Breast Cancer Associated Antigen

The invention relates to isolated nucleic acid sequences which are expressed in cancers, especially breast cancers, to their protein products and to the use of the nucleic acid and protein products for the identification and treatment of cancers.

Breast cancer is the most prevalent malignancy affecting women world-wide. Each year, there are nearly 41,000 new cases in the UK. This cancer accounts for almost one in three of all cancer cases in women, and the lifetime risk for breast cancer in women is one in nine (1). The treatment options for patients with advanced breast cancer are limited and improved treatment modalities are desperately needed, both from the compassionate and socio-economic viewpoints. In breast cancer, in spite of the identification of the tumour suppressor genes BRCAl/2 (2) and HER2/neu (3), there is an urgent need to identify new diagnostic tools and methods for treating such cancers.

Accordingly, there is a need to identify additional novel breast cancer-associated genes and proteins, which may have important implications for understanding the process of tumourigenesis, diagnosis and prognosis, and development of novel treatment regimens. This also includes assays for such newly identified breast cancer-associated genes.

Identification of immunogenic proteins in cancer is essential for the development of immunotherapeutic strategies where adoptive immunity is directed towards MHC Class I- and Class II-associated peptides (Mians, et al., Cancer Immunology (2001), page 1). Many antigens are implicated in aetiology and progression of cancer, and are associated with epigenetic events. Pre-clinical and clinical studies infer that vaccination and targeting MHC-associated peptide antigens promotes tumour rejection (AIi S.A., et al, J Immunol. (2002), Vol. 168(7), pages 3512-19 and Rees R.C., et al., Immunol. Immunother (2002), VoI 51(1), pages 58-61).

Expressed sequence tags (ESTs) are single-pass reads from randomly selected cDNA clones. ESTs belong to different cDNA libraries, each of which is prepared from one particular cell type, organ, or tumour. Therefore, the presence or absence of ESTs in different libraries provides information about the organ, cell type, or tumour specificity of expressed genes. Also, a gene is often presented by several ESTs; generally, the more a gene is expressed in a given tissue, the more ESTs for that gene will be found in the library. Thus, the number of ESTs that represent the same gene in a given library is a rough indication of the expression level of the gene in the tissue from which the library is derived. ESTs have proved to be a valuable resource for detection and characterisation of new candidate genes. ESTs also provide an ideal resource to predict alternative splicing variants by examining all the features in genomic-EST-mRNA multiple alignments (4).

Since the breast is not essential after the reproductive years, unintentional destruction of normal breast tissues by a given of novel therapeutic strategies, such as immune therapy and gene therapy, for patients with breast cancer should have minimal consequences.

In order to identify new breast-associated genes, the inventors developed a strategy to mine the UniGene database (http://www.ncbi.nlm.nih.gov/entrez/query .fcgi?db=unigene). The NCBI describes UniGene as an experimental system for automatically partitioning GenBank® (i.e. the US National Institutes of Health (NIH) genetic sequence database: an annotated collection of all publicly available DNA sequences) sequences into a non- redundant set of gene-oriented 'clusters'. Each UniGene cluster contains sequences that represent a unique gene, as well as related information such as the tissue types in which the gene has been expressed and map location.

The inventors mined UniGene for transcripts expressed exclusively in human breast. A number of different sequences from the UniGene hits were then selected by the inventors. Subsequently, reverse transcription polymerase chain reaction (RT-PCR) was used to validate the expression patterns of the selected UniGene 'clusters' . Such clusters are ESTs (Expressed Sequence Tags) considered to be derived from the same gene.

A first aspect of the present invention provides an isolated mammalian nucleic acid molecule selected from the group consisting of:

a) a nucleic acid sequence encoding BUCl 1, BUC6, BUC9 and/or BUClO;

b) a nucleic acid sequence comprising the nucleic acid sequence encoding at least one amino acid open reading frame obtainable from a nucleic acid sequence encoding BUCIl, BUC6, BUC9 and/or BUClO, wherein a peptide having the amino acid sequence of the encoded reading frame is capable of cross-reacting with samples from patients susceptible to cancer and/or from samples from patients with cancer;

c) a fragment of a nucleic acid molecule as defined in a) or b) comprising at least 20 contiguous nucleotides or which encodes at least 4 amino acids of the sequence;

d) nucleic acid molecules, the complementary strand of which specifically hybridises to nucleic acid molecules described in a), b) or c);

e) nucleic acid molecules, the sequence of which differs from the sequence of. the nucleic acid molecule of a), b) c) or d) due to the degeneracy of the genetic code;

f) nucleic acid molecules comprising at least 10 contiguous nucleotides capable of specifically hybridising to a nucleic acid molecule as defined in a), b), c), d) or e).

Preferably, the nucleic acid molecule a) comprises a sequence selected from a nucleic acid sequence shown in Figure 26 (BUCIl); Figure 30 (BUCI l mRNA including the mRNA sequence of LOC 646360); Figure 23 (BUC6), Figure 24(a) (BUC9); Figure 24(b) BUC9 8H1M13 or BUC9 4L1M13 splice variants; Figure 25 (BUClO), or Figure 28 (alignment for BUC6, BUC9, BUClO and BUCIl).

Preferably the fragment of nucleic acid (c) encodes at least 20, at least 30, at least 40, at least 50, at least 60, at least 80 or at least 100 nucleotides of the sequences.

Preferably the fragment encodes a peptide capable of cross reacting with sera from patients with cancer and/or of being specifically bound by an antibody against BUCIl, BUC6, BUC 9 or BUClO.

The BUCIl antibody may be one raised against the peptide: PSKRLFFKKKRLC.

Additionally or alternatively the fragment encodes at least 10, at least 20, at least 30, most preferably all of the amino acids of the BUC6 sequence of Figure 29.

Preferably, the fragment (c) of the nucleic acid comprises at least 20 nucleotides from nt 54-1809 of the sequence shown in Figure 23.

Preferably, the fragment does not encode a sequence found in the NY-BR-I sequence, human DNA clone RP11-141F12, or LOC646360.

The claimed nucleic acid sequences are associated with cancer. The nucleic acid molecules and their products may be used in the diagnosis, prognosis and/or management of cancer. They may be used for targets for gene/immune therapy for breast cancer.

BUCIl is expected to be useful in the management of testicular cancer and in the diagnosis/prognosis of breast cancer.

BUC6, 9 and 11 are highly expressed in breast cancer tissues and are expected to be useful for the detection of metastatic breast cancer cells in axillary lymph nodes as well as the peripheral blood stream. Moreover, the splice variants of BUC9 may be an indication of breast cancer disease state.

BUC6, BUC9 and BUClO are expressed in melanoma and are expected to be useful in management of melanoma.

