nilotinib and Dasatinib) were reported to promote RAF dimerization in co-IP assays and to stimulate ERK signalling in leukemic cells ³⁷ .

Table 8: Screening of a focused library of kinase inhibitors with BRET-based biosensors for the extended RAF family of protein kinases.

log2(BRET fold induction) (normalized to the KSR1/MEK1 and KRAS _V i ₂ /BRAF _FL interactions)

Compound Name CAS# ARAF/ ARAF/ BRAF/ BRAF/ CRAF/

BRAF CRAF BRAF CRAF BRAF

AG 1024 65678-07-1 -0.22 -0.24 0.37 -0.41 -0.16

AG 112 144978-82-5 0.12 0.03 0.17 0.06 0.05

AG 1295 71897-07-9 -0.22 -0.16 0.08 -0.22 -0.19

AG 1296 146535-11 -7 -0.12 -0.07 0.06 -0.10 -0.05

AG 1478 175178-82-2 -0.11 -0.08 0.22 0.02 -0.03

AG 490 133550-30-8 0.01 -0.06 0.11 -0.07 0.00

AG 9 2826-26-8 0.09 0.07 0.16 0.09 0.13

AGL 2043 226717-28-8 0.03 0.11 0.06 0.08 0.01

Akt Inhibitor IV 681281 -88-9 ND 0.26 1.10 ND 0.81

Akt Inhibitor V, Triciribine 35943-35-2 -0.12 0.01 0.00 -0.13 -0.18

Akt Inhibitor VIII, Isozyme- 612847-09-3 -0.16 -0.02 0.10 -0.01 0.02

Selective, Akti-1/2

Akt Inhibitor X 925681 -41 -0 -0.13 -0.12 0.03 -0.07 -0.06

Aloisine A, RP107 496864-16-5 -0.15 -0.06 -0.01 -0.06 -0.25

Aloisine, RP106 496864-15-4 -0.01 -0.02 0.04 0.02 -0.04

Alsterpaullone 237430-03-4 -0.10 -0.06 0.02 -0.12 -0.09

Alsterpaullone, 2-Cyanoethyl 852527-97-0 -0.09 -0.18 0.05 -0.01 0.01

Aminopurvalanol A 220792-57-4 0.08 -0.16 0.13 0.27 0.28

AMPK Inhibitor, Compound C 866405-64-3 -0.11 -0.11 0.06 0.04 0.02

ATM Kinase Inhibitor 587871 -26-9 -0.31 -0.12 0.25 -0.15 -0.25

ATM/ATR Kinase Inhibitor 905973-89-9 -0.14 -0.23 0.17 -0.23 -0.41

Aurora Kinase Inhibitor II 331770-21 -9 -0.36 -0.23 -0.13 -0.27 -0.60

Aurora Kinase Inhibitor III 879127-16-9 -0.34 -0.11 0.49 -0.23 -0.60

Aurora Kinase/Cdk Inhibitor 443797-96-4 0.00 -0.16 0.20 0.25 0.02

AZ-628 878739-06-1 1.62 1.94 1.38 2.29 1.92

AZD8330 869357-68-6 0.06 0.04 0.05 0.06 0.12

BAY 11 -7082 19542-67-7 -0.30 0.08 0.09 -0.40 -0.30

Bcr-abl Inhibitor 778270-11 -4 -0.47 -0.40 -0.06 -0.39 -0.61

BIRB796 285983-48-4 0.23 0.22 1.26 1.83 1.64

Bisindolylmaleimide I 133052-90-1 0.01 0.05 -0.10 -0.02 0.02

Bisindolylmaleimide IV 119139-23-0 -0.16 -0.15 0.05 -0.08 -0.08

Bohemine 189232-42-6 0.13 0.03 0.10 0.11 0.10

BPIQ-I 174709-30-9 -0.06 0.00 0.40 0.13 0.15

Casein Kinase I Inhibitor, D4476 301836-43-1 -0.06 -0.09 0.18 0.03 0.01

Casein Kinase II Inhibitor III, 934358-00-6 -0.28 -0.25 0.17 -0.03 -0.09

TBCA

Cdc2-Like Kinase Inhibitor, 300801 -52-9 -0.19 -0.15 -0.04 -0.13 -0.08

TG003

Cdk/Crk Inhibitor 784211 -09-2 -0.09 -0.21 -0.06 -0.01 -0.02 Cdk1 Inhibitor 220749-41 -7 -0.18 0.07 0.42 0.04 -0.10

Cdk1 Inhibitor, CGP74514A 190654-01 -4 -0.07 0.03 0.12 0.12 0.21

Cdk1/2 Inhibitor III 443798-55-8 0.04 -0.13 0.45 0.15 0.25

Cdk1/5 Inhibitor 40254-90-8 -0.04 -0.03 0.03 0.02 0.02

Cdk2 Inhibitor III 199986-75-9 -0.05 -0.05 0.02 0.06 0.05

Cdk2 Inhibitor IV, NU6140 444723-13-1 -0.10 0.32 0.53 -0.06 -0.12

Cdk4 Inhibitor 546102-60-7 -0.02 -0.13 0.14 -0.15 -0.10

Cdk4 Inhibitor II, NSC 625987 141992-47-4 -0.22 -0.28 -0.06 -0.18 -0.17

Cdk4 Inhibitor III 265312-55-8 -0.17 0.05 0.15 -0.06 -0.21 cFMS Receptor Tyrosine Kinase 870483-87-7 -0.19 -0.13 -0.01 -0.11 -0.19

