BIOSYNTHETIC PATHWAYS, RECOMBINANT CELLS, AND METHODS

CROSS-REFERENCE TO RELATED APPLICATION This application claims priority to U.S. Provisional Patent Application Serial No. 61/652,505, filed May 29, 2012, which is incorporated herein by reference.

SUMMARY

This disclosure describes, in one aspect, a recombinant cell modified to exhibit increased biosynthesis of an ester compared to a wild-type control. The recombinant cell may be a eukaryotic cell or a prokaryotic cell. In some cases, the microbial cell may be photosynthetic. In some cases, the microbial cell may be cellulolytic. In some embodiments, the recombinant cell can exhibit an increase in conversion of an organic acid to an acyl-CoA compared to a wild-type control, an increase in conversion of ketoacids to an acyl-CoA compared to a wild-type control, an increase in conversion of an aldehyde to an organic acid compared to a wild-type control, an increase in conversion of an aldehyde to an alcohol compared to a wild-type control, or an increase in combining an acyl-CoA with an alcohol to form an ester compared to a wild-type control.

In another aspect, this disclosure describes a method that generally includes incubating a recombinant cell modified to exhibit increased biosynthesis of an ester compared to a wild-type control in medium that includes a carbon source under conditions effective for the recombinant cell to produce an ester, wherein the carbon source comprises one or more of: glucose, pyruvate, ketovaline, C0 ₂ , cellulose, xylose, sucrose, arabinose, or glycerol.

In another aspect, this disclosure describes a method that generally includes introducing into a host cell a heterologous polynucleotide encoding at least one polypeptide that catalyzes a step in converting a carbon source to an ester, wherein the at least one polynucleotide is operably linked to a promoter so that the modified host cell catalyzes conversion of the carbon source to an ester. In some embodiments, the carbon source can include one or more of: glucose, pyruvate, ketovaline, C0 ₂ , cellulose, xylose, sucrose, arabinose, or glycerol. In some embodiments, the host cell can be a eukaryotic cell. In other embodiments, the host cell can be a prokaryotic cell. In some embodiments, the host cell can be photosynthetic. In some embodiments, the host cell can be cellulolytic.

The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list. BRIEF DESCRIPTION OF THE FIGURES

FIG. 1. (a) Proposed artificial biosynthetic pathway to esters, (b) Example molecules, (c) Advantages of ester approach to fuels and chemicals.

FIG. 2. An exemplary synthetic pathway to ester isobutyl-isobutyrate. Two independent pathways can lead to the production of isobutyryl-CoA.

FIG. 3. (a) Plasmids and (b) gas chromatography data result showing biosynthesis of isobutyl isobutyrate.

FIG. 4. Synthetic pathways for the production of isobutyl acetate (IBAC) and isoamyl acetate (IV AC). The engineered steps of the pathways are shown in the box.

NADPH-dependent enzymes are indicated with a dotted circle and key enzyme

acyltransferase are indicated with dotted rectangles. Abbreviation: PDC (pyruvate dehydrogenase complex), AAT (alcohol acyltransferase); other enzymes and are specified in FIG. 5.

FIG. 5. Synthetic operons for (a) isobutyl acetate (IBAC) (b) isoamyl acetate (IV AC) production. Abbreviation: AAT (alcohol acyltransferase).

FIG. 6. Fermentation results with the introduction of five candidate acyltransferases

(AAT) for (a) isobutyl acetate production and (b) isoamyl acetate production. Error bars indicate standard deviation. These five AATs and their natural substrates are shown as in Table 3. DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

In the description of exemplary embodiments that follow, certain metabolic enzymes, and the natural source of those enzymes, are specified. These are merely examples of suitable enzymes and suitable sources of the specified enzymes. Alternative enzymes with similar catalytic activities are possible, as are homologs that are obtainable from different microbial species or strains. Accordingly, the exemplary embodiments described herein should not be construed as limiting the scope of the microbes or methods that are reflected in the claims. The search for renewable resources to replace petroleum is a significant challenge facing science, industry, and society. Biosynthesis can provide a sustainable supply of fuels and chemicals from biomass resources. Factors that can influence the viability of a fermentation process include, for example, feedstock availability, fermentation performance (e.g., yield, titer, productivity), and the cost of recovering the fermentation product. While great advances have been made in feedstock development, current fermentation approaches to the production of alcohols or organic acids is not ideal. First, alcohols and organic acids can be very toxic to cells, which can limit the concentration to which these products can accumulate in a fermentation culture before they have a deleterious effect on the viability of the microbes in the culture. Second, alcohols and acids tend to be very soluble in aqueous media (e.g., culture media) and therefore can require an energy-intensive distillation purification scheme to recover these products from an aqueous fermentation medium. As a result, while higher alcohols such as, for example, butanol can offer advantages as fuels compared to, for example, ethanol, it is difficult for higher alcohols to compete with ethanol as a commercially viable biofuel because of the high purification cost from low fermentation titers (<20 g/L). Third, fermentation to produce organic acids often involves adding a base to the fermentation in order to neutralize the pH of the medium in which the organic acid accumulates. The recovery of the organic acid often involves subsequent addition of sulfuric acid and disposal of salts, each of which can involve significant cost.

To provide a general solution, we have developed an ester platform for the production of alcohols, organic acids, or other biofuels. As shown in FIG. 1(a), one embodiment of this approach has three components: 1) a metabolic pathway for the biosynthesis of carboxylic acids and then acyl-CoAs; 2) a parallel metabolic pathway for the biosynthesis of alcohols; and 3) an engineered pathway for the production of esters from acyl-CoAs and alcohols. The successful implementation of this platform has enabled the bio-based production of esters. In some alternative embodiments, the approach may include a metabolic pathway for the biosynthesis of carboxylic acids (and then acyl-CoAs) and an engineered pathway for the production of esters from the biosynthesized acyl-CoAs and alcohols provided as a co-reactant (e.g., in the culture medium). In other alternative embodimetns, the approach can include a metabolic pathway for the biosynthesis of alcohols and an engineered pathway for the production of esters from the biosynthesized alcohol and acyl-CoAs provided as a co-reactant (e.g., in the culture medium).

An ester produced by using our platform technology may be used as a biofuel, an industrial chemical, or a raw material for the production of other compounds. For example, esters can be readily hydrolyzed to make alcohols and organic acids. In principle, this approach can be used to manufacture any alcohol and/or organic acid from an appropriate ester produced by a microbe engineered according to our platform. Several exemplary organic acids and alcohols are listed in Fig. 1(b). Exemplary organic acid products include, for example, acetate, isobutyrate, 3-hydroxypropionate, butyrate, lactate, methacrylate, acrylate, and isopentanoate. Exemplary alcohol products include, for example, ethanol, methanol, butanol, isobutanol, propanol, isopropanol, pentanol, isopentanol, hexanol, heptanol, and octanol. The combination of any of these acids with any of these alcohols could generate an ester metabolite.

An ester produced as described herein can be used as a biofuel. Esters, in general, can provide certain advantages over, for example, ethanol as a fuel. As shown in Table 1, ester fuels have similar energy density to higher alcohols such as, for example, isobutanol and isopentanol. Esters also can exhibit less solubility in water compared to corresponding alcohol compounds, allowing one to recover an ester from aqueous medium using phase separation rather than distillation. As a result, recovering esters can be simpler, more efficient, and less costly than recovering alcohols from fermentations. While fatty acids and alkanes also have very low water solubility, long chain fatty acids typically are not efficiently secreted to the extracellular milieu and fuels prepared from these compounds may not perform well at low temperatures because they may be prone to gelling.

Bioproduction of esters can produce higher theoretical yields than bioproduction of higher alcohols, alkanes, and fatty acids. In E. coli, for example, isobutanol accumulation can reach approximately 22 g/L without in situ recovery during fermentation (Baez et al., Appl. Microbiol. Biotechnol. 2011, 90 (5), 1681-1690). In contrast, we can produce 90 g/L isobutyrate, which is comparable to fermentation of lactate (Wang et al., Proc. Natl. Acad. Sci. USA. 2011, 108 (47), 18920-18925) or succinate (Lin et al., Metab. Eng. 2005, 7 (2), 116-127), two of the most promising renewable chemicals under commercial production. Also, C5 isovalerate can accumulate to 32 g/L, much higher than isopentanol (4.4 g/L) (Connor et al., Appl. Microbiol. Biotechnol. 2010, 86 (4), 1155-1164) and fatty acid (4.5 g/L) (Liu et al, Metab. Eng. 2010, 12 (4), 378-386). Finally, esters are not toxic to cells, allowing one to observe higher accumulations in fermentation broths compared to other compounds.

Table 1. Comparison of biosynthesis profile, physical properties, and fuel properties of various compounds.

Energy density Theoretical yield Titer Solubility

Fuel (MJ/L) (g/g glucose) (g/L) (g/L)

Ethanol 21 0.51 200 miscible

Fatty acid 33 0.36 4.5 insoluble

Farnesene 31 0.29 104 insoluble

Isobutanol 26 0.41 22 85

Isopentanol 27 0.33 4.4 27

Isobutyric acid X 0.49 90 200

Isovaleric acid X 0.38 32 25

Ethyl acetate 19 0.49 83

Ethyl isobutyrate 25 0.43 3.2

Ethyl isovalerate 26 0.36 2 isobutyl isobutyrate 27 0.40 0.5 isovaleryl isovalerate 29 0.32 insoluble

Gasoline 32

Jet fuel 35

Diesel 39

FIG. 2 shows an exemplary, generalized engineered pathway for producing an exemplary ester compound, isobutyl-isobutyrate. To catalyze the esterification

enzymatically, a carboxylic acid is activated to an acyl-CoA. Then, the acyl-CoA can react with an alcohol to produce an esters. The esterification reaction is catalyzed by an acyltransferase (FIG. 2). We have engineered two ester-producing strains of E. coli, Ester strain 1 and Ester strain 2, each of which employs an independent pathway for the generation of the acyl-CoA intermediate. One pathway to producing an acyl-CoA converts isobutyrate into isobutyryl-CoA by an acyl-CoA synthetase (Acs). We cloned FadDx from Pseudomonas putida, an exemplary acyl-CoA synthetase, to catalyze the production of the acyl-CoA in this manner (Ester strain 1, shown in FIG. 2 as "Pathway Π"). Another pathway to acyl-CoA is to employ branched-chain keto acid dehydrogenase complex BKDH from Pseudomonas putida. We employed this strategy in a separate strain (Ester strain 2, shown in FIG. 2 as "Pathway I").

We then cloned benzoyl-coenzyme A (CoA):benzyl alcohol benzoyl transferase (BEBT, or LuxE) from Clarkia breweri (D'Auria et al., Plant Physiol. 2002, 130(1):466) into both Ester strain 1 and Ester strain 2.

According to gas chromatography analysis, 3.5 mg/L isobutyl isobutyrate was obtained during shake flask fermentations for Ester 1 strain and 200 mg/L for Ester 2 strain. Without LuxE, no isobutyl isobutyrate was detected in the fermentation broth.

This embodiment establishes a basic platform in which microbes can be engineered to produce an ester compound. The particular enzymes we have used are merely exemplary, establishing that the platform can be effective for biosynthesis of ester compounds. One can use any suitable combination of acyl-CoA-generating enzymes— either acyl-CoA synthetase or branched-chain keto acid dehydrogenase complex, BKDH— and acyltransferase to produce a desired ester product from a given feedstock. Exemplary acyl-CoA synthetases that may be used in our platform include, for example, those reflected in any one of SEQ ID NO:5-28, regardless of the enzyme's common name or native substrate. Certain exemplary acyl-CoA synthetases are listed in Table 2. Exemplary branched-chain keto acid

dehydrogenase complex enzymes that may be used in our platform include, for example, any one or more of the amino acid sequences reflected in SEQ ID NO:29 and 78-80, regardless of the enzyme's common name or native function. Certain exemplary branched-chain keto acid dehydrogenase complex enzymes are listed in Table 2. Exemplary acyltransferases that may be used in our platform include, for example, those reflected in any one of SEQ ID NO:30-77, regardless of the enzyme's common name or native function. Certain exemplary acyltransferases include, for example, those listed in Table 2.

Table 2. Exemplary alternative acyl-CoA synthetases and acyl-transferases

Common Name Orqanism Encodinq Accession Native Comment SEQ ID qene No. Substrate NO

Exemplary Acyl-CoA synthetases

Acyl-CoA synthetase P. Putida Acs NP_746598.1 aliphatic acids Synthesizes 5

isobutyl

isobutyrate

Acyl-CoA synthetase S. Faa2P NP_010931.1 medium chain Activate C4- 11

cerevisiae acids C22

substrates

Acyl-CoA synthetase S. Acslp NP_009347.1 acetate Activate 17

cerevisiae propionate

Acyl-activating enzyme A. tha liana AAE11 AAP03024.1 Fatty acids Activate C4- 23 1 1 C8 acids

Branched-chain alpha-keto acid dehydrogenase comlex enzymes

branched-chain alpha- bkdA1 NP_746515.1 Branched- Activate C4- 78

P. putida

keto acid chain alpha- C6 keto acids

KT2440

dehydrogenase keto acids

branched-chain alpha- bkdA2 NP_746516.1 Branched- Activate C4- 79

P. putida

keto acid chain alpha- C6 keto acids

KT2440

dehydrogenase keto acids

branched-chain alpha- bkdB NP_746517.1 Branched- Activate C4- 80

P. putida

keto acid chain alpha- C6 keto acids

KT2440

dehydrogenase keto acids

branched-chain alpha- IpdV NP_746518.1 Branched- Activate C4- 29

P. putida

keto acid chain alpha- C6 keto acids

KT2440

dehydrogenase keto acids

Exemplary Acyltransferases

Acyl-transferase S. EEB1 NP_015230.1 acyl-CoA & Produce ethyl 30

cerevisiae ethanol esters

benzyl alcohol benzoyl C. breweri BEBT Q8GT21.1 benzoyl CoA & Synthesize 36 transferase benzyl alcohol isobutyl

(luxE)

isobutyrate in our

preliminary study

alcohol acyl- C. melo CmAAT3 AAW51125.1 acetyl CoA & Accept a 42 transferases benzyl alcohol broad range

of acyl-CoA and alcohols benzyl alcohol benzoyl P. hybrida BPBT AAT68601.1 benzoyl CoA & Accept a 48 transferase phenylethanol broad range

of acyl-CoA and alcohols alcohol acyl M. MpAATI AAU 14879.2 alcohol Produce 54 transferase domestica medium- chain

aliphatic

volatile esters alcohol acyltransferase Fragaria SAAT AAG13130.1 medium-chain Produce butyl 60

spp. and aliphatic butyrate

hybrids alcohols

alcohol S. ATF1 EGA72844.1 alcohol Produce 66 acetyltransferase cerevisiae acetyl acetate alcohol S. ATF2 alcohol Produce 72 acetyltransferase cerevisiae acetyl acetate FIG. 4 illustrates an alternative embodiment of our platform for ester biosynthesis. In this embodiment, isobutyl acetate (IBAC) and/or isoamyl acetate (IV AC, banana oil) may be produced by a microbe in which the native valine biosynthetic pathway is modified. Acetyl-CoA is natively and readily available in, for example, E. coli. as a component of the TCA cycle. To produce either IBAC and IV AC, the microbe is first constructed to overexpress AlsS and IlvD to promote biosynthesis of 2-ketoisovalerate. The microbe also is constructed to express Kivd and Yqhd, which together can convert 2-ketoisovalerate to isobutanol, which can be esterified to isobutyl acetate in a reaction catalyzed by an acyltransferase. To produce isoamyl acetate, the microbe may be constructed to further express the "+1" pathway (LeuABCD), which can elongate 2-ketoisovalerate by one carbon to form 2-keto-4-methylvalerate. In these embodiments, the combination of KivD and Yqhd can convert 2-keto-4-methylvalerate to isopentanol, which can be esterified to isoamyl acetate by an acyltransferase.

We characterized five exemplary alcohol acyltransferases (AAT), LuxE, ATF1,

ATF2, BPBT, and SAAT (as shown in Table 3). Each was cloned and transformed into E. coli strain BW25113 for analysis.

