Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
CANCER-RELATED BIOLOGICAL MATERIALS IN MICROVESICLES
Document Type and Number:
WIPO Patent Application WO/2012/031008
Kind Code:
A2
Abstract:
Disclosed herein are methods for assaying a biological sample from a subject by analyzing components of microvesicle fractions in aid of risk, diagnosis, prognosis or monitoring of, or directing treatment of the subject for, a disease or other medical condition in the subject. Also disclosed are methods of treatment and identifying biomarkers using a microvesicle fraction of a subject. Kits, pharmaceutical compositions, and profiles related to the methods are also disclosed.

Inventors:
SKOG, Johan Karl Olov (400 West 63rd Street, Apt. 407New York, NY, 10069, US)
BALAJ, Leonora (9 Cedar Street, Charlestown, Massachusetts, 02129, US)
NOERHOLM, Mikkel (Preysingstrasse 21, Gauting, Gauting, DE)
BREAKEFIELD, Xandra O. (127 Homer Street, Newton, Massachusetts, 02459, US)
Application Number:
US2011/050041
Publication Date:
March 08, 2012
Filing Date:
August 31, 2011
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
THE GENERAL HOSPITAL CORPORATION (55 Fruit Street, Boston, Massachusetts, 02114, US)
SKOG, Johan Karl Olov (400 West 63rd Street, Apt. 407New York, NY, 10069, US)
BALAJ, Leonora (9 Cedar Street, Charlestown, Massachusetts, 02129, US)
NOERHOLM, Mikkel (Preysingstrasse 21, Gauting, Gauting, DE)
BREAKEFIELD, Xandra O. (127 Homer Street, Newton, Massachusetts, 02459, US)
International Classes:
C12Q1/68
Domestic Patent References:
2010-05-20
2009-02-19
2011-07-21
2011-10-13
2009-12-23
2009-08-13
2011-01-20
2011-03-17
2011-03-17
2003-03-20
2006-10-26
Foreign References:
US20100196426A12010-08-05
US20020106684A12002-08-08
US7776523B22010-08-17
US5639606A1997-06-17
US5219727A1993-06-15
US5538871A1996-07-23
US5556773A1996-09-17
US6913879B12005-07-05
US7364848B22008-04-29
US7378245B22008-05-27
US6893837B22005-05-17
US6004755A1999-12-21
US7186512B22007-03-06
US6994960B12006-02-07
US7074563B22006-07-11
US7198893B12007-04-03
US5639611A1997-06-17
US5846727A1998-12-08
US20110111401A12011-05-12
US20110098193A12011-04-28
Other References:
GeneAnnot: "Probes for MYC available on Affymetrix arrays HG-U95, HG-U133, and HG-U133 Plus 2.0", Weizmann Institute of Science , 20 April 2001 (2001-04-20), XP002674351, Retrieved from the Internet: URL:http://genecards.weizmann.ac.il/cgi-bin/geneannot/GA_search.pl [retrieved on 2012-04-20] -& "Gene chip human genome U133 set", INTERNET CITATION, 20 April 2001 (2001-04-20), XP002964621, Retrieved from the Internet: URL:http://www.affymetrix.com/products/arrays/specific/hgu133.asp [retrieved on 2003-05-21]
DIEDERICK DUIJVESZ ET AL: "Exosomes as Biomarker Treasure Chests for Prostate Cancer", EUROPEAN UROLOGY, ELSEVIER BV, NL, vol. 59, no. 5, 29 December 2010 (2010-12-29), pages 823-831, XP028160348, ISSN: 0302-2838, DOI: 10.1016/J.EURURO.2010.12.031 [retrieved on 2010-12-22]
JOSEPH SAMBROOK, DAVID W. RUSSEL, AND JOE SAMBROOK,: 'Molecular Cloning: A Laboratory Manual, 3rd edition', 15 January 2001, COLD SPRING HARBOR LABORATORY
AITKEN, C.E., A. PETROV, J.D. PUGLISI.: 'Single ribosome dynamics and the mechanism of translation' ANNU REV BIOPHYS. vol. 39, 2010, pages 491 - 513
ALESSI, D.R., L.R. PEARCE, J.M. GARCIA-MARTINEZ: 'New insights into mTOR signaling: mTORC2 and beyond' SCI SIGNAL. vol. 2, 2009, page 27
ASCH, H.L., E. ELIACIN, T.G. FANNING, J.L. CONNOLLY, G. BRATTHAUER, B.B. ASCH.: 'Comparative expression of the LINE-1 p40 protein in human breast carcinomas and normal breast tissues' ONCOL RES. vol. 8, 1996, pages 239 - 47
BARTEL, D.P.: 'MicroRNAs: target recognition and regulatory functions' CELL vol. 136, 2009, pages 215 - 33
BERGSMEDH, A., A. SZELES, M. HENRIKSSON, A. BRATT, M.J. FOLKMAN, A.L. SPETZ, L. HOLMGREN: 'Horizontal transfer of oncogenes by uptake of apoptotic bodies' PROC NATL ACAD SCI USA vol. 98, 2001, pages 6407 - 11
CHENG, G.Z., S. PARK, S. SHU, L. HE, W. KONG, W. ZHANG, Z. YUAN, L.H. WANG, J.Q. CHENG: 'Advances of AKT pathway in human oncogenesis and as a target for anti-cancer drug discovery' CURR CANCER DRUG TARGETS vol. 8, 2008, pages 2 - 6
COTTON, R.G., N.R. RODRIGUES, R.D. CAMPBELL: 'Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations' PROC NATL ACAD SCI U S A. vol. 85, 1988, pages 4397 - 401
COWELL, J.K., K.C. LO.: 'Application of oligonucleotides arrays for coincident comparative genomic hybridization, ploidy status and loss of heterozygosity studies in human cancers' METHODS MOL BIOL. vol. 556, 2009, pages 47 - 65
CRISTOFANILLI, M., J. MENDELSOHN: 'Circulating tumor cells in breast cancer: Advanced tools for ''tailored'' therapy' PROC NAIL ACAD SCI U S A vol. 103, 2006, pages 17073 - 4
DAY, J.R., M. JOST, M.A. REYNOLDS, J. GROSKOPF, H. RITTENHOUSE: 'PCA3: from basic molecular science to the clinical lab.' CANCER LELL. vol. 301, 2011, pages 1 - 6
DINGER, M.E., K.C. PANG, T.R. MERCER, J.S. MATTICK: 'Differentiating protein-coding and noncoding RNA: challenges and ambiguities' PLOS COMPUL BIOL. vol. 4, 2008, page E1000176
DOWLING, R.J., I. TOPISIROVIC, T. ALAIN, M. BIDINOSTI, B.D. FONSECA, E. PETROULAKIS, X. WANG, O. LARSSON, A. SELVARAJ, Y. LIU: 'mTORCl-mediated cell proliferation, but not cell growth, controlled by the 4E-BPs' SCIENCE vol. 328, pages 1172 - 6
ELBASHIR, S.M., W. LENDECKEL, T. TUSCHL.: 'RNA interference is mediated by 21- and 22-nucleotide RNAs' GENES DEV. vol. 15, 2001, pages 188 - 200
ENDER, C., A. KREK, M.R. FRIEDLANDER, M. BEITZINGER, L. WEINMANN, W. CHEN, S. PFEFFER, N. RAJEWSKY, G. MEISTER: 'A human snoRNA with microRNA-like functions' MOL CELL vol. 32, 2008, pages 519 - 28
FENG, J., W.D. FUNK, S.S. WANG, S.L. WEINRICH, A.A. AVILION, C.P. CHIU, R.R. ADAMS, E. CHANG, R.C. ALLSOPP, J. YU ET AL.: 'The RNA component of human telomerase' SCIENCE vol. 269, 1995, pages 1236 - 41
GOLAN, M., A. HIZI, J.H. RESAU, N. YAAL-HAHOSHEN, H. REICHMAN, I. KEYDAR, I. TSARFATY: 'Human endogenous retrovirus (HERV-K) reverse transcriptase as a breast cancer prognostic marker' NEOPLASIA vol. 10, 2008, pages 521 - 33
GOODIER, J.L., H.H. KAZAZIAN, JR.: 'Retrotransposons revisited: the restraint and rehabilitation of parasites' CELL vol. 135, 2008, pages 23 - 35
GRIBALDO, S., C. BROCHIER-ARRNANET: 'The origin and evolution of Archaea: a state of the art' PHILOS TRANS R SOC LOND B BIOL SCI. vol. 361, 2006, pages 1007 - 22
GUATELLI, J.C., K.M. WHITFIELD, D.Y. KWOH, K.J. BARRINGER, D.D. RICHMAN, T.R. GINGERAS: 'Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication' PROC NATL ACAD SCI U S A. vol. 87, 1990, pages 1874 - 8
GUERRIER-TAKADA, C., K. GARDINER, T. MARSH, N. PACE, S. ALTMAN: 'The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme' CELL. vol. 35, 1983, pages 849 - 57
GUPTA, R.A., N. SHAH, K.C. WANG, J. KIM, H.M. HORLINGS, D.J. WONG, M.C. TSAI, T. HUNG, P. ARGANI, J.L. RINN: 'Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis' NATURE vol. 464, 2010, pages 1071 - 6
HAHN, P.J.: 'Molecular biology of double-minute chromosomes' BIOESSAYS vol. 15, 1993, pages 477 - 84
HALICKA, H.D., E. BEDNER, Z. DARZYNKIEWICZ: 'Segregation of RNA and separate packaging of DNA and RNA in apoptotic bodies during apoptosis' EXP CELL RES. vol. 260, 2000, pages 248 - 56
HANAHAN, D., R.A. WEINBERG: 'The hallmarks of cancer' CELL vol. 100, 2000, pages 57 - 70
HILDEBRANDT, M.A., H. YANG, M.C. HUNG, J.G. IZZO, M. HUANG, J., LIN, J.A. AJANI, X. WU.: 'Genetic variations in the PI3K/PTEN/AKT/mTOR pathway are associated with clinical outcomes in esophageal cancer patients treated with chemoradiotherapy' J CLIN ONCOL. vol. 27, 2009, pages 857 - 71
JARROUS, N., R. REINER: 'Human RNase P: a tRNA-processing enzyme and transcription factor' NUCLEIC ACIDS RES. vol. 35, 2007, pages 3519 - 24
JEMAL, A., R. SIEGEL, E. WARD, Y. HAO, J. XU, T. MURRAY, M.J. THUN.: 'Cancer statistics' CA CANCER J CLIN. vol. 58, 2008, pages 71 - 96
JI, P., S. DIEDERICHS, W. WANG, S. BOING, R. METZGER, P.M. SCHNEIDER, N. TIDOW, B. BRANDT, H. BUERGER, E. BULK: 'MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer' ONCOGENE vol. 22, 2003, pages 8031 - 41
KAPRANOV, P., J. CHENG, S. DIKE, D.A. NIX, R. DUTTAGUPTA, A.T. WILLINGHAM, P.F. STADLER, J. HERTEL, J. HACKERMULLER, I.L. HOFACKER: 'RNA maps reveal new RNA classes and a possible function for pervasive transcription' SCIENCE vol. 316, 2007, pages 1484 - 8
KATAYAMA, S., Y. TOMARU, T. KASUKAWA, K. WAKI, M. NAKANISHI, M. NAKAMURA, H. NISHIDA, C.C. YAP, M. SUZUKI, J. KAWAI: 'Antisense transcription in the mammalian transcriptome' SCIENCE vol. 309, 2005, pages 1564 - 6
KISS, T.: 'Small nucleolar RNAs: an abundant group of noncoding RNAs with diverse cellular functions' CELL vol. 109, 2002, pages 145 - 8
KLEMKE, R.L., S. CAI, A.L. GIANNINI, P.J. GALLAGHER, P. DE LANEROLLE, D.A. CHERESH: 'Regulation of cell motility by mitogen-activated protein kinase' J CELL BIOL. vol. 137, 1997, pages 481 - 92
KWOH, D.Y., G.R. DAVIS, K.M. WHITFIELD, H.L. CHAPPELLE, L.J. DIMICHELE, T.R. GINGERAS.: 'Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format' PROC NATL ACAD SCI USA vol. 86, 1989, pages 1173 - 7
LAKKARAJU, A., E. RODRIGUEZ-BOULAN: 'Itinerant exosomes: emerging roles in cell and tissue polarity' TRENDS CELL BIOL. vol. 18, 2008, pages 199 - 209
LERNER, M.R., J.A. BOYLE, J.A. HARDIN, J.A. STEITZ: 'Two novel classes of small ribonucleoproteins detected by antibodies associated with lupus erythematosus' SCIENCE vol. 211, 1981, pages 400 - 2
LI, J., L. WANG, H. MAMON, M.H. KULKE, R. BERBECO, G.M. MAKRIGIORGOS: 'Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing' NAT MED. vol. 14, 2008, pages 579 - 84
LI, X., D.N. FRANK, N. PACE, J.M. ZENGEL, L. LINDAHL: 'Phylogenetic analysis of the structure of RNase MRP RNA in yeasts' RNA vol. 8, 2002, pages 740 - 51
LIPSON, D., T. RAZ, A. KIEU, D.R. JONES, E. GILADI, E. THAYER, J.F. THOMPSON, S. LETOVSKY, P. MILOS, M. CAUSEY: 'Quantification of the yeast transcriptome by single-molecule sequencing' NAT BIOTECHNOL. vol. 27, 2009, pages 652 - 8
LOWER, R., J. LOWER, R. KURTH: 'The viruses in all of us: characteristics and biological significance of human endogenous retrovirus sequences' PROC NATL ACAD SCI U S A. vol. 93, 1996, pages 5177 - 84
MARINER, P.D., R.D. WALTERS, C.A. ESPINOZA, L.F. DRULLINGER, S.D. WAGNER, J.F. KUGEL, J.A. GOODRICH: 'Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock' MOL CELL. vol. 29, 2008, pages 499 - 509
MATTICK, J.S.: 'RNA regulation: a new genetics?' NAI REV GENET. vol. 5, 2004, pages 316 - 23
MAXAM, A.M., W. GILBERT.: 'A new method for sequencing DNA' PROC NATL ACAD SCI USA. vol. 74, 1977, pages 560 - 4
MIELE, E.A., D.R. MILLS, F.R. KRAMER: 'Autocatalytic replication of a recombinant RNA' J MOL BIOL. vol. 171, 1983, pages 281 - 95
MIRANDA, K.C., D.T. BOND, M. MCKEE, J. SKOG, T.G. PAUNESCU, N. DA SILVA, D. BROWN, L.M. RUSSO: 'Nucleic acids within urinary exosomes/microvesicles are potential biomarkers for renal disease' KIDNEY INT. vol. 78, 2010, pages 191 - 9
MYERS, R.M., Z. LARIN, T. MANIATIS: 'Detection of single base substitutions by ribonuclease cleavage at mismatches in RNA:DNA duplexes' SCIENCE vol. 230, 1985, pages 1242 - 6
NG, K., D. PULLIRSCH, M. LEEB, A. WUTZ: 'Xist and the order of silencing' EMBO REP. vol. 8, 2007, pages 34 - 9
NILSSON, J., J. SKOG, A. NORDSTRAND, V. BARANOV, L. MINCHEVA-NILSSON, X.O. BREAKEFIELD, A. WIDMARK: 'Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer' BR J CANCER vol. 100, 2009, pages 1603 - 7
ORITA, M., H. IWAHANA, H. KANAZAWA, K. HAYASHI, T. SEKIYA: 'Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms' PROC NATL ACAD SCI U S A. vol. 86, 1989, pages 2766 - 70
OROZCO, A.F., D.E. LEWIS: 'Flow cytometric analysis of circulating microparticles in plasma' CYTOMETRY A. vol. 77, 2010, pages 502 - 14
PELLOSKI, C.E., K.V. BALLMAN, A.F. FURTH, L. ZHANG, E. LIN, E.P. SULMAN, K. BHAT, J.M. MCDONALD, W.K. YUNG, H. COLMAN: 'Epidermal growth factor receptor variant III status defines clinically distinct subtypes of glioblastoma' J CLIN ONCOL. vol. 25, 2007, pages 2288 - 94
RINN, J.L., M. KERTESZ, J.K. WANG, S.L. SQUAZZO, X. XU, S.A. BRUGMANN, L.H. GOODNOUGH, J.A. HELMS, P.J. FARNHAM, E. SEGAL: 'Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs' CELL vol. 129, 2007, pages 1311 - 23
SANGER, F., S. NICKLEN, A.R. COULSON: 'DNA sequencing with chain-terminating inhibitors' PROC NATL ACAD SCI U S A. vol. 74, 1977, pages 5463 - 7
SARBASSOV, D.D., S.M. ALI, S. SENGUPTA, J.H. SHEEN, P.P. HSU, A.F. BAGLEY, A.L. MARKHARD, D.M. SABATINI: 'Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB' MOL CELL. vol. 22, 2006, pages 159 - 68
SIMONS, M., G. RAPOSO: 'Exosomes--vesicular carriers for intercellular communication' CURR OPIN CELL BIOL. vol. 21, 2009, pages 575 - 81
SLIVA, K., B.S. SCHNIERLE: 'Selective gene silencing by viral delivery of short hairpin RNA' VIROL J. vol. 7, page 248
SRIKANTAN, V., Z. ZOU, G. PETROVICS, L. XU, M. AUGUSTUS, L. DAVIS, J.R. LIVEZEY, T. CONNELL, I.A. SESTERHENN, K. YOSHINO: 'PCGEM1, a prostate-specific gene, is overexpressed in prostate cancer' PROC NATL ACAD SCI U S A. vol. 97, 2000, pages 12216 - 21
STEEMERS, F.J., W. CHANG, G. LEE, D.L. BARKER, R. SHEN, K.L. GUNDERSON: 'Whole-genome genotyping with the single-base extension assay' NAT METHODS vol. 3, 2006, pages 31 - 3
STOREY, J.D., R. TIBSHIRANI: 'Statistical methods for identifying differentially expressed genes in DNA microarrays' METHODS MOL BIOL. vol. 224, 2003, pages 149 - 57
TAFT, R.J., K.C. PANG, T.R. MERCER, M. DINGER, J.S. MATTICK: 'Non-coding RNAs: regulators of disease' J PATHOL. vol. 220, 2010, pages 126 - 39
TEZ, S., A. KOKTENER, G. GULER, P. OZISIK: 'Atypical teratoid/rhabdoid tumors: imaging findings of two cases and review of the literature' TURK NEUROSURG. vol. 18, 2008, pages 30 - 4
TING, D.T., D. LIPSON, S. PAUL, B.W. BRANNIGAN, S. AKHAVANFARD, E.J. COFFMAN, G. CONTINO, V. DESHPANDE, A.J. IAFRATE, S. LETOVSKY: 'Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers' SCIENCE vol. 331, 2011, pages 593 - 6
VALADKHAN, S.: 'Role of the snRNAs in spliceosomal active site' RNA BIOL. vol. 7, 2010, pages 345 - 53
VELCULESCU, V.E., L. ZHANG, B. VOGELSTEIN, K.W. KINZLER: 'Serial analysis of gene expression' SCIENCE vol. 270, 1995, pages 484 - 7
VOISSET, C., R.A. WEISS, D.J. GRIFFITHS: 'Human RNA ''rumor'' viruses: the search for novel human retroviruses in chronic disease' MICROBIOL MOL BIOL REV. vol. 72, 2008, pages 157 - 96
Attorney, Agent or Firm:
RESNICK, David S. et al. (Nixon Peabody LLP, 100 Summer St.Boston, Massachusetts, 02110-2131, US)
Download PDF:
Claims:
We claim:

1. A method for assaying a biological sample from a subject in aid of diagnosis, prognosis or monitoring of a disease or other medical condition in the subject, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with diagnosis, prognosis, status or stage of a disease or other medical condition, and wherein the genetic aberration is in or corresponds to:

i. a c-myc gene;

ii. a transposable element;

iii. a retrotransposon element;

iv. a satellite correlated gene;

v. a repeated DNA element;

vi. non-coding RNA other than miRNA; or

vii. a fragment of any of the foregoing.

2. The method of claim 1, wherein the genetic aberration is in or corresponds to a

transposable element listed in Table 4 or Table 5, or a fragment thereof.

3. The method of claim 1, wherein the genetic aberration is in or corresponds to a

retrotransposon element that is LINE, SINE or HERV, or a fragment thereof.

4. The method of claim 3, wherein the genetic aberration is in or corresponds to a

retrotransposon element that is Linel (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof.

5. The method of claim 1, wherein the genetic aberration is in or corresponds to a satellite correlated gene listed in Table 6, or a fragment thereof.

6. The method of claim 1, wherein the genetic aberration is in or corresponds to a repeated DNA element listed in Table 8, or a fragment thereof.

7. The method of claim 1, wherein the genetic aberration is in or corresponds to a non- coding RNA listed in Table 9 (or a fragment thereof), other than miRNA.

8. The method of claim 7, wherein the non-coding RNA is 7SL.

9. A method for assaying a biological sample from a subject in aid of directing treatment of the subject for a disease or other medical condition, comprising the steps of :

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition, and wherein the genetic aberration is in or corresponds to:

i. a c-myc gene;

ii. a transposable element;

iii. a retrotransposon element;

iv. a satellite correlated gene;

v. a repeated DNA element;

vi. non-coding RNA other than miRNA; or

vii. a fragment of any of the foregoing.

10. The method of claim 9, wherein the genetic aberration is in or corresponds to a

transposable element listed in Table 4 or Table 5, or a fragment thereof.

11. The method of claim 9, wherein the genetic aberration is in or corresponds to a

retrotransposon element that is LINE, SINE or HERV, or a fragment thereof.

12. The method of claim 11, wherein the genetic aberration is in or corresponds to a

retrotransposon element that is Linel (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof.

13. The method of claim 9, wherein the genetic aberration is in or corresponds to a satellite correlated gene listed in Table 6, or a fragment thereof.

14. The method of claim 9, wherein the genetic aberration is in or corresponds to a repeated DNA element listed in Table 8, or a fragment thereof.

15. The method of claim 9, wherein the genetic aberration is in or corresponds to a non- coding RNA listed in Table 9 (or a fragment thereof), other than miRNA.

16. The method of claim 15, wherein the non-coding RNA is 7SL.

17. A method for assaying a biological sample from a subject in aid of a determination of the subject's risk of developing a disease or other medical condition, comprising the steps of: a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid, wherein the biomarker is a genetic aberration associated with a determination of the subject's risk of developing a disease or other medical condition, and wherein the genetic aberration is in or corresponds to:

i. a c-myc gene;

ii. a transposable element;

iii. a retrotransposon element;

iv. a satellite correlated gene;

v. a repeated DNA element;

vi. non-coding RNA other than miRNA; or

vii. a fragment of any of the foregoing.

18. The method of claim 17, wherein the genetic aberration is in or corresponds to a

transposable element listed in Table 4 or Table 5, or a fragment thereof.

19. The method of claim 17, wherein the genetic aberration is in or corresponds to a

retrotransposon element that is LINE, SINE or HERV, or a fragment thereof.

20. The method of claim 19, wherein the genetic aberration is in or corresponds to a

retrotransposon element that is Linel (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof.

21. The method of claim 17, wherein the genetic aberration is in or corresponds to a satellite correlated gene listed in Table 6, or a fragment thereof.

22. The method of claim 17, wherein the genetic aberration is in or corresponds to a repeated DNA element listed in Table 8, or a fragment thereof.

23. The method of claim 17, wherein the genetic aberration is in or corresponds to a non- coding RNA listed in Table 9 (or a fragment thereof), other than miRNA.

24. The method of claim 23, wherein the non-coding RNA is 7SL.

25. A method for assaying a biological sample from a subject in aid of diagnosis, prognosis or monitoring of a disease or other medical condition in the subject, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with diagnosis, prognosis, status or stage of a disease or other medical condition, and wherein the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof.

26. A method for assaying a biological sample from a subject in aid of directing treatment of the subject for a disease or other medical condition, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition, and wherein the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof

27. A method for assaying a biological sample from a subject in aid of a determination of the subject's risk of developing a disease or other medical condition, comprising the steps of: a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with a determination of the subject's risk of developing a disease or other medical condition, and wherein the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof.

28. A method for assaying a biological sample from a subject in aid of diagnosis, prognosis or monitoring of a disease or other medical condition in the subject, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. measuring a polypeptide activity in the fraction; and

c. determining whether the polypeptide activity is higher or lower than a normal or average activity for the polypeptide;

wherein an elevated or lowered activity is associated with diagnosis, prognosis, status or stage of a disease or other medical condition.

29. The method of claim 28, wherein the polypeptide is an enzyme.

30. The method of claim 29, wherein the enzyme is reverse transcriptase.

31. The method of claim 30, wherein step (c) involves determining whether the reverse

transcriptase activity is higher than a normal or average activity for reverse transcriptase.

32. A method for assaying a biological sample from a subject in aid of directing treatment of the subject for a disease or other medical condition, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. measuring a polypeptide activity in the fraction; and

c. determining whether the polypeptide activity is higher or lower than a normal or average activity for the same polypeptide; wherein an elevated or lowered activity is associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition.

33. The method of claim 32, wherein the polypeptide is an enzyme.

34. The method of claim 33, wherein the enzyme is reverse transcriptase.

35. The method of claim 34, wherein step (c) involves determining whether the reverse

transcriptase activity is higher than a normal or average activity for reverse transcriptase.

36. A method for assaying a biological sample from a subject in aid of a determination of the subject's risk of developing a disease or other medical condition, comprising the steps of: a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. measuring a polypeptide activity in the fraction; and

c. determining whether the polypeptide activity is higher or lower than a normal or average activity for the same polypeptide;

wherein an elevated or lowered activity is associated with a subject's risk of developing a disease or other medical condition.

37. The method of claim 36, wherein the polypeptide is an enzyme.

38. The method of claim 37, wherein the enzyme is reverse transcriptase.

39. The method of claim 38, wherein step (c) involves determining whether the reverse

transcriptase activity is higher than a normal or average activity for reverse transcriptase.

40. The method of any of claims 1-27, wherein the genetic aberration is:

a. a species of nucleic acid;

b. the level of expression of a nucleic acid;

c. a nucleic acid variant; or

d. a combination of any of the foregoing.

41. The method of any of claims 1-27, wherein the nucleic acid is RNA and the genetic

aberration is an expression profile.

42. The method of any of claims 1-27, wherein the fragment contains more than 10 nucleotides.

43. The method of any of claims 1-39, wherein the biological sample is a bodily fluid.

44. The method of claim 43, wherein the bodily fluid is blood, serum, plasma, or urine.

45. The method of any of claims 1-39, wherein the subject is a human subject.

46. The method of claim 45, wherein the disease or other medical condition is brain cancer.

47. The method of claim 46, wherein the brain cancer is medulloblastoma or glioblastoma.

48. The method of claim 45, wherein the disease or other medical condition is melanoma.

49. The method of any of claims 1-27, wherein the step of detecting the presence or absence of a biomarker in the extracted nucleic acid comprises microarray analysis, PCR, quantitative PCR, Digital Gene Expression, or direct sequencing.

50. The method of any of claims 1-39, further comprising the step of enriching the

microvesicle fraction for microvesicles originating from a specific cell type.

51. A kit for genetic analysis of a microvesicle fraction obtained from a body fluid sample from a subject, comprising, in a suitable container, one or more reagents capable of hybridizing to or amplifying a nucleic acid corresponding to one or more of the genetic aberrations referenced in any of claims 1-27.

52. An oligonucleotide microarray for genetic analysis of a microvesicle preparation from a body fluid sample from a subject, wherein the oligonucleotides on the array are designed to hybridize to one or more nucleic acids corresponding to one or more of the genetic aberrations referenced in any of claims 1-27.

53. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a

subject, wherein the profile comprises a genetic aberration in or corresponding to a cancer gene listed in Table 2 or 3, or a fragment thereof.

54. The profile of claim 53, wherein the cancer gene is a c-myc gene.

55. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to transposable element from the subject's genome, preferably an element listed in Table 4 or 5, or a fragment of any of the foregoing.

56. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a

subject, wherein the profile comprises a genetic aberration in or corresponding to a retrotransposon element from the subject's genome, preferably LINE, SINE or HERV, more preferably LINE1 (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment of any of the foregoing.

57. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a

subject, wherein the profile comprises a genetic aberration in or corresponding to a satellite correlated gene from the subject's genome, preferably a satellite correlated gene listed in Table 6, or a fragment of any of the foregoing.

58. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a

subject, wherein the profile comprises a genetic aberration in or corresponding to an element of repeated DNA from the subject's genome, preferably an element listed in Table 8, or a fragment of any of the foregoing.

59. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a

subject, wherein the profile comprises a genetic aberration in or corresponding to non- coding RNA other than miRNA, preferably a species listed in Table 9, or a fragment of any of the foregoing.

60. The profile of claim 59, wherein the non-coding RNA is 7SL.

61. The profile of any of claims 53-60, wherein the genetic aberration is:

a. a species of nucleic acid;

b. the level of expression of a nucleic acid;

c. a nucleic acid variant; or

d. a combination of any of the foregoing.

62. A method of identifying a potential new nucleic acid biomarker associated with a disease or other medical condition, status or stage of disease or other medical condition, a subject's risk of developing a disease or other medical condition, or a subject's responsiveness to a specific therapy for a disease or other medical condition, comprising the steps of:

(a) obtaining or using a microvesicle fraction from a biological sample from a subject;

(b) extracting nucleic acid from the fraction;

(c) preparing a profile according to any of claims 53-60; and

(d) comparing the profile of step (c) to a control or reference profile and selecting one or more potential new biomarkers based on one or more differences between the profile of step (c) and the control or reference profile.

