Description

Field of the Invention

[0001] The present invention relates to the use of polyhydroxylated bile acid compounds in the treatment of a subject suffering from an increased plasma level of lipoprotein (a).

Background Art

[0002] Cholesterol is a ubiquitous biological substance produced in numerous human organs and cells. It has important physiological functions such as stabilization of cell membranes, precursor of bile acids and steroid hormones. On the other hand, any excess of cholesterol is deleterious and causes numerous diseases among them coronary heart disease, myocardial infarction and stroke. [0003] Cholesterol is transported in blood in several lipoproteins: Very-low-, low-, and high-density lipoproteins (VLDL, LDL, and HDL). Whereas HDL is considered to be beneficial, excess VLDL and LDL are detrimental. There are several medications available to treat subjects with elevated LDL- and VLDL-cholesterol efficiently.

[0004] A subfraction of the cholesterol-rich lipoproteins is lipoprotein(a) (Lp(a)). Lp(a) is considered to be even more atherogenic than LDL or VLDL. Lp(a) consists of an LDL-like core particle plus the characteristic antigen, Apo(a), a large glycoprotein with a molecular mass of about 500 kD. The liver is the central organ for the biosynthesis of all lipoproteins. Lp(a) is almost exclusively produced there. [0005] It is generally acknowledged that high plasma levels of Lp(a) are causally related to myocardial infarction and stroke. The plasma concentration of Lp(a) is highly skewed and great differences among various ethnic groups have been observed. In the Western populations where high plasma levels of cholesterol and atherosclerotic diseases prevail, individuals with Lp(a) levels higher than 30 - 50 mg/dl are at an increased risk. The risk strongly rises with increased Lp(a) plasma concentrations. Plasma Lp(a) concentrations are rather stable and hardly influenced by diet. Under certain disease conditions on the other hand, there may be great fluctuations in Lp(a) abundance: Subjects with liver diseases may have reduced and those with kidney diseases may have largely increased plasma levels. [0006] There are currently no registered drugs specific for lowering Lp(a) concentrations to a significant degree. The conventional cholesterol lowering medications such as statins, bile acid sequestrants, or fibrates have little if any effect on plasma Lp(a) concentrations and may even lead to increased Lp(a) levels. [0007] PCSK9 inhibitors, relatively new drugs for lowering LDL-C may reduce Lp(a) up to 25%, but there are great inter-individual differences (Kostner, K.M., et a I., 2013. European Heart Journal, 34: 3268-3276). Nicotinic acid at higher doses may reduce Lp(a) levels up to 30% - yet this drug has been taken from the market in many countries because of unwanted side effects (Chennamsetty I. et a I., (2012) J. Lipid Res. 53: 2405-2412). There are also anecdotical reports on the effect of some functional foods that may reduce Lp(a) by 10 - 20 %, yet studies on a large collective are still missing. The most promising medication that is currently in phase-ill trials are anti-sense oligonucleotides.

[0008] Lp(a) is biosynthesized in the liver. Lp(a) plasma concentration is primarily determined by the rate of Apo(a) biosynthesis whereas the catabolic rate of Lp(a) has little impact. Thus, it is envisaged that an effective medication should interfere with the synthesis rate of Apo(a).

[0009] Farnesoid-X Receptor (FXR) is a key regulator of bile acid biosynthesis in humans. A similar regulatory mechanism was identified for Apo(a) transcription (Chennamsetty I., et al. (2011) J. Clin. Invest. 121: 3724 - 3734). FXR is a nuclear receptor that interferes with the promoter activity of target genes. In gut, FXR promotes the synthesis of FGF19 that binds to a specific receptor on liver cells and activates a signaling cascade that finally stops Apo(a) transcription. Binding of ligands to FXR on the other hand stimulates its transport to the nucleus and the interference with the binding of HNF4a, a positive transcription factor for Apo(a), to its response element and cessation of Apo(a) expression. Both mechanisms together lead to a blocking of Apo(a) transcription.