Table 3. Exemplary alcohol acyltransferases (AAT) in medium-chain esters

biosynthesis.

Gene Enzyme Native Function Organism

Uses benzoyl-CoA and benzyl

Benzyl alcohol

luxE alcohol to make benzyl C. breweri benzoyltransferase

benzoate

ATF1 Alcohol acetyltransferase Acetate ester production S. cerevisiae

ATF2 Alcohol acetyltransferase Acetate ester production S. cerevisiae

Uses benzoyl-CoA and benzyl

Benzyl alcohol

BPBT alcohol to make benzyl P. hybrida benzoyltransferase

benzoate

Uses aliphatic medium-chain

Strawberry alcohol

SAAT alcohols and broad ranges of Strawberry acetyltransferase

acyl-CoA to make esters Three synthetic operons were constructed for gene expression to produce isobutyl acetate and isoamyl acetate (FIG. 5). All the plasmids were constructed to be under the regulation of P _L lacOl promoter. To produce isobutyl acetate, the first operon included four coding regions on a medium copy plasmid carrying kanamycin resistance marker in a transcriptional order ilvC-ilvD-alsS-AAT, with the ATT position being occupied by the coding region of one of the five exemplary acyltransferases (AAT) being analyzed. (FIG. 5(a)). The second operon included two coding regions on a high copy plasmid with an ampicillin resistance maker in a transcriptional order kivd-yqhD. For the synthesis of isoamyl acetate, the coding regions of leuA, leuB, leuC, and leuD involved in leucine biosynthesis were introduced in the first medium copy plasmid between alsS and AAT, and the same second high copy plasmid was used. (FIG. 5(b)).

We assessed the effect of each of the five exemplary acyltransferases on the production titers for isobutyl acetate and isoamyl acetate. Coding regions for ATFl and ATF2 were amplified by PCR from S. cerevisiae genomic DNA. Coding regions for LuxE, BPBT, and SAAT were artificially synthesized by annealing based connection of oligonucleotides. Recombinant strains were constructed with the synthetic operons as shown in FIG. 2.

Shake flask fermentations and products analyses were carried as described in Example 2 and three independent colonies were streaked for inoculation to get standard deviation. All strains were identical except for the alcohol acyltransferase that was expressed. Therefore, with the same fermentation conditions, the strain with the highest production titer of the target compound would have the most active alcohol acyltransfersase. The activity here represents the combined effects of kinetic parameters and protein expression levels.

FIG. 6(a) provides data for isobutyl acetate production. ATFl produced the highest titer (2.14 ± 0.17 g/L). ATF2 produced a titer of 1.69 ± 0.46 g/L. FIG. 6(b) shows data for the production of isoamyl acetate and reveals a similar trend. ATFl and ATF2 produced the highest production titers.

Coding regions for any heterologous enzyme introduced into a host cell can be PCR amplified from the genomic DNA of a native host if commercially available (e.g., from American Type Culture Collection). Otherwise, one can artificially synthesize a coding region by PCR assembly using multiple primers. A synthetic coding region can be codon optimized for expression in a host cell such as, for example, E. coli or S, cerevisiae. Cells transformed with plasmids harboring the coding region for a heterologous enzyme can be cultured in medium that includes carboxylic acid and/or alcohol precursors.

Thus, in one aspect, the invention provides recombinant microbial cell modified to exhibit increased biosynthesis of an ester compared to a wild-type control. In some cases, the wild-type control may be unable to produce ester and, therefore, an increase in the biosynthesis of an ester may reflect any measurable biosynthesis of the ester. In certain embodiments, an increase in the biosynthesis of an ester can include biosynthesis sufficient for a culture of the microbial cell to accumulate the ester to a predetermine concentration.

The predetermined concentration may be any predetermined concentration of the product suitable for a given application. Thus, a predetermined concentration may be, for example, a concentration of at least 3 mg/L such as, for example, at least 10 mg/L, at least 100 mg/L, at least 200 mg/L, at least 500 mg/L, at least 1.0 g/L, at least 2.0 g/L, at least 3.0 g/L, at least 4.0 g/L, at least 5.0 g/L, at least 6.0 g/L, at least 7.0 g/L, at least 8.0 g/L, at least 9.0 g/L, at least 10 g/L, at least 20 g/L, at least 50 g/L, at least 100 g/L, or at least 200 g/L.

The recombinant cell can be, or be derived from, any suitable microbe including, for example, a prokaryotic microbe or a eukaryotic microbe. As used herein, the term "or derived from" in connection with a microbe simply allows for the "host cell" to possess one or more genetic modifications before being further modified to exhibit the indicated increased biosynthetic activity. Thus, the term "recombinant cell" encompasses a "host cell" that may contain nucleic acid material from more than one species before being modified to exhibit the indicated biosynthetic activity.

In some embodiments, the host cell may be selected to possess one or more natural physiological activities. For example, the host cell may be photosynthetic (e.g.,

cyanobacteria) or may be cellulolytic (e.g., Clostridium cellulolyticum).

In some embodiments, the recombinant cell may be, or be derived from, a eukaryotic microbe such as, for example, a fungal cell. In some of these embodiments, the fungal cell may be, or be derived from, a member of the Saccharomycetaceae family such as, for example, Saccharomyces cerevisiae, Candida rugosa, or Candida albicans. In other embodiments, the recombinant cell may be, or be derived from, a

prokaryotic microbe such as, for example, a bacterium. In some of these embodiments, the bacterium may be a member of the phylum Protobacteria. Exemplary members of the phylum Protobacteria include, for example, members of the Enterobacteriaceae family (e.g., Escherichia coli) and, for example, members of the Pseudomonaceae family (e.g.,

Pseudomonas putida). In other cases, the bacterium may be a member of the phylum

Firmicutes. Exemplary members of the phylum Firmicutes include, for example, members of the Bacillaceae family (e.g., Bacillus subtilis), members of the Clostridiaceae family (e.g., Clostridium cellulolyticum) and, for example, members of the Streptococcaceae family (e.g., Lactococcus lactis). In other cases, the bacterium may be a member of the phylum

Cyanobacteria.

In some embodiments, the increased biosynthesis of an ester compared to a wild-type control can include one or more of the following: an increase in conversion of an organic acid to an acyl-CoA compared to a wild-type control, an increase in conversion of ketoacids to an acyl-CoA compared to a wild-type control, an increase in conversion of an aldehyde to an organic acid compared to a wild-type control, an increase in conversion of an aldehyde to an alcohol compared to a wild-type control, or an increase in combining an acyl-CoA with an alcohol to form an ester compared to a wild-type control. The particular acyl-CoA synthetase, branched-chain keto acid dehydrogenase (BKDH) complex enzyme(s), and/or acyltransferase can be selected based on one or more criteria such as, for example, the metabolic substrate in the designed pathway, the available feedstock, and/or the efficiency at which the enzyme is expressed in the host microbe.

In other embodiments, the increased biosynthesis of an ester compared to a wild-type control can include one or more of the following: an increase in conversion of 2- ketoisovalerate to isobutyraldehyde, and increase in conversion of isobutyraldehyde to isobutanol, an increase in synthesis of isobutyl acetate from isobutanol and an acyl-CoA, an increase in elongation of 2-ketoisovalerate to 2-keto-4-methylvalerate, an increase in conversion of 2-keto-4-methylvalerate to isovaleraldehyde, an increase in conversion of isovaleraldehyde to isopentanol, or an increase in synthesis of isoamyl acetate from isopentanol and an acyl-CoA.

In some cases, increased biosynthesis of an ester compared to a wild-type control can include a decrease in catalytic activity of one or more enzymes such as, for example, an esterase and/or a lipase that can otherwise divert an intermediate of the designed pathway to an alternative pathway that does not result in biosynthesis of the desired ester.

As used herein, the terms "activity" with regard to particular enzyme refers to the ability of a polypeptide, regardless of its common name or native function, to catalyze the conversion of the enzyme's substrate to a product, regardless of whether the "activity" is less than, equal to, or greater than the native activity of the identified enzyme. Methods for measuring the biosynthetic activities of cells and enzymatic activities of acyl-CoA synthetase and acyltransferase are routine and well known to those of ordinary skill in the art. In the context of a genetically-modified cell, the term "activity" refers to the ability of the genetically-modified cell to synthesize an identified product compound, regardless of whether the "activity" is less than, equal to, or greater than the native activity of a wild-type strain of the cell.

As used herein, an increase in catalytic activity of an enzyme or an increase in the biosynthetic activity of a genetically-modified cell can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide or the biosynthetic activity of a genetically-modified cell can be, for example, at least 110%, at least 125%, at least 150%, at least 175%, at least 200% (two-fold), at least 250%, at least 300% (three-fold), at least 400% (four-fold), at least 500% (five-fold), at least 600% (six-fold), at least 700% (seven-fold), at least 800% (eight-fold), at least 900% (nine-fold), at least 1000% (10-fold), at least 2000% (20-fold), at least 3000% (30-fold), at least 4000% (40-fold), at least 5000% (50-fold), at least 6000% (60-fold), at least 7000% (70-fold), at least 8000% (80-fold), at least 9000% (90-fold), at least 10,000% (100-fold), or at least 100,000% (1000-fold) of the activity of an appropriate wild-type control.

Alternatively, an increase in catalytic activity may be expressed as at an increase in k _cat such as, for example, at least a two-fold increase, at least a three-fold increase, at least a four-fold increase, at least a five-fold increase, at least a six-fold increase, at least a sevenfold increase, at least an eight-fold increase, at least a nine-fold increase, at least a 10-fold increase, at least a 15-fold increase, or at least a 20-fold increase in the k _ca t value of the enzymatic conversion.

An increase in catalytic activity also may be expressed in terms of a decrease in K _m such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a sevenfold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the K _m value of the enzymatic conversion.

A decrease in catalytic activity of an enzyme or an increase in the biosynthetic activity of a genetically-modified cell can be quantitatively measured and described as a percentage of the catalytic activity of an appropriate wild-type control. The catalytic activity exhibited by a genetically-modified polypeptide or the biosynthetic activity of a genetically- modified cell can be, for example, no more than 95%, no more than 90%, no more than 85%o, no more than 80%>, no more than 75%, no more than 70%, no more than 65%, no more than 60%), no more than 55%, no more than 50%, no more than 45%, no more than 40%, no more than 35%, no more than 30%, no more than 25%, no more than 20%>, no more than 15%), no more than 10%, no more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1% of the activity, or 0%> of the activity of a suitable wild-type control.

Alternatively, a decrease in catalytic activity can be expressed as a decrease in k _ca t such as, for example, at least a two-fold decrease, at least a three-fold decrease, at least a four-fold decrease, at least a five-fold decrease, at least a six-fold decrease, at least a sevenfold decrease, at least an eight-fold decrease, at least a nine-fold decrease, at least a 10-fold decrease, at least a 15-fold decrease, or at least a 20-fold decrease in the k _cat value of the enzymatic conversion.

A decrease in catalytic activity also may be expressed in terms of an increase in K _m such as, for example, an increase in K _m of at least two-fold, at least three-fold, at least fourfold, at least five-fold, at least six-fold, at least seven-fold, at least an eight-fold, at least nine-fold, at least 10-fold, at least 15-fold, at least 20-fold, at least 25-fold, at least 30-fold, at least 35-fold, at least 40-fold, at least 45-fold, at least 50-fold, at least 75-fold, at least 100-fold, at least 150-fold, at least 200-fold, at least 230-fold, at least 250-fold, at least 300- fold, at least 350-fold, or at least 400-fold.

Thus, in another aspect, we describe herein methods for biosynthesis of an ester. The ester may be any desired ester. As noted above, the ester may be used as a biofuel, an industrial chemical, or a raw material for the production of other compounds. Our approach can be used to prepare an ester from combining any organic acid— e.g., the exemplary organic acids identified in FIG. 1(b)— with any alcohol— e.g., the exemplary alcohols identified in FIG. 1(b). The combination of any of these acids and any of these alcohols could generate an ester metabolite. In various applications, the organic acid, the alcohol, or both may be synthesized by the cell. In some of these embodiments, the cell may be genetically modified to promote the biosynthesis of the organic acid or the alcohol. Also in various applications, the organic acid or the alcohol may be provided in culture medium so that its biosynthesis is unnecessary to produce the ester.

In some cases, the ester can be an ester having no more than 12 carbon atoms (CI 2) such as, for example, a CI 1 ester, a CIO ester, a C9 ester, a C8 ester, a C7 ester, a C6 ester, a C5 ester, a C4 ester, or a C3 ester. In other cases, the ester can be an ester having any number of carbons and a predetermined degree of branching. The degree of branching may be characterized by the number of branched carbons and/or the length of one or more— or, cumulatively, all— of the branches. As used herein, branching refers to the number of carbons that are covalently bound to at least three other carbons. In certain specific embodiments, the ester can be, for example, isobutyl isobutyrate, isovaleryl isovalerate, or ethyl lactate.

Generally, the methods include incubating a recombinant cell as described herein in medium that includes a carbon source under conditions effective for the recombinant cell to produce the ester. Thus, the carbon source can include one or more of: glucose, pyruvate, or ketovaline. In addition, the carbon sources for cell growth can be C0 ₂ , cellulose, glucose, xylose, sucrose, arabinose, glycerol, alginate, glucarate, galacturonate, etc. as long as the related carbon assimilation pathways are introduced in the engineered microbe. Also, the carbon source can include the organic acid— or a metabolic precursor of the organic acid— to be activated to produced the desired ester. In the exemplary pathway shown in FIG. 2, the organic acid is isobutyric acid. In other pathways in which the ester is formed from a different organic acid, the different organic acid may be a component of the culture medium. Similarly, the carbon source can include the alcohol— or a metabolic precursor of the alcohol— from which the desired ester is synthesized. In the exemplary pathway shown in FIG. 2, the alcohol is isobutanol and metabolic precursors include, for example,

isobutyraldehyde and ketovaline. In pathways in which the ester is formed from a different alcohol, the different alcohol and/or precursors to the different alcohol may be components of the culture medium. As noted above, the ester may be the desired end product or may be used as a precursor to produce another compound. In some cases, the ester may be hydrolyzed to the alcohol and organic acid from which it was biosynthesized. In this way, one can use the platform described herein to produce greater amounts of an alcohol or organic acid than can be accumulated if the alcohol and/or organic acid is the fermentation end product. The ester may be biosynthesized and recovered from aqueous culture by phase separation— a process that can be simpler, more efficient, and/or less costly than recovery of an alcohol and/or an organic acid form an aqueous medium by, for example, distillation. The recovered ester can be hydrolyzed in a controlled volume of water, in most cases without any additional enzymatic or activating treatment, to yield the constituent alcohol and organic acid.

In yet another aspect, we describe herein methods for introducing a heterologous polynucleotide into cell so that the host cell exhibits an increased ability to convert a carbon source to an ester. The heterologous polynucleotide can encode a polypeptide operably linked to a promoter so that the modified cell catalyzes conversion of the carbon source to an ester. In some of these embodiments, the carbon source can include one or more of glucose, pyruvate, ketovaline, and organic acid (or precursor thereof), or an alcohol (or precursor thereof). The host cells for such methods can include, for example, any of the microbial species identified above with regard to the recombinant cells described herein.