Inhibitor

Chelerythrine Chloride 3895-92-9 -0.40 -0.15 0.56 -0.40 -0.13

Chk2 Inhibitor II 516480-79-8 -0.49 -0.39 0.04 -0.42 -0.78

Compound 52 212779-48-1 -0.04 0.00 0.07 -0.04 -0.03

Compound 56 171745-13-4 -0.18 -0.14 0.23 -0.07 0.00

Dasatinib 302962-49-8 0.50 0.07 1.14 1.92 1.49

Diacylglycerol Kinase Inhibitor II 120166-69-0 -0.10 0.03 0.13 -0.04 -0.17

DMBI 5812-07-7 -0.06 -0.11 0.18 -0.18 0.13

DNA-PK Inhibitor II 154447-35-5 0.08 0.08 0.19 0.10 0.08

DNA-PK Inhibitor III 404009-40-1 0.04 0.07 0.10 0.04 0.09

DNA-PK Inhibitor V 404009-46-7 -0.09 -0.04 0.08 0.02 -0.02

Dovitinib 405169-16-6 -0.01 0.18 -0.22 0.04 0.01

EGFR Inhibitor 879127-07-8 -0.35 -0.24 0.64 -0.32 -0.52

EGFR/ErbB-2 Inhibitor 179248-61 -4 -0.08 0.00 0.16 0.26 0.11

EGFR/ErbB-2/ErbB-4 Inhibitor 881001 -19-0 0.11 -0.06 0.38 0.28 0.24

ERK Inhibitor II, FR180204 865362-74-9 -0.02 -0.15 0.36 0.12 0.16

ERK Inhibitor II, Negative control 1177970-73-8 -0.05 0.00 0.04 0.00 -0.07

ERK Inhibitor III 345616-52-6 -0.01 0.01 0.07 0.02 -0.01

Erlotinib 183319-69-9 -0.04 -0.02 0.20 0.06 0.10

Fascaplysin, Synthetic 114719-57-2 0.08 0.07 0.19 0.05 0.03

Flt-3 Inhibitor 301305-73-7 0.01 0.02 0.06 0.02 -0.07

Flt-3 Inhibitor II 896138-40-2 -0.06 -0.04 0.11 0.05 -0.06

Flt-3 Inhibitor III 852045-46-6 -0.11 -0.12 0.08 -0.03 -0.12

GDC0879 905281 -76-7 2.01 2.12 1.33 2.16 2.17

Gefitinib 184475-35-2 0.07 0.13 0.24 0.20 0.28

Go 6976 136194-77-9 0.09 0.08 0.13 0.09 0.07

Go 6983 133053-19-7 -0.09 -0.12 -0.04 -0.07 0.01

GSK-3 Inhibitor IX 667463-62-9 -0.19 0.14 0.05 -0.03 -0.07

GSK-3 Inhibitor X 740841 -15-0 0.02 0.11 -0.02 -0.09 -0.01

GSK-3 Inhibitor XIII 404828-08-6 -0.04 -0.02 0.22 0.02 0.07

GSK-3b Inhibitor I 327036-89-5 -0.03 -0.03 0.03 -0.07 -0.03

GSK-3b Inhibitor II 478482-75-6 -0.31 -0.06 0.07 -0.22 -0.33

GSK-3b Inhibitor VIII 487021 -52-3 -0.18 -0.05 0.28 -0.18 -0.23

GSK-3b Inhibitor XI 626604-39-5 0.11 0.03 0.21 0.03 0.19

GSK3b Inhibitor XII, TWS119 601514-19-6 1.09 0.06 1.09 1.23 0.96

GTP-14564 34823-86-4 -0.11 -0.03 0.08 0.02 -0.01

H-89, Dihydrochloride 127243-85-0 -0.17 -0.09 0.06 -0.10 -0.23

HA 1077, Dihydrochloride 103745-39-7 0.09 -0.05 0.03 -0.01 -0.03

Herbimycin A, Streptomyces sp. 70563-58-5 0.08 0.05 -0.01 -0.34 -0.34

IC261 186611 -52-9 -0.02 0.03 0.21 0.00 -0.01

IGF-1 R Inhibitor II 196868-63-0 -0.11 0.07 0.12 -0.02 -0.06

IKK-2 Inhibitor IV 507475-17-4 -0.07 -0.09 0.18 0.16 0.11

Imatinib 220127-57-1 -0.13 -0.03 0.89 0.65 0.69

Indirubin Derivative E804 854171 -35-0 -0.08 0.11 0.05 -0.01 -0.04 lndirubin-3-monoxime 160807-49-8 -0.28 -0.09 -0.08 -0.26 -0.34

IRAK-1/4 Inhibitor 509093-47-4 -0.17 -0.12 0.04 -0.09 -0.15 Isogranulatimide 244148-46-7 -0.21 -0.09 0.17 -0.10 0.03

JAK Inhibitor I 457081 -03-7 -0.12 -0.12 -0.04 -0.08 0.00

JAK3 Inhibitor II 211555-04-3 -0.05 0.01 0.31 0.10 0.15

JAK3 Inhibitor IV 58753-54-1 -0.08 -0.05 0.10 -0.13 0.03

JAK3 Inhibitor VI 856436-16-3 -0.28 -0.19 0.16 -0.12 0.03

JNK Inhibitor II 129-56-6 -0.01 0.13 -0.10 0.11 0.01

JNK Inhibitor IX 312917-14-9 -0.06 -0.05 0.13 -0.06 0.07

JNK Inhibitor V 345987-15-7 0.02 0.06 0.67 0.08 0.23

JNK Inhibitor VIII 894804-07-0 0.00 0.05 0.14 0.06 -0.04

JNK Inhibitor, Negative Control 54642-23-8 0.09 0.29 -0.14 0.16 -0.01

K-252a, Nocardiopsis sp. 97161 -97-2 -0.46 -0.21 0.08 -0.38 -0.33

Kenpaullone 142273-20-9 -0.01 0.03 0.08 0.03 0.04

KN-62 127191 -97-3 -0.08 -0.01 0.25 -0.13 -0.12

KN-93 139298-40-1 -0.10 -0.09 0.34 -0.24 -0.35

Lapatinib 231277-92-2 -0.12 0.13 0.08 0.03 -0.08

Lck Inhibitor 213743-31 -8 -0.29 -0.29 0.43 0.15 0.01

LY 294002 154447-36-6 -0.03 0.05 0.11 0.03 -0.02

LY 303511 154447-38-8 0.00 -0.02 0.05 0.05 0.02

Masitinib 790299-79-5 -0.31 -0.03 0.14 0.07 0.09

MEK Inhibitor I 297744-42-4 0.22 0.27 0.44 0.03 0.02

MEK Inhibitor II 623163-52-0 -0.07 0.09 0.13 -0.30 0.10

MEK1/2 Inhibitor 305350-87-2 -0.06 0.01 0.00 -0.13 -0.14

Met Kinase Inhibitor 658084-23-2 -0.12 -0.22 0.28 -0.24 0.03

MK2a Inhibitor 41179-33-3 -0.24 -0.09 0.16 -0.29 -0.28

MNK1 Inhibitor 522629-08-9 0.17 -0.06 0.37 0.43 0.47

Mubritinib 366017-09-6 -0.20 -0.12 -0.03 -0.20 -0.32

NF-kB Activation Inhibitor 545380-34-5 -0.27 0.00 0.31 -0.06 -0.47

Nilotinib 641571 -10-0 0.83 0.44 1.48 2.19 1.65 p38 MAP Kinase Inhibitor 219138-24-6 0.47 0.19 0.75 1.16 1.10 p38 MAP Kinase Inhibitor III 581098-48-8 -0.24 -0.09 0.24 -0.05 -0.08

Pazopanib 444731 -52-6 -0.60 -0.13 -0.17 0.50 0.35

PD 158780 171179-06-9 -0.03 0.15 0.12 0.25 -0.11

PD 169316 152121 -53-4 0.45 0.10 1.14 1.78 1.58

PD 174265 216163-53-0 -0.08 -0.04 0.29 0.02 -0.13

PD 98059 167869-21 -8 -0.04 0.07 0.09 -0.08 -0.08

PDGF Receptor Tyrosine Kinase 249762-74-1 -0.01 -0.01 0.07 0.03 0.02

Inhibitor II

PDGF Receptor Tyrosine Kinase 205254-94-0 -0.52 -0.18 0.20 -0.38 -0.80

Inhibitor III

PDGF Receptor Tyrosine Kinase 627518-40-5 -0.16 -0.13 0.32 -0.07 -0.08

Inhibitor IV

PDGF RTK Inhibitor 347155-76-4 -0.28 -0.23 0.19 -0.22 -0.46

PDK1/Akt/Flt Dual Pathway 331253-86-2 ND -0.08 0.37 -0.25 ND Inhibitor

PI 3-K Inhibitor II 648449-76-7 -0.33 -0.21 0.30 -0.31 -0.56

PI 3-Kg Inhibitor 648450-29-7 0.00 -0.10 0.08 0.03 -0.05

PI-103 371935-74-9 -0.07 -0.07 0.64 0.22 0.31

PKCb Inhibitor 257879-35-9 -0.18 -0.11 0.04 -0.12 -0.10

PKCbll/EGFR Inhibitor 145915-60-2 -0.09 0.23 0.22 0.03 0.15

PKR Inhibitor 608512-97-6 0.12 -0.09 0.50 0.35 0.50

PKR Inhibitor, Negative Control 852547-30-9 0.53 ND 0.89 1.44 1.74

PLX4720 918505-84-7 1.68 1.17 0.94 2.71 2.15

PP1 Analog II, 1 NM-PP1 221244-14-0 -0.43 -0.37 0.05 -0.19 -0.37

PP3 5334-30-5 0.00 -0.03 0.19 0.02 0.07

Purvalanol A 212844-53-6 -0.02 0.01 0.24 0.11 0.14

Rapamycin 53123-88-9 -0.23 0.00 0.24 -0.09 -0.23 Rho Kinase Inhibitor III, Rockout 7272-84-6 0.01 0.08 0.08 0.07 0.16