[0010] Very effective FXR agonists are bile acids, in humans cholic acid, chenodeoxycholic acid deoxy cholic acid and different conjugated forms thereof. These bile acids - in particular the lipophilic ones - may be toxic at higher concentrations and not suitable for long-term medications. Furthermore, there are numerous bile acids and derivatives thereof that have no impact on plasma Lp(a) levels at all. One example is ursodeoxycholic acid, a compound used for the treatment of primary biliary cirrhosis.

[0011] W02009105897A1 and WO2011022838A1 disclose polyhydroxylated bile acids for the treatment of biliary disorders. W02013041519A1 discloses compounds with a polyhydroxylated cholane skeleton for use as modulators of the retinoid-receptor related orphan receptor (ROR). Exemplified are different 1/3 ,3a,7a,12a-tetrahydroxy-5 3 -cholan-24-oate compounds. These compounds exhibited an improvement in insulin sensitivity in obese insulin resistant mice. [0012] In summary, the effect of the state-of-the-art compounds on plasma Lp(a) levels has not been demonstrated so far. Thus, there is still an urgent need for small molecule compound medication for an efficient treatment of elevated Lp(a) levels in a subject.

Summary of invention

[0013] It is the object of the present invention to provide a small molecule compound medication for an efficient treatment of elevated Lp(a) levels in a subject in need thereof.

[0014] The objective is solved by the present invention.

[0015] The invention provides polyhydroxylated bile acids (PHBA) for the treatment of subjects with elevated Lp(a) levels. Thereby, the usefulness of polyhydroxylated bile acids (PHBA) for the treatment of subjects with elevated Lp(a) was evaluated. Transgenic mice were fed with PHBA to demonstrate a profound reduction of plasma Lp(a) concentrations.

[0016] According to the invention there is provided a polyhydroxylated bile acid compound or a pharmaceutically acceptable salt thereof for use in the treatment of a subject suffering from an increased plasma level of lipoprotein (a) (Lp(a)).

[0017] According to one aspect, the plasma level of Lp(a) in said subject is above the concentration by consensus recommendations of about >30 mg/dl.

[0018] According to another aspect, the plasma level of Lp(a) in said subject is decreased by at least 10% compared to the baseline value.

[0019] According to another aspect, the polyhydroxylated bile acid compound is conjugated to a pharmaceutically acceptable moiety.

[0020] Specifically, said pharmaceutically acceptable moiety is selected from the group consisting of amino sulfonic acid, an amine and amino acid.

[0021] Specifically, said pharmaceutically acceptable moiety is selected from the group consisting of ethanolamine, taurine, glycine or serine.

[0022] Specifically, the polyhydroxylated bile acid compound according to the invention is a tetrahydroxylated bile acid. [0023] Specifically, the tetrahydroxylated bile acid according to the invention is selected from the group consisting of

3.6.7.12-tetrahydroxy-cho la n-24-oic acid,

3.4.7.12-tetrahydroxy-cho la n-24-oic acid,

1.3.7.12-tetrahydroxy-cho la n-24-oic acid,

2.3.7.12-tetrahydroxy-cho la n-24-oic acid,

2.4.7.12-tetrahydroxy-cholan-24-oic acid, and

2.6.7.12-tetrahydroxy-cho la n-24-oic acid.

[0024] Specifically, the tetrahydroxylated bile acid according to the invention is selected from the group consisting of

3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid,

3a, 6/3 ,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid,

3a, 6a, 7 b ,12a-tetra hydroxy-5 b -cholan-24-oic acid,

3a, 6a, 7a, 12/3 -tetrahydroxy-5 b -cholan-24-oic acid,

3a, 6/3 ,7a, 12/3 -tetrahydroxy-5 b -cholan-24-oic acid,

3a, 6/3 ,7 b ,12/3 -tetrahydroxy-5 b -cholan-24-oic acid, and 1 b ,3a, 7a, 12a- tetrahydroxy-cholan-24-oic acid.

[0025] Specifically, the polyhydroxylated bile acid according to the invention is 3a, 6a, 7a, 12a-tetra hydroxy-5 b -cholan-24-oic acid.

[0026] According to one aspect of the compound for use of the present invention, the increased plasma level of Lp(a) of the subject is the cause of an associated disease.