BUC9 and BUClO are expected to be useful in the management of oesophogeal cancer and gastric cancer.

The nucleic acid may or may not be translated into protein in, for example, a mammalian body, such as the human body. Preferably the nucleic acid is expressed as mRNA. Preferably the mRNA is expressed in higher than normal concentrations in cancer tissue compared to one or more of normal adrenal gland, brain, foetal brain, foetal liver, heart, kidney, liver, lung, placenta, prostate, saliva, skeletal muscle, spinal cord, spleen, thymus, thyroid, trachea and/or uterus. The mRNA is usually translated into protein.

BUCIl is expressed in normal breast and normal testis. It is highly expressed in breast cancer tissues and testicular cancer tissues. It is not expressed in PBMC, mesothelioma tissues, melanoma tissues, gastric tissues, kidney tissues and oesophogeal tissues.

BUC6 is expressed in breast cancer tissue. BUC6 is also highly expressed in melanoma and normal breast tissues, testes and a breast cancer cell line T470.

BUC9 is highly expressed in breast cancer cell lines and is expressed in normal placenta, testis and breast. It is also expressed in oesophogeal (paired normal and cancer) tissues and has been observed in 50% of the gastric (paired normal and cancer) tissues tested. BUC9 has also been found to be highly expressed in melanoma.

BUClO is highly expressed in melanoma and breast cancer cell lines, but mRNA expression is lower in breast tissues than some normal tissues.

Nucleic acid molecules having at least 60 %, 70 %, 75 %, 80 %, 85 %, 90 %, 95 %, 98 % or 99 % homology to the nucleic acid molecules are also provided. Preferably these nucleic acid molecules express proteins which are expressed in higher concentrations in cancerous tissue than the equivalent normal tissue. Preferably this is at least 2, more preferably at least 5, most preferably at least 10 times higher concentrations than normal tissue.

Preferably the nucleic acid molecule is itself expressed in higher concentrations in breast cancer tissue, and/or in secondary tumours derived from breast cancer tissue, than in normal non-cancerous breast tissue. BUC6 has been found to be expressed in prostate cancer at approximately 1/10 the level of expression in breast cancer. It was not observed to be expressed in gastric cancer, oesophageal cancer, renal cancer or head or neck tumours.

The nucleic acid molecules of the invention may be DNA, cDNA or RNA. In RNA molecules "T" (Thymine) residues may be replaced by "U" (Uridine) residues.

Preferably, the isolated mammalian nucleic acid molecule is an isolated human nucleic acid molecule.

The invention further provides nucleic acid molecules comprising at least 15 nucleotides capable of specifically hybridising to a sequence included within the sequence of a nucleic acid molecule according to the first aspect of the invention. The hybridising nucleic acid molecule may either be DNA or RNA. Preferably the molecule is at least 90 %, at least 92 %, at least 94 %, at least 95%, at least 96 %, at least 98 %, at least 99 %, homologous to the nucleic acid molecule according to the first aspect of the invention. This may be determined by techniques known in the art.

The term "specifically hybridising" is intended to mean that the nucleic acid molecule can hybridise to nucleic acid molecules according to the invention under conditions of high stringency. Typical conditions for high stringency include 0.1 x SET, 0.1 % SDS at 68 ⁰ C for 20 minutes.

The invention also encompasses variant nucleic acid molecules such as DNAs and cDNAs which differ from the sequences identified above, but encode the same amino acid sequences as the isolated mammalian nucleic acid molecules, by virtue of redundancy in the genetic code.

siRNA encoding at least a portion of BUCIl, BUC6, BUC9 and BUClO nucleotide sequences is also provided by the invention.

* Chain-terminating, or "nonsense" codon.

** Also used to specify the initiator formyl-Met-tRNAMet. The VaI triplet GUG is therefore "ambiguous" in that it codes both valine and methionine.

The genetic code showing mRNA triplets and the amino acids for which they code

The invention also includes within its scope vectors comprising a nucleic acid according to the invention. Such vectors include bacteriophages, phagemids, cosmids and plasmids. Preferably the vectors comprise suitable regulatory sequences, such as promoters and termination sequences which enable the nucleic acid to be expressed upon insertion into a suitable host. Accordingly, the invention also includes hosts comprising such a vector. Preferably the host is E. coli.

A second aspect of the invention provides an isolated polypeptide obtainable from a nucleic acid sequence according to the invention. As indicated above, the genetic code for translating a nucleic acid sequence into an amino acid sequence is well known.

Preferably the sequence comprises is a sequence encoding BUCIl, BUC6, BUC9 or BUClO, preferably as defined above.

The invention further provides polypeptide analogues, fragments or derivatives of antigenic polypeptides which differ from naturally-occurring forms in terms of the identity of location of one or more amino acid residues (deletion analogues containing less than all of the residues specified for the protein, substitution analogues wherein one or more residues specified are replaced by other residues or addition analogues wherein one or more amino acid residues are added to a terminal or medial portion of the polypeptides) and which share some or all properties of the naturally-occurring forms. Preferably such polypeptides comprise between 1 and 20, preferably 1 and 10 amino acid deletions or substitutions.

Preferably the fragments comprise at least 4 amino acids of the sequence of BUCIl, BUC6, BUC9 or BUClO. Preferably the fragment contains at least 10, at least 20, at least 30 contiguous amino acids, preferably all of the amino acids of BUCIl, BUC6, BUC9 or BUClO.

Preferably the polypeptide is at least 80 %, 85 %, 90 %, 95 %, 96 %, 97 %, 98 % or 99 % identical to the sequences of the invention. This can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711). When using Bestfit or any other sequence alignment program to determine whether a particular sequence is, for instance, 95 % identical to a reference sequence according to the present invention, the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference amino acid sequence and that gaps in homology of up to 5 % of the total number of amino acid residues in the reference sequence are allowed.

Preferably the polypeptide is a fragment of BUCl 1. This may have the sequence: PS KRLFFKKKRLC. This has been used to raise antibodies against BUCIl, in for example, rabbits.

The third aspect of the invention provides the use of nucleic acids or polypeptides according to the invention, to detect or monitor cancers, preferably breast cancer.

The expression of the isolated nucleic acid molecule has been found to be highly breast specific. This means that secondary tumours found elsewhere in the body may be characterised by expression of the molecule as being derived from what may be a previously undiagnosed primary breast tumour.

The use of a nucleic acid molecule hybridisable under high stringency conditions, to a nucleic acid according to the first aspect of the invention to detect or monitor cancers, e.g. breast cancer, melanoma, oesophageal cancer or gastric cancer, is also encompassed, as detailed above for the individual sequences. Such molecules may be used as probes, e.g. using PCR.