Rho Kinase Inhibitor IV 913844-45-8 0.05 0.15 0.10 0.14 0.07

Ro-32-0432 151342-35-7 -0.05 -0.10 0.03 0.09 0.06

ROCK Inhibitor, Y-27632 146986-50-7 -0.01 -0.05 0.03 0.05 0.07

Roscovitine 186692-46-6 0.13 0.18 0.10 0.18 0.28

SB 202190 152121 -30-7 1.24 0.38 1.23 2.71 2.06

SB 202474 172747-50-1 -0.04 -0.09 0.18 0.04 0.11

SB 203580 152121 -47-6 1.19 0.18 1.20 2.29 1.84

SB 218078 135897-06-2 -0.14 -0.11 0.16 -0.04 -0.03

SB220025 165806-53-1 -0.03 0.00 0.02 0.07 0.10

SC-68376 318480-82-9 -0.01 -0.09 0.14 0.13 0.17

SKF-86002 72873-74-6 -0.01 -0.11 0.36 0.46 0.39

Sorafenib 284461 -73-0 1.19 0.55 1.38 1.72 1.92

Sphingosine Kinase Inhibitor 312636-16-1 -0.29 -0.24 0.04 -0.43 -0.38

Src Kinase Inhibitor I 179248-59-0 -0.49 -0.39 -0.05 -0.26 -0.48

Staurosporine, N-benzoyl- 120685-11 -2 -0.09 -0.08 0.00 -0.11 -0.18

Staurosporine, Streptomyces sp. 62996-74-1 -0.59 -0.50 -0.11 -0.61 -0.67

STO-609 52029-86-4 -0.09 0.08 -0.16 0.07 -0.10

SU11652 326914-10-7 0.15 0.13 0.83 0.18 0.23

SU6656 330161 -87-0 -0.02 -0.03 0.19 0.06 0.15

SU9516 666837-93-0 -0.09 -0.17 -0.02 0.13 0.06

Sunitinib 557795-19-4 0.07 -0.07 0.18 0.00 0.20

Syk Inhibitor 622387-85-3 0.18 0.09 0.62 0.21 0.44

Syk Inhibitor II 227449-73-2 0.06 0.08 0.14 0.18 0.16

Syk Inhibitor III 1485-00-3 0.19 0.14 0.15 0.05 0.27

Tandutinib 387867-13-2 -0.01 -0.08 0.00 0.05 0.00

TGF-b Rl Inhibitor III 356559-13-2 0.11 0.04 0.25 0.20 0.22

TGF-b Rl Kinase Inhibitor 396129-53-6 0.09 0.04 0.36 0.26 0.32

Tozasertib 639089-54-6 -0.16 -0.03 -0.04 0.02 0.00

Tpl2 Kinase Inhibitor 871307-18-5 -0.13 -0.04 0.05 -0.15 -0.24

U0126 109511 -58-2 -0.20 0.14 -0.02 -0.14 -0.16

Vandetanib 443913-73-3 0.10 -0.01 0.11 0.29 0.26

Vatalanib 212141 -51 -0 -0.05 0.15 0.42 0.36 0.37

VEGF Receptor 2 Kinase Inhibitor 15966-93-5 -0.03 0.07 0.07 -0.01 0.03

I

VEGF Receptor 2 Kinase Inhibitor 288144-20-7 -0.14 0.09 0.13 0.00 0.13

II

VEGF Receptor 2 Kinase Inhibitor 204005-46-9 0.04 0.00 0.20 0.00 0.18

III

VEGF Receptor 2 Kinase Inhibitor 216661 -57-3 -0.02 0.11 0.07 -0.01 0.07

IV

VEGF Receptor Tyrosine Kinase 269390-69-4 -0.13 -0.08 0.40 0.57 0.58

Inhibitor II

VEGFR Tyrosine Kinase Inhibitor 475108-18-0 -0.05 -0.27 1.00 2.15 1.85

IV - Tivozanib

VX-702 745833-23-2 -0.04 0.19 0.03 0.33 0.14

Wortmannin 19545-26-7 ND 0.38 0.20 0.21 0.09

Compound Name CAS# CRAF/ KSR1/ KSR1/ KSR2/ KSR2/

CRAF BRAF CRAF BRAF CRAF

AG 1024 65678-07-1 -0.13 -0.08 -0.30 0.30 ND

AG 112 144978-82-5 0.13 0.02 0.16 0.12 0.07

AG 1295 71897-07-9 -0.01 -0.10 -0.03 -0.01 -0.03

AG 1296 146535-11 -7 0.02 0.02 0.05 0.06 -0.06

AG 1478 175178-82-2 -0.07 0.04 -0.08 0.04 -0.10

AG 490 133550-30-8 0.01 0.03 0.02 -0.01 -0.02 AG 9 2826-26-8 0.05 0.18 0.17 0.24 0.14

AGL 2043 226717-28-8 0.13 0.07 0.10 0.07 0.08

Akt Inhibitor IV 681281 -88-9 ND 0.30 ND ND ND

Akt Inhibitor V, Triciribine 35943-35-2 -0.13 -0.10 0.07 -0.08 0.07

Akt Inhibitor VIII, Isozyme- 612847-09-3

Selective, Akti-1/2 0.00 0.10 0.09 -0.15 0.01

Akt Inhibitor X 925681 -41 -0 -0.07 -0.10 -0.11 -0.09 -0.12

Aloisine A, RP107 496864-16-5 -0.23 0.01 -0.11 -0.11 -0.14

Aloisine, RP106 496864-15-4 -0.01 0.00 0.07 0.04 0.15

Alsterpaullone 237430-03-4 -0.02 -0.02 -0.18 -0.15 -0.24

Alsterpaullone, 2-Cyanoethyl 852527-97-0 -0.09 -0.10 -0.27 -0.12 -0.18

Aminopurvalanol A 220792-57-4 0.11 0.32 0.01 -0.07 -0.12

AMPK Inhibitor, Compound C 866405-64-3 -0.15 0.08 -0.01 -0.05 -0.02

ATM Kinase Inhibitor 587871 -26-9 -0.09 -0.10 -0.10 0.06 ND

ATM/ATR Kinase Inhibitor 905973-89-9 -0.17 -0.11 -0.10 0.07 -0.18

Aurora Kinase Inhibitor II 331770-21 -9 -0.20 -0.10 -0.25 -0.30 -0.48

Aurora Kinase Inhibitor III 879127-16-9 -0.19 0.12 -0.09 0.31 -0.05

Aurora Kinase/Cdk Inhibitor 443797-96-4 -0.18 0.00 -0.05 -0.08 -0.09

AZ-628 878739-06-1 2.79 0.58 1.13 0.24 0.82

AZD8330 869357-68-6 -0.10 -0.04 -0.04 -0.13 0.03

BAY 11 -7082 19542-67-7 0.01 -0.01 -0.33 0.38 -0.34

Bcr-abl Inhibitor 778270-11 -4 -0.43 -0.24 -0.44 -0.19 -0.45

BIRB796 285983-48-4 1.16 -0.08 0.43 -0.07 0.32

Bisindolylmaleimide I 133052-90-1 0.08 -0.04 0.01 0.07 0.02

Bisindolylmaleimide IV 119139-23-0 -0.14 -0.17 -0.18 -0.08 -0.11

Bohemine 189232-42-6 0.09 0.13 0.09 0.09 -0.02

BPIQ-I 174709-30-9 -0.04 0.19 0.03 0.13 0.00

Casein Kinase I Inhibitor, D4476 301836-43-1 -0.01 -0.03 -0.02 0.00 0.02

Casein Kinase II Inhibitor III, 934358-00-6

TBCA -0.05 0.04 -0.10 0.01 -0.02

Cdc2-Like Kinase Inhibitor, 300801 -52-9

TG003 -0.11 -0.05 -0.15 -0.07 -0.08

Cdk/Crk Inhibitor 784211 -09-2 0.01 -0.11 -0.08 -0.06 ND