63. A method of treating a subject having a form of cancer in which cancer cells secrete

microvesicles, the method comprising administering to the subject a therapeutically effective amount of a composition comprising:

a. an inhibitor of microvesicle secretion;

b. an inhibitor of a reverse transcriptase;

c. a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles; or

d. any combination of the forgoing.

64. The method of claim 63, wherein the inhibitor of microvesicle secretion is an inhibitor of RAB GTPase.

65. The method of claim 64, where in the Rab GTPase is Rab 27a, Rab 27b or Rab 35.

66. The method of claim 63, wherein the inhibitor of a reverse transcriptase is a nucleoside analog selected from the group comprising 3'-azido2',3'-dideoxythymidine (AZT), 2',3'- dideoxyinosine (ddl), 2', 3 '-didehyro-3 '-deoxythymidine (d4T), nevirapine and efavirenz.

67. The method of claim 63, wherein the inhibitor of a reverse transcriptase is RNAi targeting the reverse transcriptase gene.

68. The method of claim 63, wherein the microvesicle neutralizer is a biological agent that binds microvesicles and destroys the integrity of the microvesicles. A pharmaceutical composition comprising, in a suitable pharmaceutical carrier: (a) an inhibitor of microvesicle secretion, particularly an inhibitor of RAB GTPase, and more particularly Rab 27a, Rab 27b or Rab 35); (b) an inhibitor of reverse transcriptase, particularly a nucleoside analog, more particularly 3'-azido2',3'-dideoxythymidine (AZT), 2',3'-dideoxyinosine (ddl), 2',3'-didehyro-3'-deoxythymidine (d4T), nevirapine, or efavirenz, or an RNAi targeting the reverse transcriptase gene; (c) a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles, particularly a biological agent that binds microvesicles and destroys the integrity of the microvesicles; or (d) a combination of any of the foregoing.

Description:
CANCER-RELATED BIOLOGICAL MATERIALS IN MICRO VESICLES

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of 35 U.S.C. § 119(e) to U.S. Provisional

Application serial numbers 61/378,860 filed August 31, 2010; 61/421,421 filed December 9, 2010; 61/437,547 filed January 28, 2011; 61/438,199 filed January 31, 2011; and 61/493,261 filed June 03, 2011, the contents of each of which are incorporated herein by reference in their entirety.

GOVERNMENT SUPPORT

[0002] This invention was made with Government support under grants CA86355,

CA69246, CA141226, and CA141150 awarded by National Cancer Institute. The

Government has certain rights in the invention.

FIELD OF INVENTION

[0003] The present invention relates to the fields of biomarker analysis, diagnosis, prognosis, patient monitoring, therapy selection, risk assessment, and novel therapeutic agents for human or other animal subjects, particularly the profiling of biological materials from a microvesicle fraction of a biological sample, and novel therapies related to micro vesicles.

BACKGROUND OF THE INVENTION

[0004] Increasing knowledge of the genetic and epigenetic changes occurring in cancer cells provides an opportunity to detect, characterize, and monitor tumors by analysing tumor-related nucleic acid sequences and profiles. Cancer-related changes include specific mutations in gene sequences (Cortez and Calin, 2009; Diehl et al., 2008; Network, 2008; Parsons et al., 2008), up- and down-regulation of mRNA and miRNA expression (Cortez and Calin, 2009; Itadani et al., 2008; Novakova et al., 2009), mRNA splicing variations, changes in DNA methylation patterns (Cadieux et al., 2006; Kristensen and Hansen, 2009), amplification and deletion of genomic regions (Cowell and Lo, 2009), and aberrant expression of repeated DNA sequences (Ting et al., 2011). Various molecular diagnostic tests such as mutational analysis, methylation status of genomic DNA, and gene expression analysis may detect these changes.

[0005] Research uncovering the molecular mechanisms underlying cancer improves our understanding of how to select and design optimal treatment regimes for a patient' s disease based on the molecular makeup of his or her particular cancer. Over the past few years, this has led to a significant increase in the development of therapies specifically targeting gene mutations involved in disease progression. In parallel, the use of molecular diagnostic testing for cancer diagnosis, prognosis and treatment selection has expanded, driven by the need for more cost efficient applications of expensive therapies. Current molecular diagnostics has so far almost exclusively relied on assaying cancer cells from tissue biopsy by needle aspiration or surgical resection.

[0006] However, the ability to perform these tests using a blood sample is sometimes more desirable than using a tissue sample from a cancer patient because, frequently, fresh tissue samples are difficult or impossible to obtain, and archival tissue samples are often less relevant to the current status of the patient's disease. A less invasive approach using a more easily accessible biological sample, e.g., a blood sample, has wide ranging implications in terms of patient welfare, the ability to conduct longitudinal disease monitoring, and the ability to obtain expression profiles even when tissue cells are not easily accessible, e.g., in ovarian or brain cancer patients.

[0007] Currently, gene expression profiling of blood samples involves the analysis of

RNA extracted from peripheral blood mononuclear cells (PBMC) (Hakonarson et al., 2005) or circulating tumor cells (CTC) (Cristofanilli and Mendelsohn, 2006).

[0008] Many types of cancer cells release an abundance of small membrane-bound vesicles, which have been observed on their surface in culture (Skog et al., 2008). These microvesicles are generated and released through several processes and vary in size (from about 30 nm to about 1 μπι in diameter) and content (Simons and Raposo, 2009).

Microvesicles can bud/bleb off the plasma membrane of cells, much like retrovirus particles (Booth et al., 2006), be released by fusion of endosomal-derived multivesicular bodies with the plasma membrane (Lakkaraju and Rodriguez-Boulan, 2008), or be formed as apoptotic bodies during programmed cell death (Halicka et al., 2000). In addition, defective (i.e., noninfectious without helper-virus) retrovirus particles derived from human endogenous retroviral (HERV) elements may be found within microvesicle populations (Voisset et al.,

2008).

[0009] Microvesicles from various cell sources have been studied with respect to protein and lipid content (Iero et al., 2008; Thery et al., 2002; Wieckowski and Whiteside, 2006). They have also been observed to contain cellular RNAs and mitochondria DNA (Baj- Krzyworzeka et al., 2006; Guescini et al.; Skog et al., 2008; Valadi et al., 2007) and may facilitate the transfer of genetic information between cells and/or act as a "release hatch" for DNA, RNA, and/or proteins that the cell is trying to eliminate. Both mRNA and miRNA in microvesicles are observed to be functional following uptake by recipient cells (Burghoff et al., 2008; Deregibus et al., 2007; Ratajczak et al., 2006; Skog et al., 2008; Valadi et al., 2007; Yuan et al., 2009) and it has also been shown that apoptotic bodies can mediate horizontal gene transfer between cells (Bergsmedh et al., 2001).

[0010] Knowing the expression profile, mutational profile, or both expression and mutational profiles of individual cancer is helpful for personalized medicine as many drugs target specific pathways affected by the genetic status of the tumors. Detection of genetic biomarkers in blood samples from tumor patients is challenging due to the need for high sensitivity against a background of normal cellular nucleic acids found circulating in blood. Microvesicles released by tumor cells into the circulation can provide a window into the genetic status of individual tumors (Skog et al., 2008).

[0011] The present invention is directed to microvesicular nucleic acid profiles of microvesicle fractions obtained from a biological sample from a subject, methods for aiding in diagnosis, prognosis, patient monitoring, treatment selection, and risk assessment based on detecting the presence or absence of a genetic aberration in a nucleic acid profile, or changes in a polypeptide profile of a microvesicle fraction obtained from a biological sample from a patient, and therapeutic agents and methods of cancer treatment or prevention.

SUMMARY OF THE INVENTION

[0012] The present invention is based on the discovery of various types of cancer- related biological materials within microvesicles. The biological materials within microvesicles from a biological sample may be characterized and measured, and the results this analysis may be used to aid in biomarker discovery, as well as in diagnosis, prognosis, monitoring, treatment selection, or risk assessment for a disease or other medical condition.

[0013] In one aspect, the biological materials are nucleic acids and the invention is a method for assaying a biological sample comprising the steps of: a) obtaining or using a microvesicle fraction from a biological sample from a subject; b) extracting nucleic acid from the fraction; and c) detecting the presence or absence of a biomarker in the extracted nucleic acid. In a method for aiding in the diagnosis, prognosis or monitoring of a subject, the biomarker is a genetic aberration that is associated with the diagnosis, prognosis, or determination of the status or stage of a disease or other medical condition in the subject. In a method for aiding in treatment selection for a subject in need of or potentially in need of therapeutic treatment, the biomarker is a genetic aberration that is associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition in the subject. In a method for aiding in a determination of a subject's risk of developing a disease or other medical condition, the biomarker is a genetic aberration that is associated with the subject's risk of developing a disease or other medical condition.

[0014] In some embodiments of the above methods, the genetic aberration is in or corresponds to a c-myc gene, a transposable element, a retrotransposon element, a satellite correlated gene, a repeated DNA element, a non-coding RNA other than miRNA, or a fragment of any of the foregoing.

[0015] In other embodiments of the above methods, the genetic aberration is in or corresponds to a transposable element listed in Table 4 or Table 5, or a fragment thereof. For one example, the genetic aberration is in or corresponds to retrotransposon elements including LINE, SINE or HERV, or a fragment thereof. For another example, the genetic aberration is in or corresponds to a retrotransposon element that is Linel (LI), ALU, HERV- H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof.

[0016] In further embodiments of the above methods, the genetic aberration is in or corresponds to a satellite-correlated gene listed in Table 6, or a fragment thereof; a repeated DNA element listed in Table 8, or a fragment thereof; or a non-coding RNA listed in Table 9 (other than miRNA) or a fragment thereof. The non-coding RNA, for example, can be 7SL RNA.

[0017] In yet further embodiments of the above methods, the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof. [0018] In another aspect, the biological material is protein or polypeptide and the invention is a method for assaying a biological sample from a subject comprising the steps of: a) obtaining or using a microvesicle fraction from a biological sample from a subject b) measuring a protein or polypeptide activity in the fraction; and c) determining whether the protein or polypeptide activity is higher or lower than a normal or average activity for the same protein or polypeptide. In a method for aiding in the diagnosis, prognosis or monitoring of a subject, an elevated or lowered activity is associated with a diagnosis, prognosis, status or stage of a disease or other medical condition in the subject. In a method for aiding in directing treatment of a subject, an elevated or lowered activity is associated with a disease or other medical condition or with the subject's responsiveness to a specific therapy for the disease or other medical condition. In a method in aid of a determination of a subject's risk of developing a disease or other medical condition, an elevated or lowered activity is associated with the subject's risk of developing a disease or other medical condition. In some embodiments of the foregoing methods, the polypeptide is an enzyme. For example, the polypeptide can be a reverse transcriptase and the method is to determine whether the reverse transcriptase activity is higher than a normal or average activity for reverse transcriptase.

[0019] In the present invention, the methods may further comprise a step of enriching the microvesicle fraction for microvesicles originating from a specific cell type. The enrichment may be achieved, for example, by affinity purification with antibody-coated magnetic beads.

[0020] In the present invention, the biological sample from a subject can be a bodily fluid, e.g., blood, serum, plasma, or urine. The subject can be a human subject. When the subject is a human, the disease or other medical condition may be brain cancer such as medulloblastoma and glioblastoma, or melanoma.

[0021] In the present invention, the presence or absence of a biomarker in the extracted nucleic acid can be determined by various techniques, e.g., microarray analysis, PCR, quantitative PCR, Digital Gene Expression, or direct sequencing.

[0022] In yet another aspect, the present invention is a kit for genetic analysis of a microvesicle fraction obtained from a body fluid sample from a subject, comprising, in a suitable container, one or more reagents capable of hybridizing to or amplifying a nucleic acid corresponding to one or more of the genetic aberrations referenced above.

[0023] In yet another aspect, the present invention is an oligonucleotide microarray for genetic analysis of a microvesicle preparation from a body fluid sample from a subject, wherein the oligonucleotides on the array are designed to hybridize to one or more nucleic acids corresponding to one or more of the genetic aberrations referenced above.

[0024] In yet another aspect, the present invention is a profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject. The profile may be a genetic aberration in or corresponding to: a) cancer gene listed in Table 2 or 3, or a fragment thereof; b) a transposable element from the subject's genome, preferably an element listed in Table 4 or 5, or a fragment of any of the foregoing; c) a retrotransposon element from the subject's genome, preferably LINE, SINE or HERV, more preferably LINE1 (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment of any of the foregoing; d) a satellite correlated gene from the subject's genome, preferably a satellite correlated gene listed in Table 6, or a fragment of any of the foregoing; e) an element of repeated DNA from the subject's genome, preferably an element listed in Table 8, or a fragment of any of the foregoing; or f) a non-coding RNA other than miRNA, preferably a species listed in Table 9, or a fragment of any of the foregoing. In one embodiment, the profile is a genetic aberration in the cancer gene c-myc. In another embodiment, the profile is a genetic aberration in the non-coding 7SL RNA.

[0025] In all of the foregoing nucleic acid-related embodiments of the invention, the genetic aberration can be a species of nucleic acid, the level of expression of a nucleic acid, a nucleic acid variant; or a combination of any of the foregoing. For example, the genetic aberration may be an RNA expression profile. For another example, the genetic aberration may be a fragment of a nucleic acid, and in some instances, the fragment contains more than 10 nucleotides.

[0026] In yet another aspect, the present invention is a method of identifying a potential new nucleic acid biomarker associated with a disease or other medical condition, status or stage of disease or other medical condition, a subject's risk of developing a disease or other medical condition, or a subject's responsiveness to a specific therapy for a disease or other medical condition. The method comprises the steps of: a) obtaining or using a microvesicle fraction from a biological sample from a subject; b) extracting nucleic acid from the fraction; c) preparing a profile according to any of the above-described profiles; and d) comparing the profile of step c) to a control or reference profile and selecting one or more potential new biomarkers based on one or more differences between the profile of step c) and the control or reference profile.

[0027] In yet anther aspect, the present invention is a method of treating a subject having a form of cancer in which cancer cells secrete micro vesicles. The method comprises administering to the subject a therapeutically effective amount of a composition including an inhibitor of microvesicle secretion; an inhibitor of a reverse transcriptase; a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor micro vesicles; or any combination of the forgoing. In some embodiments, the inhibitor of microvesicle secretion is an inhibitor of RAB GTPase which may be Rab 27a, Rab 27b or Rab 35. In other embodiments, the inhibitor of a reverse transcriptase is a nucleoside analog selected from the group comprising 3'-azido2',3'-dideoxythymidine (AZT); 2',3'-dideoxyinosine (ddl), 2', 3'- didehyro-3'-deoxythymidine (d4T); nevirapine and efavirenz. In further embodiments, the inhibitor of a reverse transcriptase is RNAi targeting the reverse transcriptase gene. In still further embodiments, the microvesicle neutralizer is a biological agent that binds

microvesicles and destroys the integrity of the microvesicles.

[0028] In yet another aspect, the present invention is a pharmaceutical composition comprising, in a suitable pharmaceutical carrier: a) an inhibitor of microvesicle secretion, particularly an inhibitor of RAB GTPase, and more particularly Rab 27a, Rab 27b or Rab 35); b) an inhibitor of reverse transcriptase, particularly a nucleoside analog, more particularly 3'-azido2',3'-dideoxythymidine (AZT); 2',3'-dideoxyinosine (ddl), 2',3'- didehyro-3'-deoxythymidine (d4T); nevirapine, or efavirenz, or an RNAi targeting the reverse transcriptase gene; c) a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles, particularly a biological agent that binds microvesicles and destroys the integrity of the microvesicles; or d) a combination of any of the foregoing.

BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the meduUoblastoma cell line D384. Each bar represents the number of particles of a certain size that are present in the media and are released by one cell over 48 hours (hrs). The sum refers to the total number of particles released by one cell over 48 hrs. ExoRNA refers to the total RNA yield in microvesicles from 1 x 10 6 cells over 48 hrs. The result is presented as the mean + SEM (n=3).

[0030] Figure 2 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the meduUoblastoma cell line D425 in the same manner as in Figure 1.

[0031] Figure 3 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the meduUoblastoma cell line D458 in the same manner as in Figure 1.

[0032] Figure 4 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the melanoma cell line Yumel 0106 in the same manner as in Figure 1.

[0033] Figure 5 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the glioblastoma cell line 20/3 in the same manner as in Figure 1.

[0034] Figure 6 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the glioblastoma cell line 11/5 in the same manner as in Figure 1.

[0035] Figure 7 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the normal fibroblast cell line HF19 in the same manner as in Figure 1. [0036] Figure 8 shows a graph depicting the quantification, size distribution and RNA yield of microvesicles purified from the normal fibroblast cell line HF27 in the same manner as in Figure 1.

[0037] Figure 9 shows a graph depicting the c-Myc gene yields in terms of genomic

DNA extracted from cells of the following cell lines: one normal human fibroblast line (HF19), one GBM line (11/5), one atypical teratoid rhabdoid tumor (AT/RT) line (NS224) and three meduUoblastoma (MB) lines (D425, D458 and D384). Quantitative PCR was used to obtain c-Myc Ct values, which were normalized to GAPDH Ct values in the same preparation. The X-axis lists the names of the cell lines tested. The Y-axis is the fold change, represented as the ratio of the Ct value for each cell line to the Ct value for the normal fibroblast cell line HF19. In all cases, the Ct values are expressed as mean + SEM (n=3) and analyzed by a two-tailed t-test.

[0038] Figure 10 shows a graph depicting the c-Myc gene yields in terms of RNA extracted from microvesicles secreted by cells of the same cell lines and in the same manner as in Figure 9. Quantitative Reverse Transcription PCR was used to obtain c-Myc RNA Ct values.

[0039] Figure 11 shows a graph depicting the c-Myc gene yields in terms of DNA extracted from microvesicles secreted by cells of the same cell lines and in the same manner as in Figure 9. Quantitative PCR was used to obtain c-Myc DNA Ct values.

[0040] Figure 12 shows a graph depicting the c-Myc gene yields in terms of RNA extracted from xenograft subcutaneous tumor cells. The subcutaneous tumors were generated by xenografting meduUoblastoma cells (MBT; D425 cell line) or epidermoid carcinoma (ECT; A431 cell line) cells in nude mice. The X-axis refers to the different tumor-bearing mice characterized by the type of tumor cell and the tumor mass weight at sacrifice. MBT tumor mass weights are as follows: MBT 1: 3.4 g; MBT 2: 1.7 g; MBT 3: 2.4 g; MBT 4: 2.9 g; and MBT 5: 1.7 g. ECT tumor mass weights are as follows: ECT 1: 1.7 g; ECT 2: 2.3 g; ECT 3: 3.1 g; ECT 4: 1.9 g; and ECT 5: 2.2 g. Ct values were normalized to GAPDH. The Y-axis refers to the Ct values generated by quantitative reverse transcription PCR of the extracted RNA in each sample. For each RNA extract, two replicate qPCR were performed.

[0041] Figure 13 shows a gel picture depicting the c-Myc gene yields in terms of

RNA extracted from serum micro vesicles from mice that bear subcutaneous tumors. The subcutaneous tumors were generated by xenografting medulloblastoma cells (MBT; D425 cell line) in nude mice. C-Myc product was amplified by reverse transcription PCR method using human c-Myc specific primers and the RNA extracted from serum microvesicles as templates. The amplified c-Myc product should be 89 bp in length. The amplified c-Myc products were resolved by electrophoresis in a 2% agarose gel and visualized with ethidium bromide staining. The arrow points to the position where an 89bp product appears on the agarose gel. The lanes are referenced as follows: MW: DNA size marker; 1: MBT tumor mass weight of 3.4 g; 2: MBT tumor mass weight of 1.7 g; 3: MBT tumor mass weight of 2.4 g; 4: MBT tumor mass weight of 2.9 g; 5: MBT tumor mass weight of 1.7 g; NC: negative control where no RNA/cDNA was used.

[0042] Figure 14 shows a gel picture depicting the c-Myc gene yields in terms of

RNA extracted from serum microvesicles from mice that bear subcutaneous tumors in the same manner as in Figure 13 except that the subcutaneous tumors were generated by xenografting epidermoid carcinoma (ECT; A431 cell line) in nude mice. The lanes are referenced as follows: MW: DNA size marker; 1: ECT tumor mass weight of 1.7 g; 2: ECT tumor mass weight of 2.3 g; 3: ECT tumor mass weight of 3.1 g; 4: ECT tumor mass weight of 1.9 g; 5: ECT tumor mass weight of 2.2 g; NC: negative control where no RNA/cDNA was used.

[0043] Figure 15 shows a MA plot depicting relative levels of all represented RNA sequences (using 44,000 RNA probes on the Agilent microarray chip) in cells and

microvesicles derived from the cells. The levels of transposon and retrotransposon sequences were compared to the rest of the RNA transcriptome in cells and microvesicles. ExoRNA and cellular RNA were isolated from GBM 20/3 cells and analyzed on an Agilent two-color 44k array. Y-axis (M) = log 2 Exo - log 2 Cell, X-axis (A) = 0.5 x (log 2 Exo + log 2 Cell).

[0044] Figure 16 shows a MA plot similar to the plot in Figure 15 except that the present plot only depicts relative levels of the following four HERV family sequences:

HERV-H, HERV-K6, HERV-W and HERV-C, all of which are enriched in microvesicles more than 16-fold as compared to the host cells, i.e., M>4.

[0045] Figure 17 shows a MA plot similar to the plot in Figure 15 except that the present plot only depicts relative levels of DNA transposons.

[0046] Figure 18 shows a MA plot similar to the plot in Figure 15 except that the present plot only depicts relative levels of LI sequences.

[0047] Figure 19 shows a MA plot similar to the plot in Figure 15 except that the present plot only depicts relative levels of HERV sequences with HERV-H, HERV-C, HERV-K6 and HERV-W being more than 16 fold enriched.

[0048] Figure 20 shows a MA plot similar to the plot in Figure 15 except that the present plot only depicts relative levels of Alu sequences. [0049] Figures 21A, 21B and 21C show MA plots depicting relative expression levels of LI (Figure 21A), ALU (Figure 21B) and HERV-K (Figure 21C) RNA in cells and microvesicles derived from the cells. qRT-PCR was carried out for retrotransposon elements in cell RNA and exoRNA from three meduUoblastoma (D425, D384 and D458), one GBM (11/5), one melanoma (0106) and one human fibroblast (HF19) line. The RNA expression levels were measured and normalized to GAPDH. HERV-K RNA was not detectable in exoRNA from normal human fibroblasts (HF19), so it was given a Ct value of 36 (below detection limit).

[0050] Figure 22 shows a chart depicting the expression levels of HERV-K at different time points in HUVEC cells. The HUVEC cells were exposed to meduUoblastoma D384 microvesicles and their expression level of HERV-K RNA was analyzed by qRT-PCR over 72 hrs following exposure. MOCK is non-exposed cells. HERV-K was normalized to GAPDH. P values were calculated using the two-tailed t-test, comparing levels to MOCK infected cells.

[0051] Figures 23A, 23B and 23C show MA plots depicting relative levels of LI

(Figure 23A), ALU (Figure 23B) and HERV-K (Figure 23C) DNA in cells and microvesicles derived from the cells. q-PCR was carried out for retrotransposon elements with cell genomic DNA and microvesicle DNA from three meduUoblastoma (D425, D384 and D458), one GBM (11/5), one melanoma (0106) and one human fibroblast (HF19) line. The DNA levels were measured and normalized to GAPDH. Results are expressed as average +SEM (n=3).

[0052] Figure 24 shows a chart depicting the Reverse Transcriptase (RT) activity in microvesicles secreted by three meduUoblastoma (D425, D384 and D458), one GBM (11/5), one melanoma (0106) and one human fibroblast (HF19) line. The RT activity was measured in the micro vesicles using the EnzChek RT Assay Kit (Invitrogen) and normalized to protein content. The RT activity is measured as RT units calculated based on the standard curve generated using Superscript III (Invitrogen). Results are expressed as average +SEM (n=3).

[0053] Figures 25A, 25B, 25C and 25D show charts depicting Bioanalyzer profiles of exoRNA and exoDNA from tumor or normal cell. Figure 25A depicts the profile of exoRNA from GBM 11/5 cells. Both 18S and 28S rRNA peaks are detectable (arrowheads). Figure 25B depicts the profile of exoDNA GBM 11/5 cells. Sizes ranged from 25 to 1000 nucleotides with a peak at 200 nt. Figure 25C depicts the profile of ExoRNA from human fibroblasts HF19, which was extracted and analyzed as in Figure 25 A. The RNA yield was too low to yield distinct 18S and 28S rRNA peaks. After concentration, these peaks were visible (data not shown). Figure 25D depicts the profile of ExoDNA from human fibroblasts HF19, which was not readily detectable on the Bioanalyzer even after it was concentrated 30 times. Bioanalyzer profiles were generated using the RNA Pico Chip (Agilent).

[0054] Figures 26A and 26B show charts depicting the Bioanalyzer profiles of exoDNA from micro vesicles isolated from medulloblastoma D384 cells. Figure 26 A depicts the profile of exoDNA purified from externally DNase-treated microvesicles using the Agilent DNA 7500 bioanalyzer chip (Agilent Technologies Inc., Santa Clara, CA. Cat.

Number 5067-1506) that detects dsDNA. Figure 26B depicts the profile of exoDNA after a second-strand synthesis treatment. Here the same sample as in (A) was subjected to second strand synthesis with Superscript Double-Stranded cDNA synthesis kit (Invitrogen) according to manufacturer's recommendation.

[0055] Figure 27 is an agarose gel picture depicting electrophoresis of GAPDH

(112bp) PCR products using templates from different samples. The different samples were exoDNA samples extracted from microvesicles isolated from three medulloblastoma cell lines (D425, D384 and D556) and genomic DNA extracted from L2132 normal fibroblasts as a control double stranded DNA, all four of which were mock treated or treated with SI nuclease enzyme which degrades single-stranded nucleic acids.

[0056] Figure 28 depicts representative bioanalyzer profiles of exoDNA extracted from medulloblastoma cell line D384 before and after SI nuclease treatment.

[0057] Figures 29A and 29B show charts depicting quantitative PCR results of c-Myc and POU5F1B, respectively, using as templates genomic DNA from cells or exoDNA extracted from microvesicles isolated from cells. Figure 29 A depicts the results for c-Myc gene. Figure 29B depicts the results for POU5F1B, which gene sequence (AF268618) is found 319 kb upstream of the c-Myc gene in the genome, but still within the commonly amplified region in tumor cells. The cell lines are medulloblastoma cell lines D458 and D384, glioblastomas (11/5), and fibroblasts HF19.

[0058] Figure 30 illustrates the c-Myc copy number analysis results in tumor cell lines using an Affymetrix 250K SNP array. The c-Myc genomic region was analyzed in medulloblastoma lines, D425, D458 and D384, as well as rhabdoid tumor line, NS224.

[0059] Figures 31 A and 3 IB show charts depicting the qPCR results of the n-Myc gene in cells lines medulloblastoma D425, D458 and D384, rhabdoid tumor, GBM, and normal fibroblasts using genomic DNA Figure 31 A or exoDNA Figure 3 IB extracted from microvesicles isolated from the cells as templates.

[0060] Figure 32 shows a chart depicting the amount of exoDNA extracted from microvesicles isolated from medulloblastoma D384 cell culture media. D384 cells were seeded in 6-well plates and treated with increasing dosages of L-mimosine (200, 400 and 600 μΜ) or mock treated. Microvesicles were isolated from the medium after 48 hrs and ssDNA was extracted using the Qiagen PCR purification kit. Single- stranded DNA yields were quantified using the Bioanalyzer and the yields were compared to mock treated cells

(normalized to 1.0).

[0061] Figure 33 depicts the results of quantitative RT-PCR analysis of the expression levels of 7SL RNA, EGFR and GAPDH in microvesicles isolated from serum samples obtained from a GBM patient or a normal individual. The X-axis is the number of PCR cycles. The Y-axis is the fluorescent intensity (delta Rn) measured by the AB 17500 machine.

[0062] Figure 34 depicts a series of signaling pathways related to cell proliferation, growth and/or survival.

DETAILED DESCRIPTION OF THE INVENTION

[0063] As described above, cell-derived vesicles are heterogeneous in size with diameters ranging from about 10 nm to about 1 μπι. For example, "exosomes" have diameters of approximately 30 to 100 nm, with shedding microvesicles and apoptotic bodies often described as larger (Orozco and Lewis, 2010). Exosomes, shedding microvesicles, microparticles, nanovesicles, apoptotic bodies, nanoparticles and membrane vesicles co- isolate using various techniques and will, therefore, collectively be referred to throughout this specification as "microvesicles" unless otherwise expressly denoted.

[0064] The present invention is based on the discovery that cancer-related biological materials such as transposable elements, oncogenes, and reverse transcriptase (RT) can be detected in microvesicles.