[0027] Specifically, the associated disease is one of hyperlipidemia, dyslipidemia, atherosclerosis, hypertension, thrombosis, disorder of hemostasis, cardiovascular disease, aortic calcification, stroke, kidney disease or Type-ll diabetes.

[0028] According to another aspect, the polyhydroxylated bile acid according to the invention is used in combination with a cholesterol lowering agent.

[0029] Specifically, said cholesterol lowering agent is a cholesterol synthesis inhibitor or a cholesterol absorption inhibitor.

[0030] According to one embodiment of the invention, there is provided a pharmaceutical composition for use in the prevention or treatment of a disease associated with an increased Lp(a) plasma level in a subject comprising a polyhydroxylated bile acid compound according to the present invention and a pharmaceutical acceptable carrier. [0031] Specifically, said disease is one of hyperlipidemia, dyslipidemia, atherosclerosis, hypertension, thrombosis, disorder of hemostasis, cardiovascular disease, aortic calcification, stroke, kidney disease or Type-ll diabetes.

[0032] Specifically, said disease is hyperlipidemia, dyslipidemia, hypertension, or Type-ll diabetes.

Brief description of drawings

[0033] Fig.l: Primary hepatocytes from tg-Apo(a) mice were incubated for 24h with 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid and the expression of Apo(a) was measured by RT-PCR. Values on the y-axis are relative expressions in relation to the control hepatocytes without THBA. Results are mean ± SEM of three independent experiments. (**P<0.01***P<0.001).

[0034] Fig. 2: Primary hepatocytes from tg-Apo(a) mice were incubated for 24h with 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid and the expression of Cyp7al was measured by RT-PCR. Values on the y-axis are relative expressions in relation to the control hepatocytes without TPIBA. Results are mean ± SEM of three independent experiments. (***P<0.001).

[0035] Fig. 3: 8 tg-Apo(a) mice were fed for 1 week with 0.1% 3a, 6a, 7a, 12a- tetrahydroxy-5 b -cholan-24-oic acid and the expression of Apo(a) and Cyp7al was measured by RT-PCR. Values on the y-axis are relative expressions in relation to the control animals fed with chow diet without TPIBA. The data are mean ± SEM from duplicate analyses. (***P<0.001).

[0036] Fig. 4: 6 tg-Apo(a) mice were fed with 0.2% 3a,6a,7a,12a-tetrahydroxy- 5 b -cholan-24-oic acid for 1 week and the plasma concentration of Apo(a) was measured in duplicates by an ELISA from Mercodia ^® . Values are in mg/dl of Apo(a).

[0037] Fig. 5: 6 tg-Apo(a) mice were fed with 1% 3a,6a,7a,12a-tetrahydroxy-5 b - cholan-24-oic acid for 2 weeks and the plasma concentration of Apo(a) was measured in duplicates by an ELISA from Mercodia ^® . Values are in mg/dl of Apo(a).

Description of embodiments

[0038] Unless indicated or defined otherwise, all terms used herein have their usual meaning in the art, which will be clear to the skilled person.

[0039] Bile acids (BAs) are amphiphilic molecules with 24 carbon atoms and consist of a hydrophobic and a rigid steroid nucleus, to which hydrophilic hydroxyl groups and a flexible acidic aliphatic side chain are attached. The steroidal core of BAs constitutes a saturated cyclopentanoperhydrophenanthrene skeleton consisting of three six-membered rings (A, B, and C) and one five-membered ring (D).

(cyclopentanoperhydrophenanthrene ring)

[0040] Cholanoic acid is the archetypal C24 bile acid skeleton from which all other C24 bile acids can be derived. Of the two common isomers: 5 a and 5 b , the latter isomer is the most biologically relevant.