The expression of genes, and detection of their polypeptide products may be used to monitor disease progression during therapy or as a prognostic indicator of the initial disease status of the patient.

The presence of the nucleic acid molecule may also be used to characterise primary or secondary tumours as, for example, being derived from breast. This has implications for the assessment of the most suitable cancer treatment for the tumour as different types of tumour may be controlled by different drugs.

There are a number of techniques which may be used to detect the presence of a gene, including the use of Northern blot and reverse transcription polymerase chain reaction (RT-PCR) which may be used on tissue or whole blood samples to detect the presence of cancer associated genes. For polypeptide sequences in situ staining techniques or enzyme linked ELISA assays or radio-immune assays may be used. RT-PCR based techniques would result in the amplification of messenger RNA of

the gene of interest (Sambrook, Fritsch and Maniatis, Molecular Cloning, A Laboratory Manual, 2nd Edition). ELISA based assays necessitate the use of antibodies raised against the protein or peptide sequence and may be used for the detection of antigen in tissue or serum samples (Mclntyre C.A., Rees R.C. et. al., Europ. J. Cancer 28, 58-631 (1990)), In situ detection of antigen in tissue sections also rely on the use of antibodies, for example, immuno peroxidase staining or alkaline phosphatase staining (Gaepel, J.R., Rees, R.C. et. al. Brit. J. Cancer 64, 880- 883 (1991)) to demonstrate expression. Similarly radio-immune assays may be developed whereby antibody conjugated to a radioactive isotope such as I ¹²⁵ is used to detect antigen in the blood.

Blood or tissue samples may be assayed for elevated concentrations of the nucleic acid molecules or polypeptides.

Methods of producing antibodies which are specific to the polypeptides of the invention, for example, by the method of Kohler & Milstein to produce monoclonal antibodies, are well known. A further aspect of the invention provides an antibody, e.g. a monoclonal antibody, which specifically binds to a polypeptide according to the invention.

Kits for detecting or monitoring cancer, such as gastro-intestinal cancers, including breast cancer, using polypeptides, nucleic acids or antibodies according to the invention are also provided. Such kits may additionally contain instructions and reagents to carry out the detection or monitoring.

A fourth aspect of the invention provides for the use of nucleic acid molecules according to the first aspect of the invention or polypeptide molecules according to the second aspect of the invention in the prophylaxis or treatment of cancer, or pharmaceutically effective fragments thereof. By pharmaceutically effective fragment, the inventors mean a fragment of the molecule which still retains the ability to be a prophylactant or to treat cancer. The cancer may be a breast cancer.

The molecules are preferably administered in a pharmaceutically effective amount. Preferably the dose is between 1 mg/kg to 10 mg/kg.

The nucleic acid molecules may be used to form DNA-based vaccines. From the published literature it is apparent that the development of protein, peptide and DNA based vaccines can promote anti-tumour immune responses. In pre-clinical studies, such vaccines effectively induce a delayed type hypersensitivity response (DTH), cytotoxic T-lymphocyte activity (CTL) effective in causing the destruction (death by lysis or apoptosis) of the cancer cell and the induction of protective or therapeutic immunity. In clinical trials peptide-based vaccines have been shown to promote these immune responses in patients and in some instances cause the regression of secondary malignant disease. Polypeptides derived from the tumour antigen may be administered with or without immunological adjuvant to promote T-cell responses and induce prophylactic and therapeutic immunity. DNA-based vaccines preferably consist of part or all of the genetic sequence of the tumour antigen inserted into an appropriate expression vector which when injected (for example via the intramuscular, subcutaneous or intradermal route) causes the production of protein and subsequently activates the immune system. An alternative approach to therapy is to use antigen presenting cells (for example, dendritic cells, DCs) either mixed with or pulsed with protein or peptides from the tumour antigen, or transfect DCs with the expression plasmid (preferably inserted into a viral vector which would infect cells and deliver the gene into the cell) allowing the expression of protein and the presentation of appropriate peptide sequences to T-lymphocytes or adaptive cellular therapy using, e.g., T-cells responsive to BUC peptides or BUC protein. A DNA based vaccine is demonstrated in, for example, Thompson S.A., et al. (J. Immunol. (1998), Vol. 160, pages 1717-1723).

Accordingly, the invention provides a nucleic acid molecule according to the invention in combination with a pharmaceutically-acceptable carrier.

Such polypeptides may be bound to a carrier molecule such as tetanus toxoid to make the polypeptide immunogenic. Such constructs are also within the scope of the invention.

A further aspect of the invention provides a method of prophylaxis or treatment of a cancer such as a breast cancer, comprising the administration to a patient of a nucleic acid molecule according to the invention.

The polypeptide molecules according to the invention may be used to produce vaccines to vaccinate against a cancer, such as a breast cancer.

Accordingly, the invention provides a polypeptide according to the invention in combination with a pharmaceutically acceptable carrier.

The invention further provides use of a polypeptide according to the invention in prophylaxis or treatment of a cancer such as a breast cancer.

Methods of prophylaxis or treating a cancer, such as a breast cancer, by administering a protein or peptide according to the invention to a patient, are also provided.

Vaccines comprising nucleic acid and/or polypeptides according to the invention are also provided. The polypeptide may be attached to another carrier peptide such as tetanus toxoid to increase the immogenicity of the polypeptide.

The polypeptides of the invention may be used to raise antibodies. In order to produce antibodies to tumour-associated antigens procedures may be used to produce polyclonal antiserum (by injecting protein or peptide material into a suitable host) or monoclonal antibodies (raised using hybridoma technology). In addition phage display antibodies may be produced, this offers an alternative procedure to conventional hybridoma methodology. Having raised antibodies which may be of value in detecting tumour antigen in tissues or cells isolated from tissue or blood, their usefulness as therapeutic reagents could be assessed. Antibodies identified for their specific reactivity with tumour antigen may be conjugated either to drugs or to radioisotopes. Upon injection it is anticipated that these antibodies localise at the site of tumour and promote the death of tumour cells through the release of drugs or the conversion of pro-drug to an active metabolite. Alternatively a lethal effect may

be delivered by the use of antibodies conjugated to radioisotopes. In the detection of secondary/residual disease, antibody tagged with radioisotope could be used, allowing tumour to be localised and monitored during the course of therapy. Unconjugated antibodies can also be useful in influencing cancer cell growth. For example, the binding of certain antibodies to cell-surface receptors on cancer cells may initiate cell death by, e.g., apoptosis. Therefore the antibodies of this invention could be therapeutically useful in a non-conjugated form.

The term "antibody" includes intact antibody molecules as well as antibody fragments such as Fab, F(ab')2 and Fv.

The invention accordingly provides a method of treating a cancer such as breast cancer, by the use of one or more antibodies raised against a polypeptide of the invention.