As used in the preceding description, the term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements; the term "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims; unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one; and the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

In the preceding description, particular embodiments may be described in isolation for clarity. Unless otherwise expressly specified that the features of a particular embodiment are incompatible with the features of another embodiment, certain embodiment can include a combination of compatible features described herein in connection with one or more embodiments. For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

EXAMPLES Example 1

Plasmid construction

BKDH enzyme complex coding regions and fadDX were amplified from

Pseudomonas Putida KT2440 genomic DNA with primers bkdh_ecofwd

(TgcatcgaattcAGGAGAAATT AACTatgAACGAGTACGCCC CCCTGCGTTTGC, SEQ ID NO: 1) and bkdh hindrev (Tgcatc aagcttTCAGATATGCAAGGCGTGGCCCAG, SEQ ID NO:2), fadDXsall-F (tgtacggtat taatgtcgac

AGGAGAAATTAACTATGCTTCAACTCCAAAAACAAGAAAC, SEQ ID NO:3) and fadDXbam-R (TGATCATGCGCCATAGTTAATTTCTCCTGGATCCTTAGACGC TGGCAGGGGTGGCCTGTT, SEQ ID NO:4), respectively. The PCR product of BKDH was then digestion with EcoRI and Hindlll, and inserted into pZE12 to make pIBA16. To construct plasmid pESTERl, the coding region of BEBT from Clarkia breweri was synthesized by DNAworks (Hoover and Lubkowski, Nucleic Acids Res 2002, 30 (10), e43), and then the linear plasmid of pIBA7 was obtained after Xbal digestion. Finally, the plasmid of pESTERl was formed after combination of fadDX, BEBT, and linear pIBA7 by as described in Gibson et al, Nat Meth 2009, 6(5):343-345. The BEBT coding region, digested with Acc65I and Hindlll, was inserted into the corresponding site of pZS plasmid, to form plasmid pESTER2.

Fermentation results

E. coli host BW25113 was used for fermentation. One strain Ester 1 was BW25113 transformed with pIBAl (International Patent Publication No. WO 2012/109534) and pESTERl, and the other strain Ester 2 was BW25113transformed with pIBAl, pIBA16 and pESTER2.

Overnight cultures incubated in LB medium were diluted 25-fold into 5 mL M9 medium supplemented with 0.5% yeast extract and 4% glucose in 125-mL conical flasks. Antibiotics were added appropriately (ampicillin 100 mg/L and kanamycin 25 mg/L). 0.1 mM isopropyl-b-D-thiogalactoside (IPTG) was added to induce protein expression. The culture medium was buffered by adding 0.5 g CaC03. Cultures were placed in a 30°C shaker (250 rpm) and incubated for 48 hours. Fermentation products were quantified by HPLC or GC analysis. Results are shown in FIG. 2(b).

Example 2

Acyltransferases LuxE, ATF1, ATF2, BPBT, and SAAT were amplified from Clarkia breweri with primers:

luxEalsS-F (gaaaacgaaagctctctaa GCTGAGCAGG AGAAATTAAC

TATGGCGCAT GATCAGAGCCT, SEQ ID NO:81) and

luxEvec-R (agcctttcgttttatttgatgcctctaga GCTCAGCTTA CAGGCTGCTC

TGGGTGAAATG, SEQ ID NO:82) from S. cerevisiae;

ATFlalsS-F (cgaaagctctctaa GCTGAGCAGG AGAAATTAAC TATGAATGAA ATCGATGAGAAAAATC, SEQ ID NO:83) and

ATF 1 vec-R (agcctttcgttttatttgatgcctctaga GCTCAGCTTA AGGGCCTAAA

AGGAGAGCTTT, SEQ ID NO:84) from S. cerevisiae;

ATF2alsS-F (cgaaagctctctaa GCTGAGCAGG AGAAATTAAC TATGGAAGAT ATAGAAGGAT ACGAAC, SEQ ID NO:85) and

ATF2vec-R (cctttcgttttatttgatgcctctaga GCTCAGCTTA AAGCGACGCA

AATTCGCCGA TGG, SEQ ID NO: 86) from P. hybrida;

BPBTalsS-F (aaacgaaagctctctaa GCTGAGCAGG AGAAATTAAC

TATGGACAGC AAACAGAGCA GCG, SEQ ID NO:87) and

BPBTvec-R (cctttcgttttatttgatgcctctaga GCTCAGCTTA AAGCGCTGGG

GTGATGAACG CAT, SEQ ID NO:88) from Strawberry; and

SAATalsS-F (aaacgaaagctctctaa GCTGAGCAGG AGAAATTAAC

TATGGAGAAA ATAGAAGTGA GCA, SEQ ID NO:89) and S AATvec-R (cctttcgttttatttgatgcctctaga GCTCAGCTTA GATCAGCGTC

TTTGGACTCG CCA,, SEQ ID NO:90) from Strawberry.

The different acyltransferases were ligated with Blpl digested plasmids of pIBAl (International Patent Publication No. WO 2012/109534) and pIVCl (Xiong et al. Sci Rep 2012, 2:311) as described in Gibson et al, Nat Meth 2009, 6(5):343-345, to form plasmids of pZA-ilvD-alsS-LuxE, pZA-ilvD-alsS-ATFl, pZA-ilvD-alsS-ATF2, pZA-ilvD-alsS- BTBT, pZA-ilvD-alsS-SAAT, pZA-leuABCD-ilvD-alsS-LuxE, pZA-leuABCD-ilvD-alsS- ATF1, pZA-leuABCD-ilvD-alsS-ATF2, pZA-leuABCD-ilvD-alsS-BTBT and pZA- leuABCD-ilvD-alsS-SAAT, respectively. To construct plasmid of pZE-KivD-yqhD, yqhD was PCR amplified with primers yqhDSphl-F (GGGCCCgcatgc AGGAGAAATT

AACTATGAAC AACTTTAATC TGCACACCCC, SEQ ID NO:91) and yqhDXbal-R (GGGCCCtctaga TTAGCGGGCG GCTTCGTATA TACGGC, SEQ ID NO:92), and then replaced the padA of plasmid pIBA7 (International Patent Publication No. WO

2012/109534) to form pZE-KivD-yqhD.

Fermentation results

Shake flask fermentations were carried out for the recombinant strains. Cells were inoculated in test tubes overnight and 200 μί _^ cells were transferred into 10 mL of fermentation medium in a 150-mL screw-cap conical flask. Fermentation medium consisted of 20 g/L glucose in M9 minimum medium (5 g/L yeast extract) supplemented with thiamine (10 mg/L), ampicillin (100 μg/mL), kanamycin (25 μg mL), and 0.5 g calcium carbonate for neutralization. Protein expression was induced by addition of 0.1 mM isopropyl-p-D-l-thiogalactoside (IPTG). Flasks were sealed with Parafilm before fermentations started to create a micor-aerobic environment. Samples were collected after incubation at 30°C on a rotary shaker (250 r.p.m.) for 48 hours. The produced medium-chain ester compounds were quantified by GC-FID (gas chromatography-flame ionization detector) analysis. Their byproducts and remaining glucose were identified by HPLC-RID (high-performance liquid chromatography-refractive index detector) analysis. Results are shown in FIG. 6.

The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference in their entirety. In the event that any

inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however,

inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Sequence Listing Free Text

SEQ ID N0:1

Tgcatc gaattc AGGAGAAATT AACTatg AACGAGTACGCCC CCCTGCGTTTGC SEQ ID N0:2

Tgcatc aagctt TCAGATATGCAAGGCGTGGC CCAG

SEQ ID N0:3

tgtacggtat taatgtcgac AGGAGAAATT AACTATGCTT CAACTCCAAA AACAAGAAAC

SEQ ID N0:4

TGATCATGCGCCATAGTTAATTTCTCCTGGATCCTTAGACGC TGGCAGGGGTGGCCTGTT SEQ ID N0:5

GL26991173, Protein name: acetyl-CoA synthetase ACS_[Pseudomonas putida KT2440]

1 msaaplypvr pevaattltd eatykamyqq svinpdgfwr eqaqrid ik pftkvkqtsf

61 ddhhvdikwf adgtlnvssn cldrhleerg dqlaiiwegd dpsehrnity relheqvckf

121 analrgqdvh rgd vtiymp mipea vaml acarigaihs vfggfspea lagriidcks

181 kvvitadegv rggrrtplka nvdlaltnpe tssvqkiivc krtggdia h qhrdiwyedl

241 mkvasshcap kemgaeealf ilytsgstgk pkgvlhttgg ylvyaalthe rvfdyrpgev

301 ywctadvgwv tghsyivygp langattllf egvpnypdit rvskivdkhk vnilytapta

361 irammaegqa avegadgssl rllgsvgepi npeawnwyyk tvgkercpiv dtwwqtetgg

421 ilisplpgat glkpgsatrp ffg vpalvd nlgnlidgaa egnlvildsw pgqsrslygd

481 hdrfvdtyfk tfrgmyftgd garrdedgyy witgrvddvl nvsghrmgta eiesamvahs

541 kvaeaa vgv phdikgqgiy vyvtlnagie aseqlrlelk n vrkeigpi aspdviqwap

601 glpktrsgki mrrilrkiat geydalgdis tladpgvvqh lidthkamnl asa

SEQ ID NO: 6

GI:260770658, Protein name: acetyl-CoA synthetase [Vibrio furnissii CIP 102972] 1 mseahiypvk enikahthad detylamyqq svsdpegfws ehgkivdwmk pftqvkhtsf

61 dtghvdirwf edgtlnvsan cidrhlaerg ddvaiiwegd dpaddktltf nelhrdvcrf

121 snalkaqgvr kgd vclymp mvpeaavaml actrigavht vvfggfspea lagriidsds

181 k vitadegv rggravplkk nvdealtnpe vktiskvivf krtggevawh ehrdvwwhda

241 vaaasdvcpp eemnaedplf ilytsgstgk pkgvlhttgg ylvyatmtfk yvfdyqpget

301 fwctadvgwi tghtyliygp Isngaktilf egvpnypsta rmse vdkhq vnilytapta

361 iralmakgde avkgtsrssl rimgsvgepi npeawewyyk tignekspiv dtw qtetgg

421 ilitplpgat alkpgsatrp ffgvqpalvd nmgevidgaa egnlvildsw pgqmrtvygd

481 herfeqtyfs tfkgmyftgd garrdedgyy witgrvddvl nvsghrmgta eiesalvafd

541 kiaeaa vgv phdikgqaiy ayitlndgvy psaelhkevk dwvrkeigpi atpdvlhwtd

601 alpktrsgki mrrilrkiat gdtgnlgdts tladpsvvdk liaekaqlv

SEQ ID NO:7

GI: 167623628, Protein name: acetyl-CoA synthetase [Shewanella halifaxensis HAW-EB4]

1 mstqslykvp seiaanalvn deqykkmyqe sivnpegfwr ehgnridwik pftkvkktsf

61 ddhnlfikwf ydgtlnasan cldrhlenna dklaiiwegd dakdqrtlty gqlhtqvckf

121 analrsqgvr rgdvvtiymp mvpeaavaml acarigaihs vfggfspds iasrvidgns

181 kvvitadegv ragriiplka nidealshpd vncvekvivm krtggdinwv egrdiwwdsl

241 mdtasehcia eemgaedplf llytsgstgn pkgvlhttgg ymvyaamthe yvfdykenev

301 ywctadvgwx tghsymvygp langatvlih egvpnypspa rlgemvdrhk vnilytaptl

361 iralmaegke qfagfdgssl rimgsvgepi npeawrwynd vighekcpiv dtwwqtetgg

421 ilisplpgat dtkpgsatrp ffgvqpalvd nmgnivdgas egnlvildsw pgqmrtvfgd

481 hdrfvltyfk tfrgmyftgd gakrdedgyy witgrvddvi nvsghrlgta evesalvahe

541 fvaeaavvgy phdikgqgiy ayvtltkgsv eteelrqelr qwvrkeigal atpdliqwag

601 glpktrsgki mrrflrkiaa nevsnlgdss tladpavidt lietrlnrse SEQ ID O:8

GI:330830937, Protein name: acetyl-CoA synthetase [Aeromonas veronii B565]

1 mstqslykvp seiaanalvn deqykkmyqe sivnpegfwr ehgnridwik pftkvkktsf

61 ddhnlfikwf ydgtlnasan cldrhlenna dklaiiwegd dakdqrtlty gqlhtqvckf 121 analrsqgvr rgdvvtiymp mvpeaavaml acarigaihs vvfggfspds iasrvidgns

181 kvvitadegv ragriiplka nidealshpd vncvekvivm krtggdinwv egrdiwwdsl

241 mdtasehcia eemgaedplf llytsgstgn pkgvlhttgg ymvyaamthe yvfdykenev

301 ywctadvgwi tghsymvygp langatvlih egvpnypspa rlgemvdrhk vnilytaptl

361 iralmaegke qfagfdgssl rimgsvgepi npeawrwynd vighekcpiv dtwwqtetgg

421 ilisplpgat dtkpgsatrp ffgvqpalvd nmgnivdgas egnlvildsw pgqmrtvfgd

481 hdrfvltyfk tfrgmyftgd gakrdedgyy witgrvddvi nvsghrlgta evesalvahe

541 fvaeaa vgy phdikgqgiy ayvtltkgsv eteelrqelr qwvrkeigal atpdliqwag

601 glpktrsgki mrrflrkiaa nevsnlgdss tladpavidt lietrlnrse SEQ ID NO:9

GL209696237, Protein name: acetyl-CoA synthetase [Aliivibrio salmonicida LFI1238]

1 msdihvypvn qdiaknahad edkyremyqq svinpegfwr ehgqivdwmt pytkvkntsf

61 dtghvdikwf edgelnvsan cidrhlaarg devaiiwegd dpqddasitf nelheqvckf

121 snalksqgvr kgdvvciymp mvaeaaiaml actrigavht vvfggfspea lagrivdsda

181 kvvitadegv rggrtvplkk nvddalnnpe vttiekvvvf qrtgndidwn eerdvwwhea

241 tavasahcep eamnaedplf ilytsgstgk pkgvlhttgg ylvyaamtfk yifdyqegev

301 fwctadvgwi tghtyliygp langaktilf egvpnypsts rmsevvdkhn vnilytapta

361 iralmahgnd avegtsrssl rvmgsvgepi npeawewyyn tigdarcpiv dtwwqtetgg

421 ilisplpgat alkpgsatrp ffgvqpalvd nmgnliegaa dgnlvitdsw pgqmrtiygd

481 hdrfeqtyfs tfkgmyftsd garrdedgyy witgrvddvi nvsghrmgta evesalvsfs

541 kiaeaaivgv phdikgqaiy ayitlnsgey psaelhkevk dwvrkeigpi atpdflhwtd

601 slpktrsgki mrrilrkiat gdtsnlgdts tladpsvvnk lieeqrkia

SEQ ID NO:10

GL54310469, Protein name: acetyl-CoA synthetase [Photobacterium profundum SS9]

1 msevhvypvn qeiaatahvn deqyremyqq svinpegfwr ehgqivdwik pftkvkhtsf

61 dtghvsvkwf edgtlnvsan cidrhlatrg dqpaiiwegd dptddatfty nelheqvckf

121 snalksqgvr kgdvvciymp mvaeaaiaml actrigavht ivfggfspea lagrivdsna 181 klvitadegv ragravplkk nvddalankn vtsiekvivl krtggnvewh serdvwwhea

241 tavasshcep eemnaedplf ilytsgstgk pkgvlhttgg ylvyatmtfk yvfdyqegdv

301 ywctadvgwi tghsylvygp langattvlf egvpnypsts rmsevvdkhn vsilytapta

361 iralmakgte aikgtsrssl rimgsvgepi npeawewyhh tigdsrcpiv dtwwqtetgg

421 ilitplpgat alkpgsatrp ffgvqpaivd nmgnilegva egnlvmvdsw pgqmrtlwgd

481 herfeqtyfs tfqgmyftgd garrdedgyy witgrvddvl nisghrmgta eiesalvafd

541 kiaeaaivgv phdikgqaiy ayitlndgei psaelhkevk dwvrkeigpi atpdflhwtd

601 alpktrsgki mrrilrkiat gdtgslgdts tladps vdk liaekqtil

SEQ ID NO: l l

GL6320852, Protein name: acetyl-CoA synthetase Faa2p[5'. cerevisiae]