[0065] The biological materials in microvesicles can be genetic materials, protein materials, lipid materials, or any combination of genetic, protein and lipid materials. [0066] Genetic materials include nucleic acids, which can be DNA and its variations, e.g., double- stranded DNA ("dsDNA"), single- stranded DNA ("ssDNA"), genomic DNA, cDNA; RNA and its variations, e.g., mRNA, rRNA, tRNA, microRNA, siRNA, piwi-RNA, coding RNA, non-coding RNA, transposons, satellite repeats, minisatellite repeats, micro satellite repeats, Interspersed repeats such as short interspersed nuclear elements (SINES), e.g. but not limited to Alus, and long interspersed nuclear elements (LINES), e.g. but not limited to LINE-1, human endogenous retroviruses (HERVs), e.g. but not limited to HERV-K; or any combination of any of the above DNA and RNA species.

[0067] Protein materials can be any polypeptides and polypeptide variants recognized in the art. For convenience, "polypeptide" as disclosed in this application refers to both a polypeptide without modifications and a polypeptide variant with modifications.

Polypeptides are composed of a chain of amino acids encoded by genetic materials as is well known in the art. For example, a reverse transcriptase is a polypeptide that can function as an enzyme to transcribe RNA into DNA. Polypeptide variants can include, e.g. polypeptides modified by acylation, ubiquitination, SUMOYlation, alkylation, amidation, glycosylation, hydroxylation, carboxylation, phosphorylations, oxidation, sulfation, selenoylation, nitrosylation, or glutathionylation.

[0068] Lipid materials include fats, waxes, sterols, fat-soluble vitamins (such as vitamins A, D, E and K), monoglycerides, diglycerides, phospholipids, fatty acids, glycerolipids, glycerophospholipids, sphingolipids, sterol lipids, prenol lipids, saccharolipids, and polyketides.

[0069] Microvesicles may be isolated from tissue, cells or other biological samples from a subject. For example, the biological sample may be a bodily fluid from the subject, preferably collected from a peripheral location. Bodily fluids include but are not limited to blood, plasma, serum, urine, sputum, spinal fluid, pleural fluid, nipple aspirates, lymph fluid, fluid of the respiratory, intestinal, and genitourinary tracts, tear fluid, saliva, breast milk, fluid from the lymphatic system, semen, cerebrospinal fluid, intra-organ system fluid, ascitic fluid, tumor cyst fluid, amniotic fluid and combinations thereof. In some embodiments, the preferred bodily fluid for use as the biological sample is urine. In other embodiments, the preferred bodily fluid is serum.

[0070] The term "subject" is intended to include all animals shown to or expected to harbor nucleic acid-containing microvesicles. In particular embodiments, the subject is a mammal, e.g., a human or nonhuman primate, a dog, cat, horse, cow, other farm animal, or rodent (e.g. a mouse, rat, guinea pig, etc.). In one embodiment, the subject is an avian, amphibian or fish. The terms "subject," "individual" and "patient" are used interchangeably herein.

[0071] Methods for isolating microvesicles from a biological sample and extracting biological materials from the isolated microvesicles are described in this application as well as in scientific publications and patent applications, e.g. (Chen et al., 2010; Miranda et al., 2010; Skog et al., 2008). See also WO 2009/100029, WO 2011/009104, WO 2011/031892 and WO 2011/031877. These publications are incorporated herein by reference for their disclosure pertaining to isolation and extraction methods and techniques.

[0072] A profile, as used herein, refers to a set of data or a collection of

characteristics or features, which can be determined through the quantitative or qualitative analysis of one or more biological materials, particularly biological materials contained in microvesicles isolated from a subject. The biological materials, extraction of the biological materials, and various types of analysis of the biological materials are described herein. A control or reference profile is a profile obtained from the literature, from an independent subject or subjects, or from the same subject at a different time point. [0073] In one aspect, the present invention includes a profile of one or more nucleic acids extracted from micro vesicles. The nucleic acids include both RNA and DNA. A nucleic acid profile may be an RNA profile, a DNA profile, or may include profiles of both RNA and DNA. In other aspects, the present invention includes a profile of one or more protein or polypeptide species extracted from micro vesicles, particularly, a level of protein activity.

[0074] In all of the various aspects of the invention described herein in relation to

RNA, the RNA can be coding RNA, e.g., messenger RNA. The RNA can also be non-coding RNA (ncRNA), e.g., ribosomal RNA (rRNA), transfer RNA (tRNA), microRNA, and other non-coding transcripts that may originate from genomic DNA. See Table 9 for more examples of non-coding RNA. Non-coding RNA transcripts may include transcripts from satellite repeats or from transposons, which may be Class I retrotransposons or Class II DNA transposons.

[0075] In all of the various aspects of the invention described herein in relation to

DNA, the DNA can be single-stranded DNA, e.g., cDNA, which is reverse transcribed from RNA. Reverse transcription is usually mediated by reverse transcriptase encoded by a reverse transcriptase gene in a cell. The DNA can also be single stranded DNA generated during DNA replication. Genomic DNA replicates in the nucleus while the cell is dividing. Some of the replicated DNA may come off its template, be exported out of the nucleus, and packaged into micro vesicles. The DNA can further be fragments of double- stranded DNA.

[0076] In addition, the DNA can be non-coding DNA (ncDNA). The human genome contains only about 20,000 protein-coding genes, representing less than 2% of the genome. The ratio of non-coding to protein-coding DNA sequences increases as a function of developmental complexity (Mattick, 2004). Prokaryotes have less than 25% ncDNA, simple eukaryotes have between 25-50%, more complex multicellular organisms like plants and animals have more than 50% ncDNA, with humans having about 98.5% ncDNA (Mattick, 2004)

[0077] Some of the ncDNA from the genome is transcribed into ncRNA. NcRNAs have been implicated in many important processes in the cell, e.g., enzymes (ribozymes), binding specifically to proteins (aptamers), and regulating gene activity at both the transcriptional and post-transcriptional levels. Examples of ncRNA classes and examples of their functions are shown in Table 9.

[0078] Many of the ncRNA species have multiple functions. For example,

Ribonuclease P (RNase P) is a ribozyme which is involved in maturation of tRNA by cleaving the precursor tRNA, and nuclear RNaseP can also act as a transcription factor (Jarrous and Reiner, 2007). In addition, bifunctional RNAs have also been described that function both as mRNA and as regulatory ncRNAs (Dinger et al., 2008) or have two different ncRNA functions (Ender et al., 2008).

[0079] One example of the many long ncRNAs is the X-inactive specific transcript

(Xist) expressed by the inactive X-chromosome, which is used to silence the extra X- chromosome in females (Ng et al., 2007). This RNA transcript binds to and inactivates the same X chromosome from which it is produced.

[0080] Another example is the HOX antisense intergenic RNA (HOTAIR) (Rinn et al., 2007). This RNA is expressed from chromosome 12, but controls gene expression on chromosome 2, affecting the skin phenotype on different parts of the body surface (Rinn et al., 2007) and also being involved in cancer metastasis (Gupta et al., 2010).

[0081] Yet another example of ncRNA is PCA3, a biomarker for prostate cancer (Day et al., 2011). PCA3 can be readily measured in the RNA from urine microvesicles which can be extracted using a rapid filtration concentrator method (Miranda et al., 2010; Nilsson et al., 2009). Another biomarker for prostate cancer is PCGEM1, which is an ncRNA transcript over-expressed in prostate cancer (Srikantan et al., 2000).

[0082] Yet another example of ncRNA is NEAT2/MALAT1, which has been found to be upregulated during metastasis of non-small cell lung cancer, and was correlated with poor patient survival (Ji et al., 2003).

[0083] Microvesicles contain a substantial array of the cellular gene expression profile from the cells from which they originate (their parent cells) at any given time. That is, substantially all the RNAs expressed in the parent cell are present within the microvesicle, although the quantitative levels of these RNAs may differ in the microvesicle compared to the parent cell. Substantially all the genes from the parent cell can, therefore, be tracked in the microvesicle fraction. In addition, microvesicles contain DNA from the parent cell, which corresponds to diagnostically relevant aspects of the subject's genome. Therefore, a nucleic acid profile from microvesicles may be associated with a disease or other medical condition.

[0084] In one embodiment, the disease is a neurological disease or other medical condition, e.g., Alzheimer's disease. The nucleic acid profile for Alzheimer's disease may be a profile of early-onset familial Alzheimer's disease, associated genes including, but not limited to, amyloid beta (A4) precursor protein gene, presenilin 1 and presenilin 2.

[0085] In another embodiment, the disease is a cancer. The microvesicular nucleic acid profile for cancer may, e.g., include nucleic acids of one or more cancer-related genes (e.g., known or suspected oncogenes or tumor suppressor genes; or genes whose expression levels correlate with the expression levels of nearby satellites). The determination of a cancer nucleic acid profile, including such cancer related genes, can aid in understanding the status of the cancer cells. In one embodiment, the oncogenes or tumor suppressor genes are one or more of those listed in Tables 2 and 3. In another embodiment, the cancer-related genes are one or more of those genes whose expression levels correlate with the expression levels of nearby satellites, such as but not limited to the satellite correlated genes listed in Table 6.

[0086] In some instances, the cancer-related gene is c-myc. The copy number of c- myc oncogene is usually increased in tumor cells, e.g., meduUablastoma cells. The detection of increased c-myc gene copy number in microvesicles indicates an increased c-myc copy number in tumor cells that secret the microvesicles.

[0087] In other instances, the cancer-related gene is one or more members in the signaling pathways depicted in Fig. 34. These signaling pathways control the growth, proliferation and/or survival of cells (Alessi et al., 2009; Dowling et al.; Hanahan and Weinberg, 2000; Sarbassov et al., 2006). These pathways are sometimes cross-linked to each other, and thus enable extracellular signals to elicit multiple biological effects. For example, the growth promoting Ras protein interacts with the survival promoting PI3K and thus growth signals can concurrently evoke survival signals in the cell (Hanahan and Weinberg, 2000).

[0088] For one example, the member is from the RAS/RAF/MEK/MAPK pathway related to melanoma, brain and lung cancers. The MAP kinase is a convergence point for diverse receptor-initiated signaling events at the plasma membrane. The

RAS/RAF/MEK/MAPK pathway regulates cell proliferation, differentiation, migration and invasion (Hanahan and Weinberg, 2000). In addition, extracellular signal-regulated kinases (ERKs) become activated upon integrin ligation and, thereby, regulate cell migration (Klemke et al., 1997).

[0089] For another sample, the member is from the PI3K/PTEN/AKT pathway related to prostate, bladder and kidney cancers. The PI3K/PTEN/AKT pathway is responsible for regulating cell survival (Cheng et al., 2008). Genetic variations in AKT1, AKY2, PIK3CA, PTEN, and FRAP1 are associated with clinical outcomes in patients who receive chemoradiotherapy (Hildebrandt et al., 2009). Therefore, the determination of genetic variations in members of the pathway may help evaluating cancer treatment efficacy.

[0090] The microvesicular nucleic acid profile of the present invention may also reflect the nucleic acid profile of DNA repeats and/or transposable elements in cells from which the microvesicles originate.

[0091] DNA repeats include one or more repeated DNA elements that are composed of arrays of tandemly repeated DNA with the repeat unit being a simple or moderately complex sequence. The array of tandemly repeated DNA can be of varying size, thereby giving rise to categories of megasatellite, satellite, minisatellite and microsatellite repeats. See Table 7. Repeated DNA of this type is not transcribed and accounts for the bulk of the heterochromatic regions of the genome, being notably found in the vicinity of the

centromeres (i.e., pericentromeric heterochromatin). The base composition, and therefore density, of such DNA regions is dictated by the base composition of constituent short repeat units and may diverge from the overall base composition of other cellular DNA. The nucleic acid profiles of the present invention comprising satellite repeats may include profiles of satellite repeat DNA and/or profiles of transcripts that are transcribed from satellite repeats.

[0092] DNA repeats may serve as biomarkers of cancer cells. For example, some satellite repeats like HSATII are over-expressed in many types of cancers including pancreatic, lung, kidney, ovarian and prostate cancers (Ting et al., 2011). The RNA expression level of such satellite repeats correlates with cancer disease status. DNA repeats encompassed within the scope of the present invention can be one or more of those recited in Table 8. In some embodiments, the DNA repeats may be HSATII, ALR, (CATTC) n , or a combination of the HSATII, ALR, and (CATTC) n . [0093] Transposable elements encompassed within the scope of the present invention may be one or more DNA transposons and/or retrotransposons. The retrotransposon can be one or more of those recited in Tables 3 and 4. In other embodiments, the retrotransposon can be one or more LINEs, Alus, HERVs or a combination of the LINEs, Alus and HERVs.

[0094] Transposable elements can serve as biomarkers of cancer cells. These repetitive elements constitute almost 50% of the human genome and include: half a million LINE-1 (LI) elements, of which about 100 are transcriptionally active and encode proteins involved in retrotransposition, including reverse transcriptase (RT) and integrase; a million Alu elements, which depend on LI functions for integration; and thousands of provirus HERV sequences, some of which contain near-to-full length coding sequences(Goodier and Kazazian, 2008; Voisset et al., 2008). Without being bound by theory, increased expression of retrotransposon elements in cancer appears to result in part from overall hypomethylation of the genome, which is also associated with genomic instability (Daskalos et al., 2009; Estecio et al., 2007) and tumor progression (Cho et al., 2007; Roman-Gomez et al., 2008).

[0095] Increased transcription of retrotransposon elements in the human genome has been noted in a number of cancer cell types. For example, increased expression of LI and HERV, as well as formation of retrovirus-like particles, has been reported in tumor tissue from breast cancer, melanoma, germ cell carcinoma and prostate cancer. See US 7,776,523 and Bratthauer et al., 1994; Golan et al., 2008; Ruprecht et al., 2008. Retrotransposon RNA and proteins, as well as antibodies against HERV proteins and virus-like particles, have also been found in blood of some cancer patients (Contreras-Galindo et al., 2008; Kleiman et al., 2004; Ruprecht et al., 2008; Wang-Johanning et al., 2008).

[0096] High level expression of retrotransposon genes and/or endogenous reverse transcriptase are sometimes associated with cancer. For example, human LINE-1 p40 protein is often expressed at a higher level in breast cancer than in normal mammary gland (Asch et al., 1996). Thus, the microvesicular nucleic acid profiles of retrotransposable elements are suitable for use in aiding the diagnosis, prognosis, and/or monitoring of medical conditions such as cancer, as well as for use in aiding in treatment selection for therapies whose efficacy is affected by the subject's genetic make-up.

[0097] In one embodiment of the present invention, the microvesicular profile(s) of retrotransposable element(s) are determined by analyzing the content of microvesicles originating from brain cancer, e.g., medullablastoma, glioblastoma, lymphoma, and breast cancer cells. In one instance, the profile comprises one or more RNA expression levels of LI, Alu and HERV elements. In another instance, the profile comprises one or more DNA levels of LI and HERV elements.

[0098] In one embodiment, the profile comprises a profile of the HERV-K element.

For example, the profile may comprise the expression of the HERV-K element in

microvesicles isolated from plasma from a subject. The expression of the HERV-K element may be assessed by determining the expression of any gene that the HERV-K element may encode, e.g., the group- specific antigen gene (gag), the protease gene (prt), the polymerase gene (pol), and the envelope gene (env) (Lower et al., 1996).

[0099] In one instance, the present invention may comprise a profile of the expression of the gag gene in microvesicles. The gag gene is from the HERV-K element and the profile of gag expression reflects the profile of HERV-K expression. The expression of the gag gene can be measured by methods known in the art, e.g., quantitative reverse transcription PCR analysis.

[00100] In another instance, the present invention may comprise a profile of the expression of the env gene in microvesicles. The env gene is from the HERV-K element and the profile of env expression reflects the profile of HERV-K expression. The expression of env gene can be measured by methods known in the art, e.g., quantitative reverse transcription PCR analysis.

[00101] In addition to the mRNA expression levels of one or more nucleic acids, the nucleic acid profiles of the present invention may also comprise the copy number of one or more nucleic acids, the fusion of several nucleic acids, the mutations of one or more nucleic acids, the alternative splicing of one or more nucleic acids, the methylation of one or more nucleic acids, and the single nucleotide polymorphism of one or more nucleic acids. The nucleic acids may correspond to genes, repeats, transposable elements, or other non-coding parts of the genomes of various organisms, including human beings.

[00102] The present invention encompasses all forms of cancer and pre-cancerous conditions. For example, without limitation, the present invention encompasses cancer and pre-cancer cells in brain, esophagus, lung, liver, stomach, ovary, testicle, kidney, skin, colon, blood, prostate, breast, uterus, and spleen.

[00103] The profile of nucleic acids can be obtained through analyzing nucleic acids obtained from isolated microvesicles according to standard protocols in the art.

[00104] In one embodiment, the nucleic acid is DNA. The analysis of the DNA may be performed by one or more various methods known in the art, including microarray analysis for determining the nucleic acid species in the extract, Quantitative PCR for measuring the expression levels of genes, DNA sequencing for detecting mutations in genes, and bisulfite methylation assays for detecting methylation patterns of genes.

[00105] In some embodiments of the present invention, data analysis may be performed by any of a variety of methods know in the art, e.g., Clustering Analysis, Principle Component Analysis, Linear Discriminant Analysis, Receiver Operating Characteristic Curve Analysis, Binary Analysis, Cox Proportional Hazards Analysis, Support Vector Machines and Recursive Feature Elimination (SVM-RFE), Classification to Nearest Centroid,

Evidence-based Analysis, or a combination thereof.

[00106] In another embodiment, the nucleic acid extracted and analyzed from the microvesicles is RNA. In some instance, the RNA may be subject to Digital Gene

Expression (DGE) analysis (Lipson et al., 2009). In this method, the RNA may be digested and converted into single stranded cDNA which may then be subject to sequencing analysis on a DNA sequencing machine, e.g., the HeliScope™ Single Molecule Sequencer from Helicos Biosciences as described in a publication by Ting et al. (Ting et al., 2011).

[00107] In other instances, the RNA is preferably reverse-transcribed into

complementary DNA (cDNA) before further amplification. Such reverse transcription may be performed alone or in combination with an amplification step. One example of a method combining reverse transcription and amplification steps is reverse transcription polymerase chain reaction (RT-PCR), which may be further modified to be quantitative, e.g., quantitative RT-PCR as described in US Patent No. 5,639,606, which is incorporated herein by reference for this teaching. Another example of the method comprises two separate steps: a first step of reverse transcription to convert RNA into cDNA and a second step of quantifying the amount of cDNA using quantitative PCR.

[00108] Nucleic acid amplification methods include, without limitation, polymerase chain reaction (PCR) (US Patent No. 5,219,727) and its variants such as in situ polymerase chain reaction (US Patent No. 5,538,871), quantitative polymerase chain reaction (US Patent No. 5,219,727), nested polymerase chain reaction (US Patent No. 5,556,773), self- sustained sequence replication and its variants (Guatelli et al., 1990), transcriptional amplification system and its variants (Kwoh et al., 1989), Qb Replicase and its variants (Miele et al., 1983), cold-PCR (Li et al., 2008), BEAMing (Li et al., 2006) or any other nucleic acid amplification methods, followed by the detection of the amplified molecules using techniques well known to those of skill in the art. Especially useful are those detection schemes designed for the detection of nucleic acid molecules if such molecules are present in very low numbers. The foregoing references are incorporated herein for their teachings of these methods. In other embodiment, the step of nucleic acid amplification is not performed. Instead, the extracted nucleic acids are analyzed directly, e.g., through next-generation sequencing.

[00109] The analysis of nucleic acids present in the isolated microvesicles can be quantitative, qualitative, or both quantitative and qualitative. For quantitative analysis, the amounts (expression levels), either relative or absolute, of specific nucleic acids of interest within the isolated microvesicles are measured with methods known in the art (some of which are described below). For qualitative analysis, the species of specific nucleic acids of interest within the isolated particles, whether wild type or variants, are identified with methods known in the art.

[00110] The present invention further encompasses methods of creating and using the microvesicular nucleic acid profiles described herein. In one embodiment of a method for creating a microvesicular profile, the method comprises the steps of isolating microvesicles from a biological sample (e.g., from a body fluid) obtained from a subject or obtaining a microvesicle fraction isolated from a biological sample obtained from a subject, extracting nucleic acids from the isolated microvesicles or microvesicle fraction (or obtaining such as extraction), and determining the profile of the nucleic acids in the extract.

[00111] The microvesicular profiles of the present invention may be used in methods of aiding diagnosis, prognosis, monitoring, therapy selection, or risk assessment of a disease or other medical condition for a subject as described herein and in the claims.

[00112] In some embodiments of the present invention, the one or more nucleic acid(s) may be one or more genes listed in Table 2 (cancer genes), Table 3 (cancer-related somatic mutations) and Table 6 (satellite-correlated genes). In one embodiment, the one or more nucleic acid(s) may be a fragment of a c-myc gene, for example, a fragment of c-myc gene containing more than 10 nucleotides. The fragment may contain incrementally longer sequences of 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 nucleotides, up to the full length of the gene.

[00113] In other embodiments, the one or more nucleic acids may be one or more sequences listed in Table 4 (GBM transposable elements), Table 5 (human transposable elements) and Table 8 (repeated DNA). In one embodiment, the one or more nucleic acids may be LI, Alu, HERV, fragments thereof, or any combination of any of the foregoing. The fragment may contain incrementally longer sequences of 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60 nucleotides up to the full length of each gene sequence.

[00114] In one embodiment, the invention comprises micro vesicular profiles and methods based on micro vesicular polypeptide species, polypeptide activities, or both the species and activities of polypeptides. The polypeptide may be any polypeptide in micro vesicles. In some embodiments, the polypeptide is a reverse transcriptase. The activity of the reverse transcriptase (RT) can be measured by standard protocols known in the art. For example, the RT activity can be measured by the EnzChek RT Assay Kit (Invitrogen).

[00115] The human endogenous retrovirus K (HERV-K) reverse transcriptase may serve as a breast cancer prognostic marker (Golan et al., 2008). As such, one particular embodiment of the present invention encompasses profiles and related methods based on detecting the activity of HERV-K reverse transcriptase in micro vesicles.

[00116] The present invention also includes a kit for genetic analysis of a micro vesicle preparation from a biological sample (e.g., a bodily fluid sample) from a subject. The kit in a suitable container may include one or more reagents capable of hybridizing to or amplifying one or more nucleic acids extracted from micro vesicles. In some embodiments, the nucleic acids correspond to one or more of those genes listed in Tables 2, 3, 4, 5, 6 and/or 8. In some further embodiments, the nucleic acids correspond to one or more RNA transcripts of one or more genes listed in Tables 2, 3, 4, 5, 6 and/or 8. In other further embodiments, the nucleic acid is DNA corresponding to one or more of the genes listed in Tables 2, 3, 4, 5, 6 and/or 8.

[00117] The present invention further includes an oligonucleotide microarray for genetic analysis of a microvesicle preparation from a body fluid sample from a subject, wherein the various oligonucleotides on the array are designed to hybridize exclusively to nucleic acids corresponding to one or more genes listed in Tables 2, 3, 4, 5, 6 and/or 8. The arrays can be made by standard methods known in the art. For example, SurePrint

Technology (Agilent Technologies Corp.) may be used to make as many as 8 arrays on a single slide.

[00118] The present invention also includes a method of aiding the discovery of one or more biomarkers for a disease or other medical condition. The method may comprise, e.g., the steps of isolating microvesicles from subjects having a disease or other medical condition of interest and also from subjects who do not have the disease or other medical condition of interest; measuring the level of one or more target biological materials extracted from the isolated microvesicles from each of the subjects; comparing the measured levels of the one or more target biological materials from each of the subjects; and determining whether there is a statistically significant difference in the measured levels. The step of determination of a statistically significant difference in the measured levels identifies the one or more target biological materials as potential biomarkers for the disease or other medical condition. As an alternative to isolating microvesicles, the method may be carried out with pre-isolated microvesicle fractions.

[00119] The one or more biomarkers and nucleic acids in each of the various embodiments of the invention described herein can be one or a collection of genetic aberrations. The term "genetic aberration" is used herein to refer to the nucleic acid amounts as well as nucleic acid variants within the nucleic acid-containing particles. Specifically, genetic aberrations include, without limitation, over-expression of a gene (e.g., an oncogene) or a panel of genes, under-expression of a gene (e.g., a tumor suppressor gene such as p53 or RB) or a panel of genes, alternative production of splice variants of a gene or a panel of genes, gene copy number variants (CNV) (e.g., DNA double minutes) (Hahn, 1993), nucleic acid modifications (e.g., methylation, acetylation and phosphorylations), single nucleotide polymorphisms (SNPs) (e.g., polymorphisms in Alu elements), chromosomal rearrangements (e.g., inversions, deletions and duplications), and mutations (insertions, deletions, duplications, missense, nonsense, synonymous or any other nucleotide changes) of a gene or a panel of genes, which mutations, in many cases, ultimately affect the activity and function of the gene products, lead to alternative transcriptional splice variants and/or changes of gene expression level, or combinations of any of the foregoing.

[00120] Genetic aberrations can be found in many types of nucleic acids. The determination of such genetic aberrations can be performed by a variety of techniques known to the skilled practitioner. For example, expression levels of nucleic acids, alternative splicing variants, chromosome rearrangement and gene copy numbers can be determined by microarray analysis (see, e.g., US Patent Nos. 6,913,879, 7,364,848, 7,378,245, 6,893,837 and 6,004,755) and quantitative PCR. Particularly, copy number changes may be detected with the Illumina Infinium II whole genome genotyping assay or Agilent Human Genome CGH Microarray (Steemers et al., 2006).

[00121] Nucleic acid modifications can be assayed by methods described in, e.g., US

Patent No. 7,186,512 and patent publication WO/2003/023065. Particularly, methylation profiles may be determined by Illumina DNA Methylation OMA003 Cancer Panel.

[00122] SNPs and mutations can be detected by hybridization with allele- specific probes, enzymatic mutation detection, chemical cleavage of mismatched heteroduplex (Cotton et al., 1988), ribonuclease cleavage of mismatched bases (Myers et al., 1985), mass spectrometry (US Patent Nos. 6,994,960, 7,074,563, and 7,198,893), single strand

conformation polymorphism (SSCP) (Orita et al., 1989), denaturing gradient gel

electrophoresis (DGGE)(Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), temperature gradient gel electrophoresis (TGGE) (Fischer and Lerman, 1979a; Fischer and Lerman, 1979b), restriction fragment length polymorphisms (RFLP) (Kan and Dozy, 1978a; Kan and Dozy, 1978b), oligonucleotide ligation assay (OLA), allele- specific PCR (ASPCR) (US Patent No. 5,639,611), ligation chain reaction (LCR) and its variants (Abravaya et al., 1995; Landegren et al., 1988; Nakazawa et al., 1994), flow-cytometric heteroduplex analysis (WO/2006/113590), nucleic acid sequencing, and combinations/modifications thereof.

[00123] Nucleic acid sequencing is to determine the base pair sequences of nucleic acids. Two traditional techniques for sequencing DNA are the Sanger dideoxy termination method (Sanger et al., 1977) and the Maxam-Gilbert chemical degradation method (Maxam and Gilbert, 1977). Both methods deliver four samples with each sample containing a family of DNA strands in which all strands terminate in the same nucleotide. Gel electrophoresis, or more recently capillary array electrophoresis is used to resolve the different length strands and to determine the nucleotide sequence, either by differentially tagging the strands of each sample before electrophoresis to indicate the terminal nucleotide, or by running the samples in different lanes of the gel or in different capillaries. Related methods using dyes or fluorescent labels associated with the terminal nucleotide have been developed, where sequence determination is also made by gel electrophoresis and automated fluorescent detectors. For example, the Sanger-extension method has recently been modified for use in an automated micro- sequencing system which requires only sub-microliter volumes of reagents and dye-labelled dideoxyribonucleotide triphosphates. U.S. Patent No.

5,846,727. [00124] More recently, high throughput DNA sequencing methods of various types have been developed and used to delineate nuclei acis sequences. These new methods are applied in sequencing machines including the 454 GenomeSequencer FLX instrument (Roche Applied Science), the Illumina (Solexa) Genome Analyzer, the Applied Biosystems ABI SOLiD system, the Helicos single-molecule sequencing device (HeliScope), and the Ion semiconductor sequencing by Ion Torrent Systems Inc. See also US patent application publications No. 20110111401 and No. 20110098193. It is understood that as the sequencing technology evolves, the analysis of nucleic acids obtained in the invention may be performed using any new sequencing method as one skilled in the art sees appropriate.

[00125] Gene expression levels may be determined by the serial analysis of gene expression (SAGE) technique (Velculescu et al., 1995), quantitative PCR, quantitative reverse transcription PCR, microarray analysis, and next generation DNA sequencing as known in the art.

[00126] In general, the methods for analyzing genetic aberrations are reported in numerous publications, not limited to those cited herein, and are available to skilled practitioners. The appropriate method of analysis will depend upon the specific goals of the analysis, the condition/history of the patient, and the specific cancer(s), diseases or other medical conditions to be detected, monitored or treated. The forgoing references are incorporated herein for their teaching of these methods.

[00127] Many biomarkers may be associated with the presence or absence of a disease or other medical condition in a subject. Therefore, detection of the presence or absence of such biomarkers in nucleic acids extracted from isolated micro vesicles, according to the methods disclosed herein, may aid diagnosis of the disease or other medical condition in the subject.

[00128] For example, as described in WO 2009/100029, detection of the presence or absence of the EGFRvIII mutation in nucleic acids extracted from microvesicles isolated from a patient serum sample aided in the diagnosis and/or monitoring of glioblastoma in the patient. This is so because the expression of the EGFRvIII mutation is specific to some tumors and defines a clinically distinct subtype of glioma (Pelloski et al., 2007).