(5 a -cholan-24-oic acid) (5 b -cholan-24-oic acid)

[0041] Most naturally occurring bile acids are characterized by hydroxyl groups in the A, B, and C ring of the cholane skeleton. In higher vertebrates, the bile acid nucleus is curved because the A and the B rings are in a cvs-fused configuration. In addition, there are angular methyl groups at positions C-10 and C-13. The BAs in lower vertebrates are known as allo-BAs. In this case, A and B rings are trans linked (5 a -stereochemistry). In higher vertebrates, C ₂₄ BAs constitute a major part of the bile. The BAs are facially amphipathic, i.e., they contain both hydrophobic (lipid soluble) and hydrophilic (polar) faces. [0042] Specifically, in unconjugated polyhydroxylated bile acids the hydrophilic character of the compounds prevails. Polyhydroxylated as used herein refers to at least 4 hydroxy substituents and up to the maximal hydroxylation level of the bile acid compound. Polyhydroxylated bile acids include but are not limited to tetrahydroxylated, pentahydroxylated, hexahydroxylated bile acids, etc. According to one embodiment of the invention tetrahydroxylated bile acids are preferred. [0043] In one embodiment, the polyhydroxylated bile acid compound according to the present invention is selected from the group consisting of tetrahydroxylated bile acids (THBA).

[0044] In another embodiment, the polyhydroxylated bile acid according to the present invention is selected from the group consisting of 3,6,7,12-tetrahydroxy- cholan-24-oic acid, 3,4,7,12-tetrahydroxy-cholan-24-oic acid, 1,3,7,12- tetrahydroxy-cholan-24-oic acid, 2,3,7,12-tetrahydroxy-cholan-24-oic acid, 2,4,7,12-cholan-24-oic acid, and 2,6,7,12-cholan-24-oic acid.

[0045] In a specific embodiment, the polyhydroxylated bile acid according to the present invention is selected from the group consisting of 3a, 6a, 7a, 12a- tetrahydroxy-5/3 -cholan-24-oic acid, 3a, 6/3 ,7a,12a-tetrahydroxy-5 b -cholan-24- oic acid, 3a, 6a, 7 b ,12a-tetrahydroxy-5 b -cholan-24-oic acid, 3a, 6a, 7a, 12 b - tetrahydroxy-5 3 -cholan-24-oic acid, 3a, 6/3 ,7a, 12/3 -tetrahydroxy-5 b -cholan-24- oic acid, and 3a, 6/3 ,7 b ,12/3 -tetrahydroxy-5/3 -cholan-24-oic acid, 1/3 ,3a, 7a, 12a tetrahydroxy-cholan-24-oic acid.

[0046] In a specific aspect, the polyhydroxylated bile acid according to the present invention is 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid.

[0047] The polyhydroxylated bile acids may be substituted by suitable substituent which do not alter the pharmaceutical activity of the compounds. Suitable substituents are for example selected from the group consisting of =0, -C _1-3 alkyl, - OC- _{L 3} a I ky I , or halogen. [0048] The term "pharmaceutically acceptable salt" refers to a formulation of a bile acid compound that does not cause significant irritation to an organism to which it is administered and does not abrogate the biological activity and properties of the bile acid. Pharmaceutical salts can also be obtained by reacting the compounds of this invention with a base to form a salt such as an ammonium salt, an alkali metal salt, such as a sodium or a potassium salt or a lithium salt, an alkaline earth metal salt, such as a calcium or a magnesium salt, a zinc salt, a salt of organic bases such as dicyclohexylamine, N-methyl-D-glucamine, tris(hydroxymethyl) methylamine, and salts thereof. In some embodiments, the pharmaceutically acceptable salt is Na ⁺ , K ⁺ , Li ⁺ , Ca ⁺⁺ , Mg ⁺⁺ or Zn ⁺⁺ .

[0049] The term “conjugated to" refers to compounds, wherein the polyhydroxylated bile acid compound according to the present invention is conjugated to a pharmaceutically acceptable moiety.

[0050] As used herein the term “pharmaceutically acceptable moiety" refers to a moiety which provides additional hydrophilicity, charge, function and/or other properties. The pharmaceutically acceptable moiety may after administration optionally be released in clinically acceptable amounts.

[0051] In one aspect, the polyhydroxylated bile acid according to the present invention is conjugated to a suitable moiety. In one aspect, the polyhydroxylated bile acid is conjugated to an amino acid, e.g., taurine, glycine or serine. In yet another aspect, the bile acid according to the present invention is conjugated to an acid or a salt thereof, e.g., sulfate, phosphate, etc.; to a sulfonic acid or a salt thereof, e.g., alkyl sulfonate, etc.; organic acid or a thereof, e.g., acetate, lactate, malate, tartrate, citrate, ascorbate, succinate, butyrate, valerate, fumarate, glucuronate, etc.; to a sugar e.g., glucose, or xylose; to an amino sugar e.g., N- acetylglucosamine, glucosamine, or ethanolamine. In some embodiments, the pharmaceutically acceptable moiety is taurine, glycine or serine.