1 maapdyaltd liesdprfes lktrlagytk gsdeyieely sqlpltsypr yktflkkqav

61 aisnpdneag fssiyrssls senlvscvdk nlrtaydhfm fsarrwpqrd clgsrpidka

121 tgtweetfrf esystvskrc hnigsgilsl vntkrkrple andf vails hnnpewiltd

181 lacqaysltn talyetlgpn tseyilnlte apilifaksn myhvlkmvpd mkf ntlvcm

241 delthdelrm lnesllpvkc nslnekitff sleqveqvgc fnkipaippt pdslytisft

301 sgttglpkgv emshrniasg iafafstfri ppdkrnqqly dmcflplahi fermviaydl

361 aigfgigflh kpdptvlved lkilkpyava lvpriltrfe agiknaldks tvqrnvanti

421 ldsksarfta rggpdksimn flvyhrvlid kirdslglsn nsfiitgsap iskdtllflr

481 saldigirqg ygltetfagv clsepfekdv gscgaigisa ecrlksvpem gyhadkdlkg

541 elqirgpqvf eryfknpnet skavdqdgwf stgdvafidg kgrisvidrv knffklahge

601 yiapekieni ylsscpyitq ifvfgdplkt flvgivgvdv daaqpilaak hpevktwtke

661 vlvenlnrnk klrkeflnki nkctdglqgf eklhnikvgl epltleddvv tptfkikrak

721 askffkdtld qlyaegslvk tekl

SEQ ID NO:12

GL255717016, Protein name: acetyl-CoA synthetase [Lachancea thermotolerans]

1 mskqdgyisl selietdkrf qnlreelavy dknskeylsn lisklpltnh vsyrqflkeq

61 avslesskkh gyspvfrssl speclvsnvh prlstffelf nfsverfpdn dclgqrsqdr

121 vtghwgqhye fesyreiqer sqnlgsgimt vvnlkrkrrf gsndfivsfl stnrkewvis 181 dlacqgyslg ntalyetlgl dtseyilnvt espvlilske niyrvmemvp klphlstivc

241 mdelsdlela qlngpllpqh tnskgerisi lnfrqverig asnkvplipp tpdslytisf

301 tsgttgtpkg vqmkqshvaa avafvlstlr mprlkhrsqa ydlcflplah iferqivafd

361 lssgtaigfl hkpdpsvlve dlkllkpdvf psvpriltkf eagiknslqn gdgsavtknv

421 astilnkrle rtthhggkdh silnt vfhr vlidkirssl glenldvvit gsapisndtl

481 Ifmksaldcg vrqgygltet fagiclsear erdsgtcggm avttecrlrs ipemgydaeh

541 dlkgevqlrg sqvfrgyykn pqetsralge dgwystgdvg fidskgrlsi idrvknffkl

601 aqgeyiapek iesvylsscp yltqisvhgd slqtflvavi glelditapi ihkkipelrg

661 fsgkdlvdei nksrahrkal ivlinsfieg lqgfekihnl yvgieplkvt ddtitptlkv

721 kranaakhfr kilenlyeeg slikvekl

SEQ ID NO: 13

GL45187925, Protein name: acetyl-CoA synthetase [Ashbya gossypii ATCC 10895]

1 msnetevnry pgmgpislve virtdarfae Iwkrlslfqq gsvefykely dnmplfagmd

61 gmalsapvpg sgkkgyspvf rnvlvpegkl lsaidegvdt gyhvfklsar mypdnhclgm

121 raydeatgkw ldeyrwetys qverraenlg agllsvvnvk rskpldtndf xvammsansk

181 ewvltdlacq tfslvntaly etlgpntsey imnltespvv vskpnllri falasklral

241 ntivimddmd lqevdrlasl lpvtknakge tisvltlrqv ekigelnnia pippspdsfh

301 tisftsgtts lpkgvqlthr aycaalafac shvrcepnkq ryalcllplt hiyqrqmtgl

361 nlmhafgxgf Ihkpnpdlfi eamcvlrpam vslvprvltk leagiknsiq gadvstfkrk

421 laktvidakd krfsavsgpd dsymnrfiyr kifvdkirdk lgftnvplvt tgsapispet

481 lrfiqcamdi gilqgyglte tfggnflsvp yetdcgscgp pamttevrlr dvpgmsynae

541 kdhmgevvvr sqqqferyyk mpektaevld kdgwfstgdv gyidkkgrlf itdrvknifk

601 Isqgeyiape kvencylssc pfitqifvhg nslnnylvgv vgidvvpfka ildsrtskws

661 klpleevipt inkdpalkql tlkiinsfvt aelqgfekig nlyadvepls vdgetltptf

721 kvkrevctkv fkdilsslyd eghilkagkl

SEQ ID NO: 14

GL380351855, Protein name: acetyl-CoA synthetase [Candida orthopsilosis]

1 maslfnekpe hiwktitesf pldqsvtsra Iplpnsevpg fspiyrnays qkelktvpyp 61 gittlhdtfe ls annghkr alghrvkkad gsfgeyvwqd yktvqqrrnn

Igsgiffvlq

121 nnpyktdsea hkklkydpls ddsfvltifa hnrpewvlad vtstaysitn talydtlgpd

181 tskyilnlte cpiilcskdk vkslvelkeq npeelsnlic lvsmddltte davlknychd

241 hnislfdykq veklgeinpl apippkpetk fsitftsgtt ganpkgvllt hetavagitf

301 vysgitlpra davfysflpl ahiyerqgih faltygaaig fpqgpspltl lediqvlepd

361 ylalvprvlt kleagikaqt inndekpilk slftkaintk lalqsnpane ntnpshllyd

421 rvlgllrkkl gmknlkiims gsapispetl kflkaslntg vgqgygmset fagvmasstf

481 etdasscgpi svttecktrd lpamgytskd eggprgellv rgpqifleyy knpeetaksf

541 dedgwfytgd varidsktgr tyiidrvknf fklaqgeyvt perientyls cfpyiaqlf

601 hgdslrthlv g vgvdpasi tqyikqrhge titdaadlvr ffqdpkrkre llvdmnaslg

661 nklqgfeklh nievdvepls veknlitptm kikrpictky fkdtldklye egslirndkl SEQ ID NO:15

GI:126136683,Protein name: acetyl-CoA synthetase [Scheffersomyces stipitis CBS 6054]

1 mslfqedpkn ihnfiraslp ldpkklcesv plpysekpgy savyrnkysv dglitrphps

61 latlfdlhev aarsqpdspc fgvrhkqadg tygpyqwiny qevydrkvhf gsgvffilqn

121 npyrtnspvh qkihydpqat espfvlsifs anraewvttd macsayslts talydslgaq

181 tskyilsste spi vsskdk lksliklkae dpetlsnlit Ivsmdpldpk tdealvkyan

241 dnritlfdfd qvlklgeink Ipqippkpet iytisftsgt tganpkgvll thanavcavt

301 fcysnitlpe sptvycflpl ahiyermsis falsmcaaig fpqspspltl mddikhlrph

361 flnlvprvyt kleaalkaqt fnsdkpiiks Ifsaainkkm elqavedgaq gkhivydq v

421 qllrkkigfd rliavttgsa pispetlkfi kaslntgmsq gygltesfag vctslkyean

481 pgscgaisit temrlrevpe mnyhahdkgg prgelmlrgp qifreyfknp eetakaidse

541 gwfatgdiar idatngnriy iidrvknffk laqgeyitpe kientylsqf pfiqqlyvhg

601 dplkthlvai vgldpatvds yikrkfndil snqddivdff rnpkhrlall edmnssvggl

661 lqgyerihni kvdfnpltie dnvitptlki krpiavkffk edfdalyeeg slikpdahkl

SEQ ID NO:16

GL294656605, Protein name: acetyl-CoA synthetase [Debaryomyces hansenii CBS767] 1 ititssdvydhg dspyvfkpsk tpasqlirdh Iplpekmfkd svslpgteke gysaiyrnkm 61 fpgrlkealt peldtyyrlf knsvltfgdk sclayrkydy vnkksaddys

fltyrevdem

121 kqrygsgfly llqnnpfkns ekfeshrkid nhvkdyknfd isdmsfvati

ysanrmewvl

181 sdlmcssysi tntalydtlg adtseyilqt tqspvviatk ehvmdivnlk

ekypeklehv

241 isivcldpld lknetslsae dqalvtacks hritlvdinq vmkvgeifpt

pelppspetl

301 ytisftsgtt gahpkgvlls qkictagvtf vltqlpripd arsfsflpla

hiferqvcaf

361 glscgncigf pqnggtpltl iedlklfkpn ymcnvprvft kyeaaiksat

vdhptstfkr

421 gifdkvistk iqaqekydga dgshlvydrl flssirkafg fdnmefivtg

sapispstvk

481 flkatlcvgm pqgygstesf agfaigipye aepgscgsvg vtvemklrel

pamgynlddp

541 egprgelllr gpqifkqyfh neeetkksfd degwfhtgdv arfsknngrl

fiidrvknff

601 klsqgeyvtp ekvenkylss ssilnqlyvh gdslrhflvg ivgidpegav

nflvekckvs

661 ksqlssseqi lneinkkenr ellvayinsr isnqlsgfek lhniyvefep

lrldrd vta

721 tqklkrpvaf kffkpqidvm ydegslvkgp kl

SEQ ID NO:17

GL6319264, Protein name: Acslp [Saccharomyces cerevisiae S288c]

1 mspsavqssk leeqsseidk lkakmsqsaa taqqkkehey ehltsvkivp qrpisdrlqp

61 aiathysphl dglqdyqrlh kesiedpakf fgskatqfln wskpfdkvfi

pdpktgrpsf

121 qnnawflngq Inacyncvdr halktpnkka iifegdepgq gysitykell

eevcqvaqvl

181 tysmgvrkgd tvavympmvp eaiitllais rigaihswf agfssnslrd

rindgdsk v

241 ittdesnrgg kvietkrivd dalretpgvr hvlvyrktnn psvafhaprd

ldwatekkky

301 ktyypctpvd sedplfllyt sgstgapkgv qhstagyllg alltmrytfd

thqedvffta

361 gdigwitght yvvygpllyg catlvfegtp aypnysrywd iidehkvtqf

yvaptalrll

421 kragdsyien hslkslrclg svgepiaaev wewysekigk neipivdtyw

qtesgshlvt

481 plaggvtpmk pgsasfpffg idavvldpnt geelntshae gvlavkaawp

sfartiwknh

541 dryldtylnp ypgyyftgdg aakdkdgyiw ilgrvddvvn vsghrlstae

ieaaiiedpi

601 vaeca vgfn ddltgqavaa f vlknkssw statddelqd ikkhlvftvr

kdigpfaapk

661 liilvddlpk trsgkimrri Irkilagesd qlgdvstlsn pgivrhlids vkl

SEQ ID NO:18

GL254579411, Protein name: ZYRO0C00682p [Zygosaccharomyces rouxii] 1 mtvnyvyagm wrnlfpesic rlrdkrkehi pysmspstta tgtsptggti gdlkarlvha

61 aerentspat tnnvstekdh eaetntpttd ydhlisvhtv qqkpithrlq selschycph

121 isgfreyekl yresidqpse ffgnkarqf1 nwfkdfdqvf ipdprtgkps lnnnawfIng

181 qtnacyncvd rhaletpdkp aiiyetdepg qgytltysel leqvcqlaqv lrysmgvrkg

241 dtvavympmi pqavislmai arigaihsvv fagfscnslr drindadshv vittdetkrg

301 gkivetkriv ddalketpgv snvlvyrrtn nprvprqvsr dldwdgelrk ykgycpcepv

361 dsehplflly tsgstgtpkg vqhstagyll salltmrysf dthredvfft agdvgwitgh

421 tyvvygplly gcttlvfegt payptyaryw diidqykvtq fyvaptalrl lkragdsfie

481 ghslqslral gtvgepiaae vwewysekig knelpivdty wqtesgshml tpmaggvtpm

541 kpgsagfpfi gidscildpt tgqeltkplv egvlavrcgw psfartiwkd hdrfldtylk

601 pypgyyftgd gaardkdgyi wilgrvdd v nisghrlsta eiesavldda ivaeca vgf

661 nddltgqava af vlknkss wstaseeell dikkhlilav rkdigpfaap klivlvddlp

721 ktrsgkimrr ilrkilagec dqlgdvstls npgvvrhlid svkl

SEQ ID NO:19

GI:45188280, Protein name: ADR408Wp [Ashbya gossypii ATCC 10895]

1 mvtsagvgha eynngadvqh adyahltsvg qveqkplggr lgalaeyykp nvasmeeyra

61 mhaqsitdpa afygerarty vdwfrpfdav flpgpdgrps fdnnawfvng qlnacynlvd

121 rhaartpdkv aiiyeadepg egysltyrel laqvckvaqv lqysmgvrkg dtvavympmi

181 pqalvtllai srigaihsvv fagfssnslr drindarsev vvttdeskrg gkiietkriv

241 ddaiketpql rkvlvykrtc npsvsyvadr dldwdtevkk yksycpcepv dsehplflly

301 tsgstgapkg vqhstagyll qaylsmlysf dvhsddifft agdigwitgh tyvvygplfs

361 gcttvvfegt paypsysryw diidkysvtq fyvaptalrl Ikragdsyvd gyslrtlrsl

421 gtvgepiaae vwewyytvig kreipvidty wqtesgahlv tplaggstpm kpgsasfpff

481 gidlaildpq tgeellgpnv egvlavkqpw psftrtiwnn hdryldtyln pykgyyfagd

541 gaardsqgfi wilgrvddvv nvsghrlsta eveaaiiqes mvaecavvgf adeltgqaia

601 af vlkqkss wntaserelq eikkhlilsv rrdigpfaap klivlvddlp ktrsgkimrr

661 ilrkilagea dqlgdvstls npgivkhlie svkf SEQ ID NO:20

GI:3139035, Protein name: acetyl-CoA synthetase [Kluyveromyces lactis]

1 mksnasaaaa dqiktheyeh ltsvpivqpl pitdrlssea aqkykpnlpg

gfeeykslhk

61 eslenpakfy heraqllnwf kpydqvfipd tegkptfenn awftngqlna

cynlvdrhaf

121 tqpnkvaily eadepgqgys ltyaelleqv ckvaqilqys mnvkkgdtva

vympmipqal

181 itllaitrig aihs vfagf ssnslrdrin daysktvitt deskrggkti

etkrivdeal

241 kdtpqvtnvl vfkrthneni kyipgrdldw deevkkyksy tpcepvdseh

plfllytsgs

301 tgapkgvqhs tagyllqall smkytfdiqn ddifftagdi gwitghtycv

ygpllqgctt

361 lvfegtpayp nfsryweivd kyqvtqfyva ptalrllkra gdsftegfsl

kslrslgsvg

421 epiaaevwew ysekigknel pivdtywqte sgshlvtpla ggatpmkpga

aafpffgidl

481 avldpttgie qtgehaegvl aikrpwpsfa rtiwknndrf Idtylkpypg

yyftgdgvar

541 dkdgffwilg rvdd vnvsg hrlstaeiea aiieddmvae cavvgfndel

tgqavaaf v

601 lknkssltaa seselqdikk hliitvrkdi gpfaapkliv lvddlpktrs

gkimrrilrk

661 ilagesdqla tsphyptlvs 1st

SEQ ID NO:21

GL320580699, Protein name: Acetyl-coA synthetase isoform [Ogataea parapolymorpha DL- 1]

1 mpekhleneh lmreralepp agflerhpsk pylssldeyk kmyeesirdp

gsffggmaeq

61 hlswfkpftv pkvpnapflk dnngepsawf vdgelnacyn cvdrwaiknp

dkpaiiyead

121 epdqgeiity gellkqvckv sqvllnlgvk kgdtvavylp mipeaivtlm

aivrigaihs

181 vvfagfssgs lrdrindans kvvittdesk rggkiietkk ivddallacp

qvtnvlvykr

241 tgnshipwte grdlwwheev kkypsyypat pvsaedtlfl lytsgstgkp

kgiqhstagy

301 llgallttky vfdvhpedil ftagdvgwit ghsy vygpl lngatt vfe

gtpaypnysr

361 yweivdkykv tqfyvaptal rllkragesy iepyslqslr vlgsvgepia

kdvwewynah

421 igrgkahicd tywqtesgsh litplagvtp tkpgsaslpf fgidpaiidp

vsgkelegne

481 vegvlairss wpsmartiwr dysrfldtyl rpyhgyyfsg dgaardkdgf

ywilgrvddv

541 vnvsghrlst aeieaalieh smvaesa vg fpdeltgsav aafvslknrs

iedpsaikke

601 liltvrkeig pfaapklill vndlpktrsg kimrrilrki lsgeedqlgd

tstlsnpq v

661 shlievvkak SEQ ID NO:22

GI:190348910,Protein name: acetyl-coenzyme A synthetase 1 [Meyerozyma guilliermondii ATCC 6260]