[00129] For another example, as described in WO 2009/100029, detection of the presence or absence of the TMPRSS2-ERG fusion gene, PCA-3, or both TMPRSS2-ERG and PCA-3 in nucleic acids extracted from microvesicles isolated from a patient's urine sample may aid in the diagnosis of prostate cancer in the patient.

[00130] Further, many biomarkers may be associated with disease or medical status monitoring in a subject. Therefore, the detection of the presence or absence of such biomarkers in a nucleic acid extraction from isolated microvesicles, according to the methods disclosed herein, may aid in monitoring the progress or reoccurrence of a disease or other medical condition in a subject.

[00131] For example, as described in WO 2009/100029, the determination of matrix metalloproteinase (MMP) levels in nucleic acids extracted from microvesicles isolated from an organ transplantation patient may be used to monitor the post-transplantation condition, as a significant increase in the expression level of MMP-2 after kidney transplantation may indicate the onset and/or deterioration of post-transplantation complications. Similarly, a significantly elevated level of MMP-9 after lung transplantation, suggests the onset and/or deterioration of bronchiolitis obliterans syndrome.

[00132] Many biomarkers have also been found to influence the effectiveness of treatment in a particular patient. Therefore, the detection of the presence or absence of such biomarkers in a nucleic acid extraction from isolated microvesicles, according to the methods disclosed herein, may aid in evaluating the efficacy of a given treatment in a given patient. For example, as disclosed in Table 1 in the publication by Furnari et al. (Furnari et al., 2007), biomarkers, e.g., mutations in a variety of genes, affect the effectiveness of specific medicines used in chemotherapy for treating brain tumors. The identification of these and other biomarkers in nucleic acids extracted from isolated particles from a biological sample from a patient can guide the skilled practitioner in the selection of treatment for the patient.

[00133] Without limitation, all of the methods mentioned above may further comprise the step of enriching the isolated microvesicles for microvesicles originating from a specific cell type. For example, the cell can be a cancer or pre-cancer cell.

[00134] Another aspect of the present invention is a method of treating a subject suffering from a form of cancer in which the cancer cells secret microvesicles. The method comprises administering to the subject a therapeutically effective amount of a composition comprising: an inhibitor of microvesicle secretion; an inhibitor of a reverse transcriptase; another microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles; or any combination of the inhibitors/neutralizers.

[00135] In one embodiment, the inhibitor of microvesicle secretion is an inhibitor of the Rab GTPase pathway (Ostrowski et al.).

[00136] In some instances, the Rab GTPases are Rab 27a and Rab 27b. The inhibition of the Rab 27a and Rab 27b can be effectuated by silencing the Slp4 gene (also known as SYTL4, synaptotagmin-like 4) and the Slac2b gene (also known as EXPH5, exophilin5), respectively. Gene silencing techniques are well known in the art. One example of such a gene silencing technique is an RNA interference technique that selectively silences genes by delivering shRNA with viral vectors (Sliva and Schnierle).

[00137] In other instances, the Rab GTPase is Rab35. The inactivation of Rab35 decreases microvesicle secretion. Therefore, silencing Rab35 may decrease the secretion of microvesicles by cells. Inactivation of Rab35 may be achieved by administering TBCIDIOB (TBC1 domain family, member 10B) polypeptide (Sliva and Schnierle). [00138] In another embodiment, instead of, or in addition to, inhibiting microvesicle secretion, the reverse transcriptase activity is inhibited by administration of an RT inhibitor. RT inhibitors may be any one of 3'-azido2',3'-dideoxythymidine (AZT), 2',3'- dideoxyinosine (ddl), 2',3'-didehyro-3'-deoxythymidine (d4T), nevirapine and efavirenz.

[00139] Further, a microvesicle neutralizer may be used to block the effects of microvesicles. For example, such neutralizer may bind to microvesicles and destroy the integrity of microvesicles so that the biological materials in microvesicles are not transferred to other intact cells.

[00140] It should be understood that this invention is not limited to the particular methodologies, protocols and reagents, described herein, which may vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[00141] The contents of earlier filed provisional applications USSN 61/378,860, filed

August 31, 2010, USSN 61/421,421, filed December 9, 2010, USSN 61/437,547, filed January 28, 2011, USSN 61/438,199, filed January 31, 2011, and 61/493,261 filed June 03, 2011 are herein incorporated by reference in their entirety.

[00142] All patents, patent applications, and publications cited herein are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies and techniques described in such publications that might be used in connection with the present invention. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or

representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.

[00143] The present invention may be as defined in any one of the following numbered paragraphs.

1. A method for assaying a biological sample from a subject in aid of diagnosis,

prognosis or monitoring of a disease or other medical condition in the subject, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with diagnosis, prognosis, status or stage of a disease or other medical condition, and wherein the genetic aberration is in or corresponds to:

i. a c-myc gene;

ii. a transposable element;

iii. a retrotransposon element;

iv. a satellite correlated gene;

v. a repeated DNA element;

vi. non-coding RNA other than miRNA; or

vii. a fragment of any of the foregoing.

2. The method of paragraph 1, wherein the genetic aberration is in or corresponds to a transposable element listed in Table 4 or Table 5, or a fragment thereof.

3. The method of paragraph 1, wherein the genetic aberration is in or corresponds to a retrotransposon element that is LINE, SINE or HERV, or a fragment thereof.

4. The method of paragraph 3, wherein the genetic aberration is in or corresponds to a retrotransposon element that is Linel (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof.

5. The method of paragraph 1, wherein the genetic aberration is in or corresponds to a satellite correlated gene listed in Table 6, or a fragment thereof. The method of paragraph 1, wherein the genetic aberration is in or corresponds to a repeated DNA element listed in Table 8, or a fragment thereof. The method of paragraph 1, wherein the genetic aberration is in or corresponds to a non-coding RNA listed in Table 9 (or a fragment thereof), other than miRNA. The method of paragraph 7, wherein the non-coding RNA is 7SL. A method for assaying a biological sample from a subject in aid of directing treatment of the subject for a disease or other medical condition, comprising the steps of :

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition, and wherein the genetic aberration is in or corresponds to:

i. a c-myc gene;

ii. a transposable element;

iii. a retrotransposon element;

iv. a satellite correlated gene;

v. a repeated DNA element;

vi. non-coding RNA other than miRNA; or

vii. a fragment of any of the foregoing. The method of paragraph 9, wherein the genetic aberration is in or corresponds to a transposable element listed in Table 4 or Table 5, or a fragment thereof. The method of paragraph 9, wherein the genetic aberration is in or corresponds to a retrotransposon element that is LINE, SINE or HERV, or a fragment thereof. The method of paragraph 11, wherein the genetic aberration is in or corresponds to a retrotransposon element that is Linel (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof. The method of paragraph 9, wherein the genetic aberration is in or corresponds to a satellite correlated gene listed in Table 6, or a fragment thereof. The method of paragraph 9, wherein the genetic aberration is in or corresponds to a repeated DNA element listed in Table 8, or a fragment thereof. The method of paragraph 9, wherein the genetic aberration is in or corresponds to a non-coding RNA listed in Table 9 (or a fragment thereof), other than miRNA. The method of paragraph 15, wherein the non-coding RNA is 7SL. A method for assaying a biological sample from a subject in aid of a determination of the subject's risk of developing a disease or other medical condition, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid, wherein the biomarker is a genetic aberration associated with a determination of the subject's risk of developing a disease or other medical condition, and wherein the genetic aberration is in or corresponds to:

i. a c-myc gene;

ii. a transposable element;

iii. a retrotransposon element;

iv. a satellite correlated gene;

v. a repeated DNA element;

vi. non-coding RNA other than miRNA; or

vii. a fragment of any of the foregoing. The method of paragraph 17, wherein the genetic aberration is in or corresponds to a transposable element listed in Table 4 or Table 5, or a fragment thereof. The method of paragraph 17, wherein the genetic aberration is in or corresponds to a retrotransposon element that is LINE, SINE or HERV, or a fragment thereof. The method of paragraph 19, wherein the genetic aberration is in or corresponds to a retrotransposon element that is Linel (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV-W or HERV-C, or a fragment thereof. The method of paragraph 17, wherein the genetic aberration is in or corresponds to a satellite correlated gene listed in Table 6, or a fragment thereof. The method of paragraph 17, wherein the genetic aberration is in or corresponds to a repeated DNA element listed in Table 8, or a fragment thereof. The method of paragraph 17, wherein the genetic aberration is in or corresponds to a non-coding RNA listed in Table 9 (or a fragment thereof), other than miRNA. The method of paragraph 23, wherein the non-coding RNA is 7SL. A method for assaying a biological sample from a subject in aid of diagnosis, prognosis or monitoring of a disease or other medical condition in the subject, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with diagnosis, prognosis, status or stage of a disease or other medical condition, and wherein the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof. A method for assaying a biological sample from a subject in aid of directing treatment of the subject for a disease or other medical condition, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition, and wherein the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof A method for assaying a biological sample from a subject in aid of a determination of the subject's risk of developing a disease or other medical condition, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. extracting nucleic acid from the fraction; and

c. detecting the presence or absence of a biomarker in the extracted nucleic acid; wherein the biomarker is a genetic aberration associated with a determination of the subject's risk of developing a disease or other medical condition, and wherein the genetic aberration is in or corresponds to a cancer gene listed in Table 2 or 3, or a fragment thereof. A method for assaying a biological sample from a subject in aid of diagnosis, prognosis or monitoring of a disease or other medical condition in the subject, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. measuring a polypeptide activity in the fraction; and

c. determining whether the polypeptide activity is higher or lower than a normal or average activity for the polypeptide;

wherein an elevated or lowered activity is associated with diagnosis, prognosis, status or stage of a disease or other medical condition. The method of paragraph 28, wherein the polypeptide is an enzyme. The method of paragraph 29, wherein the enzyme is reverse transcriptase. The method of paragraph 30, wherein step (c) involves determining whether the reverse transcriptase activity is higher than a normal or average activity for reverse transcriptase.

A method for assaying a biological sample from a subject in aid of directing treatment of the subject for a disease or other medical condition, comprising the steps of: a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. measuring a polypeptide activity in the fraction; and

c. determining whether the polypeptide activity is higher or lower than a normal or average activity for the same polypeptide;

wherein an elevated or lowered activity is associated with a disease or other medical condition or with responsiveness to a specific therapy for the disease or other medical condition. The method of paragraph 32, wherein the polypeptide is an enzyme. The method of paragraph 33, wherein the enzyme is reverse transcriptase. The method of paragraph 34, wherein step (c) involves determining whether the reverse transcriptase activity is higher than a normal or average activity for reverse transcriptase. A method for assaying a biological sample from a subject in aid of a determination of the subject's risk of developing a disease or other medical condition, comprising the steps of:

a. obtaining or using a microvesicle fraction from a biological sample from a subject;

b. measuring a polypeptide activity in the fraction; and

c. determining whether the polypeptide activity is higher or lower than a normal or average activity for the same polypeptide;

wherein an elevated or lowered activity is associated with a subject's risk of developing a disease or other medical condition. The method of paragraph 36, wherein the polypeptide is an enzyme. The method of paragraph 37, wherein the enzyme is reverse transcriptase. The method of paragraph 38, wherein step (c) involves determining whether the reverse transcriptase activity is higher than a normal or average activity for reverse transcriptase. The method of any of paragraphs 1-27, wherein the genetic aberration is: a. a species of nucleic acid;

b. the level of expression of a nucleic acid;

c. a nucleic acid variant; or

d. a combination of any of the foregoing. The method of any of paragraphs 1-27, wherein the nucleic acid is RNA and the genetic aberration is an expression profile. The method of any of paragraphs 1-27, wherein the fragment contains more than 10 nucleotides. The method of any of paragraphs 1-39, wherein the biological sample is a bodily fluid. The method of paragraph 43, wherein the bodily fluid is blood, serum, plasma, or urine. The method of any of paragraphs 1-39, wherein the subject is a human subject. The method of paragraph 45, wherein the disease or other medical condition is brain cancer. The method of paragraph 46, wherein the brain cancer is medulloblastoma or glioblastoma. The method of paragraph 45, wherein the disease or other medical condition is melanoma. The method of any of paragraphs 1-27, wherein the step of detecting the presence or absence of a biomarker in the extracted nucleic acid comprises microarray analysis, PCR, quantitative PCR, Digital Gene Expression, or direct sequencing. The method of any of paragraphs 1-39, further comprising the step of enriching the microvesicle fraction for microvesicles originating from a specific cell type. A kit for genetic analysis of a microvesicle fraction obtained from a body fluid sample from a subject, comprising, in a suitable container, one or more reagents capable of hybridizing to or amplifying a nucleic acid corresponding to one or more of the genetic aberrations referenced in any of paragraphs 1-27. An oligonucleotide microarray for genetic analysis of a microvesicle preparation from a body fluid sample from a subject, wherein the oligonucleotides on the array are designed to hybridize to one or more nucleic acids corresponding to one or more of the genetic aberrations referenced in any of paragraphs 1-27. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to a cancer gene listed in Table 2 or 3, or a fragment thereof. The profile of paragraph 53, wherein the cancer gene is a c-myc gene. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to transposable element from the subject's genome, preferably an element listed in Table 4 or 5, or a fragment of any of the foregoing. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to a retrotransposon element from the subject's genome, preferably LINE, SINE or HERV, more preferably LINE1 (LI), ALU, HERV-H, HERV-K, HERV-K6, HERV- W or HERV-C, or a fragment of any of the foregoing. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to a satellite correlated gene from the subject's genome, preferably a satellite correlated gene listed in Table 6, or a fragment of any of the foregoing. A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to an element of repeated DNA from the subject's genome, preferably an element listed in Table 8, or a fragment of any of the foregoing.

A profile of microvesicular nucleic acid derived from a bodily fluid sample from a subject, wherein the profile comprises a genetic aberration in or corresponding to non- coding RNA other than miRNA, preferably a species listed in Table 9, or a fragment of any of the foregoing. The profile of paragraph 59, wherein the non-coding RNA is 7SL. The profile of any of paragraphs 53-60, wherein the genetic aberration is:

a. a species of nucleic acid;

b. the level of expression of a nucleic acid;

c. a nucleic acid variant; or

d. a combination of any of the foregoing. A method of identifying a potential new nucleic acid biomarker associated with a disease or other medical condition, status or stage of disease or other medical condition, a subject's risk of developing a disease or other medical condition, or a subject's responsiveness to a specific therapy for a disease or other medical condition, comprising the steps of:

(a) obtaining or using a microvesicle fraction from a biological sample from a subject;

(b) extracting nucleic acid from the fraction;

(c) preparing a profile according to any of paragraphs 53-60; and

(d) comparing the profile of step (c) to a control or reference profile and selecting one or more potential new biomarkers based on one or more differences between the profile of step (c) and the control or reference profile. A method of treating a subject having a form of cancer in which cancer cells secrete microvesicles, the method comprising administering to the subject a therapeutically effective amount of a composition comprising:

a. an inhibitor of microvesicle secretion;

b. an inhibitor of a reverse transcriptase;

c. a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles; or

d. any combination of the forgoing. The method of paragraph 63, wherein the inhibitor of microvesicle secretion is an inhibitor of RAB GTPase. 65. The method of paragraph 64, where in the Rab GTPase is Rab 27a, Rab 27b or Rab 35.

66. The method of paragraph 63, wherein the inhibitor of a reverse transcriptase is a nucleoside analog selected from the group comprising 3'-azido2',3'- dideoxythymidine (AZT), 2',3'-dideoxyinosine (ddl), 2',3'-didehyro-3'- deoxythymidine (d4T), nevirapine and efavirenz.

67. The method of paragraph 63, wherein the inhibitor of a reverse transcriptase is RNAi targeting the reverse transcriptase gene.

68. The method of paragraph 63, wherein the microvesicle neutralizer is a biological agent that binds microvesicles and destroys the integrity of the micro vesicles.

69. A pharmaceutical composition comprising, in a suitable pharmaceutical carrier: (a) an inhibitor of microvesicle secretion, particularly an inhibitor of RAB GTPase, and more particularly Rab 27a, Rab 27b or Rab 35); (b) an inhibitor of reverse transcriptase, particularly a nucleoside analog, more particularly 3'-azido2',3'- dideoxythymidine (AZT), 2',3'-dideoxyinosine (ddl), 2',3'-didehyro-3'- deoxythymidine (d4T), nevirapine, or efavirenz, or an RNAi targeting the reverse transcriptase gene; (c) a microvesicle neutralizer that neutralizes the pro-tumor progression activity of tumor microvesicles, particularly a biological agent that binds microvesicles and destroys the integrity of the microvesicles; or (d) a combination of any of the foregoing.

1.

[00144] The invention is further illustrated by the following examples, which should not be construed as further limiting. Examples of the disclosed subject matter are set forth below. Other features, objects, and advantages of the disclosed subject matter will be apparent from the detailed description, figures, examples and claims. Methods and materials substantially similar or equivalent to those described herein can be used in the practice or testing of the presently disclosed subject matter. Exemplary methods and materials are now described as follows. EXAMPLES

Example 1 Cultured cells release an abundance of microvesicles

[00145] We found that cultured tumor cells as well as normal cells release microvesicles. Here, we analyzed microvesicles produced by tumor cells from glioblastoma (GBM), a common and malignant brain tumor in adults; medulloblastoma, a common and malignant tumor in children with frequent amplification of c-Myc(Bigner et al., 1990); atypical teratoid rhabdoid tumor (AT/RT), a high-grade malignant tumor in children(Tez et al., 2008); and malignant melanoma, a peripheral tumor which can metastasize to the brain(Jemal et al., 2008). We analyzed microvesicles produced by epidermoid carcinoma cells as a control for the study. Increased expression of EGFR, but not c-Myc gene, was found in epidermoid carcinoma cells (Giard et al., 1973).

[00146] We cultured glioblastoma, medulloblastoma, melanoma and normal human fibroblast cells and monitored the release of microvesicles from each cell type. Specifically, primary GBM cell lines 20/3 and 11/5 were generated in our laboratory from tumor specimens kindly provided by Dr. Bob Carter (Massachusetts General Hospital), and diagnosed as GBM by a neuropathologist at Massachusetts General Hospital (Skog et al., 2008). Glioblastoma cells were cultured in Dulbecco modified essential medium (DMEM; Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (FBS; JRH Biosciences, Carlsbad, CA), and penicillin and streptomycin (10 IU/ml and 10 μg/ml, respectively;

Cellgro, Herndon, VA).

[00147] Primary medulloblastoma cell lines D458, D384 and D425, as well as rhabdoid AT/RT tumor cell line, NS224, were provided by Drs. Y.-J. Cho and S.L. Pomeroy (Children's Hospital, Boston, MA). All medulloblastoma cell lines were cultured in suspension in DMEM containing 10% FBS, 1 x GlutaMAX (Invitrogen) and penicillin/streptomycin. Rhabdoid tumor cell line NS224 was cultured in suspension in DMEM/F12 containing B27 supplement, 20 ng/ml EGF, 20 ng/ml FGF and

penicillin/streptomycin.

[00148] Melanoma cell line, Yumel 0106, was kindly provided by Dr. R. Halaban

(Yale New Haven Hospital, New Haven, CT) and cultured in OptiMEM (Invitrogen) containing 10% FBS and penicillin/streptomycin. Epidermoid carcinoma cell line, A431 (ATCC) was kindly provided by Huilin Shao (Massachusetts General Hospital) and cultured in DMEM containing 10% FBS and penicillin/streptomycin.

[00149] Normal human fibroblast lines, HF19 and HF27 were derived from human skin biopsies in the Breakefield laboratory; L2131 was derived in Dr. Christine Klein's laboratory (Univ. Ltibeck, Ltibeck, Germany) and cultured in DMEM supplemented with 10% FBS, 10 mM HEPES (Invitrogen) and penicillin/streptomycin. All cells were grown in media with 5% exosome-depleted fetal bovine serum (dFBS) (Skog et al., 2008). All cell lines were used over a few passages, as microvesicle yield tended to change over extended passages.

[00150] To characterize the size distribution and amount of microvesicles released from tumor cells and normal fibroblasts in culture using Nanosight LM10 nanoparticle tracking analysis (NTA), we isolated microvesicles from the culture media of three medulloblastoma cell lines (D384, D425 and D458), one melanoma (Yumel 0106), two GBMs (20/3 and 11/5) and two normal fibroblasts (HF19 and HF27). The media was first spun at 500 x g for 10 min. The supernatant was removed and spun again at 16,500 x g, filtered through a 0.22 μπι filter and used for Nanosight analysis. The nanosight LM10 nanoparticle characterization system (NanoSight Ltd, UK) equipped with a blue laser (405 nm) illumination was used for real-time characterization of the vesicles. The result is presented as the average + SEM of three independent experiments.

[00151] We found that medulloblastoma cells released more microvesicles/cell than the other cells types analyzed. The amount of microvesicles released by each cell type was: 13, 400-25, 300/cell/48 hrs for medulloblastomas (Figs. 1-3), 12,600/cell/48 hrs for the melanoma (Fig. 4), 7,000-13, OOO/cell/48 hrs for the GBM cells (Figs. 5-6), and 3,800- 6,200/cell/48 hrs for the normal human fibroblasts (Fig. 7-8). Normal human fibroblasts were of low passage and grew with similar rates as the tumor lines in culture, but were of larger size and hence greater surface area per cell.

[00152] To measure the amount of RNA in the microvesicles released in the culture media from these cells, we collected each conditioned medium after culturing for 48 hr and isolated microvesicles by differential centrifugation and filtration through a 0.22 μπι filter followed by ultracentrifugation at 110,000 x g as detailed in WO 2009/100029.

[00153] For purposes of RNA extraction from microvesicles, microvesicle pellets generated from 39 ml conditioned medium produced from 0.5 x 10 6 - 3.5 x 10 6 cells over 48 hours were resuspended in 50 μΐ ^ PBS and incubated at 37°C for 30 min with DNAse I (DNA-free™ kit, Ambion) and Exonuclease III (Fermentas, Glen Burnie, MD), according to the manufacturer's instructions. After treatment, the enzymes were inactivated (using the kit's inactivation reagent and heat inactivation, respectively) and samples processed for RNA extraction.

[00154] Microvesicles were lysed in 300 μΐ MirVana lysis buffer (Ambion, Austin,

TX) followed by extraction with an equal amount of acid-phenol:chloroform. After centrifugation at 10,000 x g for 5 min, the upper aqueous phase was removed and further processed to extract RNA using the mirVana RNA isolation kit (Ambion), according to the manufacturer's instructions. RNA extracts were then treated with DNAse (DNA-free kit, Ambion) to exclude DNA carryover. RNA was quantified using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, MA) and the quantity and size ranges were evaluated using a 2100 Bioanalyzer (Agilent, Santa Clara, CA).

[00155] ExoRNA in microvesicles was measured using a 2100 Bioanalyzer (Agilent) with RNA 6000 Pico Chip for RNA. The Bioanalyzer RNA 6000 Pico Chip kit detects mainly single strand nucleic acids, but can also detect double strand DNA when present in large amounts. As shown in Figs. 1-8, the amount of RNA in microvesicles (exoRNA) from meduUoblastoma cells was 120- to 310-fold higher than the amount of exoRNA from normal fibroblasts; the amount of exoRNA from glioblastoma cells was 2.8- to 6.5-fold higher than from normal fibroblasts; and the amount from exoRNA from melanoma cells was similar to that from normal fibroblasts even though melanoma cells shed more than twice as many microvesicles. Thus, meduUoblastoma tumor cells, in particular, release abundant microvesicles with a high content of exoRNA.

Example 2 Characterization of RNA and DNA in microvesicles

[00156] To characterize the RNA and DNA in microvesicles, we isolated

microvesicles from culture media of meduUoblastoma cell line D384, glioblastoma cell line 11/5 and fibroblast cell line H19 as detailed in Example 1. Isolated microvesicles were treated extensively with DNase prior to nucleic acid extraction to reduce the chance of external DNA contamination. Isolated microvesicles may also be treated with RNase prior to nucleic acid extraction although such treatment did not affect the RNA yield from

microvesicles probably due to the absence of any significant amounts of external RNA.

[00157] ExoRNA was extracted from isolated microvesicles as detailed in Example 1. [00158] For exoDNA extraction, microvesicle pellets generated from 39 ml conditioned medium produced from 0.5 x 10 6 - 3.5 x 10 6 cells over 48 hr were resuspended in 50 μL· PBS and incubated at 37°C for 30 min with DNAse I (DNA-free™ kit, Ambion) and Exonuclease III (Fermentas, Glen Burnie, MD), according to manufacturer's instructions. After treatment, the enzymes were inactivated (using the kit's inactivation reagent and heat inactivation, respectively) and samples processed for DNA extraction.

[00159] Microvesicles were lysed in 300 μΐ MirVana lysis buffer (Ambion, Austin,

TX) followed by extraction with an equal amount of acid-phenol:chloroform. After centrifugation at 10,000 x g for 5 min, the upper aqueous phase was removed and further processed to extract DNA using the Qiagen PCR purification kit according to manufacturer's instructions. DNA extracts were then treated with RNase (e.g., RNase A, Fermentas, Glen Burnie, MD) to exclude RNA carryover. DNA were quantified using a Nanodrop ND-1000 (Thermo Fisher Scientific, Waltham, MA) and the quantity and size ranges were evaluated using a 2100 Bioanalyzer (Agilent, Santa Clara, CA). ExoDNA in microvesicles was measured using a 2100 Bioanalyzer (Agilent) with RNA 6000 Pico Chip and/or DNA 7500 LabChip kits. The Bioanalyzer RNA 6000 Pico Chip kit detects mainly single stranded ("ss") nucleic acids, but can also detect double- stranded DNA (dsDNA) when present in large amounts, while the DNA 7500 LabChip kit only detects dsDNA. SI nuclease (200 U/ml; Fermentas) was also used to digest single stranded nucleic acid at 37°C for 30 min. Genomic cell DNA was isolated from cells with the Flexigene DNA kit (Qiagen, Valencia, CA), according to manufacturers' recommendation.

[00160] As shown in Figs. 25A and 25C, the RNA profile varied among cell types and culture conditions, but in general, RNA with intact 18S and 28S ribosomal peaks were isolated from microvesicles. [00161] The DNA profile also varied among cell types. ExoDNA was much more abundant in microvesicles secreted by glioblastoma tumor cells (Fig. 25B) as compared to normal fibroblast cells (Fig. 25D).

[00162] We also found that exoDNA was primarily single stranded. When exoDNA from meduUoblastoma tumor cells (D384) was analyzed using a dsDNA detection chip, no DNA was detected (Fig. 26A). However, when this same exoDNA was subjected to second strand synthesis, this same chip detected abundant dsDNA (Fig. 26B). Similar results were obtained with exoDNA extracted from microvesicles secreted by GBM cells (GBM 20/3).

[00163] That exoDNA was primarily single stranded DNA was also supported by our

SI exonuclease assays and PicoGreen assays. In the SI exonuclease assays, we isolated exoDNA from three meduUoblastoma cell lines (D435, D384, D556) and gDNA from one normal human fibroblast cell line (L2132). Samples were incubated with SI nuclease (200U/ml) at 37° C for 30 minutes or MOCK treated. PCR for the house-keeping gene GAPDH was then performed on treated and MOCK treated samples. SI exonuclease specifically digests single stranded nucleic acids. As shown in Fig. 27, without SI treatment, the bands for exoDNAs extracted from microvesicles secreted by meduUoblastoma cell lines (D425m, D384 and D556) were observed on the gel. In contrast, after SI treatment, the bands for exoDNAs extracted from microvesicles secreted by meduUoblastoma cell lines (D425m, D384 and D556) did not show up. As a control, the band for the genomic DNA extracted from fibroblast cell line L2132 still showed up after SI exonuclease digestion. Therefore, exoDNA was sensitive to SI exonuclease digestion, suggesting that exoDNA is likely to be single stranded DNA.

[00164] Further, quantitative analysis of exoDNA using PicoGreen® (Thermo

Scientific, Waltham, MA), which is a sensitive dsDNA binding fluorescent dye, showed an 18-fold lower amount of nucleic acids in comparison with the amount detected using the Bioanalyzer RNA chip. Since the Bioanalyzer RNA chip detection method can detect only single stranded nucleic acids, the exoDNA extract contained mainly single stranded nucleic acids.

Example 3 c-Myc oncogene amplification in cultured medulloblastoma tumor cells can be detected in both exoRNA and exoDNA

[00165] We detected c-Myc oncogene amplification using either exoRNA or exoDNA from medulloblastoma tumor cells. To measure the amount of c-Myc amplification, we extracted exoRNA and exoDNA, from culture media of three medulloblastoma cell lines (D458, D425 and D384), one atypical teratoid/rhabdoid (AT/RT) tumor cell line NS224, one glioblastoma cell line (11/5), and one normal fibroblast cell line H19 using the same method as detailed in Example 1, respectively. The genomic DNA from each of the same cell lines was extracted according to standard protocols in the art, which can be found in books such as Molecular Cloning: A Laboratory Manual (3-Volume Set) Ed. Joseph Sambrook, David W. Russel, and Joe Sambrook, Cold Spring Harbor Laboratory, 3rd edition (January 15, 2001), ISBN: 0879695773. The extracted nucleic acids were then used in PCR analysis to measure the level of amplifications.