[0052] Pharmaceutical modifications can also be obtained by reacting a bile acid compound of the invention with inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, succinic acid, tartaric acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, salicylic acid and the like.

[0053] Lowering elevated low density lipoprotein cholesterol (LDL-C) is considered to be responsible for reducing cardiovascular disease (CVD; inclusive of myocardial infarction, stroke and peripheral arterial disease). Thus, all clinicians taking care of subjects at risk of or with preexisting CVD needed to incorporate lipid management in their practice, particularly in managing elevated LDL-C.

[0054] Although the main focus of CVD prevention in the lipid arena has been on lowering LDL-C, elevated Lp(a) has emerged in the last decade as a genetic, independent and likely causal risk factor for CVD and calcific aortic valve disease (CAVD) as well as many other diseases.

[0055] Lp(a) is both a highly prevalent risk factor and the most common monogenetic CVD risk factor. The average levels of Lp(a) differ among different groups and 20-30% population has plasma levels above the risk threshold of about 30 mg/dL (75 nmol/L) for CVD. In Blacks, the average levels of Lp(a) are significantly higher, and in Asians significantly lower. In these groups the cut-off levels where pharmacological treatment is recommended are distinct from Whites. The risk rises nearly linearly with increased Lp(a) levels. Since cholesterol lowering medications in most cases do not reduce Lp(a) levels to a desirable degree it is tempting to combine them with compounds of this invention. According to one embodiment the polyhydroxylated bile acid is therefore administered in combination with a cholesterol synthesis inhibitor such as a statin or a cholesterol absorption inhibitor, e.g., Ezetimibe ^® .

[0056] The term “plasma level of lipoprotein (a)" according to the present invention refers to the concentration of Lp(a) in plasma given in mg/dL or nmol/L. [0057] According to one embodiment, a subject with an increased plasma level of Lp(a) compared to a desirable reference value plasma level of Lp(a) is treated with a polyhydroxylated bile acid. Thereby, the desirable reference value of plasma lipoprotein(a) is considered as the value of plasma Lp(a) associated with a no or low cardiovascular risk. Said desirable value may vary regionally worldwide. As an exemplary desirable reference value of plasma Lp(a), a concentration of below 15 mg/dl or even of below 10 mg/dl is generally considered as a plasma level of Lp(a) associated with no or low cardiovascular risk. Whereas a plasma level of Lp(a) of above 30 mg/dl is considered as increased level associated with an increased risk. A plasma level of Lp(a) of above 60 mg/dl is considered as a condition where a therapeutic intervention is generally recommended by health professionals especially if co-occurring with additional risk factors such as high plasma LDL or low plasma HDL levels. [0058] In another embodiment, upon treatment of a subject with the polyhydroxylated bile acid compound for use according to the present invention, the plasma level of Lp(a) of said subject is decreased by at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, or at least 60% as compared to the baseline plasma level of Lp(a).

[0059] The term “baseline" as used herein refers to the subject's lipoprotein (a) level determined prior to or at start of treatment. This baseline is the refence value for determining the effective decrease of the Lp(a) concentration in the subject’s plasma. The Lp(a) level may be determined by enzyme immunoassays (EIAs), by an immunoradiometric assay (IRMA), turbidimetry, nephelometry, liquid chromatography- mass spectroscopy, or by electrophoresis measuring Lp(a)- cholesterol.

[0060] In another aspect, the present invention provides a pharmaceutical composition for use in the prevention or treatment of a disease associated with an increased plasma level of Lp(a), wherein said pharmaceutical composition comprises a polyhydroxylated bile acid compound and a pharmaceutical acceptable carrier.