1 mpestdhldh ekmldppkgf ferstskpnl asldeykkly kqsiedpatf fgnaaksfId

61 wdrpfdytrf pvdpkddfkn gdipswfing qlnasynavd rwamknpekp

aiiyeadevn

121 egrtitygel lkdvsklaat ltnlgvkkgd svavylpmip eaivtllaiv

rigalhsvvf

181 agfsstslrd riidadsriv itadeskrgg ktietkkivd dalkecphvr

nvlvfkrtgn

241 shvpfsagrd lw hdelqky gpyfppvpvn sedplfllyt sgstgkpkgv

qhntagyllg

301 almtakytfd lheediifta gdvgwitght yvvygpllcg attvvfegtp

aypdysrywd

361 vvdkykvnqf yvaptalrll kragtkyvek hdlsslrvlg svgepxaaev

whwyndnigr

421 gkahivdtyw qtesgshllt plagvtptkp gsaslpffgi darildpvsg

kdlvdnnveg

481 vlcvksawps itrgiyhdya ryietylkpy pnhyfsgdga ardkdgffwi

lgrvddvvnv

541 sghrlstaei eaaliehelv gesavvgyad eltgqavaay vslksnvevd

dleaikkeli

601 ltvrkeigpf aapklillvd dlpktrsgki mrrilrkvla geedqlgdis

tlsnpqvvsq

661 vie vkasrk

SEQ ID NO:23

GL29893231, Protein name: acyl-activating enzyme 11 -AAEl l[Arabidopsis thaliana]

1 mdnlvlcean nvpltpitfl krasecypnr tsiiygqtrf twpqtydrcc rlaasllsln

61 itrndvvsil apnvpamyem hfsvpmtgav lnpintrlda ktialilrha

epkilfvdye

121 fapliqevlr liptdqsqah priilineid sttkpfskel dyeglirkge

ptpsssasmf

181 rvhnehdpis lnytsgttad pkgvvishrg aylsalssii gwemgifpvy

Iwtlpmfhen

241 gwthtwsvaa rggtnvcirh vtapeiykni elhgvthmsc vptvfrflle

gsrtdqspks

301 spvqvltggs sppavlikkv eqlgfhvmhg yglteatgpv lfcewqdewn

klpehqqmel

361 qqrqgvrnlt ladvdvkntk tlesvprdgk tmgeivikgs slmkgylknp

katseafkhg

421 wlntgdigvi hpdgyveikd rskdiiisgg enissievek vlymyqqvle

aavvamphpl

481 wgetpcafvv lkkgdeesvt segdlikycr enmphfmcpk kvvffqelpk

nsngkilksk

541 Irdiakalvv reddagskkv hqrsiehvss rl SEQ ID NO:24

GL29893229, Protein name: acyl-activating enzyme 12 [Arabidopsis thaliana]

1 mdnlalcean nvpltpitfl krasecypnr tsiiygktrf twpqtydrcc rlaaslisln

61 igknd vsvv apntpamyem hfavpmagav lnpintrlda tsiaailrha kpkilfidrs

121 feplareilg llssedsnln lpvifiheid fpkrvssees dyecliqrge ptpsllarmf

181 ciqdehdpis Inytsgttad pkgvvishrg aylstlsaii gwemgtcpvy lwtlpmfhen

241 gwtftwgtaa rggtsvcmrh vtapeiykni emhnvthmcc vptvfnillk gnsldlshrs

301 gpvhvltggs pppaalvkkv qrlgfqvmha yglteatgpv lfcewqdewn rlpenqqmel

361 karqglsilg ltevdvrnke tqesvprdgk tmgeivmkgs simkgylknp katyeafkhg

421 wlnsgdvgvi hpdghveikd rskdiiisgg enissveven iiykypkvle tavvamphpt

481 wgetpcafvv lekgetnned redklvtker dlieycrenl phfmcprkvv fIdelpkngn

541 gkilkpklrd iakglvaede vnvrskvqrp vehftsrl SEQ ID NO:25

GL224065064, Protein name: acyhcoa ligase acetate-coa synthetase-like protein [Populus trichocarpa]

1 mdqllkcdan yvpltpitfl kranavyanr tsviyegtrf twsqtyercc rladslrsln

61 vgkndvvsvl apnipavyem hfavpmagav lntinirlda kniatilshs gakvffvdyq

121 ykelaskals fldgavpsii aciddidtpt gvqfgqleye qlvqrgnpgy tgelvqdewd

181 pialnytsgt tsapkg vys hrgaylssls lilgwemgna pvylwslpmf hcngwtftwg

241 vaarggtnvc irntsakdmy hniaehavth mccapivfnv llearpherr eitspveilt

301 ggapppasll qdierlgfhv thayglteat gpalvcewqk kwnklpqqdq aklkarqgis

361 iltladadvk dldtmvsvpr dgktmgeivl rgssimkgyf kdpeatskaf rngwfatgdv

421 gvihpdgyle ikdrskdvii sggenissve lesvlyrhpr vleaa vamp hpkwgespca

481 fisvkknsng dtndvkesdi iayckknlph ftvpkrvefm aelpktstgk iqkfqlrala

541 qnfvvneilp skkinghsqp sasgrvntev teyaqgheqv lalsrl

SEQ ID NO:26

GI:226508754, Protein name: acyl-activating enzyme 11 [Zea mays]

1 mdqlpkrpan yvplspvgfl pranavygdr tsviyrgvrf twrqtyar

rlasallslg 61 wrrgdvvsv lapnvpamye mhfavpmaga vlntintrld aaavatilrh sgaklffvdy

121 dyvrlasdal rlldaadvpl vaviddihsp tgarlgeley eallahgdpd adlpplqdew

181 davtlsytsg ttsapkgvvy shrgaylstt slllqwgvpa epvylwtlpm fhcngwtftw

241 gmaarggvnv cirdarpadi yraiarhrvt hmccapvvfs illdgdgdsd gaarqlqapv

301 hvltggappp aallerveri gfnvthaygl teatgpalac ewrdqwdrlp Iperarlkar

361 qgvsvlslad advknadtml svprdgrtvg eivlrgssvm kgylnnpean esafragwf1

421 tgdvg vhpd gyieikdrsk dviisggeni cskeleevlf rhpavadaav vamphprwge

481 tpcaf vprd kaavlsegdv lafcskrmar fmvpkkvevv galprnalgk vekvklreaa

541 rklaptvaaa qkpkaktttv ggrrdgqpva hvmavsrl

SEQ ID NO:27

GL357491641, Protein name: 2-succinylbenzoate-CoA ligase [Medicago truncatula]

1 mnqltrnqan staltpltfl eraatvygns isiiynntsf twsqthkrcl qlasslsslg

61 iqkgdvvsvl spntpamyel hfsvpmsgai Innlnfrldh ktlsvllihs esklif dil

121 slsltlnals Ifptniqqpk lvlimdetla phqipplpkn vniintyegl vakgdpyfkw

181 irpdse dpi tlnytsgtts spkg vhchr atfivsldsl idwsvpvqpv flwtlpmfhs

241 ngwsypwama avgginictr rtdaptiytl ieshgvthmc aap vlnmls nfnkteplkk

301 pvhvltggss pptailtrae rlgfevshgf gmtevigviv scawkrewdr fpatekarmk

361 arqgvrkvgv aevd vgptg esvkndgvtv geivvkgacv mlgyfkdeia tsqcikkngw

421 fytgdvavmh edgyleikdr skdliisgge nmssvevegv lymhsavkea a varpddfw

481 getpcgfvsl kdelkkndip tdneikefck eklphfmmpk tivfmkelpk tstgkvqkhv

541 Irkvakkmgs lslpppprli sri

SEQ ID NO:28

GI: 149375957, Protein name: acyl-CoA synthase [Marinobacter algicola DG893]

1 mnsifdkgle ptdannatlt pldflartas vypeypavih gatrrnwqqt yercrrlasa 61 ladrgvgkgd tvaamlpnip pmlechfgip mlgavlnaln trldakaiaf mlehgeakvl 121 iadrefgdvi neavgitildnp pqvidvndpe fsgagtqvsd ldydafvasg dpafdwqmpa 181 dewdaislcy tsgttgnpkg vyhhrgaye namgnqavws mgmhpvylwt lpmfhcngwc

241 fpwtxtafag thvclrkvep ekilqliseh kvshiticgapi vlntllgase aakssfshtv 301 qamtagaapp akvieaienm gfrvthvygl tevygpvtvc awksewddlp vedrarikar 361 qgvry tlag irativgdpetme avpkdgntig eiflrgntvm kgylknpkat eeafrggwfh 421 tgdlavwhad gyaeikdrlk diiisggeni stievedvly rhpdileaav varpdekwge 481 tpcafvtlkp eagevseddi iafcrermak fkvpktivfs elpktstgki qkfvlrddak

541 kl SEQ ID NO:29

GL26991093, Protein name: IpdV gene product [Pseudomonas putida KT2440]

1 mqqiiqttll iigggpggyv aairagqlgi ptvlvegqal ggtclnigci pskalihvae

61 qfhqasrfte psplgisvas prldigqsvt wkdgivdrlt tgvaallkkh gvk vhgwak

121 vldgkqvevd gqriqcehll latgsssvel pmlplggpvi sstealapkt lpqhl vvgg

181 gyiglelgia yrklgaqvsv vearerilpt ydseltapva eslkklgial hlghsvegye

241 ngcllasdgk ggqlrleadq vlvavgrrpr tkgfnlecld lkmngaaiai derchtsmhn

301 vwaigdvage pmlahramaq gemvaeiiag karrfeptal aavcftdpev vvgktpeqa

361 sqqgldciva qfpfaangra mslesksgfv r varrdnhl ivgwqavgva vselstafaq

421 slemgacled vagtihahpt lgeavqeaal ralghalhi

SEQ ID NO:30,

GL6325162, Protein name: Eeblp [Saccharomyces cerevisiae S288c]

1 mfrsgyyptv tpshwgyngt vkhvlgekgt kslafrdskr qiplhefvtk hvptlkdgan

61 frlnsllftg ylqtlylsag dfskkfqvfy greiikfsdg gvctadwvmp eweqtyslna

121 ekasfnekqf sndekathpk gwprlhprtr ylsseelekc hskgysyplv vlhglaggs

181 hepliralse dlskvgdgkf qvvvlnargc srskvttrri ftalhtgdvr eflnhqkalf

241 pqrkiyavgt sfgaamltny Igeegdncpl naavalsnpw dfvhtwdkla hdwwsnhifs

301 rtltqfltrt vkvnmnelqv penfevshkp tvekpvfyty trenlekaek ftdilefdnl

361 ftapsmglpd gltyyrkass inrlpnikip tliinatddp vtgenvipyk qarenpcvll

421 cetdlgghla yldnesnswl tkqaaeflgs fdelvl

SEQ ID NO:31

GI:207340567, Protein name: YPL095Cp-like protein [Saccharomyces cerevisiae AWRI1631]

1 mfrsgyyptv tpshwgyngt vkhvlgekgt rslafrdskr qiplhefvtk hvptlkdgan

61 frlnsllftg ylqtlylsag dfskkfqvfy greiikfsdg gvctadwvmp eweqtyslna

121 ekasfnekqf sndekathpk gwprlhprtr ylsseelekc hskgysyplv vvlhglaggs

181 hepliralse dlskvgdgkf qvvvlnargc srskvttrri ftalhtgdvr eflnhqkalf

241 pqrkiyavgt sfgaamltny Igeegdncpl naavalsnpw dfvhtwdkla hdwwsnhifs

301 rtltqfltrt vkvnmnelqv penfevshkp tvekpsfiri pekiwkrlkn lqty SEQ ID NO:32

GL255715549, Protein name: KLTH0E13310p [Lachancea thermotolerans]

1 mplpifnpf wgyhgtieqv snpngtvalt lkdekkpvqf sdfvsreipg lkdkakfevn

61 pllftgylqt lylggadfsk sfpvyygrei vkfsdggict adwvmkswks kygadtssfk

121 tdeqathpen wprlhprtrf leesekkdvh nsekplv vl hglaggshep iirsltqdls

181 nagdskfd v vlncrgcars kittrklfya vftsdirefi arekarhpsr kiyavgfsfg

241 atmlghylge egekapieaa sflcnpwdly qsalkmnqdw srnlfskni aqflirlvkv

301 nikelefkeg dvmpaepasl ehpsfcvfts knlrkarefg staefdnlft apclgfdnam

361 dyykacgsih qlpnikvpsl iinskddp gedsipykca kesdnlvlcv sdlgghlaf1

421 dkkyns ats kiaaffdkfe elvq

SEQ ID NO:33

GL254584546, Protein name: ZYRO0F14740p [Zygosaccharomyces rouxii]

1 msnlpiinpf hwgsrgtlkh tsapsgttkl tlnhdktkid fqhfvsqyvp alkdgskfkl

61 nnflftgilq tsmylsgadyt kwfpvfygre ilelsdggvc tvdnvmvswe ekyqlrqnsg

121 sfnklefekd ekdthpqnwp rlqartrylt akelaevhgd qrpl vvlhg laggshetii

181 rsltsklski dggkfqvavl ncrgcarski tnkklfsafq tgdlkeylar eksrnpnrki

241 yavgfsfgas llanylgetg sesnltaavt lccpwdfllc aekmkkdyws knlfskaitq

301 flvrlvkvnm gelespegsk pefqpdienp clymctksnl eraksftqml efdgtftaps

361 mgfssaeeyy ragsainnlh kvqvptliin stddpiidas sipysqvkmn pnllllatdl

421 gghlayldet wdswmnthia sffstfdefl v

SEQ ID NO:34

GL45185426, Protein name: ABR194Cp [Ashbya gossypii ATCC 10895]

1 mglptfaprs gyrgtithr pheeglvklp lkdkekepvt lsdllnehvp elkdgarfyl

61 hpylyngilq tmylygadfs qqykpfygre ivsysdggvs tadwamrewd dlyaapegyn

121 kekfdadaak thpen prlq pntrfldeee lakipkdtrp li ahglag gsheniiral

181 vtellsvgng qfn vvlnsr gcarskiank klfsafhtmd irefinreha rqperkiygl

241 gfsfgsvifg nylgeegdks plsgavccag pwdmfasskm lnddfwisrl fgknlvkhls 301 rllhvnrkel eydgskgddv edasptnpas hiftkenlar astmactrdf

dnfftapalg

361 fknandyyka aspvnivgki rvptllinal ddpmvgaegf lpieklrsnk

hillcttdig

421 ghlayldkny tpwmagrvae fIskmdtlva

SEQ ID NO:35

GL294659670, Protein name: DEHA2G12430p [Debaryomyces hansenii CBS767]

1 mvfpwgfrsn vkihqsnsdk sidlplrnge ktikyadfik delpiideke klwlnpllfn 61 gllqtlyyss anlshkfqvy ygreiftyed ggvcsidhvi pqpenteefk

alhdktlpeg

121 pklhprsry fsneeleqvn spsegsqstk picvvlhgla ggsheplirn

laeylstgkn

181 enkwdtlvin srgccrtkit ngklftalst gdihevlvel kkrnpnrpiy

tvgfsfgaai

241 lanylaeikd dtmitaaclv gcp dlidsa yhiekswsgs ylfnpaltsf

lnklvknnft

301 elnhhnpelf neenlkrgmk qtktwqfdsv ytchtigysn pfeyyrdasp

vnriskihtp

361 tlilnstddp avgvrlpwme vennphlcmv etdlgghlgy vqssgkfwcv

qlveeffakf

421 delias

SEQ ID NO:36

GI:75150384, Protein name: Benzoyl coenzyme A:benzyl alcohol benzoyl

transferase [Clarkia breweri]