[00166] For PCR analysis of exoRNA, total exoRNA (50 ng) was converted into cDNA with the Sensiscript RT Kit (Qiagen) using random primers, according to the manufacturer's instructions, and a 1:20 fraction (corresponding to 2.5 ng reverse transcribed RNA) was used for quantitative PCR (qPCR). For PCR analysis of the gDNA and exoDNA, qPCR was carried out using 10 ng DNA as a template. All reactions were performed in a 25μ1 reaction using Power SYBR® Green PCR Master Mix (Applied Biosystems, Foster City, CA) and 160 nM of each primer. Amplification conditions consisted of: (1) 1 cycle of 50°C, 2 min; (2) 1 cycle of 95°C, 10 min; (3) 40 cycles of 95°C, 15 sec; and 60°C, 1 min, and (4) a dissociation stage consisting of 1 cycle of 95°C, 15 sec; 60°C, 20 sec; and 95°C, 15 sec on the 7000 ABI Prism PCR system (Applied Biosystems). Cycle threshold ("Ct") values were analyzed in auto mode and manually inspected for accuracy. The Ct values of both RNA and DNA levels were normalized to the housekeeping gene GAPDH in each sample. Primer dimers were excluded by evaluation of dissociation curve and agarose gel

electrophoresis.

[00167] Sequences of the primers used were as follows n-Myc primers: 1) Forward

TCTACCCGGACGAAGATGAC (SEQ ID NO: 1), Reverse

AGCTCGTTCTCAAGCAGCAT (SEQ ID NO: 2) (primers within exon 2); c-Myc primer: Forward TCAAGAGGCGAACACACAAC (SEQ ID NO: 3), Reverse

TAACTACCTTGGGGGCCTTT (SEQ ID NO: 4) (both primers in exon 3); c-Myc primer: Forward CCTACCCTCTCAACGACAGC (SEQ ID NO: 5), Reverse

CTCTGACCTTTTGCCAGGAG (SEQ ID NO: 6) (spanning intron 2). c-Myc human specific primers: Forward CAACCCTTGCCGCATCCAC (SEQ ID NO: 7), Reverse AGTCGCGTCCTTGCTCGG (SEQ ID NO: 8) (both primers in exon 1). POU5F1B primers: Forward ATCCTGGGGGTTCTATTTGG (SEQ ID NO: 9), Reverse

CTCCAGGTTGCCTCTCACTC (SEQ ID NO: 10); and GAPDH primers: Forward

CTCTGCTCCTCCTGTTCGAC (SEQ ID NO: 11) (exon 8), Reverse

ACGACCAAATCCGTTGACTC (SEQ ID NO: 12) (exon 9).

[00168] Levels of c-Myc amplification were measured at the genomic level (gDNA) by qPCR (Fig. 9). All three medulloblastoma cell lines had significant amplifications of c- Myc sequences (16-34-fold) compared to fibroblasts and other tumor cell types. RNA and DNA were extracted from microvesicles shed by these cell lines and quantitated by RT-PCR and PCR respectively, using primers in exon 3 with values for c-Myc sequences normalized to glyceraldehyde 3-phosphate dehydrogenase (GAPDH), a housekeeping gene constitutively expressed in cells and found in exoRNA 14 and here in exoDNA. Microvesicles from all meduUoblastoma cell lines showed elevated levels of c-Myc sequences, both for exoRNA (8- 45-fold) and exoDNA (10-25 fold), compared to microvesicles from fibroblasts and tumor cells with diploid c-Myc copy numbers (Figs. 10-11). Also, using primers that span a full intron, we successfully detected a 1.6 kb fragment corresponding to the unspliced c-Myc genomic DNA (verified by sequencing) in exoDNA from all three meduUoblastoma cell lines, but not in any of the other cell lines.

[00169] Furthermore, to establish that this genomic fragment of c-Myc in

microvesicles was derived from a genomic amplicon, we verified the presence of elevated levels of a flanking gene, POU5F1B gene(Storlazzi et al., 2006) at levels matching those of c- Myc (Fig. 29B). POU5F1B PCR product was also verified by sequencing.

[00170] Levels of n-Myc sequences in cellular genomic DNA (gDNA) or exoRNA were also measured by qPCR and qRT-PCR and none of the other tumor types showed genomic amplification of n-Myc sequences or elevated levels of n-Myc exoRNA (Figs. 31A and B).

[00171] The levels of c-Myc DNA quantitated for gDNA and exoDNA/RNA in these meduUoblastoma lines were also compared to levels estimated by 250K single nucleotide polymorphism (SNP) analysis. For gene copy number estimation by the SNP array analysis, genomic DNA was extracted from meduUoblastoma cell pellets using the Puregene DNA Extraction Kit (Gentra Systems, Minneapolis, MN), according to the manufacturer's instructions. To obtain signal intensities and genotype calls, genomic DNA samples were digested, labeled and hybridized to Affymetrix 250K Styl SNP arrays, according to the manufacturer's protocol (Affymetrix, Santa Clara, CA). Signal intensities were normalized using rank invariant set normalization, and copy numbers for altered genomic regions were inferred using the GLAD (Gain and Loss of DNA) algorithm available in the Genepattern software package (www.genepattern.org). C-Myc and n-Myc copy numbers were inferred by analyzing the smoothed copy number data at genomic regions ch8q24.12 and ch2p24, respectively.

[00172] The results are shown in Table 1 and in Fig. 30 in a representative heat map.

Increased levels of c-Myc exoDNA corresponded well to the genomic copy number estimated by 250k SNP and qPCR in medulloblastoma lines, as compared to normal diploid levels in other cell lines, with correspondingly elevated c-Myc exoRNA in medulloblastoma micro vesicles.

Table 1. Assessment of c-Myc gene amplification levels in different cell types.

a2.5 ng reverse transcribed exoRNA and 10 ng of exoDNA were used as template for qPCR. All values were normalized to GAPDH mRNA.

hFISH = Fluorescence in situ hybridization of metaphase chromosome spread. 63

cSee representative heat map shown in Fig. 30. Example 4 c-Myc oncogene amplification in xenografted medulloblastoma tumor cells in vivo can be detected with both exoRNA and exoDNA

[00173] To assess the potential diagnostic utility of using exoRNA to detect c-Myc amplification in tumors, human medulloblastoma cells (c-Myc amplified) and epidermoid carcinoma tumor cells (non- amplified) were grown as xenograft tumors in nude mice. In the xenograft experiments, two groups of five adult immunodeficient mice (nu/nu NCI) were each injected subcutaneously in both flanks with 5 x 10 6 medulloblastoma cells (line D425) or epidermoid carcinoma cells (line A431). Tumors were allowed to grow for three weeks; the mice were then sacrificed and blood was drawn by cardiac puncture. Approximately 1 ml of blood was obtained from each mouse and allowed to clot at room temperature for 15 min and then centrifuged at 1300 x g for 10 min. The serum was then filtered through a 0.22 μπι filter and stored at -80°C. Samples were thawed and centrifuged for 1 hr at 100,000 x g to obtain microvesicles for RNA extraction, as described above.

[00174] As shown in Fig. 12, microvesicles were isolated from serum samples in tumor-bearing mice and exoRNA was extracted from the isolated microvesicles. Human c- Myc was detected in exoRNAs from 2/5 (40%) of the medulloblastoma-bearing mice (Fig. 13) and from 0/5 (0%) of the epidermoid carcinoma-bearing mice (Fig. 14).

Example 5 Retrotransposon elements are enriched in tumor microvesicles

[00175] We analyzed the RNA species in cellular RNA and exoRNA preparations from a low passage GBM line by microarray analysis using a whole genome array (Agilent Technologies). Briefly, RNA was extracted from microvesicles, as described above. RNA (0.5 μg) was used for linear T7 -based amplification and Cy-3/Cy-5 labeling (Agilent Low RNA Input Linear Amp Kit, Agilent Technologies) following the manufacturer's protocol. The microarray experiments were performed by Miltenyi Biotec (Auburn, CA) using the Agilent whole human genome microarray, 4 x 44K (44,000 probes), two-color array. The array was performed on two different RNA preparations from primary GBM cells and their microvesicles.

[00176] The microarray results have been deposited with a Geo accession number

GSE13470. The results indicate the presence of higher transcription levels of a number of retrotransposon sequences in exoRNA extracts as compared to cellular RNA extracts.

[00177] From the two-color Agilent array data, we generated MA plots as previously described(Storey and Tibshirani, 2003). The intensities of the expression levels for each transcript were obtained from the array data for both exoRNA extracts from microvesicles and cellular RNA extracts from cells. The intensity of exoRNA is here designated

"Microvesicle." The intensity of cellular RNA is here designated "Cell". The log ratio of the intensities of microvesicle/cell is plotted on the Y-axis (M = log 2 Microvesicle - logiCell) and the mean log expression of the two on the X-axis (A = 0.5 x (log 2 Microvesicle + logiCell)).

[00178] As shown in Fig. 15, the microarray data was represented on a MA plot as the cumulative abundance (in microvesicles and cells) of specific RNAs (X-axis) and the relative ratio of these RNAs in microvesicles versus cells (Y-axis). The Y-axis scale was log2, so RNAs above 4 or below -4 on the Y-axis have at least a 16-fold different level in the microvesicles vs. cells. There were many RNA species that were at least 16 fold more abundant in microvesicles than in cells (M value above 4). Similarly, there were also many RNA species that were at least 16 fold less abundant in microvesicles than in cells (M value below -4).

[00179] As shown in FIG. 17, RNA from DNA transposons was similar in content in cells and microvesicles with the M values spreading between -4 and 4. In contrast, as shown in Figs. 18-20, RNA from retrotransposons, e.g. HERV, Alu and LI, was frequently higher in microvesicles than in cells. This was particularly notable for the HERV sequences. As shown in Fig. 16, HERV-H was the most abundant and microvesicle-enriched in these GBM cells, followed by HERV-C, HERV-K6 and HERV-W. Therefore, some retrotransposon RNAs, e.g., HERV RNA, may be selectively packaged or enriched, in tumor microvesicles.

[00180] Since only a selected subset of transposon/retrotransposon probes are represented on the Agilent arrays, other retrotransposons that are not represented on the Agilent arrays may be enriched in microvesicles from tumor cells as well.

[00181] Since LI and HERV-K retrotransposons, as well as Alu elements (Goodier and

Kazazian, 2008), have been implicated in tumor progression, we further assayed their levels in cellular RNA and exoRNA from tumor and normal cells by qRT-PCR (again with the caveat that the primers used only detect a subset of these sequences). See Figs. 21A-C. The expression levels were normalized to that of the GAPDH mRNA. LI and Alu sequences were abundant in both cells and microvesicles (high values on the X-axis) and enriched in most of the microvesicles compared to the cells (M>0). The levels of retrotransposon sequences tended to be higher in exoRNA vs. cellular RNA, with HERV-K being relatively high in some tumors. Interestingly, HERV-K RNA was not detectable in exoRNA from normal human fibroblasts (HF19), with a Ct value of 36 (below detection limit). This difference between levels of HERV-K RNA in microvesicles from fibroblasts and tumor cells is shown in the MA plot (Fig. 21C).

Example 6 The non-coding 7SL RNA in microvesicles as biomarkers for cancer cells

[00182] We found that the expression profiles of the non-coding 7SL RNA in microvesicles from plasma may serve as biomarkers for glioblastoma. We obtained de- identified blood samples from a GBM patient and healthy control from the biobank at Massachusetts General Hospital. We took the serum for each blood sample and isolated microvesicles from the serum using the method as described in Example 1. RNA was extracted from the isolated microvesicles for further analysis. The expression levels of the 7SL RNA, EGFR and GAPDH were determined using qRT-PCR following a procedure as detailed in Example 3. The primers used for the qRT-PCR are as follows: 7SL-RNA:

Forward primer 5' CAAAACTCCCGTGCTGATCA 3' (SEQ ID NO: 13), Reverse primer 5' GGCTGGAGTGCAGTGGCTAT 3' (SEQ ID NO: 14), Probe (FAM labeled MGB probe), 5' TGGGATCGCGCCTGT 3' (SEQ ID NO: 15); EGFR: Forward primer 5' TATGTCCTCATTGCCCTCAACA 3' (SEQ ID NO: 16), Reverse primer 5'

CTGATGATCTGCAGGTTTTCCA 3' (SEQ ID NO: 17), Probe (FAM labeled MGB probe), 5' AAGGAATTCGCTCCACTG 3' (SEQ ID NO: 18); GAPDH, huGAPDH ID 4326317E from the vendor Applied Biosystems Inc..

[00183] The results show that the expression profile of the 7SL RNA in microvesicles correlates with the disease status of the subject from which the microvesicles were isolated (Fig. 34). The expression levels of the 7SL RNA in microvesicles from GBM serum samples were about 200 times higher than the levels from normal serum samples. In contrast, the expression levels of EGFR in microvesicles from GBM serum samples were about 2 times higher than the levels from normal serum samples. Further, the expression levels of GAPDH in microvesicles from GBM serum samples were roughly the same as the levels in normal serum samples.

[00184] As such, one aspect of the present invention is directed to the profile of 7SL

RNA in microvesicles isolated from a subject, e.g., a human being. The profile of 7SL RNA may be the expression profile of the 7SL RNA. The profile of 7SL RNA may be correlated with the medical condition of the subject wherefrom the microvesicles are isolated. [00185] Another aspect of the present invention is directed to a method of aiding the diagnosis, prognosis or selection of treatment therapy of a medical condition by determining the profile of the 7SL RNA. The determination of the profile of 7SL RNA may be the determination of the expression profile of the 7SL RNA. Since the profile of 7SL RNA may be correlated with the medical condition of the subject wherefrom the microvesicles are isolated, the determination of the profile in microvesicles may therefore aid the diagnosis, prognosis or selection of treatment therapy for the subject.

Example 7 Retrotransposon elements in tumor microvesicles are transferrable

[00186] To determine whether microvesicles could transfer HERV-K RNA to normal cells, human umbilical vein endothelial cells (HUVEC) were exposed to microvesicles from medulloblastoma cells and levels of HERV-K RNA were measured in HUVEC cells over time. Human umbilical vein endothelial cells (HUVEC) cells, kindly provided by Dr.

Jonathan Song (Massachusetts General Hospital), were cultured in gelatin - coated flasks in endothelial basal medium (Lonza, Walkersville, MD) supplemented with hEGF,

hydrocortisone, GA-1000 and FBS (Singlequots from Lonza). All cell lines were used over a few passages, as microvesicle yield tended to change over extended passages.

[00187] Specifically, HUVEC cells were seeded in 12- well plates at a density of 1.5 x

10 5 cells/well. Microvesicles were isolated from 1.2 x 107 D384 cells over a 48 hour period and added to each well in a total volume of 400 μΐ DMEM. Mock treated cells were incubated in 400 μΐ exosome-free DMEM. The cells were incubated for 2 hrs at 37°C and were then replenished with 1.5 ml DMEM (with 5% dFBS). Cells were collected at different time points after the microvesicle exposure and cell RNA was extracted for qRT-PCR analysis. The result is presented as the average + SEM of three independent experiments. [00188] As shown in Fig. 22, HERV-K RNA expression was increased in HUVEC cells at 2, 6, 12, 24, 48 and 72 hours after microvesicle exposure. The increased HERV-K RNA expression in HUVEC cells indicated that the microvesicles contained active HERV-K genes and such genes were transferred to the HUVEC cells.

Example 8 Retrotransposon elements in the form of exoDNA were enriched in tumor microvesicles with elevated RT activities

[00189] ExoDNA was also analyzed at the retrotransposon level with qPCR.

ExoDNAs were extracted from microvesicles as detailed in Example 2. gDNA were extracted from cells as detailed in Example 3. The primers used for qPCR are as follows: GAPDH primers: Forward CTCTGCTCCTCCTGTTCGAC (SEQ ID NO: 19) (exon 8), Reverse ACGACCAAATCCGTTGACTC (SEQ ID NO: 20) (exon 9); LI primers: Forward TAAGGGCAGCCAGAGAGAAA (SEQ ID NO: 21), Reverse

GCCTGGTGGTGACAAAATCT (SEQ ID NO: 22); HERV-K6 primers: Forward

GGAGAGAAGCTGTCCTGTGG (SEQ ID NO: 23), Reverse

TGACTGGACTTGCACGTAGG (SEQ ID NO: 24); Alu primers: Forward

CATGTGGGTTAGCCTGGTCT (SEQ ID NO: 25), Reverse

TTCCCACATTGCGTCATTTA (SEQ ID NO: 26).

[00190] The exoDNA levels were compared to nuclear gDNA isolated from the cells in MA plots. The levels of exoDNA in microvesicles and gDNA in corresponding cells were normalized to levels of GAPDH. The exoDNA (presumably originating from the cytoplasmic compartment) and gDNA (isolated from the nuclear compartment of the cells) showed clearly different patterns (M≠0). LI was slightly enriched in all medulloblastomas (Fig. 23A). HERV-K DNA was enriched in two of the medulloblastomas (D425 and D384) (Fig. 23C). In contrast, Alu was not enriched in any of the meduUoblastoma tested (Fig. 23B).

[00191] We further found that the enrichment of the transposable elements at the exoDNA level in the meduUoblastoma cell lines corresponded to high levels of endogenous Reverse Transcription (RT) activity in exosomes. To measure RT activities, microvesicles were lysed in RIPA buffer [50 mM Tris-HCl (pH 8); 150 mM NaCl, 2.5% sodium dodecyl sulfate, 2.5% deoxycholic acid, 2.5% Nonidet P-40] for 20 min at 4°C. Exosomal debris was removed by centrifugation at 14,000 x g for 15 min. Proteins were quantified by Bradford assay and diluted 1:6 for each RT reaction. The RT assay was performed using the

EnzCheck RT assay kit (Invitrogen) on a 25 μΐ ^ reaction, as described by the manufacturer. Fluorescence signal of the samples was measured before and after the RT incubation. The difference between the two values indicates newly synthesized DNA. Serial dilutions of Superscript™ III First Strand (Invitrogen) were used as standards. The result is presented as the average + SEM of three independent experiments.

[00192] As shown in Fig. 24, RT activities in the 0106, GBM11/5, GBM 20/3 and

HF19 cells are significantly less than those in D384, D425 and D458 cells. This decreased RT activities correlate well with the reduced levels of LI and HERV-K exoDNA in 0106, GBM11/5, GBM 20/3 and HF19 cells (as shown by the negative values on the MA plots in Fig. 23 A and C). Such correlation suggests that a fraction of exoDNA may be cDNA.

[00193] In addition, we found that exoDNA might also include fragments of genomic

DNA. We used L-mimosine to inhibit DNA replication and examined whether the inhibition affected the yield of exoDNA. If the exoDNA yield is decreased after inhibition, it is very likely that exoDNA may contain fragments of genomic DNA. [00194] Specifically, D384 cells were plated on 6- well plates (2 x 106 cells/well) and treated with increasing amounts (200, 400 and 600 μΜ) of L-mimosine (Sigma- Aldrich, St. Louis, MO) which is an inhibitor of DNA replication. The drug was added at one time point and 48 hrs after, the media was collected and processed for the isolation of micro vesicles. Cell viability was assessed by cell count using the Countess Automated Cell Counter (Invitogen). SsDNA yields are normalized to one.

[00195] As shown in Fig. 32, the exoDNA yield in microvesicles was decreased by about 50% following inhibition of DNA replication with L-mimosine. Therefore, some of the exoDNA may also be fragments of genomic DNA generated during DNA replication and mitosis.

[00196] While the present invention has been disclosed with reference to certain embodiments, numerous modifications, alterations, and changes to the described

embodiments are possible without departing from the sphere and scope of the present invention, as defined in the appended claims. Accordingly, it is intended that the present invention not be limited to the described embodiments, but that it has the full scope defined by the language of the following claims, and equivalents thereof.

Table 2 Cancer genes.

melanoma

ovarian, other

FANCD2 2177 NP 149075 3o26 AML, Fanconi L Rec D, Mis, N, Cance

r Transl molec ocatio

Locuslin Chrom Tumour Tumour Cancer ular n k Protein osome types types syndrom Tissue geneti Mutation partne

Symbol ID ID* band (somatic) (germline) e type cs type r

leukaemia anaemia F

D2

6p21- AML, Fanconi

FANCE 2178 NP_068741 L Rec N, F, S

p22 leukaemia anaemia E

AML, Fanconi

FANCF 2188 Q9NPI8 l lplS L Rec N, F

leukaemia anaemia F

AML, Fanconi Mis, N, F,

FANCG 2189 O 15287 9pl3 L Rec

leukaemia anaemia G S

Ewing's

FEV 54738 NP_059991 2q36 M Dorn T EWSR1 sarcoma

BCR,

8pl l.2- FOP,

FGFR1 2260 PI 1362 MPD/NHL L Dom T

pl l.l ZNF198

, CEP l

FGFRIOP 11116 NP_008976 6q27 MPD/NHL L Dom T FGFR1

FGFR2 2263 P21802 10q26 Gastric E Dom Mis -

FGFR3 2261 P22607 4pl6.3 Bladder, MM L, E Dom Mis, T IGHa

FH 2271 P07954 lq42.1 Leiomyomato Hereditary E, M Rec Mis, N, F

sis, renal leiomyoma

tosis and

renal-cell

cancer

FIP1L1 81608 NP_112179 4ql2 Idiopathic L Dom T PDGFR hypereosinop A hilic

syndrome

FLU 2313 Q01543 l lq24 Ewing's M Dom T EWSR1 sarcoma

FLT3 2322 P36888 ...13.ql2 AML, ALL L Dom Mis, O -

FLT4 2324 P35916 5q35.3 Angiosarcom M Dom Mis - a

FNBP1 23048 XP_052666 9q23 AML L Dom T MLL

FOXOIA 2308 Q12778 13ql4.1 Alveolar M Dom T PAX3 rhabdomyosa

rcomas

FOX03A 2309 043524 6q21 AL L Dom T MLL

FSTL3 10272 095633 19pl3 B-CLL L Dom T CCND1

FUS 2521 P35637 16pl l.2 Liposarcoma M Dom T DDIT3

GAS7 8522 060861 17p AML § L Dom T MLL

GATA1 2623 P15976 Xp 11.23 Megakaryobl L Dom Mis, F

astic

leukaemia

of Down

syndrome

GMPS 8833 P49915 3q24 AML L Dom T MLL

GNAS 2778 P04895 20ql3.2 Pituitary E Dom Mis - adenoma

GOLGA5 9950 NP_005104 14q Papillary E Dom T RET thyroid

GPC3 2719 P51654 Xq26.1 Wilms' Simpson- O Rec T, D, Mis,

tumour Golabi- N, F, S

Behmel O

syndrome

GPHN 10243 Q9NQX3 14q24 AL L Dom T MLL

GRAF 23092 NP 055886 5q31 AML, MDS L Dom T, F, S MLL

HEI10 57820 NP_067001 14ql l.l Uterine M Dom T HMGA2 leiomyoma

HIP1 3092 000291 7ql l.23 CMML L Dom T PDGFR

B

HIST1H4I 8294 NP 003486 6p21.3 NHL L Dom T BCL6

HLF 3131 Q 16534 17q22 ALL L Dom T TCF3

HMGA2 8091 P52926 12ql5 Lipoma M Dom T LHFP,

RAD51

LI,

LPP,

HEI10,

syndrome

Cance

r molec

Locuslin Chrom Tumour Tumour Cancer ular k Protein osome types types syndrom Tissue geneti Mutation

Symbol ID ID* band (somatic) (germline) type type

MLL 4297 Q03164 l lq23 AML, ALL Dom T, O

amp e n

other cancers,

ma ma syndrome

pheochromoc oma

q t yro ,

Table 3 List of genes which contain cancer-related somatic mutations. The list was adapted from Sanger Center's COSMIC database(Bamford et al., 2004; Forbes et al., 2008; Forbes et al.; Forbes et al.; Friedberg; Pleasance et al.). The gene names are uniquely assigned by HUGO Gene Nomenclature Committee (http://www.genenames.org/index.html, accessed January 31. 2011).

HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ACRBP ACRC ACRV1 ACSBG1 ACSBG2

ACSF2 ACSF3 ACSL1 ACSL3 ACSL4

ACSL5 ACSL6 ACSM1 ACSM2A ACSM2B

ACSM3 ACSM5 ACSS1 ACSS2 ACSS3

ACTA1 ACTA2 ACTB ACTBL2 ACTC1

ACTG1 ACTG2 ACTL6A ACTL6B ACTL7A

ACTL7B ACTL8 ACTL9 ACTN1 ACTN2

ACTN3 ACTN4 ACTR10 ACTR1 A ACTR1 B

ACTR2 ACTR3 ACTR3B ACTR5 ACTR6

ACTR8 ACTRT1 ACTRT2 ACVR1 ACVR1 B

ACVR1 C ACVR2A ACVR2B ACVRL1 ACY1

ACY3 ACYP1 ACYP2 ADA ADAD1

ADAD2 ADAL ADAM10 ADAM1 1 ADAM12

ADAM15 ADAM17 ADAM18 ADAM19 ADAM2

ADAM22 ENS

ADAM20 ADAM21 ADAM22 T0000031 5984 ADAM23

ADAM28 ADAM29 ADAM30 ADAM32 ADAM33

ADAM7 ADAM8 ADAM9 ADAMDEC1 ADAMTS1

ADAMTS10 ADAMTS12 ADAMTS13 ADAMTS14 ADAMTS15

ADAMTS16 ENS

ADAMTS16 T00000274181 ADAMTS17 ADAMTS18 ADAMTS19

ADAMTS2 ADAMTS20 ADAMTS3 ADAMTS4 ADAMTS5

ADAMTS6 ENS

ADAMTS6 T00000381055 ADAMTS7 ADAMTS8 ADAMTS9

ADAMTSL1 ENS

ADAMTSL1 T00000380548 ADAMTSL2 ADAMTSL3 ADAMTSL4

ADAMTSL5 ADAP1 ADAP2 ADAR ADARB1

ADARB2 ADAT1 ADAT2 ADAT3 ADC

ADCK1 ADCK2 ADCK4 ADCK5 ADCY1

ADCY10 ADCY2 ADCY3 ADCY4 ADCY5

ADCY6 ADCY7 ADCY8 ADCY9 ADCYAP1

ADCYAP1 R1 ADD1 ADD2 ADD3 ADH1 A

ADH1 B ADH4 ADH5 ADH6 ADH7

ADHFE1 ADM ADIPOQ ADIPOR1 ADIPOR2

ADK ADM ADM2 ADNP ADNP2

ADO ADORA1 ADORA2A ADORA2B ADORA3

ADPGK ADPRH ADPRHL1 ADPRHL2 ADRA1 A

ADRA1 B ADRA1 D ADRA2A ADRA2B ADRA2C

ADRB1 ADRB2 ADRB3 ADRBK1 ADRBK2

ADRM1 ADSL ADSS ADSSL1 AEBP1

AEN AES AFAP1 AFAP1 L1 AFAP1 L2

AFF1 AFF2 AFF3 AFF4 AFG3L2

AFM AFMID AFP AFTPH AGA

AGAP1 AGAP2 AGAP3 AGAP4 AGAP5

AGAP7 AGAP8 AGBL2 AGBL4 AGBL5

AGC1 AGER AGFG1 AGFG2 AGGF1

AGK AGL AG MAT AGPAT1 AGPAT2

AGPAT3 AGPAT4 AGPAT5 AGPAT6 AGPAT9

AGPHD1 AG PS AGR2 AGR3 AGRN

AGRP AGT AGTPBP1 AGTR1 AGTR2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

AGTRAP AG XT AGXT2 AGXT2L1 AGXT2L2

AHCTF1 AHCTF1 P AHCY AHCYL1 AHCYL2

AHDC1 AHI1 AHNAK AHNAK2 AHR

AHRR AHSA1 AHSA2 AHSG AHSP

AIF1 ENSTO

AICDA AIDA AIF1 AIF1 L 0000376051

AIFM1 AIFM2 AIFM3 AIG1 AIM1

AIM1 L AIM2 AIMP1 AIMP2 AIP

AIPL1 AIRE AJAP1 AK1 AK2

AK3 AK3L1 AK5 AK7 AKAP1

AKAP10 AKAP1 1 AKAP12 AKAP13 AKAP14

AKAP2 AKAP3 AKAP4 AKAP5 AKAP6

AKAP9 NM 00

AKAP7 AKAP8 AKAP9 5751 AKD1

AKIRIN1 AKIRIN2 AKNA AKNAD1 AKR1 A1

AKR1 B1 AKR1 B10 AKR1 B1 P8 AKR1 C1 AKR1 C2

AKR1 C3 AKR1 C4 AKR1 CL1 AKR1 D1 AKR1 E2

AKR7A2 AKR7A3 AKR7L AKT1 AKT1 S1

AL121675 36- AL122001 3

AKT2 AKT3 AKTIP 2 2

AL1 61645 14 AL512274 9 ALAD ALAS1 ALAS2

ALB ALCAM ALDH16A1 ALDH18A1 ALDH1 A1

ALDH1 A2 ALDH1 A3 ALDH1 B1 ALDH1 L1 ALDH1 L2

ALDH2 ALDH3A1 ALDH3A2 ALDH3B2 ALDH4A1

ALDH5A1 ALDH6A1 ALDH7A1 ALDH8A1 ALDH9A1

ALDOA ALDOB ALDOC ALG1 ALG10

ALG10B ALG1 1 ALG12 ALG13 ALG14

ALG1 L ALG2 ALG5 ALG6 ALG8

ALG9 ALK ALKBH1 ALKBH2 ALKBH3

ALKBH4 ALKBH5 ALKBH6 ALKBH7 ALKBH8

ALLC ALMS1 ALOX12 ALOX12B ALOX12P2

ALOX15 ALOX15B ALOX5 ALOX5AP ALOXE3

ALPK2 ENSTO

ALPI ALPK1 ALPK2 0000361673 ALPK3

ALPL ALPP ALPPL2 ALS2 ALS2CL

ALS2CR1 1 ALS2CR12 ALS2CR8 ALX1 ALX3

ALX4 AMAC1 AMAC1 L2 AMACR AMBN

AMBP AMBRA1 AMD1 AMDHD1 AMDHD2

AMELX AM ELY AMFR AMH AMHR2

AMICA1 AMIG01 AMIG02 AMIG03 AMMECR1

AMMECR1 L AMN AMOT AMOTL1 AMOTL2

AMPD2 ENST

AMPD1 AMPD2 00000393689 AMPD3 AMPH

AMT AMTN AMY1 A AMY1 B AMY1 C

AMY2A AMY2B AMZ1 AMZ2 ANAPC1

ANAPC10 ANAPC1 1 ANAPC13 ANAPC2 ANAPC4

ANAPC5 ANAPC7 ANG ANGEL1 ANGEL2

ANGPT1 ANGPT2 ANGPT4 ANGPTL1 ANGPTL2

ANGPTL3 ANGPTL4 ANGPTL5 ANGPTL6 ANGPTL7

ANK1 ANK2 ANK3 ANKAR ANKDD1 A HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ANKHD1 -