The cancer-associated proteins identified may form targets for therapy.

The invention also provides nucleic acid probes capable of binding sequences of the invention under high stringency conditions. These may have sequences complementary to the sequences of the invention and may be used to detect mutations identified by the inventors. Such probes may be labelled by techniques known in the art, e.g. with radioactive or fluorescent labels. Suitable nucleotide sequences for the probes include the sequences provided below:

BUC 6 forward: 5' TGGAAAATGTGTCCACCAAG

BUC 6 reverse: 5' CGCTGCTGTAAGC ATTC ACT

BUC6(2) forward: 5' ttgcataaagctgcacagga

BUC6(2) reverse: 5' cttcaacacaacccccatgt

BUC6(3) forward: 5' ccttcgagttcctttttctgg BUC6(3) reverse: 5' ggcaacacaaactcagagca

BUC9 forward: 5' ccagattttcaccgctatgc

BUC9 reverse: 5' aggcaagctctcatcaggac

BUClO forward: 5' caccgacgtttaaaggagga

BUClO reverse: 5' gtcctctgcaccttgggata

BUCIl forward: 5' tctttcccacaatccctgac

BUCIl reverse: 5' cagcttgccccatgtatttt

BUC 11 (2) forward: 5 ' tgccattccactgttttctg

BUC 11 (2) reverse: 5 ' cagcttgccccatgtatttt BUCl 1(3) forward: 5' tctagtcgacccacaatccctgacacagaa

BUCl 1(3) reverse: 5' tctatctagagccagaaaacagtggaatgg

BUC6/9 forward: 5' gaggccttgctaatttccta

BUC6/9 reverse: 5' ctgttgcagtgagctcaagt

BUC9/10 forward: 5' gtcctgatgagagcttgcct BUC9/10 reverse: 5' caaactggccttgatctgga

BUC6Q forward: 5' ctcgaagccatcaatgacaa

BUC6Q reverse: 5' tgagataatccgctccttgg

BUC9Q forward: 5' gccacatggggtatgttctc

BUC9Q reverse: 5' aggcaagctctcatcaggac

Preferably the cancer which is detected, assayed for, monitored, treated or targeted for prophylaxis, is a breast cancer.

The invention will now be described by way of example only and with reference to the following example and figures.

Figure 1: RT-PCR expression analysis of BUC6 in normal tissues.

Figure 2: RT-PCR expression analysis of BUC6 in normal tissues.

Figure 3: RT-PCR expression analysis of BUC6 in normal tissues and in breast cancer tissue. Nb: normal breast tissue; TS: normal testis tissue; Br: breast cancer tissue.

Figure 4: Expression analysis of BUC6 in normal tissues, testes, breast cancer tissues and breast cancer cell line by RT-PCR. TS: normal testis; Br: breast cancer tissue; T47D: breast cancer cell line.

Figure 5: Expression analysis of BUC6 in normal and breast cancer tissues by RT- PCR. PBMC: peripheral blood mononuclear cells; Br: breast cancer tissue.

Figure 6: Quantitative analysis of BUC6 mRNA in normal and breast cancer tissues and breast cancer cell line. TS: normal testis; Br: breast cancer tissue; T47D: breast cancer cell line. *Ct value; t Reference tissue; φCompared with liver.

Figure 7: mRNA expression of BUC6 in melanoma samples. Lanes: (1) DNA ladder, (2) Negative control, (3) Positive control SK-BR3-V-, (4) to (13) Melanoma 1 to 10, (14) DNA ladder. Following completion of the RT-PCR reaction, 24μl of the products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 350bp which correspond to the expected size (375bp) of the target for the BUC6 primers used.

Figure 8: mRNA expression of BUC6 in breast cancer cell lines. Lanes: (1) DNA ladder, (2) Negative control, (3) Positive control SK-BR3-V-, (4) and (5) BR293, (6) and (7) T47D, (8) and (9) MDA468, (10) and (11) MDA231.

Following completion of the RT-PCR reaction, 24 μl of the products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 350bp which correspond to the expected size (375bp) of the target for the BUC6 primers used.

Figure 9: mRNA expression of BUC9 in breast cancer tissues and cell lines. Lanes: (1) to (8) Breast cancer tissues: (1) BRI l, (2) BR12, (3) BR13, (4) BR15, (5) BR16, (6) BR19, (7) BR25, (8) BR28. (9) to (12): breast cancer cell lines: (9) MDAP3, (10) MDA435, (11) T47D, (12) BR293. (13) Negative control, (14) DNA ladder.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 500bp which correspond to the expected size (495bp) of the target for the BUC9 primers used. The double band observed suggests that BUC9 may exist as a splice variant in breast cancer tissues and cell lines except for MDAP3.

Figure 10: mRNA expression of BUC9 in normal tissues. Lanes: (1) Brain, (2) Skeletal muscle, (3) Kidney, (4) Placenta, (5) Heart, (6) Testis, (7) Lung, (8) Liver, (9) Breast 1, (10) Breast 2, (11) Negative control, (12) DNA ladder.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 500bp which correspond to the expected size (495bp) of the target for the BUC9 primers used. The double band observed for testis and the breast samples suggest that BUC9 may exist as a splice variant in these tissues.

Figure 11: mRNA expression of BUC9 in paired oesophageal normal and cancer tissues and paired gastric normal and cancer tissues. Lanes: (1) DNA ladder, (2) Negative control, (3) Normal oesophageal 2, (4) Oesophageal cancer 2, (5) Normal oesophageal 1, (6) Oesophageal cancer 1, (7) Normal oesophageal 3, (8) Oesophageal cancer 3, (9) Normal oesophageal 4, (10) Oesophageal cancer 4, (11) DNA ladder, (12) Normal gastric 2, (13) Gastric cancer 2, (14) Normal gastric 4, (15) Gastric cancer 4, (16) Normal gastric 5, (17) Gastric cancer 5, (18) Normal gastric 6, (19) Gastric cancer 6, (20) DNA ladder. Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 500bp which correspond to the expected size (495bp) of the target for the BUC9 primers used.

Figure 12: mRNA expression of BUC9 in melanoma samples. Lanes: (1) DNA ladder, (2) Negative control, (3) Positive control SK-BR3-V-, (4) to (13) Melanoma 1 to 10, (14) DNA ladder.

Following completion of the RT-PCR reaction, 24μl of the products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 500bρ which correspond to the expected size (495bp) of the target for the BUC9 primers used.

Figure 13: mRNA expression of BUClO in melanoma samples. Lanes: (1) DNA ladder, (2) Negative control, (3) Positive control SK-BR3-V-, (4) to (13) Melanoma 1 to 10, (14) DNA ladder.