Cdk1 Inhibitor 220749-41 -7 0.08 0.04 0.10 ND 0.13

Cdk1 Inhibitor, CGP74514A 190654-01 -4 0.06 -0.02 -0.07 -0.16 -0.09

Cdk1/2 Inhibitor III 443798-55-8 0.01 -0.06 -0.02 -0.29 -0.05

Cdk1/5 Inhibitor 40254-90-8 0.05 -0.04 -0.12 -0.02 -0.09

Cdk2 Inhibitor III 199986-75-9 -0.07 -0.07 0.00 -0.03 -0.03

Cdk2 Inhibitor IV, NU6140 444723-13-1 0.37 0.18 0.17 0.26 0.41

Cdk4 Inhibitor 546102-60-7 -0.03 0.05 -0.05 0.10 -0.12

Cdk4 Inhibitor II, NSC 625987 141992-47-4 -0.19 -0.12 -0.12 -0.03 -0.15

Cdk4 Inhibitor III 265312-55-8 -0.07 -0.19 -0.11 0.07 -0.11 cFMS Receptor Tyrosine Kinase 870483-87-7

Inhibitor -0.14 -0.19 -0.04 0.03 -0.03

Chelerythrine Chloride 3895-92-9 0.06 -0.13 0.08 0.14 0.05

Chk2 Inhibitor II 516480-79-8 -0.46 -0.39 -0.29 -0.06 -0.57

Compound 52 212779-48-1 -0.07 -0.04 -0.16 -0.04 -0.17

Compound 56 171745-13-4 -0.05 0.15 -0.13 0.02 0.08

Dasatinib 302962-49-8 1.10 0.26 0.41 0.16 0.16

Diacylglycerol Kinase Inhibitor II 120166-69-0 -0.11 0.08 0.07 0.14 -0.01

DMBI 5812-07-7 -0.03 0.03 ND 0.13 -0.03

DNA-PK Inhibitor II 154447-35-5 0.01 0.14 -0.01 0.06 -0.07

DNA-PK Inhibitor III 404009-40-1 0.15 0.03 0.02 0.01 -0.13

DNA-PK Inhibitor V 404009-46-7 0.07 0.02 0.09 0.02 0.05

Dovitinib 405169-16-6 0.08 0.00 0.10 -0.05 -0.09

EGFR Inhibitor 879127-07-8 -0.27 0.22 -0.11 0.32 0.13 EGFR/ErbB-2 Inhibitor 179248-61 -4 0.32 -0.07 -0.10 0.06 0.06

EGFR/ErbB-2/ErbB-4 Inhibitor 881001 -19-0 0.08 0.23 -0.01 0.20 0.08

ERK Inhibitor II, FR180204 865362-74-9 0.02 -0.02 0.07 0.01 0.18

ERK Inhibitor II, Negative control 1177970-73-8 -0.06 -0.11 -0.05 0.06 -0.03

ERK Inhibitor III 345616-52-6 0.08 -0.02 0.04 0.00 0.05

Erlotinib 183319-69-9 -0.07 -0.01 0.00 -0.10 -0.06

Fascaplysin, Synthetic 114719-57-2 0.17 -0.08 -0.01 0.21 0.15

Flt-3 Inhibitor 301305-73-7 -0.02 -0.02 0.06 -0.01 -0.03

Flt-3 Inhibitor II 896138-40-2 -0.01 0.03 -0.02 -0.07 -0.04

Flt-3 Inhibitor III 852045-46-6 0.01 0.01 -0.03 0.17 0.04

GDC0879 905281 -76-7 2.86 0.69 1.02 0.26 0.60

Gefitinib 184475-35-2 -0.09 0.08 -0.04 -0.02 -0.02

Go 6976 136194-77-9 0.10 0.05 0.15 0.13 0.17

Go 6983 133053-19-7 -0.02 -0.12 -0.12 0.07 -0.10

GSK-3 Inhibitor IX 667463-62-9 0.04 -0.03 -0.20 0.12 ND

GSK-3 Inhibitor X 740841 -15-0 0.02 -0.01 0.10 0.10 -0.03

GSK-3 Inhibitor XIII 404828-08-6 0.06 0.16 0.12 0.07 0.00

GSK-3b Inhibitor I 327036-89-5 0.02 -0.05 -0.11 ND -0.07

GSK-3b Inhibitor II 478482-75-6 -0.02 -0.26 -0.05 -0.15 -0.03

GSK-3b Inhibitor VIII 487021 -52-3 -0.06 -0.13 0.08 0.07 0.14

GSK-3b Inhibitor XI 626604-39-5 0.04 0.05 -0.13 -0.03 0.10

GSK3b Inhibitor XII, TWS119 601514-19-6 0.05 0.60 0.17 0.41 0.08

GTP-14564 34823-86-4 -0.02 -0.02 -0.11 -0.01 -0.03

H-89, Dihydrochloride 127243-85-0 0.02 -0.10 -0.09 0.09 -0.07

HA 1077, Dihydrochloride 103745-39-7 0.00 0.01 0.01 -0.07 0.01

Herbimycin A, Streptomyces sp. 70563-58-5 0.07 0.30 -0.03 0.54 0.14

IC261 186611 -52-9 0.02 0.01 0.10 0.12 0.03

IGF-1 R Inhibitor II 196868-63-0 0.03 0.05 0.01 -0.02 -0.08

IKK-2 Inhibitor IV 507475-17-4 0.08 -0.07 0.07 0.04 -0.16

Imatinib 220127-57-1 -0.03 -0.16 0.07 -0.17 -0.12

Indirubin Derivative E804 854171 -35-0 0.04 0.14 0.09 0.04 ND lndirubin-3-monoxime 160807-49-8 -0.15 -0.08 -0.03 -0.06 -0.02

IRAK-1/4 Inhibitor 509093-47-4 -0.05 -0.01 -0.09 0.10 -0.06

Isogranulatimide 244148-46-7 -0.17 0.18 -0.08 0.04 -0.01

JAK Inhibitor I 457081 -03-7 -0.07 -0.01 0.03 0.05 -0.03

JAK3 Inhibitor II 211555-04-3 -0.04 0.09 -0.05 0.09 -0.05

JAK3 Inhibitor IV 58753-54-1 0.10 0.16 -0.08 0.10 0.25

JAK3 Inhibitor VI 856436-16-3 -0.11 0.04 0.07 -0.25 -0.21

JNK Inhibitor II 129-56-6 -0.01 -0.04 0.12 0.02 -0.03

JNK Inhibitor IX 312917-14-9 -0.02 0.00 0.06 0.22 -0.01

JNK Inhibitor V 345987-15-7 0.39 0.06 0.19 0.23 0.20

JNK Inhibitor VIII 894804-07-0 0.23 -0.04 0.16 -0.03 0.08

JNK Inhibitor, Negative Control 54642-23-8 0.17 0.06 0.15 0.03 0.19

K-252a, Nocardiopsis sp. 97161 -97-2 -0.32 -0.14 -0.28 -0.34 -0.23

Kenpaullone 142273-20-9 0.07 0.00 0.03 0.01 -0.04

KN-62 127191 -97-3 0.01 0.03 0.05 0.23 -0.03

KN-93 139298-40-1 0.07 0.08 0.05 0.23 0.20

Lapatinib 231277-92-2 -0.11 -0.05 0.00 -0.09 0.00

Lck Inhibitor 213743-31 -8 0.25 -0.26 -0.19 0.01 ND

LY 294002 154447-36-6 -0.06 -0.15 0.03 0.05 -0.08

LY 303511 154447-38-8 -0.02 -0.06 0.02 -0.03 0.04

Masitinib 790299-79-5 -0.11 -0.12 -0.17 -0.26 -0.15

MEK Inhibitor I 297744-42-4 0.41 0.22 0.38 0.41 0.54

MEK Inhibitor II 623163-52-0 0.17 0.13 0.15 0.07 -0.01

MEK1/2 Inhibitor 305350-87-2 0.06 -0.14 0.13 0.04 0.26 Met Kinase Inhibitor 658084-23-2 -0.12 -0.04 -0.09 -0.11 -0.28