ANKFN1 ANKFY1 ANKH ANKHD1 EIF4EBP3

ANKK1 ANKLE2 ANKMY1 ANKMY2 ANKRA2

ANKRD1 ANKRD10 ANKRD1 1 ANKRD12 ANKRD13A

ANKRD13B ANKRD13C ANKRD13D ANKRD16 ANKRD17

ANKRD18A ANKRD2 ANKRD20A1 ANKRD20A2 ANKRD20A3

ANKRD20A4 ANKRD20A5 ANKRD22 ANKRD23 ANKRD24

ANKRD26 ANKRD27 ANKRD28 ANKRD29 ANKRD30A

ANKRD31 ANKRD32 ANKRD33 ANKRD34A ANKRD34B

ANKRD35 ANKRD37 ANKRD39 ANKRD40 ANKRD42

ANKRD43 ANKRD44 ANKRD45 ANKRD46 ANKRD49

ANKRD5 ANKRD50 ANKRD52 ANKRD53 ANKRD54

ANKRD55 ANKRD56 ANKRD57 ANKRD58 ANKRD6

ANKRD60 ANKRD7 ANKRD9 ANKS1 A ANKS3

ANKS4B ANKS6 ANKZF1 ANLN ANO10

AN02 AN03 AN04 AN05 AN06

AN07 AN08 AN09 ANP32B ANP32C

ANP32D ANP32E ANPEP ANTXR1 ANTXRL

ANUBL1 ANXA1 ANXA10 ANXA1 1 ANXA13

ANXA2 ANXA3 ANXA4 ANXA5 ANXA6

ANXA7 ANXA8 ANXA8L1 ANXA8L2 ANXA9

AOAH AOC2 AOC3 AOF2 AOX1

AP001 01 1 .2 EN AP001 01 1 .3 EN

ST00000261598 ST00000320876 AP005901 2 AP1 AR AP1 B1

AP1 G1 AP1 G2 AP1 M1 AP1 M2 AP1 S1

AP1 S2 AP1 S3 AP2A1 AP2A2 AP2B1

AP2M1 AP2S1 AP3B1 AP3B2 AP3D1

AP3M1 AP3M2 AP3S1 AP3S2 AP4B1

AP4E1 AP4M1 AP4S1 APAF1 APBA1

APBA2 APBA3 APBB1 APBB1 IP APBB2

APBB3 APC APC2 APCDD1 APCDD1 L

APCS APEH APEX1 APEX2 APH1 A

APH1 B API5 APIP APITD1 APLF

APLN APLNR APLP1 APLP2 APOA1

APOA1 BP APOA2 APOA4 APOA5 APOB

APOB48R APOBEC1 APOBEC2 APOBEC3A APOBEC3B

APOBEC3C APOBEC3D APOBEC3F APOBEC3G APOBEC3H

APOBEC4 APOC1 APOC2 APOC3 APOC4

APOD APOE APOH APOL1 APOL2

APOL3 APOL4 APOL5 APOL6 APOLD1

APOM APOO APOOL APP APPBP2

APPL1 APPL2 APRT APTX AQP1

AQP1 0 AQP1 1 AQP12A AQP2 AQP3

AQP4 AQP5 AQP6 AQP7 AQP8

AQP9 AQR AR ARAF ARAP1

ARAP2 ARAP3 ARC ARCN1 ARD1 B

AREG ARF1 ARF3 ARF4 ARF5

ARF6 ARFGAP1 ARFGAP2 ARFGAP3 ARFGEF1

ARFGEF2 ARFIP1 ARFIP2 ARFRP1 ARG1

ARG2 ARGFX ARGLU1 ARHGAP1 ARHGAP1 0 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ARHGAP1 1 A ARHGAP1 1 B ARHGAP12 ARHGAP15 ARHGAP1 7

ARHGAP1 9 E

NST000003585

ARHGAP1 8 ARHGAP1 9 31 ARHGAP20 ARHGAP21

ARHGAP22 ARHGAP23 ARHGAP24 ARHGAP25 ARHGAP26

ARHGAP27 ARHGAP28 ARHGAP29 ARHGAP30 ARHGAP31

ARHGAP32 EN

ARHGAP32 ST00000310343 ARHGAP33 ARHGAP36 ARHGAP4

ARHGAP5 ARHGAP6 ARHGAP8 ARHGAP9 ARHGDIA

ARHGDIB ARHGDIG ARHGEF1 ARHGEF10 ARHGEF10L

ARHGEF10 ENS

T00000398564 ARHGEF1 1 ARHGEF12 ARHGEF15 ARHGEF16

ARHGEF17 ARHGEF18 ARHGEF19 ARHGEF2 ARHGEF3

ARHGEF4 ARHGEF5 ARHGEF5L ARHGEF6 ARHGEF7

ARHGEF9 ARID1 A ARID1 B ARID2 ARID3A

ARID4B EN ST00000264

ARID3B ARID3C ARID4A ARID4B 183

ARID5A ARID5B ARIH1 ARIH2 ARL1

ARL1 0 ARL1 1 ARL13A ARL13B ARL14

ARL1 5 ARL1 7B ARL2 ARL2BP ARL3

ARL4A ARL4C ARL4D ARL4P ARL5A

ARL5B ARL5C ARL6 ARL6IP1 ARL6IP4

ARL6IP5 ARL6IP6 ARL8A ARL8B ARL9

ARMC1 ARMC10 ARMC2 ARMC3 ARMC4

ARMC6 ARMC7 ARMC8 ARMC9 ARMCX1

ARMCX2 ARMCX3 ARMCX4 ARMCX5 ARMCX6

ARNT ARNT2 ARNTL ARNTL2 ARPC1 A

ARPC1 B ARPC2 ARPC3 ARPC4 ARPC5

ARPC5L ARPM1 ARPP-21 ARPP1 9 ARR3

ARRB1 ARRB2 ARRDC1 ARRDC2 ARRDC3

ARRDC4 ARSA ARSB ARSD ARSE

ARSF ARSG ARSH ARSI ARSJ

ARSK ART1 ART3 ART4 ART5

ARTN ARV1 ARVCF ARX AS3MT

ASAH1 ASAH2 ASAH2B ASAM ASAP1

ASAP2 ASAP3 ASB1 ASB10 ASB1 1

ASB12 ASB13 ASB14 ASB15 ASB16

ASB17 ASB18 ASB2 ASB3 ASB4

ASB5 ASB6 ASB7 ASB8 ASB9

ASCC1 ASCC2 ASCC3 ASCL1 ASCL2

ASGR1 ENS

T000003809

ASCL3 ASCL4 ASF1 B ASGR1 20

ASGR2 ASH1 L ASH2L ASIP ASL

ASMT ASMTL ASNA1 ASNS ASNSD1

ASNS ENSTOOO

00394309 AS PA ASPDH ASPH ASPHD1

ASPHD2 ASPM ASPN ASPRV1 ASPSCR1

ASRGL1 ASS1 ASTE1 ASTL ASTN1

ASTN2 ASXL1 ASXL2 ASXL3 ASZ1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ATAD2B ENS

ATAD1 ATAD2 ATAD2B T00000238789 ATAD3A

ATAD3B ENSTO

ATAD3B 0000378741 ATAD5 ATCAY ATE1

ATF1 ATF2 ATF3 ATF4 ATF5

ATF6 ATF6B ATF7IP ATF7IP2 ATG10

ATG12 ATG16L1 ATG16L2 ATG2A ATG2B

ATG4A ENST

ATG3 ATG4A 00000372232 ATG4C ATG4D

ATG5 ATG7 ATG9A ATG9B ATHL1

ATIC ATL1 ATL2 ATL3 ATM

ATM IN ATN1 ATOH1 ATOH7 ATOH8

ATP10A ATP10B ATP10D ATP1 1 A ATP1 1 B

ATP1 1 C ATP12A ATP13A1 ATP13A2 ATP 13 A3

ATP13A4 ATP13A5 ATP1 A1 ATP1 A2 ATP1 A3

ATP1 A4 ATP1 B1 ATP1 B2 ATP1 B3 ATP1 B4

ATP2A1 ATP2A2 ATP2A3 ATP2B1 ATP2B2

ATP2B3 ENSTO

ATP2B3 0000370186 ATP2B4 ATP2C1 ATP2C2

ATP4A ATP4B ATP5A1 ATP5B ATP5C1

ATP5D ATP5E ATP5F1 ATP5G1 ATP5G2

ATP5G3 ATP5H ATP5I ATP5J ATP5J2

ATP5L ATP50 ATP5S ATP5SL ATP6AP1

ATP6AP1 L ATP6AP2 ATP6V0A1 ATP6V0A2 ATP6V0A4

ATP6V0B ATP6V0C ATP6V0D1 ATP6V0D2 ATP6V0E1

ATP6V0E2L ATP6V1 A ATP6V1 B1 ATP6V1 B2 ATP6V1 C1

ATP6V1 C2 ATP6V1 D ATP6V1 E1 ATP6V1 E2 ATP6V1 F

ATP6V1 G1 ATP6V1 G2 ATP6V1 G3 ATP6V1 H ATP7A

ATP7B ATP8A1 ATP8A2 ATP8B1 ATP8B2

ATP8B4 ATP9A ATP9B ATPAF1 ATPAF2

ATPBD3 ATPBD4 ATPGD1 ATPIF1 ATR

ATRIP ATRN ATRNL1 ATRX ATXN1

ATXN10 ATXN2 ATXN2L ATXN3 ATXN3L

ATXN7 ATXN7L1 ATXN7L2 ATXN7L3 AUH

AUP1 AURKA AURKAIP1 AURKB AURKC

AUTS2 AVEN AVIL AVL9 AVP

AVPI1 AVPR1 A AVPR1 B AVPR2 AWAT1

AWAT2 AXIN1 AXIN2 AXL AZGP1

AZI1 AZI2 AZIN1 AZU1 B2M

B3GALNT1 B3GALNT2 B3GALT1 B3GALT2 B3GALT4

B3GALT5 B3GALT6 B3GALTL B3GAT1 B3GAT2

B3GAT3 B3GNT1 B3GNT2 B3GNT3 B3GNT4

B3GNT5 B3GNT6 B3GNT7 B3GNT8 B3GNTL1

B3Gn-T6 B4GALNT1 B4GALNT2 B4GALNT3 B4GALNT4

B4GALT1 B4GALT2 B4GALT3 B4GALT4 B4GALT5

B4GALT6 B4GALT7 B7 B9D1 B9D2

BAALC BAAT BACE1 BACE2 BACH1

BACH2 BAD BAG1 BAG 2 BAG3

BAG4 BAG 5 BAHD1 BAM BAI2

BAI3 BAIAP2 BAIAP2L1 BAIAP2L2 BAIAP3 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene

Name Name Name Name Name

BAK1 BAMBI BANF1 BANF2 BANK1

BANP BAP1 BARD1 BARHL1 BARHL2

BARX1 BARX2 BASP1 BAT1 BAT2

BAT2D1 ENSTO

BAT2D1 0000392078 BAT3 BAT4 BAT5

BATF BATF2 BATF3 BAX BAZ1 A

BAZ1 B BAZ2A BAZ2B BBC3 BBOX1

BBS1 BBS10 BBS12 BBS2 BBS4

BBS5 BBS7 BBS9 BBX BCAM

BCAN BCAP29 BCAP31 BCAR1 BCAR3

BCAS4 ENS

T000003587

BCAS1 BCAS2 BCAS3 BCAS4 91

BCAT1 BCAT2 BCCIP BCDIN3D BCHE

BCKDHA BCKDHB BCKDK BCL10 BCL1 1 A

BCL1 1 B BCL2 BCL2A1 BCL2L1 BCL2L10

BCL2L1 1 BCL2L12 BCL2L13 BCL2L14 BCL2L15

BCL2L2 BCL3 BCL6 BCL6B BCL7A

BCL7B BCL7C BCL9 BCL9L BCLAF1

BCM01 BC02 BCOR BCORL1 BCORL2

BCR BCS1 L BDH1 BDH2 BDKRB1

BDKRB2 BDNF BDP1 BECN1 BEGAIN

BEND2 BEND3 BEND4 BEND5 BEND6

BEND7 BEST1 BEST2 BEST3 BEST4

BET1 BET1 L BEX1 BEX2 BEX4

BEX5 BFAR BFSP1 BFSP2 BGLAP

BGN BHLHA1 5 BHLHB9 BHLHE22 BHLHE23

BHLHE40 BHLHE41 BHMT BHMT2 BICC1

BICD1 BICD2 BID BIK BIN1

BIN2 BIRC2 BIRC3 BIRC5 BIRC6

BIRC7 BIRC8 BIVM BLCAP BLID

BLK BLM BLMH BLNK BLOC1 S1

BLYM HUM

BL0C1 S2 BLOC1 S3 BLVRA BLVRB AN

BLZF1 BMF BMI1 BMP1 BMP10

BMP2K ENS

T000003350

BMP15 BMP2 BMP2K BMP2KL 16

BMP3 BMP4 BMP5 BMP6 BMP7

BMP8A BMP8B BMPER BMPR1 A BMPR1 B

BMPR2 BMS1 BMX BNC1 BNC2

BNIP1 BNIP2 BNIP3 BNIP3L BNIPL

BOC BOD1 BOD1 L BOK BOLA1

BOLA2 BOLA2B BOLA3 BOLL BOP1

BPGM BPHL BPI BPIL1 BPIL2

BPIL3 BPNT1 BPTF BPY2B BPY2C

BRAF BRAP BRCA1 BRCA2 BRCC3

BRD2 ENSTOO BRD3 ENST

BRD1 BRD2 000395289 BRD3 00000303407

BRD4 ENSTOOO

BRD4 00263377 BRD7 BRD8 BRD9 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

BRDT BRE BRF1 BRF2 BRI3

BRI3BP BRIP1 BRIX1 BRMS1 BRMS1L

BRP44 BRP44L BRPF1 BRPF3 BRS3

BRSK1 BRSK2 BRWD1 BRWD3 BSCL2

BSDC1 BSG BSN BSND BSPRY

BST1 BST2 BSX BTAF1 BTBD1

BTBD10 BTBD11 BTBD12 BTBD16 BTBD17

BTBD2 BTBD3 BTBD6 BTBD7 BTBD8

BTBD9 ENSTOO

BTBD9 000403056 BTC BTD BTF3

BTF3L1 BTF3L3 BTF3L4 BTG1 BTG2

BTG3 BTG4 BTK BTLA BTN1A1

BTN2A1 BTN2A2 BTN2A3 BTN3A1 BTN3A2

BTN3A3 BTNL2 BTNL8 BTNL9 BTRC

BUB1 BUB1B BUB3 BUD13 BUD31

BVES BYSL BZRAP1 BZW1 BZW2

C10orf10 C1 Oorf 104 C1 Oorf 107 C1 Oorf 11 C10orf111

C1 Oorf 113 ENST

C10orf113 00000377118 C10orf114 C10orf116 C10orf118

C1 Oorf 119 C1 Oorf 12 C1 Oorf 120 C1 Oorf 125 C1 Oorf 128

C10orf129 C1 Oorf 131 C1 Oorf 137 C1 Oorf 18 C10orf2

C10orf25 C10orf26 C10orf27 C10orf28 C10orf31

C10orf32 C10orf35 C10orf4 C10orf46 C10orf47

C10orf53 C10orf54 C10orf57 C10orf58 C10orf6

C10orf61 C10orf62 C10orf64 C10orf68 C10orf71

C10orf71 ENSTO

0000374144 C10orf72 C10orf76 C10orf78 C10orf79

C10orf81 C10orf82 C10orf84 C10orf88 C10orf90

C10orf91 C10orf92 C10orf93 C10orf95 C10orf96

C10orf99 C11orf1 C11orf10 C11orf16 C11orf17

C11orf2 C11orf24 C11orf30 C11orf34 C11orf35

C11orf40 C11orf41 C11orf42 C11orf44 C11orf45

C11orf46 C11orf47 C11orf48 C11orf49 C11orf51

C11orf52 C11orf53 C11orf54 C11orf57 C11orf58

C11orf59 C11orf60 C11orf61 C11orf63 C11orf65

C11orf66 C11orf67 C11orf68 C11orf70 C11orf73

C11orf74 C11orf75 C11orf76 C11orf77 C11orf82

C11orf83 C11orf84 C11orf85 C11orf86 C11orf87

C11orf88 C11orf9 C11orf92 C12orf10 C12orf11

C12orf12 C12orf23 C12orf24 C12orf26 C12orf28

C12orf29 C12orf32 C12orf34 C12orf35 C12orf36

C12orf37 C12orf39 C12orf4 C12orf40 C12orf42

C12orf43 C12orf44 C12orf45 C12orf48 C12orf49

C12orf5 C12orf50 C12orf52 C12orf54 C12orf55

C12orf56 C12orf57 C12orf59 C12orf60 C12orf61

C12orf62 C12orf63 C12orf64 C12orf65 C12orf66

C12orf67 C12orf68 C12orf69 C12orf72 C12orf74

C12orf76 C13orf1 C13orf15 C13orf16 C13orf23

C13orf26 C13orf27 C13orf28 C13orf30 C13orf31

C13orf33 C13orf34 C13orf35 C13orf36 C13orf37 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

C13orf39 C13orf40 C14orf1 C14orf100 C14orf101

C14orf102 C14orf104 C14orf105 C14orf106 C14orf109

C14orf1 15 C14orf1 18 C14orf1 19 C14orf126 C14orf128

C14orf129 C14orf135 C14orf138 C14orf142 C14orf143

C14orf145 C14orf147 C14orf148 C14orf149 C14orf153

C14orf156 C14orf159 C14orf166 C14orf167 C14orf173

C14orf174 C14orf177 C14orf178 C14orf179 C14orf180

C14orf181 C14orf182 C14orf183 C14orf2 C14orf20

C14orf21 C14orf23 C14orf28 C14orf37 C14orf38

C14orf39 C14orf4 C14orf43 C14orf45 C14orf48

C14orf49 C14orf50 C14orf68 C14orf73 C14orf79

C14orf80 C14orf93 C15orf17 C15orf2 C15orf23

C15orf24 C15orf26 C15orf27 C15orf29 C15orf32

C15orf33 C15orf38 C15orf39 C15orf40 C15orf42

C15orf43 C15orf44 C15orf48 C15orf52 C15orf53

C15orf54 C15orf55 C15orf56 C15orf57 C15orf58

C15orf59 C15orf63 C16orf1 1 C16orf13 C16orf3

C16orf35 C16orf38 C16orf42 C16orf45 C16orf46

C16orf48 C16orf5 C16orf53 C16orf54 C16orf55

C16orf57 C16orf58 C16orf59 C16orf61 C16orf62

C16orf63 C16orf65 C16orf68 C16orf7 C16orf70

C16orf71 C16orf72 C16orf73 C16orf75 C16orf78

C16orf79 C16orf80 C16orf85 C16orf87 C16orf88

C16orf89 C16orf91 C16orf92 C16orf93 C17orf 101

C17orf102 C17orf103 C17orf28 C17orf37 C17orf38

C17orf39 C17orf42 C17orf46 C17orf47 C17orf48

C17orf49 C17orf50 C17orf53 C17orf55 C17orf56

C17orf57 C17orf58 C17orf59 C17orf60 C17orf61

C17orf62 C17orf64 C17orf65 C17orf66 C17orf67

C17orf68 C17orf70 C17orf71 C17orf74 C17orf76

C17orf77 C17orf79 C17orf80 C17orf81 C17orf82

C17orf85 C17orf87 C17orf90 C17orf91 C17orf92

C17orf97 C17orf98 C18orf1 C18orf10 C18orf19

C18orf21 C18orf22 C18orf25 C18orf26 C18orf32

C18orf34 C18orf45 C18orf54 C18orf55 C18orf56

C18orf62 C18orf8 C19orf10 C19orf12 C19orf16

C19orf18 C19orf2 C19orf20 C19orf21 C19orf22

C19orf29 EN

ST00000429

C19orf24 C19orf26 C19orf28 C19orf29 344

C19orf33 C19orf35 C19orf36 C19orf39 C19orf40

C19orf41 C19orf42 C19orf43 C19orf44 C19orf45

C19orf46 C19orf47 C19orf48 C19orf50 C19orf51

C19orf52 C19orf53 C19orf56 C19orf57 C19orf59

C19orf6 C19orf60 C19orf61 C19orf63 C19orf67

C19orf75 C1 D C1 GALT1 C1 GALT1 C1 C1 QA

C1 QB C1 QBP C1 QC C1 QL1 C1 QL2

C1 QL3 C1 QL4 C1 QTNF1 C1 QTNF2 C1 QTNF3

C1 QTNF4 C1 QTNF5 C1 QTNF6 C1 QTNF7 C1 QTNF8

C1 QTNF9 C1 RL C1 S C1 orf100 C1 orf101

C1 orf103 C1 orf105 C1 orf106 C1 orf107 C1 orf109 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

C1orf111 C1orf112 C1orf113 C1orf114 C1orf115

C1orf116 C1orf122 C1orf123 C1orf124 C1orf125

C1orf127 C1orf128 C1orf129 C1orf130 C1orf131

C1orf135 C1orf14 C1orf141 C1orf144 C1orf146

C1orf147 C1orf150 C1orf151 C1orf156 C1orf158

C1orf161 C1orf162 C1orf163 C1orf164 C1orf167

C1orf168 C1orf170 C1orf172 C1orf173 C1orf174

C1orf175 C1orf177 C1orf182 C1orf183 C1orf186

C1orf187 C1orf189 C1orf190 C1orf192 C1orf194

C1orf198 C1orf201 C1orf21 C1orf210 C1orf212

C1orf213 C1orf216 C1orf218 C1orf220 C1orf222

C1orf227 C1orf229 C1orf25 C1orf26 C1orf31

C1orf34 C1orf35 C1orf38 C1orf43 C1orf49

C1orf50 C1orf51 C1orf52 C1orf54 C1orf55

C1orf56 C1orf57 C1orf58 C1orf59 C1orf61

C1orf63 C1orf64 C1orf65 C1orf66 C1orf67

C1orf68 C1orf69 C1orf74 C1orf77 C1orf83

C1orf84 C1orf85 C1orf86 C1orf87 C1orf88

C1orf89 C1orf9 C1orf91 C1orf92 C1orf93

C1orf94 C1orf95 C1orf96 C2 C20orf 103

C20orf106 C20orf107 C20orf108 C20orf 11 C20orf 111

C20orf112 C20orf114 C20orf 118 C20orf133 C20orf134

C20orf134 ENST

00000330271 C20orf135 C20orf141 C20orf144 C20orf151

C20orf 152 C20orf160 C20orf165 C20orf166 C20orf 177

C20orf185 C20orf186 C20orf187 C20orf191 C20orf 194

C20orf195 C20orf196 C20orf197 C20orf20 C20orf200

C20orf201 C20orf24 C20orf26 C20orf27 C20orf29

C20orf3 C20orf30 C20orf4 C20orf43 C20orf46

C20orf54 C20orf62 C20orf7 C20orf70 C20orf71

C20orf72 C20orf74 C20orf78 C20orf79 C20orf80

C20orf85 C20orf94 C20orf95 C20orf96 C21orf105

C21orf124 C21orf13 C21orf15 C21orf2 C21orf29

C21orf33 C21orf34 C21orf45 C21orf56 C21orf57

C21orf58 C21orf59 C21orf62 C21orf63 C21orf66

C21orf7 C21orf70 C21orf74 C21orf88 C21orf89

C21orf9 C21orf91 C22orf13 C22orf 15 C22orf23

C22orf24 C22orf25 C22orf26 C22orf28 C22orf29

C22orf30 C22orf31 C22orf32 C22orf33 C22orf36

C22orf39 C22orf40 C22orf42 C22orf43 C22orf9

C2CD2 C2CD2L C2CD3 C2CD4A C2CD4B

C2orf 15 C2orf 16 C2orf 18 C2orf24 C2orf27A

C2orf27B C2orf28 C2orf29 C2orf3 C2orf34

C2orf39 C2orf40 C2orf42 C2orf43 C2orf44

C2orf47 C2orf48 C2orf49 C2orf50 C2orf51

C2orf52 C2orf53 C2orf54 C2orf55 C2orf56

C2orf57 C2orf60 C2orf61 C2orf62 C2orf63

C2orf63 ENSTOO

000407122 C2orf64 C2orf65 C2orf66 C2orf67

C2orf68 C2orf69 C2orf7 C2orf70 C2orf71 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

C2orf76 C2orf77 C2orf79 C2orf80 C2orf82

C2orf83 C2orf84 C2orf85 C2orf86 C2orf88

C3 C3AR1 C3P1 C3orf1 C3orf14

C3orf 15 C3orf 17 C3orf 18 C3orf 19 C3orf20

C3orf21 C3orf22 C3orf23 C3orf24 C3orf25

C3orf26 C3orf27 C3orf28 C3orf30 C3orf31

C3orf32 C3orf33 C3orf34 C3orf35 C3orf36

C3orf37 C3orf38 C3orf39 C3orf43 C3orf45

C3orf46 C3orf49 C3orf53 C3orf54 C3orf57

C3orf58 C3orf59 C3orf62 C3orf63 C3orf64

C3orf67 C3orf70 C3orf72 C3orf75 C3orf77

C4A C4B C4BPA C4BPB C4orf14

C4orf 17 C4orf 19 C4orf21 C4orf22 C4orf23

C4orf26 C4orf27 C4orf31 C4orf32 C4orf33

C4orf34 C4orf35 C4orf36 C4orf37 C4orf39

C4orf40 C4orf41 C4orf42 C4orf43 C4orf44

C4orf46 C4orf49 C4orf50 C4orf6 C4orf7

C5 C5AR1 C5orf13 C5orf15 C5orf22

C5orf23 C5orf24 C5orf28 C5orf30 C5orf32

C5orf33 C5orf34 C5orf35 C5orf36 C5orf37

C5orf38 C5orf39 C5orf4 C5orf40 C5orf41

C5orf42 C5orf43 C5orf45 C5orf46 C5orf48

C5orf49 C5orf5 C5orf50 C5orf51 C5orf53

C5orf54 C5orf56 C6 C6orf1 C6orf10

C6orf 103 C6orf105 C6orf106 C6orf108 C6orf1 14

C6orf1 15 C6orf1 18 C6orf12 C6orf120 C6orf124

C6orf125 C6orf129 C6orf130 C6orf134 C6orf136

C6orf138 C6orf142 C6orf145 C6orf146 C6orf15

C6orf163 EN

ST00000369

C6orf150 C6orf 153 C6orf 154 C6orf 162 574

C6orf165 C6orf167 C6orf168 C6orf 170 C6orf 173

C6orf 174 C6orf 182 C6orf186 C6orf191 C6orf 192

C6orf195 C6orf201 C6orf203 C6orf204 C6orf21 1

C6orf213 C6orf218 C6orf221 C6orf222 C6orf223

C6orf224 C6orf225 C6orf227 C6orf25 C6orf26

C6orf27 C6orf35 C6orf47 C6orf48 C6orf49

C6orf57 C6orf58 C6orf62 C6orf64 C6orf70

C6orf72 C6orf81 C6orf87 C6orf89 C6orf94

C6orf97 C6orf98 C7 C7orf 1 1 C7orf 16

C7orf20 C7orf23 C7orf25 C7orf26 C7orf27

C7orf28A C7orf28B C7orf29 C7orf30 C7orf31

C7orf33 C7orf34 C7orf36 C7orf41 C7orf42

C7orf43 C7orf44 C7orf45 C7orf46 C7orf47

C7orf49 C7orf50 C7orf51 C7orf52 C7orf53

C7orf54 C7orf55 C7orf58 C7orf59 C7orf60

C7orf62 C7orf63 C7orf64 C7orf66 C7orf68

C7orf72 ENST

C7orf69 C7orf70 00000297001 C8A C8B

C8G C8orf12 C8orf13 C8orf14 C8orf30A

C8orf31 C8orf33 C8orf34 C8orf37 C8orf38 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