Following completion of the RT-PCR reaction, 24μl of the products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 300bp which correspond to the expected size (304bp) of the target for the BUClO primers used.

Figure 14: mRNA expression of BUClO in breast cancer cell lines. Lanes: (1) DNA ladder, (2) Negative control, (3) Positive control SK-BR3-V-, (4) BR293, (5) T47D, (6) MDA468, (7) MDA231, (8) DNA ladder.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 300bp which correspond to the expected size (304bp) of the target for the BUClO primers used.

Figure 15: A scatter graph of mRNA BUClO gene expression in normal tissues, gastric cancer tissues, breast cancer tissues, oesophageal cancer tissues and head and neck (cancer and normal) tissues using RT-Q-PCR. The SQ mean of BUClO was divided by the SQ mean of GAPDH and the result was multiply by 1000.

Figure 16: mRNA expression of BUCIl in normal tissues. Figure (A) lanes: (1) DNA ladder, (2) Negative control, (3) Breast, (4) Heart, (5) Testis, (6) Liver, (7) Prostate, (8) Brain, (9) Uterus, (10) Spleen, (11) Skeletal muscle, (12) Lung, (13) Kidney, (14) Placenta, (15) DNA ladder. Figure (B) lanes: (1) DNA ladder, (Z) Negative control, (3) Fetal brain, (4) Fetal liver, (5) Trachea, (6) Thyroid, (7) Spinal cord, (8) Salivary gland, (9) Thymus, (10) DNA ladder.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 200bp which correspond to the expected size (197bp) of the target for the BUCIl primers used.

Figure 17: mRNA expression of BUCIl in Peripheral Blood Mononuclear Cells (PBMC). Lanes: (1) DNA ladder, (2) Negative control, (3) to (8) PBMC: (3) PBMCl, (4) PBMC2, (5) PBMC3, (6) PBMC4, (7) PBMC83, (8) PBMC108, (9) DNA ladder.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. BUCIl mRNA is not expressed in any of the PBMC tested. The band which appears in lane 2 for BUCIl is the DNA ladder that has been accidentally loaded twice.

Figure 18: mRNA expression of BUCIl in breast cancer cell lines and tissues. Figure (A) lanes: (1) DNA ladder, (2) Negative control, (3) to (8) cell lines: (3) T47D, (4) MDA231, (5) MDA468, (6) BR293, (7) MCF-7, (8) MDAP3, (9) to (14) tissues: (9) BR2, (10) BR15, (11) BR19, (12) BRIl, (13) BR20, (14) BR13, (15) DNA ladder. Figure (B) lanes: (1) DNA ladder, (2) Negative control, (3) to (7) tissues: (3) BR25, (4) BR26, (5) BR27, (6) BR9, (7) BR12.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 200bp which correspond to the expected size (197bp) of the target for the BUCIl primers used.

Figure 19: mRNA expression of BUCIl in testis (normal and cancer) tissues. Lanes: (1) DNA ladder, (2) Negative control, (3) to (5) testicular cancer tissues: (3) TS2, (4) TS3, (5) TS4, (6) to (7) normal testis tissues: (6) TS6, (7) TS7, (8 DNA ladder. Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. Bands were present at approximately 200bp which correspond to the expected size (197bp) of the target for the BUCl 1 primers used.

Figure 20: mRNA expression of BUCIl in diverse cancer tissues. Figure (A) lanes: (1) DNA ladder, (2) Negative control, (3) to (10) Mesothelioma tissues: (3) Mesol, (4) Meso2, (5) Meso3, (6) Meso4, (7) Meso5, (8) Meso6, (9) Meso7, (10) MesoS.

Figure (B) lanes: (1) DNA ladder, (2) Negative control, (3) to (12) Melanoma samples 1 to 10, (13) DNA ladder.

Figure (C) lanes: (1) DNA ladder, (2) Negative control, (3) to (10) Gastric paired normal (N) and cancer (T) tissues: (3) BN2, (4) BT2, (5) BN4, (6) BT4, (7) BN5, (8) BT5, (9) BN6, (10) BT6.

Figure (D) lanes: (1) DNA ladder, (2) Negative control, (3) to (10) Kidney paired normal (N) and cancer (T) tissues: (3) KNl, (4) KTl, (5) KN2, (6) KT2, (7) KNlO, (8) KTlO, (9) KN12, (10) KT12.

Figure (E) lanes: (1) DNA ladder, (2) Negative control, (3) to (8) Oesophageal paired normal (N) and cancer (T) tissues: (3) ENl, (4) ETl, (5) EN3, (6) ET3, (7) EN4, (8) ET4.

Following completion of the RT-PCR reaction, products were loaded and run on a 1.5% Agarose gel. BUCIl mRNA is not expressed in any of the tissues tested. This experiment is semi-quantitative for (A), (C), (D) and (E) but not for (B).

Figure 21: A scatter graph of mRNA BUCIl gene expression in normal tissues, breast cancer cell lines and tissues, and testicular cancer using RT-Q-PCR. The SQ mean of BUCl 1 was divided by the SQ mean of GAPDH and the result was multiply by 1000.

Figure 22: A scatter graph of mRNA BUCIl gene expression in breast cancer tissues from different stages using RT-Q-PCR. RNA samples have been provided by Dr. Aija Line the Latvian University Biomedical Centre (Latvia). The RNA was extracted from paraffin-embedded tissues and reverse-transcribed using Random Primers. The tissues are paired cancer and normal counterpart, each pair from the same patient. The SQ mean of B

Figure 23 : mRNA sequence of BUC6.

Figure 24(a): mRNA sequence of BUC9.

Figure 24(b): Two potential variants of BUC9. Following RT-PCR with BR15 cDNA, the gel extracted and purified "upper band" (about 500bp) and "lower band" (about 400bp) were individually cloned into pCRII- blunt-TOPO vectors and XLlB cells were transformed and cultured. After DNA Miniprep and EcoRI restriction digest, positive clones for BUC9 genes were sent to sequencing. The sequences were then aligned to the original BUC9 sequence using the JustBio Aligner tool (http://www.justbio.com). 8HlM13Forward shows the "upper band" sequence and 4LM13Forward shows the "lower band" sequence. The 4LM13Forward sequence clearly lack of about lOObp which are present in 8HlM13Forward sequence. These sequences represent two potential splice variants for BUC9.

Figure 25: mRNA sequence of BUClO. Figure 26: mRNA sequence of BUCIl.

Figure 27: SPIDEY alignments of BUC mRNA original sequences and sequencing results against genomic Human DNA sequence from clone RP11-20F24 on chromosome 1 OpI 1.21-12.1.