MK2a Inhibitor 41179-33-3 -0.11 -0.02 0.03 0.19 0.03

MNK1 Inhibitor 522629-08-9 0.26 0.26 0.08 0.09 0.08

Mubritinib 366017-09-6 -0.20 -0.31 -0.23 -0.06 -0.17

NF-kB Activation Inhibitor 545380-34-5 0.03 -0.14 -0.04 0.16 -0.19

Nilotinib 641571 -10-0 1.26 -0.03 0.47 0.03 -0.10 p38 MAP Kinase Inhibitor 219138-24-6 0.68 0.37 0.34 0.42 0.12 p38 MAP Kinase Inhibitor III 581098-48-8 -0.10 -0.08 0.01 0.03 -0.10

Pazopanib 444731 -52-6 0.81 -0.51 0.01 -0.25 0.10

PD 158780 171179-06-9 0.12 0.02 0.22 0.11 -0.09

PD 169316 152121 -53-4 1.08 0.59 0.25 0.53 0.10

PD 174265 216163-53-0 -0.02 0.04 0.05 0.18 0.02

PD 98059 167869-21 -8 0.05 0.00 -0.03 0.02 0.07

PDGF Receptor Tyrosine Kinase 249762-74-1

Inhibitor II 0.01 0.03 0.07 0.06 0.15

PDGF Receptor Tyrosine Kinase 205254-94-0

Inhibitor III -0.40 -0.33 -0.41 0.00 -0.22

PDGF Receptor Tyrosine Kinase 627518-40-5

Inhibitor IV -0.07 0.07 -0.09 0.01 -0.16

PDGF RTK Inhibitor 347155-76-4 -0.13 -0.09 -0.21 0.04 -0.33

PDK1/Akt/Flt Dual Pathway 331253-86-2

Inhibitor 0.22 0.46 0.27 1.07 ND

PI 3-K Inhibitor II 648449-76-7 -0.19 -0.09 -0.12 0.14 ND

PI 3-Kg Inhibitor 648450-29-7 0.03 -0.05 0.04 -0.09 -0.13

PI-103 371935-74-9 0.06 0.00 0.00 0.03 ND

PKCb Inhibitor 257879-35-9 -0.22 -0.23 -0.07 -0.19 -0.08

PKCbll/EGFR Inhibitor 145915-60-2 ND ND ND ND ND

PKR Inhibitor 608512-97-6 0.04 0.06 0.01 -0.05 -0.13

PKR Inhibitor, Negative Control 852547-30-9 ND -0.04 0.03 ND -0.26

PLX4720 918505-84-7 2.52 0.41 0.48 0.00 0.07

PP1 Analog II, 1 NM-PP1 221244-14-0 -0.30 -0.13 -0.12 0.06 -0.37

PP3 5334-30-5 -0.02 -0.02 0.06 0.05 -0.01

Purvalanol A 212844-53-6 0.04 0.15 0.01 0.20 -0.12

Rapamycin 53123-88-9 -0.05 0.04 -0.06 0.07 -0.12

Rho Kinase Inhibitor III, Rockout 7272-84-6 0.11 0.11 0.03 0.12 0.16

Rho Kinase Inhibitor IV 913844-45-8 0.05 -0.04 0.11 -0.04 0.27

Ro-32-0432 151342-35-7 0.04 -0.10 -0.03 0.11 -0.09

ROCK Inhibitor, Y-27632 146986-50-7 0.02 0.02 -0.05 0.05 -0.03

Roscovitine 186692-46-6 0.10 0.02 0.04 0.04 0.16

SB 202190 152121 -30-7 2.26 0.62 0.44 0.36 0.22

SB 202474 172747-50-1 0.02 0.09 -0.13 0.02 -0.03

SB 203580 152121 -47-6 1.44 0.65 0.40 0.46 0.18

SB 218078 135897-06-2 -0.01 0.01 0.01 -0.15 -0.22

SB220025 165806-53-1 0.05 0.01 -0.04 0.05 ND

SC-68376 318480-82-9 0.08 0.04 0.01 0.12 0.17

SKF-86002 72873-74-6 0.13 0.21 -0.05 0.06 0.04

Sorafenib 284461 -73-0 2.01 0.75 1.15 0.49 0.57

Sphingosine Kinase Inhibitor 312636-16-1 -0.08 -0.10 -0.19 -0.15 -0.21

Src Kinase Inhibitor I 179248-59-0 -0.25 -0.40 -0.36 -0.01 ND

Staurosporine, N-benzoyl- 120685-11 -2 -0.13 -0.01 -0.09 -0.07 -0.32

Staurosporine, Streptomyces sp. 62996-74-1 -0.56 -0.36 -0.45 -0.37 -0.64

STO-609 52029-86-4 -0.01 -0.02 0.11 -0.04 0.07

SU11652 326914-10-7 ND 0.22 0.11 -0.22 ND

SU6656 330161 -87-0 0.13 0.07 0.05 0.12 ND

SU9516 666837-93-0 -0.18 -0.06 -0.03 -0.16 -0.06

Sunitinib 557795-19-4 -0.09 -0.02 -0.03 -0.19 -0.06 Syk Inhibitor 622387-85-3 0.01 0.39 0.32 0.23 0.12