[0061] The term “pharmaceutically acceptable carrier" refers to a pharmaceutical carrier according to acceptable pharmaceutical techniques. The carrier may take a wide variety of forms depending on the form of preparation desired for administration. Various organic or inorganic carrier materials conventionally used as materials for pharmaceutical preparations may be used as pharmaceutically acceptable carrier for the compounds of the invention and the route of administration chosen. They are blended as excipient, lubricant, binder or disintegrant for solid preparations; and solvent, solubilizing agent, suspending agent, isotonicity agent, buffer, soothing agent and the like for liquid preparations. Where necessary, an additive for pharmaceutical preparations such as preservative, antioxidant, colorant, sweetening agent and the like can be used. [0062] The term "treatment" in relation to a given disease or disorder, includes, but is not limited to, inhibiting the disease or disorder, for example, arresting the development of the disease or disorder; relieving the disease or disorder, for example, causing regression of the disease or disorder; or relieving a condition caused by or resulting from the disease or disorder, for example, relieving, preventing or treating symptoms of the disease or disorder. The term "prevention" in relation to a given disease or disorder means: preventing the onset of disease development if none had occurred, preventing the disease or disorder from occurring in a subject that may be predisposed to the disorder or disease but has not yet been diagnosed as having the disorder or disease, and/or preventing further disease/disorder development if already present.

[0063] In one aspect, the present invention relates to the treatment and prevention of a disease associated with an increased plasma level of Lp(a), wherein said associated disease refers to a disease, disorder of condition of a subject having family and/or personal histories of heart disease, lipid metabolism disorder, hypercholesterolemia, hypertriglyceridemia, dyslipidemia, high triglycerides and/or high blood cholesterol levels, non-fatal heart attack, non-fatal stroke, postmenopausal subjects with increased risk factors for heart disease, hypothyroidism, underactive thyroid gland, diabetes, renal disease, renal failure, nephrotic syndrome, hypertension, hemostasis disorders, thrombosis, aortic valve calcification.

[0064] In a further aspect, the disease associated with an increased plasma level of Lp(a) is selected from the group consisting of atherosclerosis; stroke; vascular disease, e.g., cardiovascular disease, peripheral vascular disease, hereditary vascular disease; thrombosis; diabetes; metabolic disease conditions, e.g., dyslipoproteinemia, hyperlipidemia, etc.

[0065] In a specific aspect, the disease associated with an increased plasma level of Lp(a) is type II diabetes, hyperlipidemia, or dyslipidemia.

Examples

[0066] The Examples which follow are set forth to aid in the understanding of the invention but are not intended to, and should not be construed to limit the scope of the invention in any way. The Examples do not include detailed descriptions of conventional methods. Such methods are well known to those of ordinary skill in the art.

Example 1 -3a,6a,7a,12a-tetrahydroxy-5/3-cholan-24-oic acid reduces Apo(a) expression in transgenic Apo(a) mice - in vitro

Material and Methods of in vitro experiments:

[0067] For the experiments, transgenic (tg) mice generated according to Frazer KA. et al. 1995 (Frazer KA, et al. (1995) Nat Genet. 1995;9(4):424-431) were used. The mice carrying a 110-kb human APOA gene surrounded by more than 60- kb 5' -and 3' -flanking DNA in the YAC were the same as reported in previously (Chennamsetty, I. et al. (2011) J. din. Invest. 121: 3724 - 3734; Chennamsetty, I., et al. (2012) Arterioscier. Thromb. Vase. Biol. 32: 1220 - 1227; and Chennamsetty, I. et al. (2012) J. Lipid Res. 53: 2405-2412). 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24- oic acid (MF: C24H40O6 MW: 424.57) > 95% purity was purchased from UHN Shanghai 88 Cailun Rd, Zhangjiang Hi-Tech Park, Pudong New Area, Shanghai, 201210, China. All other chemicals were from Sigma-Aldrich https://www.sigmaaldrich.com if not stated otherwise.

[0068] in vitro experiments were carried out with primary hepatocytes prepared as described previously (Salonpaa P., et al. (1994) Biochem BiophysRes CC>/77/77Z//7.205:631-637) and outlined previously (Chennamsetty, I., et al (2012) J. Lipid Res. 53: 2405-2412). In short, two 3 months old tg Apo(a) mice kept on a Altromin 1324 chow diet were sacrificed the livers were harvested and perfused with collagenase solution. After filtration and centrifugation, cells from 2 livers were mixed and re-suspended in DMEM supplemented with 20% (v/v) FCS and 100 units/ml of penicillin and streptomycin respectively. Cells were placed in 6-well collagen coated plates and cultivated in DMEM/10% FCS for 24 h before treatment with 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid.