These alignments were made in SPEDEY alignment tool (http://www.ncbi.nlm.nih.gov/spidey/). According to a database research, the BUC genes may all be related (top alignment). Genomic DNA corresponds to Human DNA sequence from clone RP11-20F24 on chromosome 10pll.21-12.1 which contains the 3' end of the NY-BR-I gene for breast cancer antigen NY-BR-I, two novel genes, a pseudogene similar to part of ATP8. RT-PCR has been carried out using BUC6, BUC9, BUClO, BUCIl, BUC69, BUC910 and BUClOIl primers. PCR products were sequenced and sequences aligned. Overlapping of the sequences was observed. The "BUC genes" are expressed as an mRNA sequence of 6509 base- pair long and which does not include any obvious protein coding frame.

Figure 28: Alignment of the nucleotide sequences for BUC6, 9, 10 and 11.

Figure 29: Amino acid sequence of the aligned BUC genes.

Sequence of the predicted protein of the LOC646360 gene: mgllpppskr lffkkkrlcf dlkyfiypqs qdtvdgikak hickkdiagg gakswkpslq swekqwygka meraf.

Figure 30: BUCIl mRNA sequence including the mRNA sequence of LOC646360. After a BLAST search (http://www.ncbi.nlm.nih.gov/BLAST/) and alignment of the sequences, the mRNA sequence of an unpublished hypothetical protein coding gene LOC646360 (in bold) is 100% matching the mRNA sequence of the last 6 exons of the "BUC gene" which includes BUCl 1. The LOC646360 gene is located just after the NY-BR-I gene, previously published regarding breast cancer, on chromosome 10 (10pll.21). LOC646360 has a predicted protein of 75 amino acids (aa). LOC646360 gene does not have an equivalent in any other species

Methodology

Bioinformatic identification of breast-associated UniGene clusters

The UniGene resource was used to search the UniGene clusters associated with human breast in the following manner. Firstly, UniGene clusters containing ESTs from cDNA libraries constructed from human breast were identified. Secondly, any of the selected UniGene clusters containing additional ESTs derived from essential human tissues or organs, such as brain, lung, liver, kidney, heart and pancreas except testis, ovary and placenta were excluded from further study. Thirdly, the UniGene clusters containing ESTs exclusively from normal human breast, and/or breast cancer tissues, and/or breast cancer cell lines were chosen.

RT-PCR analysis

Total RNA from different normal human tissues was purchased from Clontech (Oxford, UK). These included brain, trachea, kidney, lung, placenta, ovary, muscle, spleen, heart, spinal chord, uterus, prostate, thymus, saliva, liver, foetal, brain, thyroid, adrenal gland and small intestine. Normal breast and breast tumour tissues were derived from surgical specimens obtained from Saint Savvas Hospital (Athens, Greece). The Ethical Committee of the hospital approved the specimen collection procedure. Total RNA from the tissues was prepared by the guanidinium thiocyanate method (Sambrook, Molecular Cloning, a laboratory manual, 2 ^nd Ed.). The first- strand cDNA was synthesised from 2μg of total RNA primed with oligo-dT ¹⁵ primers (Promega, Southampton, UK). Gene specific PCR primers located within different exons were designed to amplify cDNA fragments of the selected UniGene clusters and from Glyceraldehyde-3 -phosphate dehydrogenase (GAPDH, used as an internal control) in a total reaction volume of 50μl. The reaction mixture contained 400 nM of each primer, 200 μM of dNTPs and 2.5 U of Tag polymerase in a thermal cycler (Perkin-Elmer, Beaconsfield, UK). The PCR products were analysed by agarose gel electrophoresis and stained with ethidium bromide. Amplification of BUC6 was performed using the cycling conditions (45 seconds at 94°C, 45 seconds at 58°C, 45 seconds at 72°C). The cycling conditions for all other BUC genes are as follows (30 seconds at 94°C, 30 seconds at 58°C, 30 seconds at 72°C) except for the

number of cycles. The appropriate number of cycles was determined for each target gene. The primers of BUC genes and GAPDH were as follows:

GAPDH forward: 5' GAGTCAAC- GGATTTGGTCGT GAPDH reverse: 5' AATGAAGGGGTCATTGATGG

Real-time quantitative RT-PCR

Total RNA and reverse transcription were prepared and carried out as described above. Gene-specific primers for real time PCR were designed using Primer 3 software (Primer 3 software is available at http://frodo.wi.mit.edu/cgi~ bin/primer3/primer3_www.cgi) and synthesised commercially (Sigma-Genosys, Cambridge, UK).

iQ SYBR® green SuperMix (containing SYBR® green I dye, hot-start iTaq DNA polymerase, optimised buffer, and dNTPs) was purchased from Bio-Rad (Hemel Hempstead, UK). A 25 μl PCR reaction was prepared for each cDNA sample. Each PCR reaction consisted of 40 cycles of 95°C for 15 seconds, 58°C for 20 seconds and 72°C for 30 seconds. The thermal cycling and fluorescent monitoring were performed using an iCycler iQ real-time PCR detection system (Bio-Rad). The cycle interval at which a PCR product is first detected above a fixed threshold, termed the cycle threshold (Ct), was determined for each sample. The Quantitative PCR (Q- PCR) results were analysed by the 2-δδCT method 5). GAPDH was used as an internal control and normal human liver was used as a reference tissue. The primers used for real-time RT-PCR were the same as those used for the conventional RT- PCR, described above.

Molecular cloning of BUC6 gene by screening a breast cancer cDNA library with gene-specific probe.

In order to construct a breast cancer cDNA library, poly (A)+ RNA was isolated and purified from a breast cancer tissue. cDNA prepared from poly (A)+ RNA was ligated into the ZAP Expression vector using Gigapack III Gold cloning kit

(Stratagene, Amsterdam, The Netherlands). After in vitro packaging, a cDNA library containing 2.0x106 primary cDNA clones was obtained.

Approximately 5000 phage plaques were screened on a nylon membrane using a digoxigenein (DIG) labelled PCR product of BUC6. Those recombinant phage which were identified as positive recombinant phages were excised into phagemid (12). cDNA insert sequencing was performed in both directions using BigDye Terminator Cycle Sequencing Ready Reaction kit on ABI PRISM 310 automatic sequencer (Applied Biosystems, Foster City, CA, USA).

Results

Identification of breast-associated UniGene clusters by database mining

There were 18545 UniGene clusters containing EST(s) derived from cDNA libraries constructed from normal breast or breast cancer tissues. Among these were 228 UniGene clusters comprising ESTs from normal breast and/or breast cancer tissues or cell lines but not from normal essential tissues or organs except for testis, ovary and placenta. These 228 UniGene clusters have been designated as breast-associated UniGene clusters (BUC). The inventors have designated these clusters as BUC 1- 228.