Syk Inhibitor II 227449-73-2 0.05 0.09 0.10 0.05 0.02

Syk Inhibitor III 1485-00-3 0.20 0.22 0.18 0.13 ND

Tandutinib 387867-13-2 -0.08 -0.04 -0.08 -0.16 -0.08

TGF-b Rl Inhibitor III 356559-13-2 0.15 0.18 0.20 0.18 0.12

TGF-b Rl Kinase Inhibitor 396129-53-6 0.07 0.02 0.05 0.1 1 0.09

Tozasertib 639089-54-6 -0.01 -0.16 -0.05 -0.24 0.02

Tpl2 Kinase Inhibitor 871307-18-5 -0.03 0.00 -0.06 -0.22 -0.08

U0126 109511 -58-2 -0.02 -0.18 0.03 -0.18 0.19

Vandetanib 443913-73-3 -0.1 1 0.05 -0.05 -0.08 0.03

Vatalanib 212141 -51 -0 0.12 -0.04 0.00 -0.10 -0.04

VEGF Receptor 2 Kinase Inhibitor 15966-93-5

I 0.10 0.10 0.07 0.01 0.01

VEGF Receptor 2 Kinase Inhibitor 288144-20-7

II 0.00 0.04 0.06 0.14 -0.13

VEGF Receptor 2 Kinase Inhibitor 204005-46-9

III 0.08 0.17 0.10 0.05 0.02

VEGF Receptor 2 Kinase Inhibitor 216661 -57-3

IV 0.06 0.02 0.09 -0.08 -0.17

VEGF Receptor Tyrosine Kinase 269390-69-4

Inhibitor II 0.33 -0.12 0.05 -0.14 0.10

VEGFR Tyrosine Kinase Inhibitor 475108-18-0

IV - Tivozanib 2.29 0.02 0.22 -0.14 -0.12

VX-702 745833-23-2 0.21 -0.01 0.05 0.15 -0.07

Wortmannin 19545-26-7 0.40 0.18 ND 0.19 0.49

To prove that the BRET-inducing kinase inhibitors genuinely promoted RAF dimerization, we evaluated the activity of the 14 strongest inhibitors (FIG. 15) in co-IP experiments using the LUMIER assay ³⁸ . As shown in FIG. 5B, all inhibitors promoted BRAF/CRAF co-IP. Moreover, as predicted from their RAF dimerizing properties, the same compounds induced ERK phosphorylation in KRAS ^G13D mutant cells (HCT-1 16; FIG. 5C and FIG. 17), but reduced ERK activation in KRAS WT; BRAF ^V600E mutant cells (COLO205; FIG. 17). We observed a strong correlation between the concentration of inhibitor causing maximal ERK activation and its associated CRAF _K D/BRAF _K D BRET EC ₅₀ (FIG. 5D). To verify that the BRET-inducing kinase inhibitors acted by direct binding to the RAF catalytic cleft, we used an in vitro time resolved (TR)-FRET-based assay to monitor the ability of the compounds to compete a fluorescent kinase tracer bound to the BRAF orthosteric site. All compounds with off-target effects on RAF dimerization effectively displaced the tracer (FIG. 12). Interestingly, with the exception of PLX4720, the binding IC ₅₀ for all these inhibitors closely correlated with their EC ₅₀ in the BRAF _K D/BRAF _K D BRET assay, suggesting that the BRET assay can also predict the affinity of small molecule inhibitors for RAF (FIG. 18F).

Example 8: Kinase inhibitors induce RAF dimerization in vitro

To test if induced dimerization was mediated directly by the kinase domain of RAF as a consequence of inhibitor binding, we established a sedimentation velocity analytical ultracentrifugation (AUC) assay using the purified BRAF kinase domain. We first characterized the isolated kinase domain of human BRAF (residues 444 to 723) in its APO state and found a weak ability to dimerize with a Kd greater than 25 μΜ (FIG. 5E and FIG. 19). This was considerably weaker than observed previously for a shorter BRAF kinase domain construct (residues 448 to 723, <6.25μΜ) analysed by sedimentation equilibrium ⁷ and may reflect a real difference in dimerization propensity or a difference in experimental conditions.

We then tested the impact of GDC-0879 at saturating inhibitor concentration (40 μΜ) ¹³ . We observed a drastic enhancement in the ability to form dimers (Kd «< 0.78 μΜ) such that no evidence of a monomer state was observed even at the lowest detectable concentration of BRAF protein (0.78 μΜ) (FIG. 19). Analysis of the RAF inhibitor AZ-628 revealed a similar enhancement of dimerization (Kd «<0.78 μΜ) (FIG. 19) as did Sorafenib, but the limited solubility of Sorafenib in aqueous solution hampered a comparable full analysis.

We next examined the effect of other kinase inhibitors predicted by BRET to have off- target effects on RAF dimerization. Consistent with their effects on BRET, SB202190, BIRB796, Dasatinib, Nilotinib and Tivozanib, all promoted dimerization relative to the APO state (FIG. 5E and FIG. 19). Interestingly, ADP and the ATP mimetic AMP-PNP in contrast, inhibited dimer formation with no dimer species detected even at the highest protein concentration tested (25 μΜ; FIG. 5E and FIG. 19). Together, these findings demonstrate that kinase inhibitors promote RAF dimerization directly through effects on the kinase domain. Example 9: Model for inhibitor-induced RAF dimerization

Available co-structures for RAF dimer-promoting kinase inhibitors bound to RAF or to other protein kinase domains (FIGs. 15 and 20) did not reveal any obvious feature in either small molecule structure or binding mode that could readily explain why these diverse molecules commonly promote RAF dimerization. The only comparable characteristic of all co- structures was that the kinase domains adopted a closed conformation of the N- and C-lobes. Protein kinases are dynamic structures possessing a large degree of flexibility between N- and C-lobes and within the N-lobe itself (FIG. 6A). With respect to the latter, helix aC is tenuously tethered to a five strand β-sheet, which provides great opportunity for regulatory control of phospho-transfer function ³⁹ ' ⁴⁰ . Interestingly, the side-to-side dimerization surface of RAF kinases spans both N- and C-lobes ⁷ (FIG. 6A). Furthermore, the N-lobe portion of the contact surface spans both the β-sheet and helix aC components. Thus dimerization through the side- to-side surface would require a great restriction in flexibility of the RAF kinase domain. We posited that the binding of dimer promoting compounds to the catalytic cleft of the RAF kinase domains, irrespective of their variable modes of association, commonly stabilize the kinase domain in the closed state, thereby promoting dimerization.

The alignment of the hydrophobic regulatory (R-) and catalytic (C-) spines, each of which traverses both N- and C-lobes of the kinase domain, serves as a diagnostic feature of low-energy closed conformations of the kinase domain ⁴¹ ' ⁴² (FIG. 6A and FIGs. 20-21 ). All inhibitors found to induce RAF dimerization preserve spine alignment (FIG. 20), but do so through related, but distinct mechanisms. Type I inhibitors achieve spine alignment by binding within the ATP-binding pocket to bridge the N- and C-lobes along the C-spine (Fig. 6a and FIG. 21 ). The R-spine in contrast is composed strictly by hydrophobic side chains of the kinase domain, including the phenylalanine of the DFG-motif. Type II inhibitors bind the ATP-binding pocket and similarly bridge the N- and C-lobes along the C-spine, but in addition they occupy the DFG-out hydrophobic pocket (as a surrogate phenylalanine) to directly bridge the N- and C- lobes along the R-spine (FIG. 6A and FIG. 21 ). The end result of either inhibitor-binding mode is a closed rigid conformation of the kinase domain that presents a relatively static outer surface conducive to dimerization.

If lobe closure is involved in the creation of a productive dimerization interface, we hypothesized that interfering with it should reduce dimerization. To verify this, we mutagenized the DFG phenylalanine (F595) in BRAF to a glycine or arginine residue as these changes have been reported to induce a constitutive DFG-out-like conformation in p38a ⁴³ . Consistent with our model, DFG mutant BRAF _K D biosensors showed a significant reduction in dimerization- dependent BRET signals (FIG. 22A) and similar loss of dimerization was observed by co-IP (FIG. 6D).

To further test the model, we took advantage of the distinct binding modes of Type I and Type II inhibitors (schematized in FIG. 22B). Type I inhibitors should be sensitive to DFG mutations since the DFG-in configuration would be unattainable. In addition, their affinity for DFG mutants might be reduced since Type I inhibitors are selected on the basis of binding to DFG-in configurations. In contrast, given that Type I I inhibitors provide a surrogate phenylalanine, they should bind DFG mutants similar to WT and promote a closed configuration enabling dimerization. We first tested the binding of both classes of inhibitors by TR-FRET and indeed our predictions were confirmed (FIGs. 22C-D). Next, we examined the ability of both classes to promote dimerization of WT versus DFG BRAF mutants. As shown in FIG. 6B, four distinct Type I inhibitors were in general, highly sensitive to DFG mutations, whereas four Type II inhibitors were far less so (see Table 9 for EC ₅₀ values). Co-crystal structure analysis confirmed that BIRB796 bound to BRAF in a DFG-out conformation (FIG. 23 and Table 10). We then characterized two representative inhibitors from each class for dimerization potential using BRET titration and BRAF co-IP assays (FIGs. 6C-D). Again we observed that Type I inhibitors were more sensitive to the DFG mutation than Type II inhibitors. Together, these findings are consistent with a model whereby kinase inhibitors promote RAF dimerization by stabilizing a rigid closed conformation of the kinase domain. Table 9: BRAF R-spine mutants distinguish Type I from Type II kinase inhibitors in their ability to promote dimerization. EC ₅₀ s (nM) calculated from experiments shown in FIG. 6B. DFG mutations in BRAF _K D tend to significantly increase the EC ₅₀ s of Type I inhibitors, while they do not affect or even improve the EC ₅₀ s of Type II inhibitors.

variant Type I in hibitors Type II inhibitors

Dasatini Sorafenib Nilotinib

WT 9,6 41,8 875,2 684,7 16,4 89,3 187,9 1054,0

2000,0 883,6 3148,0 ND 5,5 99,6 105,2 206,4

23221,0 8840,0 836,2 1485,0 5,4 21 ,5 68,4 237,0

Table 10: Data collection and refinement statistics (molecular replacement).