Results of in vitro experiments:

[0069] Liver explants from 2 transgenic Apo(a) mice (tg-mice) on standard rodent diet 1324 from Altromin (Germany) were harvested and primary hepatocytes were prepared as described in Methods. The cells were then incubated for 24 h with 0.1 mM and 0.2 mM of 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid and Apo(a) mRNA expression was measured by real-time PCR (RT-PCR). The results shown in Fig.l represent the mean ± SEM of three independent experiments. For comparison we also measured in the primary hepatocytes from tg-mice the expression Cyp7al the key enzyme of bile acid biosynthesis. The results are shown in Fig. 2.

Example 2 - 3a,6a,7a,12a-tetrahydroxy-5¾-cholanoic acid reduces Apo(a) expression in transgenic Apo(a) mice - in vivo

Material and Methods of in vivo and ex vivo experiments:

For the experiments, transgenic (tg) mice generated previously (Frazer KA et al. (1995) Nat Genet. 1995;9(4):424-431) were used. The mice carrying a 110-kb human APOA gene surrounded by more than 60- kb 5' -and 3' -flanking DNA in the YAC were the same as reported in detail previously (Chennamsetty, I., et al. (2011) J. Clin. Invest. 121: 3724 - 3734; Chennamsetty, I., et al (2012) Arterioscler. Thromb. Vase. Biol. 32: 1220 - 1227; Chennamsetty, I., et al (2012) J. Lipid Res. 53: 2405-2412). As representative THBA, 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24- oic acid (MF: C24H40O6 MW: 424.57) > 95% purity was purchased from UHN Shanghai 88 Cailun Rd, Zhangjiang Hi-Tech Park, Pudong New Area, Shanghai, 201210, China. All other chemicals were from Sigma-Aldrich https://www.sigmaaldrich.com if not stated otherwise.

[0070] In vivo experiments were carried out with 2- 3 months old ig-A OA mice kept on chow diet. On day zero, the animals received for 2 weeks chow diet supplemented 0.1%, 0.2%, and 1% of 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid. After one and 2 weeks feeding, blood was harvested from the animals for analysis of different serum parameters.

[0071] mRNA expression was measured in primary hepatocytes as well as in whole liver extracts as described previously (Chennamsetty, I., et al. (2011) J. Clin. Invest. 121: 3724 - 3734; Chennamsetty, I., et al. (2012) Arterioscler. Thromb. Vase. Biol. 32: 1220 - 1227; Chennamsetty, I., et al. (2012) J. Lipid Res. 53: 2405-2412). In short, total RNA was extracted using Trizol (Invitrogen) according to the manufacturer’s protocol. Two micrograms of total RNA were reverse transcribed using the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). Quantitative real-time PCR was performed on a Light Cycler 480 instrument (Roche Diagnostics), using the QuantiFast SYBR Green PCR Kit (Qiagen). The following primer were used: Apo(a) mouse: Forward primer (5’ 3’) GGCACGTATGGCAGCAAGAT (SEQ ID NO:l); Reverse primer (5’ 3’) CCAAGGAGGAGGATTCAAACTG (SEQ ID NO:2); Ppia mouse: Forward primer (5’ 3’) TTCCAGGATTCATGTGCCAG (SEQ ID NO:3); Reverse primer (5’ 3’) CCATCCAGCCATTCAGTCTT (SEQ ID NO:4). Cyp7Al mouse: Forward primer (5’ 3’) GGGATTGCTGTGGTAGTGAGC (SEQ ID NO:5); Reverse primer (5’ 3’) GGTATGGAATCAACCCGTTGTC (SEQ ID NO:6).