1 mahdqslsfe vcrrkpelir pakqtphefk klsdvedqeg lrfqipviqf ykhnnesmqe

61 rdpvqvireg iaralvyyyp fagrlrevdg rklwectge gvmfieadad

vtleqfgdal

121 qppfpcfdql lfdvpgsggi ldspllliqv trlkcgsfif alrlnhtmad

aagivlfmka

181 vgemargaat pstlpvwdrh ilnarvppqv tfnhreyeev kgtiftpfdd

lahrsfffgs

241 teisamrkqi pphlrscstt ievltaclwr crtlaikpnp deevrmiciv

narskfnppl

301 pdgyygnafa ipaavttagk lcnnplgfal elirkakrev teeymhsvad

lmvatgrphf

361 t vntylvsd vtragfgevd fgwgeavygg pakggvgvip gvtsfyiplr

nrqgekgivl

421 piclpsaame ifaealnntl ngkeieiakh ftqssl

SEQ ID NO:37

GL49798480, Protein name: benzoyl coenzyme A: benzyl alcohol benzoyl transferase

[Petunia x hybrida]

1 mdskqsselv ftvrrqepel iapakptpre tkflsdiddq eglrfqipvi nfyrkdssmg 61 gkdpvevikk aiaetlvfyy pfagrlregn drklmvdctg egvrafveana dvtleefgde

121 lqppfpclee llydvpgsag vlhcpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemargat apstlpvwcr ellnarnppq vtcthheyee vpdtkgtlip lddmvhrsff

241 fgptevsalr rfvpphlhnc stfevltaal wrcrtisikp dpeeevrvlc ivnarsrfnp

301 qlpsgyygna fafpvavtta eklcknplgy alelvkktks dvteeymksv adlmvikgrp

361 hftvvrtylv sdvtragfge vdfgwgkavy ggpakggvga ipgvasfyip frnkkgengi

421 vvpiclpgfa mekfvkelds mlkgdaqldn kkyafitpal

SEQ ID NO:38

GI:1171577, Protein name: hsr201 [Nicotiana tabacum]

1 mdskqsselv ftvrrqkpel iapakptpre tkflsdiddq eglrfqipvi qfyhkdssmg

61 rkdpvkvikk aiaetlvfyy pfagrlregn grklmvdctg egimfveada dvtleqfgde

121 lqppfpclee llydvpdsag vlncpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemarggs apsilpvwcr ellnarnppq vtcthheyde vrdtkgtiip

Iddmvhksff

241 fgpsevsalr rfvphhlrkc stfelltavl wrcrtmslkp dpeeevralc ivnarsrfnp

301 plptgyygna fafpvavtta aklsknplgy alelvkktks dvteeymksv adlmvikgrp

361 hftvvrtflv sdvtrggfge vdfgwgkavy ggpakggvga ipgvasfyip fknkkgengi

421 vvpiclpgfa metfvkeldg mlkvdaplvn snyaiirpal

SEQ ID NO:39

GL84578877, Protein name: benzoyl CoA benzoic acid benzoyltransferase [Verbena x hybrida]

1 maqnntlltf tvrrnepeli apakptprel kplsdiddqe glrfqipviq fyrhdpkmrn

61 knparvirea lakvlvfyyp fagrlkegpa kklmvdcsge gvlfieaead vtlnqfgdal

121 qppfpcleel lydvpgsggv ldspllliqv trllcggfif alrlnhtmsd apglvqfmta

181 lgemaqgapr psilpvwqre llfarvqphv tcthheydev kdtkgtiipl ddmahrsfff

241 gptevaalrr fvpsslqkcs tfevltaclw rcrtialkpd peeemriici vnarakfnpp

301 lpkgyygngf afpvaisrag dlstkplgha lklvmqakna vndeymrslt dlmvikgrph

361 ftvvrsylvs dvtragfdav dfgwgnaayg gpakggvgai pgvasfyipf tnhkgetgiv

421 lpiclpnaam etfvkelnnm lakgnndqvl kehnynvlsr 1 SEQ ID NO:40

GL254771941, Protein name: alcohol acyltransferase [Vasconcellea cundinamarcensis]

1 maekasslmf nvrrhepeli tpakptprei kllsdiddqd glrfqvpiiq fyknnssmqg

61 knpakiiksa laetlvhyyp lagrlregfg rklmvectge gilfieadad vtlhefgddl

121 pppfpclvel lydvpgssgi idtpllliqv trlkcggfif alrlnhtmsd asglvqfmta

181 vgemargqrs lsiqpvwerh llnardpprv thihheyddl edtkgtiipl ddmvhrsfff

241 gpsemaaxrr Ivpahfhrst tsevltaylw rcytialqpd peeemrvicv vnsrtklnpp

301 lptgfygngi afpaaisqak kicenpfgyt lqlvkqtkvd vteeymrsaa dlmamkgrph

361 ftvvrrymvs dvtragfglv dfgwgrpepv yggpakggvg pipgvtsffv pfknrkgekg

421 i vptclptp amerfaklmn eilqnqllvs aeenksvfiv sai

SEQ ID NO:41

GI:161089458,Protein name: acyltransferase [Vanda hybrid cultivar]

l masstlhfsv rrrppqlvap asptprelkr lsdiddqegl rfqipviqfy rhepamagqn

61 pasvirdala rtlvfyypfa grlregagkk lfvdctgegv lfieaeadvk lkdfgdalhp

121 pfpcleellf dvdgssavln tpllliqvtl Iscggfilal rlnhtmsdap glvqlmtavg

181 elargsssps vipvwrrell earpspapff phpeyeqvpd tegtitpldn tahrsfifgp

241 reisilrsrl psqlrgasst fdiltacvwr srtralqpad pkenfriici vnirgrinpp

301 lpsgfygnaf glpvaiatag elcsrpldya velvkraksq vsgdylhsva dymvmkgrph

361 ftvvrtyvis dltragfgdv dfgwgkpvyg gpakggvgvs pgvfnffipf vnasgekgiv

421 vpiclpppam rrfvaeiqsl Isaqsal

SEQ ID NO:42

GI: 57471999, Protein name: putative alcohol acyl-transferases CmAAT3 [Cucumis melo]

1 masslvfqvq rsqpqlipps dptphefkql sdiddqeglr fqipviqfyr hdprmagtdp

61 arvikeaiak alvfyypfag rlregpgrkl fvectgegvm fieadadvsl eqfgdalqpp

121 fpcleeplfd vpnssgvldc pllliqvtrl kcggfifalr lnhtmsdasg lvqfmmavge

181 margatapsv rpvwqralln ardppkvtch hreydevvdt kgtiiplddm ahrsfffgps

241 eisairkalp shlrqcssfe vltacl rfr tislqpdpee evrvlcivns rskfnpplpt 301 gyygnafafp valttagklc qnplgyalel vrkakadvte dymksvadlm vikgrphftv

361 vrtylvsdvt ragfedvdfg wgkamyggpa kggvgaipgv asfyipfknk kgergilvpl

421 clpapamerf vkeldallka gktidgvdnk kplfiasal

SEQ ID NO:43

GL49798480, Protein name: benzoyl coenzyme A: benzyl alcohol benzoyl transferase [Petunia x hybrida]

1 mdskqsselv ftvrrqepel iapakptpre tkflsdiddq eglrfqipvi nf rkdssmg

61 gkdpvevikk aiaetlvfyy pfagrlregn drklmvdctg egvmfveana dvtleefgde

121 Iqppfpclee llydvpgsag vlhcpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemargat apstlpvwcr ellnarnppq vtcthheyee vpdtkgtlip lddmvhrsff

241 fgptevsalr rfvpphlhnc stfevltaal wrcrtisikp dpeeevrvlc ivnarsrfnp

301 qlpsgyygna fafpvavtta eklcknplgy alelvkktks dvteeymksv adlmvikgrp

361 hftvvrtylv sdvtragfge vdfgwgkavy ggpakggvga ipgvasfyip frnkkgengi

421 vvpiclpgfa mekfvkelds mlkgdaqldn kkyafitpal

SEQ ID NO:44

GL75150383, Protein name: Benzoyl coenzyme A:benzyl alcohol benzoyl transferase [Nicotiana tabacum]

1 mdskqsselv ftvrrqkpel iapakptpre ikflsdiddq eglrfqipvi qf hkdssmg

61 rkdpvkvikk aiaetlvfyy pfagrlregn grklmvdctg egimfveada dvtleqfgde

121 Iqppfpclee llydvpdsag vlncpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemargas apsilpvwcr ellnarnppq vtcthheyde vrdtkgtiip lddmvhksff

241 fgpsevsalr rfvphhlrkc stfelltavl wrcrtmslkp dpeeevralc ivnarsrfnp

301 plptgyygna fafpvavtta aklsknplgy alelvkktks dvteeymksv adlmvikgrp

361 hft vrtflv sdvtrggfge vdfgwgkavy ggpakggvga ipgvasfyip fknkkgengi

421 vvpiclpgfa metfvkeldg mlkvdapldn snyaiirpal

SEQ ID NO:45

GL224144897, Protein name: predicted protein [Populus trichocarpa]

1 masspasllf kvhrrepeli kpakptphef kllsdiddqe glrfhipvmq fyrnnpsmqg 61 kdpvkiirea laktlvfyyp fagrlregpn rklmvectge gilfieadad vtleqfgdal

121 qppfpcleel lfdvpgssgv lncpllliqv trlkcggflf alrlnhtmsd avglvqfmaa

181 vgemargana psvpavwerq vlnasdpprv tcthreyeev adtkgtiipl ddmahrsfff

241 gpsemsalrk fvpphlshcs tfeiltaclw kcrtialqpd pteemrilci vnarekfnpp

301 lprgyygngf afpvavatae elsknpfgya lelvrkakad vteeymrsvs slmvikgrph

361 ft vraylvs dlrragfeev dfgwgnaiyg gaakggvgai pgvasfyipf tnkkgengvv

421 vpfclpapam erfvkeldgm lkddqtvsaq tkskfivssl

SEQ ID NO:46

GL356500043, Protein name: PREDICTED: benzyl alcohol O-benzoyltransferase-like [Glycine max]

1 mdtslvftvr rseaeliapa kptprevkll sdiddqdglr fqipviqfyr hdpsmagkdp

61 vdvirkavak tlvfyypfag rlreglgrkl mvdctgegvl fieadadvtl kqfgdalqpp

121 fpcweellyd vpgsqgvlnt pllliqvtrl kcggfilavr lnhtmsdaag lvqfmsalge

181 iargrqepsi ppvwrrelln ardpprvtct hreyehvpdt kgtxipldhm ahrsfffgps

241 evaairslip qtdqrcsnfe vltaclwrcr tialqpdkde evrilcivna rskfdpplps

301 gyygnafafp vavttagklc dnplgyalel vrkakadvte eymhsvadlm vtkgrphftv

361 vrsylvsdvt ragfgniefg wgkavyggpa kggvgaipgv asfyipfkna kgeeglvipv

421 clpseamerf qkeldcvlnh hivqpsaiap nsrfivssl

SEQ ID NO:47

GL133874202, Protein name: putative acyltransferase [Clitoria ternatea]

1 matstssssl mfqvqkreae liapakptpr evkllsdidd qeglrfqipv iqfyrynetm

61 agkdpvevir kalaktlvfy ypfagrlreg pgrklmvdct gegvlfieah advtlqqfgd

121 slqppfpgld hllynlpnsd gvlnspllli qvtrlkcggf ilalrlnhtm sdaaglvqfm

181 savgeiargm eepsippvwr rellnarnpp kvtcthreye qvpdskgtii plddmahrsf

241 ffgpaeisai rrlipaqqqr qcsnfeilta clwrcrtial qpdsdeevri lcivnargkf

301 npplpagyyg nafafpvavt tagklcgnpl gyalelvrka kgdvseeymh sladlmvtkg

361 rphftvvrsy lvsdvtragf gdvdfgwgkp vyggpakggv gaipgvasfy ipfrnskgee

421 glvipvclps qamdrfvrel dtilnhhlqp ppksplvlss 1 SEQ ID NO:48

GL49798480, Protein name: benzyl alcohol benzoyl transferase(BPBT) [Petunia x hybrida]

1 mdskqsselv ftvrrqepel iapakptpre tkflsdiddq eglrfqipvi nfyrkdssrag

61 gkdpvevikk aiaetlvfyy pfagrlregn drklmvdctg egvmfveana dvtleefgde

121 lqppfpclee llydvpgsag vlhcpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemargat apstlpvwcr ellnarnppq vtcthheyee vpdtkgtlip lddmvhrsff

241 fgptevsalr rfvpphlhnc stfevltaal wrcrtisikp dpeeevrvlc ivnarsrfnp

301 qlpsgyygna fafpvavtta eklcknplgy alelvkktks dvteeymksv adlmvikgrp

361 hft vrtylv sdvtragfge vdfgwgkavy ggpakggvga ipgvasfyip frnkkgengi

421 vvpiclpgfa mekfvkelds mlkgdaqldn kkyafitpal

SEQ ID NO:49

GI: 1171577, Protein name: hsr201 [Nicotiana tabacum]

1 mdskqsselv ftvrrqkpel iapakptpre tkflsdiddq eglrfqipvi qfyhkdssmg

61 rkdpvkvikk aiaetlvfyy pfagrlregn grklmvdctg egimfveada dvtleqfgde

121 lqppfpclee llydvpdsag vlncpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemarggs apsilpvwcr ellnarnppq vtcthheyde vrdtkgtiip

Iddmvhksff

241 fgpsevsalr rfvphhlrkc stfelltavl wrcrtmslkp dpeeevralc ivnarsrfnp

301 plptgyygna fafpvavtta aklsknplgy alelvkktks dvteeymksv adlmvikgrp

361 hftvvrtflv sdvtrggfge vdfgwgkavy ggpakggvga ipgvasfyip fknkkgengi

421 vvpiclpgfa metfvkeldg mlkvdaplvn snyaiirpal

SEQ ID NO:50

GL57471999, Protein name: putative alcohol acyl-transferases [Cucumis melo]

1 masslvfqvq rsqpqlipps dptphefkql sdiddqeglr fqipviqfyr hdprmag dp

61 arvikeaiak alvfyypfag rlregpgrkl fvectgegvm fieadadvsl eqfgdalqpp

121 fpcleeplfd vpnssgvldc pllliqvtrl kcggfifalr lnhtmsdasg lvqfmmavge

181 margatapsv rpvwqralln ardppkvtch hreydevvdt kgtiiplddm ahrsfffgps

241 eisairkalp shlrqcssfe vltaclwrfr tislqpdpee evrvlcivns rskfnpplpt 301 gyygnafafp valttagklc qnplgyalel vrkakadvte dymksvadlm vikgrphftv

361 vrtylvsdvt ragfedvdfg wgkamyggpa kggvgaipgv asfyipfknk kgergilvpl

421 clpapamerf vkeldallka gktidgvdnk kplfiasal

SEQ ID NO:51

GL133874202, Protein name: putative acyltransferase [Clitoria ternatea]

1 matstssssl mfqvqkreae liapakptpr evkllsdidd qeglrfqipv iqfyrynetm

61 agkdpvevir kalaktlvfy ypfagrlreg pgrklmvdct gegvlfieah advtlqqfgd

121 slqppfpgld hllynlpnsd gvlnspllli qvtrlkcggf ilalrlnhtm sdaaglvqfm

181 savgeiargm eepsippvwr rellnarnpp kvtcthreye qvpdskgtii plddmahrsf

241 ffgpaeisai rrlipaqqqr qcsnfeilta clwrcrtial qpdsdeevri lcivnargkf

301 npplpagyyg nafafpvavt tagklcgnpl gyalelvrka kgdvseeymh sladlmvtkg

361 rphftvvrsy Ivsdvtragf gdvdfgwgkp vyggpakggv gaipgvasfy ipfrnskgee

421 glvipvclps qamdrfvrel dtilnhhlqp ppksplvlss 1

SEQ ID NO: 52

GL224144897, Protein name: predicted protein [Populus trichocarpa]