BRAF-BIRB796

Data collection

Space group P2i

Cell dimensions

a, b, c (A) 90, 90, 90.44

«, P, 7 O 55.00, 120.61, 81.71

Resolution (A) 50.0 - 3.10 (3.17-3.10)

^gyni ^ merge 0.10 (0.54)

II Gl 5.6S (1.0)

Completeness (%) 91.0 (92.2)

Redundancy 2.1 (2.0)

Refinement

Resolution (A) 50.0 - 3.10 (3.17-3.10)

No. reflections 36384

^work I Rbee (%) 23.1/29.5

No. atoms

Protein 7906

Ligand/ion 156

Water 0

B-factors

Protein 72.2

Ligand ion 47.6

Water 0

R.m.s. deviations

Bond lengths (A) 1.420

Bond angles (°) 0.0084

* Number of xtals for each structure should be noted in footnote. *Highest-resolution shell is shown in parentheses.

[AU: Equations defining various R values are standard and hence are no longer defined in the footnotes.] [AU: Ramachandran statistics should be in methods section at the end of the refinement sub-section.] [AU: Wavelength of data collection, temperature, beamline should all be in methods section. ]

Example 10: Biosensors for RAS/effector protein-protein interactions

FIG. 33A shows that a BRET-based biosensor permits to detect the interaction between the BRAF Ras binding domain (BRAF ^RBD ) and three constitutively activated oncogenic RAS proteins (HRAS ^G12V , NRAS ^G12V and KRAS ^G12V ). The constitutively active form of KRAS, KRAS ^G12V , has the highest ability to associate with BRAF ^RBD compared with wild-type KRAS and KRAS ^S17N (the dominant negative form), which does not interact and thereby produces background signals (FIG. 33B). FIG. 33C shows that various oncogenic forms of KRAS exhibit higher BRET signals than wild-type KRAS when BRAF ^RBD is used as the BRET acceptor constructs. A strong and specific BRET signal is detected for the interaction between HRAS ^G12V and BRAF ^RBD (FIG. 34A) or full length BRAF (BRAF ^FL ) (FIG. 34A). Similar results were obtained when KRAS ^G12V was used instead of HRAS ^G12V . The BRET signal was abrogated when a mutation affecting the RAS/RAF interaction (R188L) was introduced in the BRAF ^RBD , or when dominant negative forms of KRAS or HRAS (S17N mutants) were used.

FIGs. 35A and 35B show that a BRET-based biosensor permits to detect the interaction between RAS (HRAS ^G12V ) and the RALGDS Ras binding domain (RALGDS ^RBD ) or full-length RALGDS (RALGDS ^FL ), respectively. Similar results were obtained using Rlucll- KRAS ^G12V as the donor construct (FIGs. 35C and 35D). The BRET signal was reduced when a mutation affecting the RAS/RALGDS interaction (K835E) was introduced in the RALGDS ^RBD , or when dominant negative forms of KRAS or HRAS (S17N mutants) were used.

FIGs. 36A to 36C show that a BRET-based biosensor permits to detect the interaction between RAS (HRAS ^G12V ) and the p1 10a ^RBD and ρ1 10γ ^ΚΒΟ , but not with the ρ1 10β ^ΚΒΟ . The ρ1 10β subunit was shown to be devoid of RAS-binding activity and rather signals in a Rho GTPase-dependent manner (Fritsch et al. 2013. Cell, 153:1050-1063). The BRET signal was reduced when a mutation affecting the RAS/p1 10a interaction (K227E) or the RAS/pH Oy interaction (K255E) was introduced in p1 10a ^RBD or p1 10γ ^ΚΒΟ , or when a dominant negative form of HRAS (S17N mutant) was used. Also, BRET allowed the detection of the interaction between _{H RAS} G12V _{and fu|| |ength p 1 1} o _Y (pi 1 o _Y ^FL ) (FIG. 36D).

FIGs 37 and 38 shows that the KRAS/BRAF ^RBD BRET biosensors allows the identification of, by high-throughput chemical screening, of inhibitors of the dimerization between KRAS and BRAF. The fact that the dimerization between BRAF ^KD and CRAF ^KD was not significantly modulated by the 4 hit compounds provides evidence that the inhibitory effect of the compounds is specific to the KRAS/BRAF interaction (bottom panels of FIGs. 38A and B).

Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The singular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise. REFERENCES

1. Roberts, P.J. & Der, C.J. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene 26, 3291-3310 (2007).

2. Wellbrock, C, Karasarides, M. & Marais, R. The RAF proteins take centre stage. Nat Rev Mol Cell Biol 5, 875-885 (2004).

3. Dhomen, N. & Marais, R. New insight into BRAF mutations in cancer. Current opinion in genetics & development 17 , 31-39 (2007).

4. Schubbert, S., Shannon, K. & Bollag, G. Hyperactive Ras in developmental disorders and cancer. Nat Rev Cancer 7, 295-308 (2007).

5. Claperon, A. & Therrien, M. KSR and CNK: two scaffolds regulating RAS-mediated RAF activation. Oncogene 26, 3143-3158 (2007).

6. Garnett, M.J., Rana, S., Paterson, H., Barford, D. & Marais, R. Wild-type and mutant B-RAF activate C-RAF through distinct mechanisms involving heterodimerization. Mol Cell 20, 963- 969 (2005).

7. Rajakulendran, T., Sahmi, M., Lefrancois, M., Sicheri, F. & Therrien, M. A dimerization- dependent mechanism drives RAF catalytic activation. Nature 461 , 542-545 (2009).

8. Rushworth, L.K., Hindley, A.D., O'Neill, E. & Kolch, W. Regulation and role of Raf-1/B-Raf heterodimerization. Mol Cell Biol 26, 2262-2272 (2006).

9. Weber, C.K., Slupsky, J.R., Kalmes, H.A. & Rapp, U.R. Active Ras induces

heterodimerization of cRaf and BRaf. Cancer Res 61 , 3595-3598 (2001 ).

10. Halilovic, E. & Solit, D.B. Therapeutic strategies for inhibiting oncogenic BRAF signaling.

Curr Opin Pharmacol 8, 419-426 (2008).

1 1. Bollag, G. et al. Clinical efficacy of a RAF inhibitor needs broad target blockade in BRAF- mutant melanoma. Nature 467, 596-599 (2010).

12. Joseph, E.W. et al. The RAF inhibitor PLX4032 inhibits ERK signaling and tumor cell

proliferation in a V600E BRAF-selective manner. Proc Natl Acad Sci U S A 107, 14903- 14908 (2010).

13. Hatzivassiliou, G. et al. RAF inhibitors prime wild-type RAF to activate the MAPK pathway and enhance growth. Nature 464, 431-435 (2010).

14. Heidorn, S.J. et al. Kinase-dead BRAF and oncogenic RAS cooperate to drive tumor

progression through CRAF. Cell 140, 209-221 (2010).

15. Poulikakos, P. I., Zhang, C, Bollag, G., Shokat, K.M. & Rosen, N. RAF inhibitors

transactivate RAF dimers and ERK signalling in cells with wild-type BRAF. Nature 464, 427-

430 (2010).