[0072] The gene expression values were normalized to cyclophilin A {Ppia) as a housekeeping gene. The data were analyzed by the public domain program Relative Expression Software Tool (REST; http://www.gene- quantification. de/download. html#rest ). Values are presented as mean ± SEM. [0073] Blood parameters: Lp(a) concentrations were measured in plasma of tg- mice using the ELISA from Mercodia ^® (https://www.mercodia.com/product/lp-a- ELISA) in duplicates according to the protocol of the manufacturer. Glucose was measured in whole blood by an Accu-Check Active with the commercial strips from the manufacturer. All other parameters were assayed in plasma using the Cobas (ROCHE) auto-analyzer with the reagents and protocols from the manufacturer. Example 3 - 3a,6a,7a,12a-tetrahydroxy-5/3-cholan-24-oic acid reduces Apo(a) plasma concentrations in transgenic Apo(a) mice - in vivo Results of in vivo experiments:

[0074] Feeding with 0.1% 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid for 1 week: 8 tg-Apo(a) mice were fed for 1 week with chow containing 0.1% (w/w)

3a, 6a, 7a, 12a-tetra hydroxy-5 b -cholan-24-oic acid. At the end of this feeding period, the animals were sacrificed, livers were harvested and the expression of Apo(a) mRNA and in comparison of Cyp7al was measured by RT-PCR as described (Fig.3). The results are mean ± SEM.

[0075] Feeding with 0.2% 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid for 2 weeks: 6 tg-Apo(a) mice were fed for one week with 0.2% (w/w) 3a, 6a, 7a, 12a- tetrahydroxy-5 b -cholan-24-oic acid mixed to standard rodent chow. At the end of this feeding period, blood was harvested and plasma Apo(a) concentrations were measured as described in Methods. The results are shown in Fig.4. At the x-axis the individual mice are numbered from 1-6; y-axis : Apo(a) concentrations in mg/dl. [0076] Feeding with 1% 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid for 1 and 2 weeks: In subsequent experiments 6 tg Apo(a) mice were fed for 2 weeks with 1% (w/w) 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid mixed to standard rodent chow and plasma Apo(a) values were analyzed 1 week and 2 weeks after the start. The results are shown in Fig. 5. At the x-axis the individual mice are numbered from 1-6; y-axis : Apo(a) concentrations in mg/dl.

[0077] Evaluation of potential toxic effects: In order to evaluate any adverse or toxic effect of the 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid, the body weight and the laboratory parameters glucose, urea, bilirubin, AST, ALT, and CHE were analyzed at one-week and two-week time points after starting the experiment with 1% (w/w) 3a,6a,7a,12a-tetrahydroxy-5 b -cholan-24-oic acid feeding. As shown in Table 1 no signs of toxicity or intolerance could be observed. Table 1: Laboratory parameters of 6 mice treated for 2 weeks with 3a, 6a, 7a, 12a- tetrahydroxy-5 b -cholan-24-oic acid

[0078] Interpretation and discussion: As previously shown (Chennamsetty et al, (2011) J. din. Invest. 121: 3724 - 3734) plasma Lp(a) concentrations are determined by the production rate (expression) of Apo(a) in the liver. The expression of human genes in general is strongly influenced by transcription factors and nuclear receptors. There are at least 70 response elements in the promoter region of the Apo(a) gene. Two mechanisms have been suggested to be responsible for Apo(a) expression, both sensitive to farnesoid-X receptor (FXR) agonists. A known FXR agonist is cholic acid (3 a ,7 a ,12 a -trihydroxy-5 b -cholan- 24-oic acid), that in fact reduced plasma Apo(a) concentrations when fed to tg- Apo(a) mice. Due to its unwanted side effects cholic acid is not recommended for use as a medication because it may cause liver damage.

[0079] Surprisingly, it was demonstrated here, that the non-toxic polyhydroxylated bile acid 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid is effective in reducing plasma Apo(a) in tg-Apo(a) mice. 3a,6a,7a,12a-tetrahydroxy-5 3 -cholan-24-oic acid interferes in Apo(a) transcription by reducing mRNA abundance in liver of tg- Apo(a) mice. From this surprising result it can be concluded that polyhydroxylated bile acids are effective in decreasing the Lp(a) level in subject’s plasma and thus, prevent or treat diseases which are associated with an increased Lp(a) level.