1 masspasllf kvhrrepeli kpakptphef kllsdiddqe glrfhipvmq fyrnnpsmqg

61 kdpvkiirea laktlvfyyp fagrlregpn rklmvectge gilfieadad vtleqfgdal

121 qppfpcleel Ifdvpgssgv Incpllliqv trlkcggflf alrlnhtmsd avglvqfmaa

181 vgemargana psvpavwerq vlnasdpprv tcthreyeev adtkgtiipl ddmahrsfff

241 gpsemsalrk fvpphlshcs tfeiltaclw kcrtialqpd pteemrilci vnarekfnpp

301 lprgyygngf afpvavatae elsknpfgya lelvrkakad vteeymrsvs slmvikgrph

361 ftvvraylvs dlrragfeev dfgwgnaiyg gaakggvgai pgvasfyipf tnkkgengvv

421 vpfclpapam erfvkeldgm lkddqtvsaq tkskfivssl

SEQ ID NO:53

GL225454593, Protein name: benzyl alcohol O-benzoyltransferase [Vitis vinifera]

1 mapppslvfs vrrskpelva pakptphefk plsdiddqeg lrfqipviqf ykkvpsmhgr

61 dpakvikdav aralvfyypf agrlreeagr klvvectgeg ivfieadadv tleqfgdalq 121 ppfpgleeli ydapgsggvl nspllliqvt rlqcggfifg lrlnhtmsda aglvqfmsav

181 gemargasap sippvwrrdl Inardpprvt rthheydeva dtkgtiipld dmehrsfffg

241 ptefaalrrl Isphlrtcst felltaclwr crtialrpdp eeevrvlciv narsrlqppl

301 pagyygnvfg fpvalssagk lcrnpleyal dlvkgaknsv dqeymksvad Imvstgrrhf

361 t vrsylvsd Itragfgdvd fgwgkavygg aakggvgaip gvasfyipfr nhkgedgivv

421 pfclpaaame ifvkelnsll keehplpsnk sstfiisal

SEQ ID NO:54

GI:52139953, Protein name: alcohol acyl transferase (MpAATl) [Malus x domestica]

1 mmsfsvlqvk rlqpelitpa kstpqetkfl sdiddqeslr vqipiimcyk dnpslnknrn

61 pvkaireals ralvyyypla grlregpnrk l vdcngegi lfveasadvt leqlgdkilp

121 pcplleefly nfpgsdgiid cpllliqvtc ltcggfilal rlnhtmcdaa glllfltaia

181 emargahaps ilpvwerell fardppritc ahheyedvig hsdgsyassn qsnmvqrsfy

241 fgakemrvlr kqipphlist cstfdlitac lwkcrtlaln inpkeavrvs civnargkhn

301 nvrlplgyyg nafafpaais kaeplcknpl gyalelvkka katmneeylr svadllvlrg

361 rpqysstgsy livsdntrvg fgdvnfgwgq pvfagpvkal dlisfyvqhk nntedgilvp

421 mclpssamer fqqeleritq epkedicnnl rstsq

SEQ ID NO:55

GL44887628, Protein nai ie: alcohol acyl transferase [Pyrus communis]

1 mmslsvlqvk rlqpelitpa kptpqetkfl sdiddqeglr fqlpvimcyk dnpslnknrn

61 pikvikeals ralvyyypla grlregpnrk lmvncngegi lfveasadvt leqlgdkilp

121 pcplleeflf nfpgsdgiig cplllvqvtc ltcggfilal rlnhtmcdat gllmfItait

181 emgrgadaps ilpvwerell fardppritc ahyeyedvid hsdgsyafsn qsnmvqrsfy

241 fgakemrvlr kqipphlist cstfdlitac lwkcrtlvlk inpkqavrvs civnargkhn

301 nvhiplgyyg nafafpaavs kaeplcknpl gyalelvkka katmneeylr svadllvlrg

361 rpqysstgsy livsdntrag fgdvnfgwgq pvfagpakal dlisfyvqhk nniedgilvp

421 mclpssamer fqqeleritt gt

SEQ ID NO:56

GI: 147801410, Protein name: hypothetical protein VITISV_042062 [Vitis vinifera] 1 masswsplvf svkrcapefv rptnltprev kqlsdiddqe glrfqipvim fypnnplmkg

61 kdpvkvirea lgkalvyyyp fagrliegdn rklmvdctge gvlfieadad ttlenlgdai

121 qpmcpcfeel lydvpgsggi lgspliliqv trlrcggfif alrlnhtmsd algliqflna

181 isemaqglsv psllpiwere llnarnppri trihheyeev tnnkgtlmam dennlvhrsf

241 ffgpkeiral rnrlpaslga cstfevltay vwrcrtiafa vdpde vris clinrargkrg

301 fdlppgyygn afvypasitk agmlcknple yairllkkak aemsqeyiks vadlmvikgr

361 psftqpgnyf vsdvtragfg evnfgwgkpv ygglaralsi isfctrfrns kgeegnvipi

421 clpppvmerf eqelkrmtke aepvrliksm 1

SEQ ID NO:57

GL49798480, Protein name: benzyl ale ohol benzoyl transferase [Petunia x hybrida]

1 mdskqsselv ftvrrqepel iapakptpre tkflsdiddq eglrfqipvi nfyrkdssmg

61 gkdpvevikk aiaetlvfyy pfagrlregn drklmvdctg egvmfveana dvtleefgde

121 Iqppfpclee llydvpgsag vlhcpllliq vtrlrcggfi falrlnhtms dapglvqfmt

181 avgemargat apstlpvwcr ellnarnppq vtcthheyee vpdtkgtlip lddmvhrsff

241 fgptevsalr rfvpphlhnc stfevltaal wrcrtisikp dpeeevrvlc ivnarsrfnp

301 qlpsgyygna fafpvavtta eklcknplgy alelvkktks dvteeymksv adlmvikgrp

361 hft vrtylv sdvtragfge vdfgwgkavy ggpakggvga ipgvasfyip frnkkgengi

421 vvpiclpgfa mekfvkelds mlkgdaqldn kkyafitpal

SEQ ID NO:58

GI: 158828372, Protein name: alcohol acyl transferase [Citrus sinensis]

1 mvftfsqgll vtrkapeliv perptprevk qisdiddqes lrfqipllff ykndpspsmq

61 grdpvkvire aiskalvfyy plagrlkegy nrklmvecna egvlfleada nftleqlrdd

121 vqppcpylnq liydvpgseg ilgcpllliq vtrltcggfi fairfnhtmc dafglvqflk

181 aiedmarger sptlfpiwqr lilnarnppq vtcihheyde intnevpsdn mahksfffsi

241 kgikalrnql pfqlkdcstf elllaflwkc rtialklqpe eiakvccivn vrgksyemdi

301 ppgyygnaft fsavcskaeq Icknpigyav elvkkakaqm neeyirsaad lmvikgrrik

361 fstrgnfivs dlrnvglgdv dfgwgkpiya gtagavavis fftkyqnkng epgilvpicl

421 pqsamerlqe elkglmiqgs aedlcninqt qifskl SEQ ID NO:59

GL255552914, Protein name: Taxadien-5-alpha-ol O-acetyltransferase, putative [Ricinus communis]

1 malppppftf avrrsppeli vparptprel kkvsdiddqe glrfqisfvm fyrslpsmkg 61 rdpveiirka lsealvfyyp fagrliegpn rklivdcnge gilfieadad

itieqlgdsm

121 qppcpcieel lydvpgssgi igcpllliqi trlacggfvf avrlnhvmsd

svglakffka

181 tgeiakgacm pslfpvwqre ilsarnppqv thkleeyeei khtddksilt

ldspdmvqra

241 fffgpkemrs Irrqlpshlr ncssfemlaa clwrcrtiaf dippnevvrl

scimnvrgkk

301 glqlpdgycg nsfifpavls raehlcknpl gyavelvrks kskmseeyir

stidlmeikg

361 rphyvtawnl llvdmshvgl advdfg gnp vyfgptgsfp nismfsrfkn

skgengfvvp

421 mwlprtvmek fqdeflkmte esaenlndar rqriistl

SEQ ID NO:60

GL10121328, Protein name: alcohol acyltransferase (SAAT) [Fragaria x ananassa]

1 mekievsins khtikpstss tplqpykltl ldqltppayv pivffypitd hdfnlpqtla

61 dlrqalsetl tlyyplsgrv knnlyiddfe egvpylearv ncdmtdflrl

rkieclnefv

121 pikpfsmeai sderypllgv qvnvfdsgia igvsvshkli dggtadcflk

swgavfrgcr

181 eniihpslse aallfpprdd lpekyvdqme alwfagkkva trrfvfgvka

issiqdeaks

241 esvpkpsrvh avtgflwkhl iaasraltsg ttstrlsiaa qavnlrtrmn

metvldnatg

301 nlfwwaqail elshttpeis dlklcdlvnl Ingsvkqcng dyfetfkgke

gygrmceyld

361 fqrtmssmep apdiylfssw tnffnpldfg wgrtswigva gkiesasckf

iilvptqcgs

421 gieawvnlee ekmamleqdp hflalaspkt li

SEQ ID NO:61

GI:374498907, Protein name: alcohol acyl-transferase [Rosa rugosa]

1 mekievsiis rdtikpsaas sslhpyklsi idqftpttyf pviffypitd pvfnlpqtlt

61 dlkitvsqtl tlyyplsgri knnlyiddfe agipylearv nchmidflrl

pkiewlnefv

121 piapyrketi sellpllgiq vnifdsgiai gvsfshkind getancflks

wvaifrgyrn

181 kiihpnlsqa allfpsrddl sekyvammer wwfgekk vt rrfvfdtkai

salqhegkse

241 yvpkpsrvqa Itgflwkhql aatralssgt strfslaiqa vnlrsrmnmk

ttldnaigni 301 flwapaflel nyttpessdh klcdlvnllk esvkeynsdy letlkgekgy ggmcdwldlm

361 degssiepal eiysfsswtr mfdqvdfgwg kpfwigvtgk vqttytnstv lvetqcengi

421 eawvtldqkr mamleqdpqf lafasptpgi smassvgid

SEQ ID NO:62

GI:255585363, Protein name: Anthranilate N-benzoyltransferase protein, putative [Ricinus communis]

1 mvtkmqvdii srevikpssp tihhykpfkf plfsqltptt yspviffypt tkpnlnitqt

61 lihlkktlae tltlyypfsg r vdnlsidh fdegvpffia rvtglvlsdf

Iknpeielln

121 gflpykpftk etdkgvpqma fqvnvfscgg ivigwssshk lvdgptgaaf ihawatmsrt

181 gslsdvikpn cdeasiffpp rnpfpeehls lmeslwftkg nyiskrfvfd skaiaslrvk

241 argegnekkn mpsrvealsc fiwkccmaas raasgtpkps ilveavnlrt rtkppmskvs

301 igdifwwata vadpslhnke lhelatllde aialydsdym eslqgedgfe tmseycnqlr

361 glfsieepdi fafts srlg iydmdfgfgn pfwigilgkv gpafrnltvf letrdgkgie

421 awitldeerm allerdpefl anaspnprfs si

SEQ ID NO:63

GL380863876, Protein name: BAHD acyltransferase [Erythroxylum coca]

1 mevhivsret vkpsspatlt kkpyklslfd qltpgtytpt iffypknrpn sdttqvlarl

61 krslsetlds yfflsgrtrd nrfidcfdeg vpffeasvsv glsdflkhhe hewlnrlvay

121 rpytkealds pllsiqvsvf acggivigts ashklidalt gsfilktwaa mfrgdvsdgi

181 spqideasmy fptrdsfpqn hlslmesl f teanyvtrrf vfgaksisai kemakskpes

241 kqsriealsc fiwkhcmsas kavsgspqvs ilveavnlrt rttppmssss igdif wata

301 asnnddtkst elpelanllk eaielydtdf tkslqgnegd eaiyqyceql eglfslekpd

361 ifaftswcyv gftklnfgwg epiwvgtvgk agpafrnltv fietrdgkgi eawitldqkr

421 msvlehdpqf lafaslnpki ssl

SEQ ID NO:64

GL255577416, Protein name: Anthranilate N-benzoyltransferase protein, putative [Ricinus communis]

1 mevhivsrem mkpsspaikh qkpyklclld qltpttyipi iffypmnnlf tkstlahlke 61 slvktlnfyy pfsgrakdnl yidrfeegvp ffeakvncsm syflkhyete slsnlfipsh

121 pfskeidmsi alvavqvsmf tcggiavglc lshklidaat assfvttwas fcrgdpknvi

181 qpdfeqpstf fpsstslpqn ylslmeriwf vkanyitkrf vfdakaiaal rvkakaklea

241 eptriatlsc fiwkcsmaas raisgapkps ilveavnlrq ktkppmkdss tgnlfwwava

301 lasptdtnst elnelvsmls eaiavyksdy thslqgengl kimseyceql egmfsleepd

361 ifgfts skm pvtrpnfgwg epfwvglmak agpefrnftv fidtkdgkgi eawitldear

421 raailqrdpef lafaspnpki ssl

SEQ ID NO:65

GL359492333, Protein name: PREDICTED: vinorine synthase-like [Vitis vinifera]

1 mevtiisret ikpssptphh lrafklslld qlvpccytqv llfylidgfh gqsietshis

61 trlkdslset lthfyplags igddelqidc ndegvpyfea rvdcnlsefl qepelellnq

121 ffpcdplntp pmaklhlami qvnifnrggi aigvclshki adgvsisafl kawaaiargc

181 feeypsfeak slfpqneslp qdysmvlgkc lirtgkcvtk rvvfdasaia alkakasvdc

241 trvevvsafi wkramaaakq klgfqrssil thavnlrkkt ilslpessmg nlfwiaiteg

301 rvddeaeldl lvdktrkais kiscdfakkl qgeegfavaf ehvkevkaaf eedgvdfygf

361 sswckfevye gdfgwgrpiw vssfsgkgsv yknliffmdt rcgngieewv tldeeelgil

421 ecdpeflsfg smdpsplkla hfgqv

SEQ ID NO:66

GL323331427, Protein name: Atflp [Saccharomyces cerevisiae AWRI796]

1 mdlwkrlfea nptkirdkki knghfisitn tinlsalmne ideknqapvq qeclkemiqn

61 gharrmgsve dlyvalnrqn lyrnfctyge Isdyctrdql tlalreiclk nptllhivlp

121 trwpnhenyy rsseyysrph pvhdyisvlq elklsgwln eqpeysavmk qileefknsk

181 gsytakifkl tttltipyfg ptgpswrlic Ipeehtekwk kfifvsnhciti sdgrssihff

241 hdlrdelnni ktppkkldyi fkyeedyqll rklpepiekv idfrppylfi pksllsgfiy

301 nhlrfsskgv cmrmddvekt ddwteiini sptefqaika niksniqgkc titpflhvcw

361 fvslhrwgkf fkplnfewlt difipadcrs qlpdddemrq myryganvgf idftpwisef

421 dmndnkenfw pliehyhevi sealrnkkhl hglgfniqgf vqkyvnidkv mcdraigkrr

481 ggtllsnvgl fnqleepdak ysicdlafgq fqgswhqafs lgvcstnvkg mrii vastkn

541 wgsqeslee lcsiykalll gp SEQ ID NO:67

GL34485580, Protein name: lager alcohol acetyltransferase I [Saccharomyces pastorianus]

1 meteesqfss itkiinpktl mntysektsl vqdeclvkmi qnghsrrmgs vedlyaalnr

61 qklyrnfsty selndyctkd qlalalrnic lknptllhiv lparwpdhkk yylsseyysq

121 prpkhdyisv lpelkldgvi lneqpehnal mkqileefan sngsytakif klttaltipy

181 tgptsptwrl iclpeeddtn kwkkfifvsn hcmcdgrssi hffqdlrdel nniktlpkkl

241 dyifeyekdy qllrklpepi enraidfrppy lfipksllsg fiyshlrfss kgvctrmdei

301 eksdeivtei inispsefqk irtkiklnip gkctitpfle vcwfvtlhk

gkffkplkfe

361 ltdvfipad crsllpedee vramyrygan vgfvdftpwi skfnmndske nfwpliahyh

421 evisgaikdk khlnglgfni qslvqkyvni dkvmrdralg ksrggtllsn vgmfhqseet

481 ehkyrirdla fgqfqgswhq afslgvsstn vkgmniliss tknvvgsqel leelcamyka

541 lllnp

SEQ ID NO:68

GI:365758173, Protein name: Atflp [Saccharomyces cerevisiae x Saccharomyces kudriavzevii VIN7]