16. Poulikakos, P.I. & Rosen, N. Mutant BRAF melanomas-dependence and resistance.

Cancer Cell 19, 1 1-15 (201 1 ). 17. Poulikakos, P.I. et al. RAF inhibitor resistance is mediated by dimerization of aberrantly spliced BRAF(V600E). Nature 480, 387-390 (2011 ).

18. Solit, D.B. & Rosen, N. Resistance to BRAF inhibition in melanomas. The New England journal of medicine 364, 112-11 (201 1 ).

19. Bacart, J., Corbel, C, Jockers, R., Bach, S. & Couturier, C. The BRET technology and its application to screening assays. Biotechnol J 3, 31 1-324 (2008).

20. Breton, B. et al. Multiplexing of multicolor bioluminescence resonance energy transfer.

Biophys J 99, 4037-4046 (2010).

21. Kocan, M., See, H.B., Seeber, R.M., Eidne, K.A. & Pfleger, K.D. Demonstration of

improvements to the bioluminescence resonance energy transfer (BRET) technology for the monitoring of G protein-coupled receptors in live cells. J Biomol Screen 13, 888-898 (2008).

22. James, J.R., Oliveira, M.I., Carmo, A.M., laboni, A. & Davis, S.J. A rigorous experimental framework for detecting protein oligomerization using bioluminescence resonance energy transfer. Nat Methods 3, 1001-1006 (2006).

23. Roring, M. et al. Distinct requirement for an intact dimer interface in wild-type, V600E and kinase-dead B-Raf signalling. EMBO J 31 , 2629-2647 (2012).

24. Ritt, D.A., Monson, D.M., Specht, S.I. & Morrison, D.K. Impact of feedback phosphorylation and Raf heterodimerization on normal and mutant B-Raf signaling. Mol Cell Biol 30, 806- 819 (2010).

25. Dar, A.C. & Shokat, K.M. The evolution of protein kinase inhibitors from antagonists to

agonists of cellular signaling. Annu Rev Biochem 80, 769-795 (201 1 ).

26. Whittaker, S. et al. Gatekeeper mutations mediate resistance to BRAF-targeted therapies.

Sci Transl Med 2, 35ra41 (2010).

27. Zhang, J.H., Chung, T.D. & Oldenburg, K.R. A Simple Statistical Parameter for Use in

Evaluation and Validation of High Throughput Screening Assays. J Biomol Screen 4, 67-73

(1999).

28. Tsai, J. et al. Discovery of a selective inhibitor of oncogenic B-Raf kinase with potent

antimelanoma activity. Proc Natl Acad Sci U S A 105, 3041-3046 (2008).

29. Wan, P.T. et al. Mechanism of activation of the RAF-ERK signaling pathway by oncogenic mutations of B-RAF. Cell 116, 855-867 (2004).

30. Lee, J.C. et al. A protein kinase involved in the regulation of inflammatory cytokine

biosynthesis. Nature 372, 739-746 (1994).

31. Hall-Jackson, C.A., Goedert, M., Hedge, P. & Cohen, P. Effect of SB 203580 on the activity of c-Raf in vitro and in vivo. Oncogene 18, 2047-2054 (1999).

32. Kalmes, A., Deou, J., Clowes, A.W. & Daum, G. Raf-1 is activated by the p38 mitogen- activated protein kinase inhibitor, SB203580. FEBS Lett 444, 71-74 (1999). 33. McKay, M.M., Ritt, D.A. & Morrison, D.K. RAF Inhibitor-Induced KSR1/B-RAF Binding and Its Effects on ERK Cascade Signaling. Curr Biol 21 , 563-568 (201 1 ).

34. King, A.J. et al. Demonstration of a genetic therapeutic index for tumors expressing

oncogenic BRAF by the kinase inhibitor SB-590885. Cancer Res 66, 1 1 100-1 1 105 (2006). 35. Wang, Z. et al. Structural basis of inhibitor selectivity in MAP kinases. Structure 6, 1 1 17- 1 128 (1998).

36. Anastassiadis, T., Deacon, S.W., Devarajan, K., Ma, H. & Peterson, J.R. Comprehensive assay of kinase catalytic activity reveals features of kinase inhibitor selectivity. Nat Biotech nol 29, 1039-1045 (201 1 ).

37. Packer, L.M. et al. Nilotinib and MEK inhibitors induce synthetic lethality through

paradoxical activation of RAF in drug-resistant chronic myeloid leukemia. Cancer Cell 20, 715-727 (201 1 ).

38. Barrios-Rodiles, M. et al. High-throughput mapping of a dynamic signaling network in

mammalian cells. Science 307, 1621-1625 (2005).

39. Jeffrey, P.D. et al. Mechanism of CDK activation revealed by the structure of a cyclinA- CDK2 complex. Nature 376, 313-320 (1995).

40. Sicheri, F. & Kuriyan, J. Structures of Src-family tyrosine kinases. Curr Opin Struct Biol 7,

777-785 (1997).

41. Kornev, A.P., Haste, N.M., Taylor, S.S. & Eyck, L.F. Surface comparison of active and inactive protein kinases identifies a conserved activation mechanism. Proc Natl Acad Sci U

S A 103, 17783-17788 (2006).

42. Kornev, A.P. & Taylor, S.S. Defining the conserved internal architecture of a protein kinase.

Biochim Biophys Acta 1804, 440-444 (2010).

43. Bukhtiyarova, M., Karpusas, M., Northrop, K., Namboodiri, H.V. & Springman, E.B.

Mutagenesis of p38alpha MAP kinase establishes key roles of Phe169 in function and structural dynamics and reveals a novel DFG-OUT state. Biochemistry 46, 5687-5696 (2007).

44. Axten, J.M. et al. Discovery of 7-Methyl-5-(1 -{[3-(trifluoromethyl)phenyl]acetyl}-2, 3-dihydro- 1 H-indol-5-yl)-7H-p yrrolo[2,3-d]pyrimidin-4-amine (GSK2606414), a Potent and Selective First-in-Class Inhibitor of Protein Kinase R (PKR)-like Endoplasmic Reticulum Kinase

(PERK). J Med Chem 55, 7193-7207 (2012).

45. Korennykh, A.V. et al. The unfolded protein response signals through high-order assembly of Ire1. Nature 457, 687-693 (2009).

46. Sen, B. et al. Kinase-impaired BRAF mutations in lung cancer confer sensitivity to

dasatinib. Sci Trans! Med 4, 136ra170 (2012).

47. Dar, A.C., Dever, T.E. & Sicheri, F. Higher-order substrate recognition of elF2alpha by the RNA-dependent protein kinase PKR. Cell 122, 887-900 (2005). 48. Dey, M. et al. Mechanistic link between PKR dimerization, autophosphorylation, and elF2alpha substrate recognition. Cell 122, 901-913 (2005).

49. Taylor, S.S., Haste, N.M. & Ghosh, G. PKR and elF2alpha: integration of kinase

dimerization, activation, and substrate docking. Cell 122, 823-825 (2005).

50. Boussif, O. et al. A versatile vector for gene and oligonucleotide transfer into cells in culture and in vivo: polyethylenimine. Proc Natl Acad Sci U S A 92, 7297-7301 (1995).

51. Adams, P.D. et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta crystallographica. Section D, Biological crystallography 66, 213-221 (2010).

52. Ciruela, F. Fluorescence-based methods in the study of protein-protein interactions in living cells. Curr Opin Biotechnol 19, 338-343 (2008).

53. Geyer ei a/. 1997. Nat. Struct. Biol., 4:694-699. PMID: 9302994;

54. Linnemann et al. 2002. J Biol. Chem. 277:7831-7837. PMID: 1 1748241.

55. Fritsch et al. 2013. Cell, 153:1050-1063. PMID: 23706742.

56. Pacold et al. 2000. Cell, 103:931 -943. PMID: 1 1 136978.