Expression analysis of breast-associated UniGene clusters by conventional RT-PCR

The mRNA expression patterns of 4 selected UniGene clusters (BUC6, BUC9, BUClO, BUCIl) were analysed by conventional RT-PCR using a panel of RNA samples derived from normal tissues, breast cancer tissues, breast cancer cell lines, melanoma tissues, oesophageal cancer tissues, gastric cancer tissues, head&neck cancer tissues, peripheral blood mononuclear cells (PBMC), testis cancer tissues, kidney cancer tissues and mesothelioma tissues.

The mRNA expression patterns of the first five UniGene clusters (which the inventors annotated as BUCl - BUC5) revealed that they are ubiquitously expressed in normal tissues or could not be amplified (data not shown). Therefore, BUCl -

BUC5 were excluded from further study. BUC6 was found to be related to the cluster in UniGene accession number: hs.373787. This contains 56 ESTs, 17 of them are derived from breast tumour cDNA libraries, 25 from normal breast cDNA libraries, 4 from a normal testis library, 4 from a cDNA library constructed from pooled human tissues including testis, 1 from a cDNA library constructed from mixed foetal liver and spleen and 3 from vascular tissues (these 3 ESTs have the same location but have different sizes). The inventors identified that BUC 6 maps to chromosome 10pll.21 in humans. The inventors found that some ESTs of BUC6 are identical to human breast cancer antigen NY-BR-I mRNA (6) and ankyrin repeat domain 3OA (ANKRD30A) mRNA. However, the inventors found that most BUC6 EST' s are not homologous to any previously known genes.

PCR primers were designed to amplify the unique region of BUC6 (i.e. BUC6 forward and BUC6 reverse sequences given below). As shown in figures 1-6, BUC6 was not expressed in 21 different normal foetal and adult tissues including brain, liver, lung, kidney and PBMC, but BUC6 was highly expressed in normal breast and testis tissues, and breast cancer tissues. BUC6 was also expressed in a breast cancer cell line (T47D). As shown in figures 7-8, BUC6 was expressed in all the melanoma samples tested and was also expressed in all the breast cancer cell lines tested.

PCR primers were designed to amplify the unique region of BUC9 (i.e. BUC9 forward and BUC9 reverse, sequences given below). A shown in figures 9-12, BUC9 was expressed in 6 out of 9 breast cancer tissues tested, in 2 out of 4 breast cancer cell lines tested, in placenta, in normal testis, in normal breast, in all the tested oesophageal (paired normal and cancer) tissues, in 2 out of 4 gastric (paired normal and cancer) tissues and in all the melanoma samples tested.

PCR primers were designed to amplify the unique region of BUClO (i.e. BUClO forward and BUClO reverse, sequences given below). As shown in figures 13-14, BUClO was expressed in all the melanoma samples tested and in all breast cancer cell lines tested but BR293.

PCR primers were designed to amplify the unique region of BUCIl (i.e. BUCIl forward and BUCIl reverse, sequences given below). As shown in figures 16-20,

BUCIl was expressed in normal breast tissue, normal testis tissue, in the breast cancer cell line T47D, in 90% of the breast cancer tissues tested, in all testis (paired normal and cancer) tissues tested, and BUCIl was not expressed in any of the PBMC tested nor in any of the mesothelioma tissues, melanoma tissues, gastric (paired normal and cancer) tissues and oesophageal (paired normal and cancer) tissues tested.

Sequences for BUC 6, 9, 10 and 11 are shown in Figures 23-26.

Quantitative analysis ofBUCό, BUClO and BUCIl gene expression

To investigate further the mRNA expression profiles of BUC6, quantitative real-time RT-PCR was performed using an RNA panel derived from various normal and tumour specimens. The normalised level of BUC6 mRNA expression in normal and breast cancer tissues, relative to its expression level in normal liver, is given in Figure 6. Overall, real-time RT-PCR analysis revealed very low levels of BUC6 mRNA in normal tissues except testes. This is shown in Figures 1 and 2. The expression of BUC6 in all breast cancer tissues tested was up-regulated. The level of BUC6 in one breast cancer tissue (Br 4) was 131 072 times the level detected in normal liver.

A peptide sequence encoding a fragment of BUCIl has been used to raise anti- BUCIl antibodies in rabbits:

PS KRLFFKKKRLC

BUC6 was found to be breast specific. The relatively low levels observed in breast cancer cell lines (Figures 4 and 5) were due to tumour heterogeneity.

As shown in figure 15, BUClO mRNA was not overexpressed in breast cancer, when compared to its expression in the other cancer and normal tissues. BUClO mRNA was expressed at different levels in normal tissues, gastric cancer tissues, breast cancer tissues and oesophageal cancer tissues.

As shown in figure 21, BUCIl mRNA was expressed at widely different levels in the breast cancer samples tested. BUCIl mRNA was not (or at a very low level) expressed in the normal tissues tested except breast and testis tissues. BUCIl mRNA was expressed at similar levels in the normal testis and testicular cancer tissues tested. BUCIl mRNA was only expressed in the breast cancer cell lines T47D and MDA231.

As shown on figure 22, BUCIl mRNA expression was higher in early stages of breast cancer when compared to later stages. In the normal breast tissues coming from the same patients, BUCl 1 mRNA expression followed the same trend.

BUC 11 Proliferation Assay

siRNA was designed for specific BUCIl silencing. BUCIl siRNA efficacy was firstly tested using Real-Time RT-PCR following transfection and mRNA isolation.

The transfection of breast cancer cell line MDA231 was carried out using

INTERFERin siRNA Transfection reagent (Autogen Bioclear, UK). The experiment was performed in duplicate wells. Each experiment comprised cells with BUCIl gene-specific siRNA, cells with negative control siRNA, cells with INTERFERin alone and cells alone.

On day 2, 3H-thymidine (Sigma-Aldrich, UK) was added to the cells. On day 3, cell suspensions were transferred to a filter plate, Microscint solution (Packard, USA) was added and the reading of the plate was performed. The procedure was repeated on day 7 and day 10.

siRNA silencing of BUCIl was observed to inhibit the proliferation of MDA231 breast cancer cells. This suggests BUCIl has a role in proliferation of cancer cells in the breast.

Isolation and sequencing ofBUCό cDNA

After screening half million plaque forming units (pfu) from the breast cDNA library with BUC6-specific probe, 6 positive clones were obtained. Inserts sizes of these

clones ranged between -1.0 and -1.9 kb. All the 6 cDNA inserts were sequenced at least partially. This showed that these 6 cDNA inserts have the same 3 ' ends with different length poly (A)+ tails. The longest insert (1879bp) contained an initiation codon, an open reading frame for 87 amino acid residues, a stop codon (TAG), and a 3' untranslated region. However there was not a stop codon before the initiation codon, suggesting the possibility of additional 5' coding sequence (Fig 7A and 7B). Amino acid sequence homology searches revealed that the first 20 amino acids from the N-terminal region are identical to NY-BR-I antigen (residues 433-452), whereas the rest of the amino acid residues are not highly homologous to any known proteins (Fig 7C). Homology studies were carried out using BLASTp.