C8orf4 C8orf40 C8orf41 C8orf44 C8orf45

C8orf46 C8orf47 C8orf55 C8orf58 C8orf59

C8orf76 C8orf79 C8orf8 C8orf80 C8orf82

C8orf84 C8orf85 C8orf86 C9 C9orf100

C9orf 102 C9orf 103 C9orf106 C9orf 1 1 C9orf1 14

C9orf1 16 C9orf1 17 C9orf1 19 C9orf123 C9orf125

C9orf128 C9orf129 C9orf131 C9orf135 C9orf139

C9orf140 C9orf142 C9orf144 C9orf150 C9orf 152

C9orf 153 C9orf156 C9orf16 C9orf 163 C9orf 164

C9orf167 C9orf 170 C9orf171 C9orf21 C9orf23

C9orf24 C9orf25 C9orf3 C9orf30 C9orf37

C9orf4 C9orf40 C9orf41 C9orf43 C9orf46

C9orf47 C9orf48 C9orf5 C9orf50 C9orf51

C9orf56 C9orf6 C9orf62 C9orf64 C9orf66

C9orf68 C9orf7 C9orf71 C9orf72 C9orf75

C9orf78 C9orf79 C9orf80 C9orf82 C9orf84

C9orf85 C9orf86 C9orf89 C9orf9 C9orf91

C9orf98 EN ST00000298

C9orf93 C9orf95 C9orf96 C9orf98 545

CA1 CA10 CA1 1 CA12 CA13

CAM CA2 CA3 CA4 CA5A

CA5B CA5BP CA6 CA7 CA8

CA9 CAB39 CAB39L CABC1 CABIN1

CABLES1 CABLES2 CABP1 CABP2 CABP4

CABP5 CABP7 CABYR CACHD1 CACNA1 A

CACNA1 A ENST

00000357018 CACNA1 B CACNA1 C CACNA1 D CACNA1 E

CACNA1 H EN

ST0000035859

CACNA1 F CACNA1 G CACNA1 H 0 CACNA1 1

CACNA1 S CACNA2D1 CACNA2D2 CACNA2D3 CACNB1

CACNB2 CACNB3 CACNG1 CACNG2 CACNG3

CACNG4 CACNG5 CACNG6 CACNG7 CACNG8

CACYBP CAD CADM1 CADM2 CADM3

CADM4 CAD PS CADPS2 CAGE1 CALB1

CALB2 CALCA CALCB CALCOC01 CALCOC02

CALCR CALCR L CALD1 CALHM1 CALHM2

CALM1 CALM2 CALM3 CALML3 CALML4

CALML5 CALML6 CALN1 CALR CALR3

CALU CALY CAMK1 CAMK1 D CAMK1 G

CAMK2A CAMK2B CAMK2D CAMK2G CAMK2N1

CAMK2N2 CAMK4 CAMKK1 CAMKK2 CAMKV

CAMKV ENSTOO

000477224 CAMLG CAMP CAMSAP1 CAMSAP1 L1

CAMTA1 CAMTA2 CAND1 CAND2 CANT1

CANX CAP1 CAP2 CAPG CAPN1

CAPN10 CAPN1 1 CAPN12 CAPN13 CAPN2

CAPN3 CAPN5 CAPN6 CAPN7 CAPN9

CAPNS1 CAPRIN1 CAPRIN2 CAPS CAPS2

CAPSL CAPZA1 CAPZA2 CAPZA3 CAPZB HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CARD1 0 CARD1 1 CARD14 CARD16 CARD1 7

CARD1 8 CARD6 CARD8 CARD9 CARHSP1

CARKD CARM1 CARS CARS2 CARTPT

CASC1 CASC3 CASC4 CASC5 CASD1

CASK CASKIN1 CASKIN2 CASP1 CASP10

CASP14 CASP2 CASP3 CASP4 CASP5

CASP6 CASP7 CASP8 CASP9 CASQ1

CASQ2 CASR CASS4 CAST CASZ1

CAT CATSPER1 CATSPER2 CATSPER3 CATSPER4

CATSPERB CATSPERG CAV1 CAV2 CAV3

CBARA1 CBFA2T2 CBFA2T3 CBFB CBL

CBLB CBLC CBLL1 CBLN1 CBLN2

CBLN3 CBLN4 CBR1 CBR3 CBR4

CBS CBWD1 CBWD2 CBWD3 CBWD5

CBWD6 CBX1 CBX2 CBX3 CBX4

CBX5 CBX6 CBX7 CBX8 CBY1

CC2D1 A CC2D1 B CC2D2A CC2D2B CCAR1

CCBL2 ENSTO

CCBE1 CCBL1 CCBL2 0000370491 CCBP2

CCDC101 CCDC102A CCDC102B CCDC103 CCDC104

CCDC105 CCDC106 CCDC107 CCDC108 CCDC109A

CCDC109B CCDC1 1 CCDC1 10 CCDC1 1 1 CCDC1 12

CCDC1 13 CCDC1 14 CCDC1 15 CCDC1 1 6 CCDC1 17

CCDC12 CCDC120 CCDC121 CCDC122 CCDC123

CCDC124 CCDC125 CCDC126 CCDC127 CCDC128

CCDC132 EN

ST0000030586

CCDC13 CCDC130 CCDC132 6 CCDC134

CCDC135 CCDC137 CCDC138 CCDC14 CCDC140

CCDC141 CCDC142 CCDC144B CCDC144NL CCDC146

CCDC147 CCDC148 CCDC149 CCDC15 CCDC151

CCDC153 CCDC155 CCDC157 CCDC158 CCDC160

CCDC18 CCDC19 CCDC21 CCDC22 CCDC23

CCDC24 CCDC25 CCDC27 CCDC28A CCDC28B

CCDC29 CCDC3 CCDC30 CCDC33 CCDC34

CCDC35 CCDC36 CCDC37 CCDC38 CCDC39

CCDC40 CCDC41 CCDC42 CCDC46 CCDC47

CCDC48 CCDC50 CCDC51 CCDC52 CCDC54

CCDC55 CCDC56 CCDC58 CCDC59 CCDC6

CCDC60 CCDC62 CCDC63 CCDC64 CCDC65

CCDC66 CCDC67 CCDC68 CCDC69 CCDC7

CCDC70 CCDC71 CCDC72 CCDC73 CCDC74A

CCDC74B CCDC76 CCDC77 CCDC78 CCDC8

CCDC80 CCDC81 CCDC82 CCDC83 CCDC84

CCDC85A CCDC85B CCDC86 CCDC87 CCDC88A

CCDC88B CCDC89 CCDC9 CCDC90A CCDC90B

CCDC91 CCDC92 CCDC93 CCDC94 CCDC96

CCDC97 CCDC99 CCHCR1 CCIN CCK

CCKAR CCKBR CCL1 CCL1 1 CCL13

CCL14 CCL15 CCL16 CCL17 CCL18

CCL19 CCL2 CCL20 CCL21 CCL22 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CCL23 CCL24 CCL25 CCL26 CCL27

CCL28 CCL3 CCL3L1 CCL3L3 CCL4

CCL4L1 CCL4L2 CCL5 CCL7 CCL8

CCM2 CCNA1 CCNA2 CCNB1 CCNB1 IP1

CCNB3 ENST

CCNB2 CCNB3 00000376042 CCNC CCND1

CCND2 CCND3 CCNDBP1 CCNE1 CCNE2

CCNF CCNG1 CCNG2 CCNH CCNI

CCNI2 CCNJ CCNJL CCNL1 CCNL2

CCNO CCNT1 CCNT2 CCNY CCNYL1

CCNYL2 CCPG1 CCR1 CCR10 CCR2

CCR3 CCR4 CCR5 CCR6 CCR7

CCR8 CCR9 CCRL1 CCRL2 CCRN4L

CCS CCT2 CCT3 CCT4 CCT5

CCT6A CCT6B CCT7 CCT8 CCT8L1

CCT8L2 CD101 CD109 CD14 CD151

CD160 CD163 CD163L1 CD164 CD164L2

CD180 CD19 CD1 A CD1 B CD1 C

CD1 D CD1 E CD2 CD200 CD200R1

CD200R1 L CD207 CD209 CD22 CD226

CD244 CD247 CD248 CD27 CD274

CD276 CD28 CD2AP CD2BP2 CD300A

CD300C CD300E CD300LB CD300LD CD300LF

CD300LG CD302 CD320 CD33 CD34

CD36 ENSTOOO

CD36 00433696 CD37 CD38 CD3D

CD3E CD3EAP CD3G CD4 CD40

CD40LG CD44 CD46 CD47 CD48

CD5 CD52 CD53 CD55 CD58

CD59 CD5L CD6 CD63 CD68

CD69 CD7 CD70 CD72 CD74

CD79A CD79B CD80 CD81 CD82

CD83 CD84 CD86 CD8A CD8B

CD9 CD93 CD96 CD97 CD99

CD99L2 CDA CDADC1 CDAN1 CDC123

CDC14A CDC14B CDC16 CDC20 CDC20B

CDC23 CDC25A CDC25B CDC25C CDC26

CDC27 CDC2L2 CDC34 CDC37 CDC37L1

CDC37P1 CDC40 CDC42 CDC42BPA CDC42BPB

CDC42BPG CDC42EP1 CDC42EP2 CDC42EP3 CDC42EP4

CDC42EP5 CDC42SE1 CDC42SE2 CDC45L CDC5L

CDC6 CDC7 CDC73 CDCA2 CDC A3

CDCA4 CDCA5 CDCA7 CDCA7L CDCA8

CDCP1 CDCP2 CDH1 CDH10 CDH1 1

CDH12 CDH13 CDH15 CDH16 CDH17

CDH18 CDH19 CDH2 CDH20 CDH22

CDH23 CDH24 CDH26 CDH3 CDH4

CDH5 CDH6 CDH7 CDH8 CDH9

CDHR1 CDHR5 CDIPT CDK1 CDK1 0

CDK1 1 B CDK12 CDK13 CDK14 CDK1 5 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CDK1 ENST

CDK1 6 CDK1 7 CDK1 8 CDK19 00000395284

CDK2 CDK20 CDK2AP1 CDK2AP2 CDK3

CDK4 CDK5 CDK5R1 CDK5R2 CDK5RAP1

CDK5RAP2 CDK5RAP3 CDK6 CDK7 CDK8

CDK9 CDKAL1 CDKL1 CDKL2 CDKL3

CDKL4 CDKL5 CDKN1 A CDKN1 B CDKN1 C

CDKN2A CDKN2AIP CDKN2AIPNL CDKN2B CDKN2C

CDKN2D CDKN2a(p14) CDKN3 CDNF CD01

CDON CDR1 CDR2 CDRT1 CDRT15

CDRT4 CDS1 CDS2 CDSN CDT1

CDV3 CDX1 CDX2 CDX4 CDY1

CDY1 B CDY2A CDY2B CDYL CDYL2

CEACAM18 E

NST000004516

CEACAM1 CEACAM18 26 CEACAM19 CEACAM20

CEACAM3 CEACAM4 CEACAM5 CEACAM6 CEACAM7

CEACAM8 CEBPA CEBPB CEBPE CEBPG

CEBPZ CECR1 CECR2 CECR5 CECR6

CEL CELA1 CELA2A CELA2B CELA3A

CELA3B CELF1 CELF2 CELF3 CELF4

CELF5 CELF6 CELP CELSR1 CELSR2

CELSR3 CEMP1 CEND1 CENPA CENPB

CENPC1 CENPE CENPF CENPH CENPI

CENPJ CENPK CENPL CENPM CENPN

CENPO CENPP CENPQ CENPT CENPV

CEP1 10 CEP120 CEP135 CEP152 CEP164

CEP170 CEP170L CEP192 CEP250 CEP290

CEP55 CEP57 CEP63 CEP68 CEP70

CEP72 CEP76 CEP78 CEP97 CEPT1

CER1 CERCAM CERK CERKL CES1

CES1 ENST000

00360526 CES2 CES3 CES7 CES8

CETN1 CETN2 CETN3 CETP CFB

CFC1 CFC1 B CFD CFDP1 CFH

CFHR1 CFHR2 CFHR3 CFHR4 CFHR5

CFI CFL1 CFL2 CFLAR CFP

CFTR CGA CGB CGB1 CGB2

CGB5 CGB7 CGB8 CGGBP1 CGI-77

CGN CGNL1 CGREF1 CGRRF1 CH25H

CHAC1 CHAC2 CHAD CHADL CHAF1 A

CHAF1 B CHAT CHCHD1 CHCHD1 0 CHCHD2

CHCHD3 CHCHD4 CHCHD5 CHCHD6 CHCHD7

CHCHD8 CHCHD9 CHD1 CHD1 L CHD2

CHD3 CHD4 CHD5 CHD6 CHD7

CHD8 CHD9 CHDH CHEK1 CHEK2

CHERP CHFR CHGA CHGB CHI3L1

CHI3L2 CHIA CHIC1 CHIC2 CHID1

CHIT1 CHKA CHKB CHL1 CHM

CHML CHMP2A CHMP2B CHMP4A CHMP4B

CHMP4C CHMP5 CHMP6 CHMP7 CHN1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CHN2 CHODL CHORDC1 CHP CHP2

CHPF CHPF2 CHPT1 CHRAC1 CHRD

CHRDL1 CHRDL2 CHRFAM7A CHRM1 CHRM2

CHRM3 CHRM5 CHRNA1 CHRNA10 CHRNA2

CHRNA3 CHRNA4 CHRNA5 CHRNA6 CHRNA7

CHRNA9 CHRNB1 CHRNB2 CHRNB3 CHRNB4

CHRND CHRNE CHRNG CHST1 CHST10

CHST1 1 CHST12 CHST13 CHST14 CHST15

CHST2 CHST3 CHST4 CHST5 CHST6

CHST7 CHST8 CHST9 CHSY1 CHSY3

CHTF18 CHTF8 CHUK CHURC1 CIA01

CIAPIN1 CIB1 CIB2 CIB3 CIB4

CIC CIDEA CIDEB CIDEC CIITA

CILP CILP2 CINP CIR1 CIRBP

CIRH1 A CISD1 CISD1 B CISD2 CISH

CIT CITED1 CITED2 CITED4 CIZ1

CKAP2 CKAP2L CKAP4 CKAP5 CKB

CKLF CKM CKMT1 A CKMT1 B CKMT2

CKS1 B CKS2 CLASP1 CLASP2 CLC

CLCA1 CLCA2 CLCA3P CLCA4 CLCC1

CLCF1 CLCN1 CLCN2 CLCN3 CLCN4

CLCN5 CLCN6 CLCN7 CLCNKA CLCNKB

CLDN1 CLDN10 CLDN1 1 CLDN12 CLDN14

CLDN15 CLDN16 CLDN17 CLDN1 8 CLDN19

CLDN2 CLDN20 CLDN22 CLDN3 CLDN4

CLDN5 CLDN6 CLDN7 CLDN8 CLDN9

CLDND1 CLDND2 CLEC10A CLEC1 1 A CLEC12A

CLEC12B CLEC14A CLEC16A CLEC18A CLEC18B

CLEC18C CLEC1 A CLEC1 B CLEC2B CLEC2D

CLEC3A CLEC3B CLEC4A CLEC4C CLEC4D

CLEC4E CLEC4F CLEC4G CLEC4M CLEC5A

CLEC6A CLEC7A CLEC9A CLECL1 CLGN

CLIC1 CLIC2 CLIC3 CLIC4 CLIC5

CLIC6 CLIP1 CLIP2 CLIP3 CLIP4

CLK1 CLK2 CLK3 CLK4 CLLU1

CLLU10S CLMN CLN3 CLN5 CLN6

CLN8 CLNS1 A CLOCK CLP1 CLPB

CLPP CLPS CLPTM1 CLPTM1 L CLPX

CLRN1 CLRN2 CLRN3 CLSPN CLSTN1

CLSTN2 CLSTN3 CLTA CLTB CLTC

CLTCL1 CLU CLUAP1 CLUL1 CLVS2

CLYBL CMA1 CMAS CMBL CMC1

CMKLR1 CMPK1 CMPK2 CMTM1 CMTM2

CMTM3 CMTM4 CMTM5 CMTM6 CMTM7

CMTM8 CMYA5 CNBP CNDP1 CNDP2

CNFN CNGA1 CNGA2 CNGA3 CNGA4

CNGB1 CNGB3 CNIH CNIH2 CNIH3

CNIH4 CNKSR1 CNKSR2 CNKSR3 CNN1

CNN2 CNN3 CNNM1 CNNM2 CNNM3

CNNM4 CNO CNOT1 CNOT10 CNOT2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CNOT3 CNOT4 CNOT6 CNOT6L CNOT7

CNOT8 CNP CNPY1 CNPY2 CNPY3

CNPY4 CNR1 CNR2 CNRIP1 CNST

CNTD1 CNTD2 CNTF CNTFR CNTLN

CNTN1 CNTN2 CNTN3 CNTN4 CNTN5

CNTN6 CNTNAP1 CNTNAP2 CNTNAP3 CNTNAP4

CNTNAP5 CNTROB COASY COBL COBLL1

COBRA1 COCH COE4 HUMAN COG1 COG2

COG3 COG4 COG5 COG6 COG7

COG8 COIL COL10A1 COL1 1 A1 COL1 1 A2

COL12A1 COL13A1 COL14A1 COL15A1 COL16A1

COL17A1 COL18A1 COL19A1 COL1 A1 COL1 A2

COL20A1 COL22A1 COL23A1 COL24A1 COL25A1

COL27A1 COL28A1 COL2A1 COL3A1 COL4A1

COL4A2 COL4A3 COL4A3BP COL4A4 COL4A5

COL4A6 COL5A1 COL5A2 COL5A3 COL6A1

COL6A2 COL6A3 COL6A6 COL7A1 COL8A1

COL8A2 COL9A1 COL9A2 COL9A3 COLEC10

COLEC1 1 COLEC12 COLO COMMD1 COMMD1 0

COMMD2 COMMD3 COMMD4 COMMD5 COMMD6

COMMD7 COMMD8 COMMD9 COMP COMT

COMTD1 COPA COPB1 COPB2 COPE

COPG COPS2 COPS3 COPS4 COPS5

COPS6 COPS7A COPS7B COPS8 COPZ1

COQ10A COQ10B COQ2 COQ3 COQ4

COQ5 COQ6 COQ7 COQ9 CORIN

COR01 A COR01 B COR01 C COR02A COR02B

COR06 COR07 CORT COTL1 COX10

COX1 1 COX15 COX16 COX17 COX18

COX19 COX4I1 COX4I2 COX4NB COX5A

COX6B1 EN ST00000392

COX5B COX6A1 COX6A2 COX6B1 201

COX6B2 COX6BP3 COX6C COX7A1 COX7A2

COX7A2L COX7AP2 COX7B COX7B2 COX7C

COX8A COX8C CP CP1 10 CPA1

CPA2 CP A3 CPA4 CPA5 CPA6

CPAMD8 CPB1 CPB2 CPD CPE

CPEB1 CPEB2 CPEB3 CPEB4 CPLX2

CPLX3 CPLX4 CPM CPN1 CPN2

CPNE1 CPNE2 CPNE3 CPNE4 CPNE5

CPNE6 CPNE7 CPNE8 CPNE9 CPO

CPOX CPPED1 CPS1 CPSF1 CPSF2

CPSF3 CPSF3L CPSF4 CPSF4L CPSF6

CPSF7 CPT1 A CPT1 B CPT1 C CPT2

CPVL CPXCR1 CPXM1 CPXM2 CPZ

CR1 CR1 L CR2 CRABP1 CRABP2

CRADD CRAT CRB1 CRB2 CRB3

CRBN CRCP CRCT1 CREB1 CREB3

CREB3L1 CREB3L2 CREB3L3 CREB3L4 CREB5

CREBBP CREBL2 CREBZF CREG1 CREG2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CREM ENSTO

CRELD1 CRELD2 CREM 0000395887 CRH

CRHBP CRHR1 CRHR2 CRIM1 CRIP1

CRIP2 CRIP3 CRIPAK CRIPT CRISP1

CRISP2 CRISP3 CRISPLD1 CRISPLD2 CRK

CRKL CRLF1 CRLF2 CRLF3 CRLS1

CRMP1 CRNKL1 CRNN CROCC CROT

CRP CRSP3 CRTAC1 CRTAM CRTAP

CRTC1 CRTC2 CRTC3 CRX CRY1

CRY2 CRYAA CRYAB CRYBA1 CRYBA2

CRYBA4 CRYBB1 CRYBB2 CRYBB3 CRYBG3

CRYGA CRYGB CRYGC CRYGD CRYGN

CRYGS CRYL1 CRYM CRYZ CRYZL1

CS CSAD CSAG1 CSAG2 CSAG3

CSAG4 CSDA CSDC2 CSDE1 CSE1 L

CSF1 CSF1 R CSF2 CSF2RA CSF2RB

CSF3 CSF3R CSGALNACT1 CSGALNACT2 CSH1

CSMD1 ENS

T000003182

CSH2 CSHL1 CSK CSMD1 52

CSMD2 CSMD3 CSN2 CSN3 CSNK1 A1

CSNK1 E ENS

CSNK1 A1 L CSNK1 D CSNK1 E T00000403904 CSNK1 G1

CSNK1 G2 CSNK1 G3 CSNK2A1 CSNK2A2 CSNK2B

CSPG4 CSPG5 CSPP1 CSRNP1 CSRNP2

CSRNP3 CSRP1 CSRP2 CSRP2BP CSRP3

CST1 CST1 1 CST2 CST3 CST4

CST5 CST6 CST7 CST8 CST9

CST9L CSTA CSTB CSTF1 CSTF2

CSTF2T CSTF3 CSTL1 CT45-1 CT45A2

CT45A3 CT45A4 CT45A5 CT45A6 CT47A1

CT47A10 CT47A1 1 CT47A2 CT47A3 CT47A4

CT47A5 CT47A6 CT47A7 CT47A8 CT47A9

CTAG2 ENST

CTAG1 A CTAG1 B CTAG2 00000247306 CTAGE5

CTBP1 CTBP2 CTBS CTCF CTCFL

CTD-2267G17 3 CTDP1 CTDSP1 CTDSP2 CTDSPL

CTDSPL2 CTF1 CTGF CTH CTHRC1

CTNNA2 ENS

CTLA4 CTNNA1 CTNNA2 T00000466387 CTNNA3

CTNNAL1 CTNNB1 CTNNBIP1 CTNNBL1 CTNND1

CTNND2 CTNS CTPS CTPS2 CTR9

CTRB1 CTRB2 CTRC CTRL CTSA

CTSB CTSC CTSD CTSE CTSF

CTSG CTSH CTSK CTSL1 CTSL2

CTSL3 CTSO CTSS CTSW CTSZ

CTTN CTTNBP2 CTTNBP2NL CTU2 CTXN1

CU085 HUMA

CTXN3 CU041 HUMAN N CUBN CUEDC1

CUEDC2 CUL1 CUL2 CUL3 CUL4A HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

CUL4B ENSTOO

CUL4B 000371322 CUL5 CUL7 CUL9

CUX1 ENSTOO

CUTA CUTC CUX1 000292538 CUX2

CUZD1 CWC22 CWC27 CWF19L1 CWF19L2

CWH43 CX3CL1 CX3CR1 CXADR CXCL1

CXCL10 CXCL1 1 CXCL12 CXCL13 CXCL14

CXCL16 CXCL17 CXCL2 CXCL3 CXCL5

CXCL6 CXCL9 CXCR1 CXCR2 CXCR3

CXCR4 CXCR5 CXCR6 CXCR7 CXXC1

CXXC4 CXXC5 CXorfl CXorfl 5 CXorfl 9

CXorf21 CXorf22 CXorf23 CXorf24 CXorf25

CXorf26 CXorf27 CXorf28 CXorf29 CXorf30

CXorf31 CXorf35 CXorf36 CXorf38 CXorf40A

CXorf40B CXorf41 CXorf42 CXorf48 CXorf56

CXorf57 CXorf58 CXorf59 CXorf61 CXorf62

CXorf65 CXorf66 CXorf67 CYB561 CYB561 D1

CYB561 D2 CYB5A CYB5B CYB5D1 CYB5D2

CYB5R1 CYB5R2 CYB5R3 CYB5R4 CYBA

CYBASC3 CYBB CYBRD1 CYC1 CYCS

CYCSP52 CYFIP1 CYFIP2 CYGB CYHR1

CYLC1 CYLC2 CYLD CYP1 1 A1 CYP1 1 B1

CYP1 1 B2 CYP17A1 CYP19A1 CYP1 A1 CYP1 A2

CYP1 B1 CYP20A1 CYP21 A2 CYP24A1 CYP26A1

CYP26B1 CYP26C1 CYP27A1 CYP27B1 CYP27C1

CYP2A13 CYP2A6 CYP2A7 CYP2B6 CYP2B7P1

CYP2C1 8 CYP2C1 9 CYP2C8 CYP2C9 CYP2D6

CYP2E1 CYP2F1 CYP2J2 CYP2R1 CYP2S1

CYP2U1 CYP2W1 CYP39A1 CYP3A4 CYP3A43

CYP3A5 CYP3A7 CYP46A1 CYP4A1 1 CYP4A22

CYP4B1 CYP4F1 1 CYP4F12 CYP4F2 CYP4F22

CYP4F3 CYP4F8 CYP4V2 CYP4X1 CYP4Z1

CYP51 A1 CYP7A1 CYP7B1 CYP8B1 CYR61

CYS1 CYSLTR1 CYSLTR2 CYTH1 CYTH2

CYTH3 CYTH4 CYTIP CYTL1 CYTSA

CYTSB CYYR1 CYorf 15B CaMKI b D2HGDH

D4S234E DAAM1 DAAM2 DAB1 DAB2

DACH2 ENST

DAB2IP DACH1 DACH2 00000373131 DACT1

DACT2 DAD1 DAG1 DAG LA DAG LB

DAMS HUMA

DAK DALRD3 N DAND5 DAO

DAOA DAP DAP3 DAPK1 DAPK2

DAPK3 DAPL1 DAPP1 DARC DARS

DARS2 DAXX DAZ2 DAZ3 DAZAP1

DAZAP2 DAZL DBC1 DBF4 DBF4B

DBF4B ENSTOO

000315005 DBH DBI DBN1 DBNDD1

DBNDD2 DBNL DBP DBR1 DBT

DBX1 DBX2 DCAF10 DCAF12 DCAF12L1

DCAF12L2 DCAF13 DCAF15 DCAF1 6 DCAF17 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

DCAF4 DCAF4L1 DCAF4L2 DCAF5 DCAF6

DCAF7 DCAF8 DCAF8L1 DCAF8L2 DCAKD

DCBLD1 DCBLD2 DCC DCD DCDC1

DCDC2 DCDC5 DCHS1 DCHS2 DCI

DCK DCLK1 DCLK2 DCLK3 DCLRE1 A

DCLRE1 C EN

ST0000037827

DCLRE1 B DCLRE1 C 8 DCN DCP1 A

DCP1 B DCP2 DCPS DCST1 DCST2

DCT DCTD DCTN1 DCTN3 DCTN4

DCTN5 DCTN6 DCTPP1 DCUN1 D1 DCUN1 D2

DCUN1 D3 DCUN1 D4 DCUN1 D5 DCX DCXR

DDA1 DDAH1 DDAH2 DDB1 DDB2

DDC DDHD1 DDHD2 DDI1 DDI2

DDIT3 DDIT4 DDIT4L DDN DDO

DDOST DDR1 DDR2 DDRGK1 DDT

DDTL DDX1 DDX10 DDX1 1 DDX12

DDX12 ENSTOO

000432996 DDX17 DDX18 DDX19A DDX19B

DDX20 DDX21 DDX23 DDX24 DDX25

DDX26B DDX27 DDX28 DDX31 DDX39

DDX3X DDX3Y DDX4 DDX41 DDX42

DDX43 DDX46 DDX47 DDX49 DDX5

DDX50 DDX51 DDX52 DDX53 DDX54

DDX55 DDX56 DDX58 DDX59 DDX6

DDX60 ENSTO

DDX60 DDX60L 0000393743 DEAF1 01 -Dec

DECR1 DECR2 DEDD DEDD2 DEF6

DEF8 DEFA1 DEFA1 B DEFA3 DEFA4

DEFA5 DEFA6 DEFB1 DEFB103A DEFB103B

DEFB104A DEFB104B DEFB105A DEFB105B DEFB106A

DEFB106B DEFB107A DEFB107B DEFB108B DEFB1 10

DEFB1 1 1 DEFB1 12 DEFB1 13 DEFB1 14 DEFB1 15

DEFB1 16 DEFB1 18 DEFB1 19 DEFB121 DEFB123

DEFB124 DEFB125 DEFB126 DEFB127 DEFB128

DEFB129 DEFB130 DEFB131 DEFB132 DEFB134

DEFB135 DEFB136 DEFB4A DEGS1 DEGS2

DEK DEM1 DENND1 A DENND1 B DENND1 C

DENND2A DENND2C DENND2D DENND3 DENND4A

DENND4B DENND4C DENND5A DENND5B DEPDC1

DEPDC1 B DEPDC4 DEPDC5 DEPDC6 DEPDC7

DERL1 DERL2 DERL3 DES DET1

DEXI DFFA DFFB DFNA5 DFNB31

DFNB59 DGAT1 DGAT2 DGAT2L6 DGCR14

DGCR2 DGCR6 DGCR6L DGCR8 DGKA

DGKB DGKD DGKE DGKG DGKH

DGKI DGKK DGKQ DGKZ DGUOK

DHCR24 DHCR7 DHDDS DHDH DHDPSL

DHFR DHFRL1 DHH DHODH DHPS

DHRS1 DHRS1 1 DHRS12 DHRS13 DHRS2

DHRS3 DHRS4 DHRS4L2 DHRS7 DHRS7B HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