1 miqngharrm gsvedlyval nrqnlyrnfs ayaelsdycs kdqltlalrn iclknptllh

61 ivlptrwpdh enyylsseyy shphpkhdyi svlpelkldg viineqpeng kivrqileef

121 rnsngtynak ifklttalti pyfgptspnw rliclpeeht dkwkkfifvs nhcmsdgrss

181 ihffhdlrae lndiktppkk ldylfkyend yqllrklpep iekvidfrpp ylfipkslls

241 gfiynhlrfa srgictrmdd meksdd vae iitispselq eirtkiksni qgkctltpfl

301 qvcwfvslhq gkffkplnf ewltdifipa dcrpqlpdde evrqmyryga nvgf dftpw

361 icesnmnenk enfwpliehy hqvisgalrd nkhlhglgln iqgfvqkyvn idkamcdrai

421 gkarggtlls nvgmfkqlds sncnysiktw llgnfkghgt khfhwvfvrl m

SEQ ID NO:69

GL255712859, Protein name: KLTH0C11440p [Lachancea thermotolerans]

1 mdslkergha rplghlenyf sitqrqklya nfsmycelsk pcspkqlaya lrsiclqnpi

61 Ivhqvlpkhw pnhleyyasd eflaqptlqh edmrlldnvl lsdivmneqe eygtvvseai 121 eefsqnggqy skkifdiiad iripygdplk pnwrllcfpe gesnlwrkfi yitnhcssdg

181 rsaanlmrdl seqlnhvpet Ipdsdiifny ssdyeglrkl pdpienridy kppisyllql

241 lsssyvrdyl gyyskgplvt ridevgenkt yysyflnfsa eqmktikqkl ksrlpgctmt

301 pflqacwlts myksgrvfsk smrewffd v itmntaqmlp ddpelrsmyk ygsnvggtry

361 nylissfnvg edkdafwslv dyyqgvfnsa mekkhylfpl galmldslre ksnmdkvimd

421 dllgkprqgv ilsnvgyfqq kketdgyyvr dlvfaqslgs lrhtfvcnsc ttdvggmniv

481 acaaqgsvas ehdwadvcel fkeqtlal

SEQ ID NO:70

GI: 156847986, Protein name: hypothetical protein Kpol_2002p89 [Vanderwaltozyma polyspora DSM 70294]

1 meeyapfitq elvdrgharr mgqlenyfal Iqrqnlyknf nvygeinepi dkfqlgtafr

61 qmllkypilm hvivprkyph heeyyasdey lnnpqpindy ikvmenidle dillnsqpey

121 eaivgklldq yksdgykytn rmieiigdis ipicdqtkpn wrllclptke sdkkwhaf y

181 isnhcaadgm tsmnffhdiv nglndksset vtevngrmnl vnyakdhkni skfpkpiter

241 veyrpslsql pkfmigniar tklnykspca Itttvdkvdm qtfdyilnft neevgkirkh

301 ikanthngvt ltpflqtclf vtlyqfgtif qktllewgld svlpvnarky lpedaelrds

361 ykygsnvggi hyfnlissfn ikndeaetfw slvdyyhany qkayhngdtf vgfgllmsdf

421 ivknknvdkl ikedyvnqkr ggvilsnlgf fpqdtrneyy Indlifaqtf gsmkftfgls

481 lcstnvngln igis rdaf ndretfekfc khyketiinf anl

SEQ ID NO:71

GL255711342, Protein name: KLTH0B03806p [Lachancea thermotolerans]

1 mttsqadtkl eelekrghar rlgnlenyfa lgqrqdlysn fgmfceldra csenelaeal

61 rgmcleypll lhtvlekkea qdvnfyqtse ylskpwpqhd yirvlqrvrf advllndqee

121 yaeivnaalk efasnggqys sevfelinkv ripychnsrp nwrimcfpee gnaqsrewrk

181 illlsnhcss dgmssanffh dlqdhlnnlp pslpqadvif dysqdhetlg klpapietqi

241 syvgpksyfa qlvgnqvlre yfgyksptpp iprvnepggn dfysyflkit psevaavkkk

301 lknkldpsct ltpffqacwf aalyksgivf sksfsqqlsn imvamntaql lpedkqlkkq

361 yryganvggs hynyqissfn vadkpeafwk lvryyqdvfv dakrkkhfly plgalmidsi 421 yktknidlav tnsilgksrl gtmlsnvgyf pqkaratvgg fhiqdlifaq ttgsfrftfd

481 inlcatdigg lnitacvaeg alptredwkk lcelfktiil es

SEQ ID NO:72

GL6321616, Protein name: Atf2p [Saccharomyces cerevisiae S288c]

1 mediegyeph itqelidrgh arrmghleny favlsrqkmy snftvyaeln kgvnkrqlml

61 vlkvllqkys tlahtiipkh yphheayyss eeylskpfpq hdfikvishl efddlimnnq

121 peyrevmeki seqfkkddfk vtnrlielis pviiplgnpk rpnwrliclp gkdtdgfetw

181 knfvyvtnhc gsdgvsgsnf fkdlallfck ieekgfdyde efiedqviid ydrdyteisk

241 Ipkpitdrid ykpaltslpk fflttfiyeh cnfktssest ltaryspssn anasynyllh

301 fstkqveqir aqikknvhdg ctltpfiqac flvalyrldk Iftkslleyg fdvaipsnar

361 rflpndeelr dsykygsnvg gshyayliss fdipegdndk fwslveyyyd rflesydngd

421 hliglgvlql dfivenknid sllansylhq qrggaiisnt glvsqdttkp yyvrdlifsq

481 sagalrfafg Invcstnvng mnmdmsvvqg tlrdrgewes fcklfyqtig efasl

SEQ ID NO:73

GI: 156847986, Protein name: hypothetical protein Kpol_2002p89 [Vanderwaltozyma polyspora DSM 70294]

1 meeyapfitq elvdrgharr mgqlenyfal Iqrqnlyknf nvygeinepi dkfqlgtafr

61 qmllkypilm hvivprkyph heeyyasdey lnnpqpindy ikvmenidle dillnsqpey

121 eaivgklldq yksdgykytn rmieiigdis ipicdqtkpn wrllclptke sdkkwhaf y

181 isnhcaadgm tsmnffhdiv nglndksset vtevngrmnl vnyakdhkni skfpkpiter

241 veyrpslsql pkfmigniar tklnykspca ltttvdkvdm qtfdyilnft neevgkirkh

301 ikanthngvt Itpflqtclf vtlyqfgtif qktllewgld svlpvnarky Ipedaelrds

361 ykygsnvggi hyfnlissfn ikndeaetfw slvdyyhany qkayhngdtf vgfgllmsdf

421 ivknknvdkl ikedyvnqkr ggvilsnlgf fpqdtrneyy lndlifaqtf gsmkftfgls

481 lcstnvngln igisvvrdaf ndretfekfc khyketiinf anl

SEQ ID NO:74

GL50286475, Protein name: hypothetical protein [Candida glabrata CBS 138]

1 mapntksieq pliskakisg kgpdgfaiee sllerghsrr mghlenyfai mqrqklytnf 61 nmygelnkev treqlavair qillrhpimm qaiipkkfpe heeyytsddy

yntpfpendf

121 lrvitskikl sdiiineqse dygeiidmil seykkngykf daymqelign

ivipignpnk

181 pnwrllclps aegggaqwkk fvyisnhccs daisavnlfq diaenvslie

qnswavpyad

241 dvivdyeqdv adiaklpapi terveyrppl sklpkimlvs flktalnfks

daletrcnde

301 ysgepetsav qmgdvcydsi Inytceevav irdrikhnvh gkctvtpfiq

aaff amhqs

361 rkllgqkqgf ke msewgvd matpsstrry Ipedpevrdm ykygsnvggi

hylymisgmk

421 vereetekfw slveyyhdil lashsngdqt vglgtlmldv ivdkknvdkl

irdeylyqkr

481 ggvimsnagy f qdpaqayh vtdlvfgqrp galkfsfgvn vstniggmn

lnvgmvrrtl

541 rdraefrefi gildrvirdf tgln SEQ ID NO:75

GL367002213, Protein name: hypothetical protein TPHA_0E03170 [Tetrapisispora phaffii CBS 4417]

1 mslealsfde ykpyiteeli ergharrmgh lqdyfaiiqr qklynnfniy celnekvnkv 61 qlshafremf lqypalieyi vpkfypkhea yyrseeylsk pcpihdyirv

lnevnindii

121 mneqdeyksi ttkisdifvk ndykfsneis emvstikiai cdpkkpnwri

iclpsktsst

181 ewkdfilvsn hfdsdgtsav nffedltnil skqanvendt ivigndinii

nyskdyklis

241 klpipiteri sytptlssip kfivgnickt klqytsdggd tpaefvsedp

ltydylinfs

301 seevakmkkt iknclynsvt ltpfiqacff vamykynkil nlnn wqwgv

dcalatnarr

361 llpddpetrd lyrygsnvgg thyfnlisqf ninefeydkf fklvdyyhkn

yqnsyrngde

421 lvgfgvlfsd liinntnmdk tikddytnhk rggllfsnvg yrnedltkkv

hvnniifsqs

481 pgcmkftfgl nlistdkcgm nilmngvrgs vksrenfedf crffrktven fakl

SEQ ID NO:76

GI: 366987729, Protein name: hypothetical protein NCAS_0A06920 [Naumovozyma castellii CBS 4309]

1 mtqdqvtlde ykpyiadeli ergharrmgh lenyfallqr qklytnfsiy gelnkevkdv

61 dltralrsii fknpilahti vpkkypdqep fyqseeylna pypehdfikv

lpklslsdil

121 ineqeefrei vddiltqfke angvitpdim kavayviipi cdpsrpnwrl

frlsptkffy

181 isnhctsdai sgvnifqdic telsqndeep frddlqifny eedwesfhki

yipitdiiey

241 rpaltslpki iasalvkgfl nyrnwptelt stndkgipfd fniitftnde

vnsiretvkk 301 ynctftpflq acwfvamfnn gkifhmdswr ewgldvaips nsrrfladee

Ikdiykygsn

361 vgglhythli ssfniqldek ekfwdlvqyy qdgytksyen gdhfsglgll mmdglvkrqn

421 idkvissdyl hktragvlfs nagffpqdrt qayhvndllf tqsqgamkfs fglniattni

481 ggmniainva qgtfddeegi idlsqdfyrn iksfsnia SEQ ID NO:77

GI:372463540, Protein name: hypothetical protein KAFR 0D01730 [Kazachstania africana CBS 2517]

1 mglstkvees vrevqsqsda ssialledpv aeydipqeli drgharrmgh lenyfamlqr

61 qelysnfavy lkmnksvsrn dlkhalrevi lensvlahti vpkyypdhea fyksekylnv

121 pypkhdfmki lpslsledii indqseytev vnsiidqfvk dngkitnkls eivsnicipi

181 ydqsrpnwrl lclpdntdey snfvyisnhc csdgtsginl fqdlvkslng kkspemtspd

241 sliynyekdf dkisklpaai tdrvdyrpal wklpqfmlst Igkvffsyks papvstkinm

301 skpqpsfhni lnftpdelnk iriaikknac tmtsflqtcl fitlkehgif anrkwnefgf

361 ditvpsntrk dlpeelvtsq ykygsnvggl hysflissfi aenfwklcsy ysavlkqadf

421 lrplgtimld f vnkqnids misdsylnkk rggiilsnvg yfeqnddece ildlmlmqnv

481 gglnfsyavn icstnlggmn iclsivegtl kdrddfnafc delkttvrqf cdin

SEQ ID NO:78

GL26991090, Protein name: bkdAl gene product [Pseudomonas putida KT2440]

1 mneyaplrlh vpeptgrpgc qtdfsylrln dagqarkpai dvdaadtadl syslvrvlde

61 qgdaqgpwae didpqilrqg mramlktrif dsrmvvaqrq kkmsfymqsl geeaigsgqa

121 lalnrtdmcf ptyrqqsilm ardvslvemi cqllsnerdp Ikgrqlpimy svreagffti

181 sgnlatqfvq avgwamasai kgdtkiasaw igdgataesd fhtaltfahv yrapvilnvv

241 nnqwaistfq aiaggesttf agrgvgcgia slrvdgndfv avyaasrwaa erarrglgps

301 liewvtyrag phstsddpsk yrpaddwshf plgdpiarlk qhlikigh s eeehqavtae

361 leaaviaaqk eaeqygtlan ghipsaasmf edvykempdh Irrqrqelgv

SEQ ID NO:79

GL26991091, Protein name: bkdA2 gene product [Pseudomonas putida KT2440]

1 matttmtmiq alrsamdvml erddn vvyg qdvgyfggvf rcteglqnky gksrvfdapi 61 sesgivgtav gmgayglrpv veiqfadyfy pasdqivsel arlryrsage

fiapltlrmp

121 cgggiyggqt hsqspeamft qvcglrtvmp snpydakgll iasiecddpv

iflepkrlyn

181 gpfdghhdrp vtpwskhphs avpdgyytvp ldkaaitrpg ndvtvltygt

tvyvaqvaae

241 esgvdaevid lrsl pldld tivesvkktg rcvvvheatr tcgfgaelvs

lvqehcfhhl

301 eapiervtgw dtpyphaqew ayfpgpsrvg aalkkvmev

SEQ ID NO:80

GL26991092, Protein name: bkdB gene product [Pseudomonas putida KT2440]

1 mgthvikmpd igegiaqvel ve fvkvgdi iaedq vadv mtdkatveip spvsgkvlal

61 ggqpgevmav gselirieve gsgnhvdvpq pkpveapaap iaakpepqkd

vkpavyqapa

121 nheaapivpr qpgdkplasp avrkraldag ielryvhgsg pagrilhedl

dafmskpqsn

181 agqapdgyak rtdseqvpvi glrrkiaqrm qdakrrvahf syveeidvta

lealrqqlns

241 khgdsrgklt llpflvralv valrdfpqin atyddeaqii trhgavhvgi

atqgdnglmv

301 pvlrhaeags Iwanageisr lanaarnnka sreelsgsti tltslgalgg

ivstp vntp

361 evaivgvnrm verpvvidgq ivvrkmmnls ssfdhrwdg mdaalfiqav

rglleqpacl

421 fve

SEQ ID NO:81

gaaaacgaaagctctctaaGCTGAGCAGGAGAAATTAACTATGGCGCATGATCAGAG CCT SEQ ID NO:82

agcctttcgttttatttgatgcctctagaGCTCAGCTTACAGGCTGCTCTGGGTGAA ATG

SEQ ID NO:83

cgaaagctctctaaGCTGAGCAGGAGAAATTAACTATGAATGAAATCGATGAGAAAA AT C

SEQ ID NO: 84

agcctttcgttttatttgatgcctctagaGCTCAGCTTAAGGGCCTAAAAGGAGAGC TTT SEQ ID NO:85

cgaaagctctctaaGCTGAGCAGGAGAAATTAACTATGGAAGATATAGAAGGATACG A AC SEQ ID NO: 86

cctttcgttttatttgatgcctctagaGCTCAGCTTAAAGCGACGCAAATTCGCCGA TGG

SEQ ID NO:87

aaacgaaagctctctaaGCTGAGCAGGAGAAATTAACTATGGACAGCAAACAGAGCA GC G

SEQ ID NO:88

cctttcgttttatttgatgcctctagaGCTCAGCTTAAAGCGCTGGGGTGATGAACG CAT SEQ ID NO:89

aaacgaaagctctctaaGCTGAGCAGGAGAAATTAACTATGGAGAAAATAGAAGTGA GC A

SEQ ID NO:90

cctttcgttttatttgatgcctctagaGCTCAGCTTAGATCAGCGTCTTTGGACTCG CCA SEQ ID NO:91

GGGCCCgcatgcAGGAGAAATTAACTATGAACAACTTTAATCTGCACACCCC SEQ ID NO:92

GGGCCCtctagaTTAGCGGGCGGCTTCGTATATACGGC