This is shown in Figure 30. To summarise, the "BUC gene" mRNA sequence is composed, at its 5' end, of 2510bp (including BUC6 sequence) in the 3' end of the NY-BR-I gene but not in the coding region and, at its 3' end, of the 1308bp sequence of LOC646360. Basically, LOC646360 matches 50% of BUCl 1 sequence. Using softwares available on the internet, in silico analysis of the LOC646360 predicted protein has been analysed. According to the PSORT II server (http://psort.nibb.ac.jp/form2.html), LOC646360 protein could be a cytoplasmic protein. According to the iPSORT (http://hc.ims.u-tokyo.ac.jp/iPSORT/) prediction, LOC646360 protein has a mitochondrial targeting peptide. Furthermore, the protein pattern according to JustBio PatSearch (http://www.justbio.com/patterns/) is: MYRISTYL pattern (position 55), TYR_PHOSPHO_SITE pattern (24) and PKC_PHOSPHO_SrTE pattern (10, 56).

Discussion

EST data bases are repositories of the human transcriptome, containing a wealth of nucleic acid sequence information and mRNA expression data. EST database mining has resulted in the discovery of a prostate cancer-related gene, PAGE- 1/G AGE-B (7), a Ewing's sarcoma-associated gene, XAGE-I (8), and a number of differentially expressed transcripts in glioblastoma (9). The UniGene resource, developed at NCBI, clusters ESTs and other mRNA sequences, along with coding sequences (CDSs) annotated on genomic DNA, into subsets of related sequences. This study mined UniGene database for gene clusters associated with human breast.

The current bioinformatics analysis identified 228 UniGene clusters associated with human breast. One of them, BUC6, contains 56 ESTs. Some ESTs are identical to breast cancer antigen NY-BR-I mRNA but most of them are not homologous to any known genes. Both conventional and real-time RT-PCR analyses confirmed that BUC 6 is highly expressed in normal breast tissues, testes, and breast cancer tissues and a breast cancer cell line (T47D) but not in 21 different normal tissues. The inventors cloned BUC6 cDNA from a breast cancer cDNA library.

BUC6 is also highly expressed in melanoma. BUC9 is highly expressed in breast cancer tissues and cell lines and is expressed in placenta, testis and breast regarding the normal tissue expression. BUC9 is also highly expressed in oesophageal (paired normal and cancer) tissues and is expressed in 50% of the gastric (paired normal and cancer) tissues tested. Furthermore, BUC9 is highly expressed in melanoma. BUClO is highly expressed in melanoma and breast cancer cell lines. BUClO mRNA expression is lower in breast tumours than in some normal tissues and other cancers. BUCIl is expressed only in normal breast and normal testis regarding the normal tissue distribution. BUCIl is highly expressed in breast cancer tissues, testicular cancer tissues but its expression is quite low in the breast cancer cell lines T47D and MDA231. BUCIl is not expressed in PBMC, mesothelioma tissues, melanoma tissues, gastric tissues, kidney tissues and oesophageal tissues.

Breast cancer is the most common cancer in women and carries a high mortality rate. Detection of axillary lymph node metastases is the most valuable prognostic parameter for breast cancer. The standard technique for detection of the presence of lymph node metastasis is the histological analysis of one or a few hematoxylin and eosin (H&E) sections from each lymph node. However, small foci of metastatic disease are not easy to identify by this technique. As many as 30 % of patients considered to have negative nodes ultimately develop recurrent disease (10). PCR combines superb sensitivity with high throughput. Real-time PCR has the ability to quantify gene expression level over a wide range dynamic range. Both conventional and real-time RT-PCR analyses of BUC6, BUC9 and BUCIl could be useful for detection of metastatic breast cancer cells in axillary lymph nodes as well as peripheral blood stream.

Most (about 77 %) of women with breast cancer are older than 50 when they are diagnosed (11). Unintentional destruction of normal breast tissues by a given of novel therapeutic strategies for patents older than 50 with advanced breast cancer should have minimal consequences. BUC6, BUC9, BUClO, BUCIl and their products could be used as a target for gene and/or immune therapy for breast cancer patients.

According to the gene expression analysis, BUC6, BUC9 and BUClO could be useful in the management of melanoma. Also, BUC9 and BUClO could be useful in the management of oesophageal cancer and gastric cancer. The presence or absence of the splice variants of BUC9 could be an indication of the disease state for breast cancer. Furthermore, BUCIl could be useful in the management of testicular cancer and could be of interest for the diagnosis and/or prognosis of breast cancer.

References

1. http://www.cancerresearchuk.org

2. King MC, Marks JH, Mandell JB; New York Breast Cancer Study Group. Breast and ovarian cancer risks due to inherited mutations in BRCAl and

BRCA2. Science. 2003; 302(5645):643-6.

3. Burstein HJ. The distinctive nature of HER2-positive breast cancers. N Engl J Med. 2005; 353:1652-4.

4. http://www.ncbi.nlm.nih.gov/dbEST/index.html 5. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 2001; 25:402-8.

6. Jager D, Stockert E, Gure AO, Scanlan MJ, Karbach J, Jager E, Knuth A, Old LJ, Chen YT. Identification of a tissue-specific putative transcription factor in breast tissue by serological screening of a breast cancer library. Cancer

Res. 2001; 61(5):2055-61.

7. Brinkmann U, Vasmatzis G, Lee B, Yerushalmi N, Essand M, Pastan I. PAGE-I, an X chromosome-linked GAGE-like gene that is expressed in normal and neoplastic prostate, testis, and uterus. Proc Natl Acad Sci U S A. 1998; 95(18):10757-62.

8. Liu XF, Helman LJ, Yeung C, Bera TK, Lee B, Pastan I. XAGE-I , a new gene that is frequently expressed in Ewing's sarcoma. Cancer Res. 2000; 60(17):4752-5.

9. Loging WT, LaI A, Siu JJVI, Loney TL, Wikstrand CJ, Marra MA, Prange C, Bigner DD, Strausberg RL, Riggins GJ. Identifying potential tumor markers and antigens by database mining and rapid expression screening. Genome Res. 2000;10(9):1393-402.

10. Cady B. The need to reexamine axillary lymph node dissection in invasive breast cancer. Cancer. 1994; 73(3):505-8. 11. http://www.cancer.org

12. SaMn U., et al, PNAS (1995), 92(25):11810-3.