DHRS9 DHRSX DHTKD1 DHX15 DHX16

DHX29 DHX30 DHX32 DHX33 DHX34

DHX35 DHX36 DHX37 DHX38 DHX40

DHX57 DHX58 DHX8 DHX9 DIABLO

DIAPH1 DIAPH2 DIAPH3 DICER1 DID01

DIMT1 L DI01 DI03 DIP2B DIP2C

DIRAS1 DIRAS2 DIRAS3 DIRC1 DIRC2

DIS3 DIS3L DIS3L2 DISC1 DISP1

DKFZP434P17 DKFZP5640

DISP2 DIXDC1 DKC1 50 0823

DKFZP566M1 14 DKK1 DKK2 DKK3 DKK4

DLC1 ENSTOO

DKKL1 DLAT DLC1 000316609 DLD

DLEC1 DLEU2L DLG1 DLG2 DLG3

DLGAP2 EN

DLG4 ENSTOOO ST00000356 00293813 DLG5 DLGAP1 DLGAP2 067

DLGAP3 DLGAP4 DLGAP5 DLK1 DLK2

DLL1 DLL3 DLL4 DLST DLX1

DLX2 DLX3 DLX4 DLX5 DLX6

DMAP1 DMBT1 DMBX1 DMC1 DMD

DMD ENSTOOOO

0378687 DMGDH DMKN DMP1 DMPK

DMRT2 ENST

DMRT1 DMRT2 00000302441 DMRT3 DMRTA1

DMRTB1 DMRTC1 DMRTC1 B DMRTC2 DMTF1

DMWD DMXL1 DMXL2 DNA2L DNAH1

DNAH1 0_same_

DNAH1 0 name DNAH1 1 DNAH12L DNAH14

DNAH1 ENSTOO

DNAH1 7 000420323 DNAH2 DNAH3 DNAH5

DNAH6 DNAH7 DNAH8 DNAH9 DNAI1

DNAI2 DNAJA1 DNAJA2 DNAJA3 DNAJA4

DNAJB1 DNAJB1 1 DNAJB12 DNAJB13 DNAJB14

DNAJB2 DNAJB4 DNAJB5 DNAJB6 DNAJB7

DNAJB8 DNAJB9 DNAJC1 DNAJC10 DNAJC1 1

DNAJC12 DNAJC13 DNAJC14 DNAJC15 DNAJC1 6

DNAJC1 7 DNAJC1 8 DNAJC1 9 DNAJC2 DNAJC21

DNAJC25-

DNAJC22 DNAJC24 DNAJC25 GNG10 DNAJC27

DNAJC28 DNAJC3 DNAJC30 DNAJC4 DNAJC5

DNAJC5B DNAJC5G DNAJC6 DNAJC7 DNAJC8

DNAJC9 DNAL4 DNALI1 DNAPTP6 DNASE1

DNASE1 L1 DNASE1 L2 DNASE1 L3 DNASE2 DNASE2B

DNHD1 ENST

DND1 DNER 00000254579 DNHL1 DNLZ

DNM1 DNM1 L DNM2 DNM3 DNMBP

DNMT1 DNMT3A DNMT3B DNMT3L DNPEP

DNTT DNTTIP1 DOC2A DOCK1 DOCK10

DOCK10 ENSTO DOCK3 ENS 0000373702 DOCK1 1 DOCK2 DOCK3 T000002660 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

37

DOCK4 D0CK5 DOCK6 DOCK7 DOCK8

DOCK9 DOHH DOK1 DOK2 DOK3

DOK4 DOK5 DOK6 DOK7 DOLK

DOLPP1 DOM3Z DONSON DOPEY1 DOPEY2

DOT1 L DPAGT1 DPCR1 DPEP1 DPEP2

DPH1 -

DPEP3 DPF1 DPF2 DPH1 OVCA2

DPH2 DPH3 DPH3B DPH5 DPMI

DPM2 DPM3 DPP10 DPP3 DPP4

DPP6 DPP7 DPP8 DPP9 DPPA2

DPP A3 DPPA4 DPPA5 DPRX DPT

DPY19L1 DPY19L2 DPY19L3 DPY19L4 DPY30

DPYD DPYS DPYSL2 DPYSL3 DPYSL4

DPYSL5 DQX1 DR1 DRAM1 DRAM2

DRAP1 DRD1 DRD2 DRD3 DRD4

DRD5 DRD5P1 DRG1 DRG2 DRP2

DSC1 DSC2 DSC3 DSCAM DSCAML1

DSCC1 DSCR3 DSCR4 DSCR6 DSE

DSEL DSG1 DSG2 DSG3 DSG4

DSN1 DSP DSPP DST DSTN

DST ENSTOOOO DST ENSTOOO

DSTYK 0370754 00370769 DTD1 DTHD1

DTL DTNA DTNB DTNBP1 DTWD1

DTWD2 DTX1 DTX2 DTX3 DTX3L

DTX4 DTYMK DULLARD DUOX1 DUOX2

DU0XA1 DUOXA2 DUPD1 DUS1 L DUS2L

DUS3L DUS4L DUSP1 DUSP10 DUSP1 1

DUSP13 ENS

DUSP12 DUSP13 T00000356369 DUSP14 DUSP15

DUSP16 DUSP18 DUSP19 DUSP2 DUSP21

DUSP22 DUSP23 DUSP26 DUSP27 DUSP28

DUSP3 DUSP4 DUSP5 DUSP5P DUSP6

DUSP7 DUSP8 DUSP9 DUT DUXA

DVL1 DVL2 DVL3 DYDC1 DYDC2

DYM DYNC1 H1 DYNC1 I1 DYNC1 I2 DYNC1 LI1

DYNC2H1 EN

ST0000039809

DYNC1 LI2 DYNC2H1 3 DYNC2LI1 DYNLL1

DYNLL2 DYNLRB1 DYNLRB2 DYNLT1 DYNLT3

DYRK1 A DYRK1 B DYRK2 DYRK3 DYRK4

DYSF DYSFIP1 DYX1 C1 DZIP1 DZIP1 L

DZIP3 E2F1 E2F2 E2F3 E2F4

E2F5 E2F6 E2F7 E2F8 E4F1

EAF1 EAF2 EAPP EARS2 EBAG9

EBF1 EBF3 EBI3 EBNA1 BP2 EBP

EBPL ECD ECE1 ECE2 ECEL1

ECH1 ECHDC1 ECHDC2 ECHDC3 ECHS1

ECM1 ECM2 ECOP ECSIT ECT2

ECT2L EDA EDA2R EDAR EDARADD HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

EDC3 EDC4 EDDM3A EDDM3B EDEM1

EDEM2 EDEM3 EDF1 EDG6 EDIL3

EDN1 EDN2 EDN3 EDNRA EDNRB

EEA1 EED EEF1 A1 EEF1 A1 P1 1 EEF1 A2

EEF1 B2 EEF1 D EEF1 E1 EEF2 EEF2K

EEFSEC EEPD1 EFCAB1 EFCAB2 EFCAB3

EFCAB4A EFCAB4B EFCAB5 EFCAB6 EFCAB7

EFEMP1 EFEMP2 EFHA1 EFHA2 EFHB

EFHC1 EFHC2 EFHD1 EFHD2 EFNA1

EFNA2 EFNA3 EFNA4 EFNA5 EFNB1

EFNB2 EFNB3 EFR3A EFS EFTUD1

EFTUD2 EGF EGFL4 EGFL6 EGFL7

EGFR ENSTO

EGFL8 EG FLAM EGFR 0000344576 EGLN1

EGLN2 EGLN3 EGR1 EGR2 EGR3

EGR4 EHBP1 EHBP1 L1 EHD1 EHD2

EHD3 EHD4 EHF EHHADH EHMT1

EHMT2 EI24 EID1 EID2 EID2B

EIF1 EIF1 AD EIF1 AX EIF1 AY EIF1 B

EIF2A EIF2AK1 EIF2AK2 EIF2AK3 EIF2AK4

EIF2A ENSTOOO

00487799 EIF2B1 EIF2B2 EIF2B3 EIF2B4

EIF2B5 EIF2C1 EIF2C2 EIF2C3 EIF2C4

EIF2S1 EIF2S2 EIF2S3 EIF3A EIF3B

EIF3C EIF3CL EIF3D EIF3E EIF3EIP

EIF3F EIF3G EIF3H EIF3I EIF3J

EIF3K EIF3M EIF3S8 EIF4A1 EIF4A2

EIF4A3 EIF4B EIF4E EIF4E2 EIF4E3

EIF4EBP1 EIF4EBP2 EIF4EBP3 EIF4ENIF1 EIF4G1

EIF4G2 EIF4G3 EIF4H EIF5 EIF5A

EIF5A2 EIF5B EIF6 ELAC1 ELAC2

ELANE ELAVL1 ELAVL2 ELAVL3 ELAVL4

ELF1 ELF2 ELF3 ELF4 ELF5

ELFN2 ELK1 ELK3 ELK4 ELL

ELL2 ELL3 ELM01 ELM02 ELM03

ELMOD2 ELMOD3 ELN ELOF1 ELOVL1

ELOVL2 ELOVL3 ELOVL4 ELOVL5 ELOVL6

ELOVL7 ELP2 ELP3 ELP4 ELSPBP1

ELTD1 EMB EMCN EMD EME1

EME2 EMID1 EMID2 EMILIN1 EMILIN2

EMILIN3 EML1 EML2 EML3 EML4

EML5 EMP1 EMP2 EMP3 EMR1

EMR2 EMR3 EMR4 EMX1 EMX2

EN1 EN2 ENAH ENAM ENC1

ENDOD1 ENDOG ENDOU ENG ENGASE

ENHO ENKUR EN01 EN02 EN03

EN04 ENOPH1 ENOSF1 ENOX1 EN 0X2

ENPEP ENPP1 ENPP2 ENPP3 ENPP4

ENSG00000

ENPP5 ENPP6 ENPP7 ENSA 038102 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ENSG000000644 ENSG000000686 ENSG0000010 ENSG0000010 ENSG00000 89 50 1152 2445 104880

ENSG000001062 ENSG000001078 ENSG0000011 ENSG0000011 ENSG00000 32 16 5339 7540 118519

ENSG000001189 ENSG000001232 ENSG0000012 ENSG0000012 ENSG00000 28 57 4224 4677 124854

ENSG000001249 ENSG000001256 ENSG0000012 ENSG0000012 ENSG00000 15 31 5822 5881 125964

ENSG000001260 ENSG000001262 ENSG0000012 ENSG0000012 ENSG00000 02 17 8422 8563 129973

ENSG000001302 ENSG000001302 ENSG0000013 ENSG0000013 ENSG00000 25 41 1484 5213 135702

ENSG000001357 ENSG000001370 ENSG0000013 ENSG0000013 ENSG00000 49 21 7746 9239 140209

ENSG000001428 ENSG000001429 ENSG0000014 ENSG0000014 ENSG00000 32 51 3910 4396 145642

ENSG000001467 ENSG000001471 ENSG0000014 ENSG0000014 ENSG00000 36 13 8667 8713 148805

ENSG000001496 ENSG000001496 ENSG0000015 ENSG0000015 ENSG00000 18 58 0980 3081 154732

ENSG000001563 ENSG000001565 ENSG0000015 ENSG0000015 ENSG00000 67 09 7819 7999 158185

ENSG000001583 ENSG000001584 ENSG0000015 ENSG0000016 ENSG00000 01 03 9239 1643 162568

ENSG000001626 ENSG000001626 ENSG0000016 ENSG0000016 ENSG00000 21 44 2734 2767 162872

ENSG000001631 ENSG000001631 ENSG0000016 ENSG0000016 ENSG00000 44 82 3612 4159 164236

ENSG000001642 ENSG000001645 ENSG0000016 ENSG0000016 ENSG00000 41 00 4845 4860 164946

ENSG000001651 ENSG000001651 ENSG0000016 ENSG0000016 ENSG00000 14 24 5429 5851 165935

ENSG000001660 ENSG000001663 ENSG0000016 ENSG0000016 ENSG00000 13 29 6492 6593 166707

ENSG000001672 ENSG000001673 ENSG0000016 ENSG0000016 ENSG00000 81 90 7433 7442 167475

ENSG000001680 ENSG000001681 ENSG0000016 ENSG0000016 ENSG00000 38 13 8561 9664 169697

ENSG000001702 ENSG000001708 ENSG0000017 ENSG0000017 ENSG00000 38 17 0987 1084 171459

ENSG000001718 ENSG000001718 ENSG0000017 ENSG0000017 ENSG00000 41 78 1995 2070 172212

ENSG000001722 ENSG000001727 ENSG0000017 ENSG0000017 ENSG00000 61 64 2786 2823 172895

ENSG000001728 ENSG000001729 ENSG0000017 ENSG0000017 ENSG00000 99 00 2963 3115 173213

ENSG000001736 ENSG000001736 ENSG0000017 ENSG0000017 ENSG00000 09 71 3679 3774 173780

ENSG000001738 ENSG000001738 ENSG0000017 ENSG0000017 ENSG00000 20 63 3961 3968 174028 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ENSG000001740 ENSG000001741 ENSG0000017 ENSG0000017 ENSG00000 57 04 4121 4126 174144

ENSG000001743 ENSG000001744 ENSG0000017 ENSG0000017 ENSG00000 98 40 4459 4483 174658

ENSG000001746 ENSG000001748 ENSG0000017 ENSG0000017 ENSG00000 81 80 5117 5143 175267

ENSG000001758 ENSG000001758 ENSG0000017 ENSG0000017 ENSG00000 22 56 6050 6207 176220

ENSG000001767 ENSG000001768 ENSG0000017 ENSG0000017 ENSG00000 57 19 6900 6937 176951

ENSG000001769 ENSG000001771 ENSG0000017 ENSG0000017 ENSG00000 60 11 7634 7835 177858

ENSG000001778 ENSG000001780 ENSG0000017 ENSG0000017 ENSG00000 63 06 8225 8322 178510

ENSG000001785 ENSG000001785 ENSG0000017 ENSG0000017 ENSG00000 46 85 9294 9312 179326

ENSG000001793 ENSG000001795 ENSG0000017 ENSG0000017 ENSG00000 60 74 9702 9755 179824

ENSG000001798 ENSG000001801 ENSG0000018 ENSG0000018 ENSG00000 51 50 0494 0518 180519

ENSG000001806 ENSG000001807 ENSG0000018 ENSG0000018 ENSG00000 49 15 0882 1437 181669

ENSG000001818 ENSG000001819 ENSG0000018 ENSG0000018 ENSG00000 82 22 2053 2065 182150

ENSG000001825 ENSG000001826 ENSG0000018 ENSG0000018 ENSG00000 53 25 2729 2933 182957

ENSG000001830 ENSG000001830 ENSG0000018 ENSG0000018 ENSG00000 00 59 3096 3122 183144

ENSG000001831 ENSG000001832 ENSG0000018 ENSG0000018 ENSG00000 90 39 3317 3355 183397

ENSG000001834 ENSG000001834 ENSG0000018 ENSG0000018 ENSG00000 05 45 3455 3514 183627

ENSG000001838 ENSG000001838 ENSG0000018 ENSG0000018 ENSG00000 17 51 3920 3981 183983

ENSG000001840 ENSG000001840 ENSG0000018 ENSG0000018 ENSG00000 08 64 4100 4263 184352

ENSG000001843 ENSG000001843 ENSG0000018 ENSG0000018 ENSG00000 53 91 4490 4493 184521

ENSG000001845 ENSG000001846 ENSG0000018 ENSG0000018 ENSG00000 43 53 4673 4844 184888

ENSG000001849 ENSG000001850 ENSG0000018 ENSG0000018 ENSG00000 02 34 5055 5082 185095

ENSG000001853 ENSG000001854 ENSG0000018 ENSG0000018 ENSG00000 19 48 5467 5636 185641

ENSG000001856 ENSG000001857 ENSG0000018 ENSG0000018 ENSG00000 85 58 5834 5863 185929

ENSG000001859 ENSG000001859 ENSG0000018 ENSG0000018 ENSG00000 45 56 6218 6259 186381

ENSG000001864 ENSG000001864 ENSG0000018 ENSG0000018 ENSG00000 00 14 6483 6659 186663 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ENSG000001867 ENSG000001867 ENSG0000018 ENSG0000018 ENSG00000 09 28 6743 6756 186773

ENSG000001867 ENSG000001870 ENSG0000018 ENSG0000018 ENSG00000 87 42 7072 7080 187522

ENSG000001875 ENSG000001875 ENSG0000018 ENSG0000018 ENSG00000 34 44 7600 7615 187653

ENSG000001876 ENSG000001876 ENSG0000018 ENSG0000018 ENSG00000 61 86 7791 7809 187828

ENSG000001878 ENSG000001879 ENSG0000018 ENSG0000018 ENSG00000 51 00 7938 7963 187988

ENSG000001879 ENSG000001880 ENSG0000018 ENSG0000018 ENSG00000 99 13 8023 8031 188075

ENSG000001880 ENSG000001881 ENSG0000018 ENSG0000018 ENSG00000 82 44 8292 8405 188423

ENSG000001884 ENSG000001884 ENSG0000018 ENSG0000018 ENSG00000 38 47 8463 8469 188604

ENSG000001886 ENSG000001886 ENSG0000018 ENSG0000018 ENSG00000 68 83 8796 8831 188841

ENSG000001888 ENSG000001888 ENSG0000018 ENSG0000018 ENSG00000 73 90 8912 8926 188974

ENSG000001889 ENSG000001889 ENSG0000018 ENSG0000018 ENSG00000 85 89 9118 9119 189128

ENSG000001892 ENSG000001892 ENSG0000018 ENSG0000018 ENSG00000 44 58 9279 9290 189311

ENSG000001893 ENSG000001893 ENSG0000019 ENSG0000019 ENSG00000 78 84 6076 6094 196115

ENSG000001961 ENSG000001961 ENSG0000019 ENSG0000019 ENSG00000 21 83 6230 6285 196292

ENSG000001963 ENSG000001964 ENSG0000019 ENSG0000019 ENSG00000 06 54 6527 6681 196690

ENSG000001969 ENSG000001969 ENSG0000019 ENSG0000019 ENSG00000 26 30 6940 6960 197023

ENSG000001970 ENSG000001971 ENSG0000019 ENSG0000019 ENSG00000 49 49 7185 7218 197246

ENSG000001973 ENSG000001973 ENSG0000019 ENSG0000019 ENSG00000 20 35 7369 7407 197438

ENSG000001974 ENSG000001974 ENSG0000019 ENSG0000019 ENSG00000 50 75 7481 7490 197526

ENSG000001975 ENSG000001975 ENSG0000019 ENSG0000019 ENSG00000 75 85 7608 7630 197680

ENSG000001977 ENSG000001978 ENSG0000019 ENSG0000019 ENSG00000 99 25 7865 7883 198059

ENSG000001980 ENSG000001981 ENSG0000019 ENSG0000019 ENSG00000 79 07 8154 8179 198229

ENSG000001982 ENSG000001983 ENSG0000019 ENSG0000019 ENSG00000 73 22 8326 8475 198544

ENSG000001986 ENSG000001986 ENSG0000019 ENSG0000019 ENSG00000 15 16 8649 8684 198694

ENSG000001987 ENSG000001987 ENSG0000019 ENSG0000019 ENSG00000 06 25 8726 8731 198760 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ENSG000001 987 ENSG000001 987 ENSG000001 9 ENSG0000019 ENSG00000 78 89 8801 8810 198902

ENSG000001 989 ENSG000001 989 ENSG000001 9

21 57 8965 ENTHD1 ENTPD1

ENTPD2 ENTPD3 ENTPD4 ENTPD5 ENTPD6

ENTPD7 ENTPD8 ENY2 EOMES EP300

EP400 EPAS1 EPB41 EPB41 L1 EPB41 L2

EPB41 L3 EPB41 L4A EPB41 L4B EPB41 L5 EPB42

EPB49 EPC1 EPC2 EPCAM EPDR1

EPGN EPHA1 EPHA10 EPHA2 EPHA3

EPHA4 EPHA5 EPHA6 EPHA7 EPHA8

EPHB1 ENSTOO

EPHB1 000398015 EPHB2 EPHB3 EPHB4

EPHB6 EPHX1 EPHX2 EPHX3 EPHX4

EPM2A EPN2 EPN3 EPO EPOR

EPRS EPS15 EPS15L1 EPS8 EPS8L1

EPS8L2 EPS8L3 EPSTI1 EPX EPYC

ERAL1 ERAP1 ERAP2 ERAS ERBB2

ERBB3 ENST

ERBB2IP ERBB3 00000267101 ERBB4 ERC1

ERCC1 ERCC2 ERCC3 ERCC4 ERCC5

ERCC6 ERCC6L ERCC8 EREG ERF

ERG ERGIC1 ERGIC2 ERGIC3 ERH

ERI1 ERI2 ERI3 ERICH1 ERLEC1

ERLIN2 ERMAP ERMN ERMP1 ERN1

ERN2 ER01 L ER01 LB ERP27 ERP29

ERP44 ERRFI1 ERVFC1 ERVWE1 ESAM

ESC01 ESC02 ESD ESF1 ESM1

ESPL1 ESPN ESPNL ESR1 ESR2

ESRP1 ESRP2 ESRRA ESRRB ESRRG

ESSPL ESX1 ESYT1 ESYT2 ESYT3

ETAA1 ETF1 ETFA ETFB ETFDH

ETHE1 ETNK1 ETNK2 ETS1 ETS2

ETV1 ETV2 ETV3 ETV3L ETV4

ETV5 ETV6 ETV7 EVC EVC2

EVI2A EVI2B EVI5 EVI5L EVL

EVPL EVX1 EVX2 EWSR1 EXD1

EXD3 EXDL2 EX01 EXOC1 EXOC2

EX0C3 EXOC3L EXOC3L2 EXOC4 EXOC5

EX0C6 EXOC6B EXOC7 EXOC8 EXOG

EX0SC1 EXOSC10 EXOSC2 EXOSC3 EXOSC4

EX0SC5 EXOSC6 EXOSC7 EXOSC8 EXOSC9

EXPH5 EXT1 EXT2 EXTL1 EXTL2

EXTL3 EYA1 EYA2 EYA3 EYA4

EZH2 ENSTOO

EYS EZH1 EZH2 000350995 EZR

F10 F1 1 F1 1 R F12 F13A1

F13B F2 F2R F2RL1 F2RL2

F2RL3 F3 F5 F7 F8 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

F8 ENST0000

F8A1 F8A2 F8A3 0360256 F9

FA2H FA87B HUMAN FAAH FAAH2 FABP1

FABP12 FABP2 FABP3 FABP4 FABP5

FABPE HUMA

FABP6 FABP7 FABP9 N FADD

FADS1 FADS2 FADS3 FADS6 FAF1

FAF2 FAH FAHD1 FAHD2A FAHD2B

FAIM FAIM2 FAIM3 F AM 100 A FAM100B

FAM101A FAM102 A FAM102B FAM103A1 FAM104B

FAM105A FAM105B FAM107A FAM107B FAM108A1

FAM108 A3 FAM108B1 FAM109A FAM109B FAM110A

FAM110B FAM110C FAM111A FAM111B FAM113A

FAM113B FAM114A1 FAM114A2 FAM115A FAM115C

FAM116A FAM117A FAM117B FAM118A FAM118B

FAM119A FAM119B FAM120A FAM120AOS FAM120B

FAM120C FAM122A FAM122B FAM122C FAM123A

FAM123B FAM123C FAM124A FAM124B FAM125A

FAM125B FAM126A FAM126B FAM127A FAM127B

FAM127C FAM128A FAM128B FAM129A FAM129B

FAM129C FAM131A FAM131B FAM131C FAM132A

FAM133A FAM134A FAM134B FAM134C FAM135A

FAM135B FAM136A FAM13A1 FAM13C FAM149A

FAM150A FAM151A FAM151B F AM 153 A FAM153B

FAM153C FAM154A FAM154B F AM 155 A FAM155B

FAM156A FAM156B FAM158A F AM 159 A FAM160 A2

FAM160B1 FAM161A FAM161B F AM 162 A FAM162B

FAM163 A FAM163B FAM164A FAM164C FAM165B

FAM166A FAM167B FAM168A FAM168B FAM169A

FAM170 A FAM171A1 FAM171B F AM 172 A FAM173 A

FAM173B FAM174A FAM174B F AM 175 A FAM175B

FAM176 A FAM176B FAM177A1 FAM177B FAM178B

FAM179 A FAM179B FAM180A FAM181A FAM181B

FAM184A FAM184B FAM186A FAM186B FAM187B

FAM188A FAM188B FAM189A1 FAM189A2 FAM189B

FAM18B FAM18B2 FAM190A FAM190B FAM192 A

FAM193 A FAM194A FAM194B F AM 195 A FAM196A

FAM198A FAM198B FAM199X FAM19A2 FAM19 A3

FAM19A4 FAM19A5 FAM200A FAM20A FAM20B

FAM21A FAM21C FAM22A FAM22D FAM22F

FAM22G FAM23A FAM23B FAM24A FAM24B

FAM26A FAM26D FAM26E FAM26F FAM32A

FAM33A FAM35A FAM36A FAM38B FAM39B

FAM3A FAM3B FAM3C FAM3D FAM40A

FAM40B FAM43A FAM43B FAM45A FAM45B

FAM46A FAM46B FAM46C FAM46D FAM47A

FAM47B FAM47C FAM48A FAM48B1 FAM48B2

FAM49A FAM49B FAM50A FAM50B FAM53A

FAM53B FAM53C FAM54A FAM54B FAM55A

FAM55C FAM55D FAM57A FAM57B FAM58A HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

FAM58B FAM59A FAM5B FAM5C FAM60A

FAM63A FAM63B FAM64A FAM65A FAM65B

FAM65C FAM69B FAM69C FAM70A FAM70B

FAM71 A FAM71 B FAM71 C FAM71 E1 FAM71 F1

FAM72A FAM72B FAM73A FAM73B FAM74A3

FAM75A1 FAM75A2 FAM75A6 FAM75A7 FAM76A

FAM76B FAM78A FAM78B FAM81 A FAM81 B

FAM82A1 FAM82A2 FAM82B FAM83A FAM83B

FAM83C FAM83D FAM83E FAM83F FAM83G

FAM83H FAM84A FAM84B FAM86A FAM86C

FAM87B FAM89A FAM89B FAM8A1 FAM90A1

FAM90A20 FAM91 A1 FAM92B FAM96A FAM98A

FAM98B FAM98C FAM9A FAM9B FAM9C

FANCA FANCB FANCC FANCD2 FANCE

FANCF FANCG FANCI FANCL FANCM

FANK1 FAP FAR1 FAR2 FARP1

FARP2 FARS2 FARSA FARSB FAS

FASLG FASN FASTK FASTKD1 FASTKD2

FASTKD3 FASTKD5 FAT FAT1 FAT2

FAT4 ENSTOO

FAT3 FAT4 000394329 FATE1 FAU

FBF1 FBL FBLIM1 FBLN1 FBLN2

FBLN2 ENSTOO

000492059 FBLN5 FBLN7 FBN1 FBN2

FBN3 FBP1 FBP2 FBRSL1 FBXL12

FBXL13 FBXL14 FBXL15 FBXL16 FBXL17

FBXL18 FBXL19 FBXL2 FBXL20 FBXL21

FBXL21 ENSTOO

0002971 58 FBXL22 FBXL3 FBXL4 FBXL5

FBXL6 FBXL7 FBXL8 FBXO10 FBX01 1

FBX015 FBX016 FBX017 FBX018 FBX02

FBX021 FBX022 FBX024 FBX025 FBX027

FBX028 FBX03 FBXO30 FBX031 FBX032

FBX033 FBX034 FBX036 FBX038 FBX039

FBX04 FBXO40 FBX041 FBX042 FBX043

FBX044 FBX045 FBX046 FBX047 FBX048

FBX05 FBX06 FBX07 FBX08 FBX09

FBXW10 FBXW1 1 FBXW12 FBXW2 FBXW4

FBXW7 NM 0

FBXW5 FBXW7 18315 2 FBXW8 FBXW9

FCAMR FCAR FCER1 A FCER1 G FCER2

FCF1 FCGBP FCGR1 A FCGR1 B FCGR2A

FCGR2B FCGR3A FCGR3B FCGRT FCH01

FCHSD1 FCHSD2 FCN1 FCN2 FCN3

FCRL1 FCRL2 FCRL3 FCRL4 FCRL5

FCRL6 FCRLA FCRLB FDFT1 FDPS

FDX1 FDX1 L FDXR FECH FEM1 A

FEM1 B FEM1 C FEN1 FER FER1 L6

FERD3L FERMT1 FERMT2 FERMT3 FES

FETUB FEV FEZ1 FEZF1 FEZF2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

FFAR1 FFAR2 FFAR3 FGA FGB

FGD1 FGD2 FGD3 FGD4 FGD5

FGD6 FGF1 FGF10 FGF1 1 FGF12

FGF13 FGF14 FGF16 FGF17 FGF18

FGF19 FGF2 FGF20 FGF21 FGF22

FGF23 FGF3 FGF4 FGF5 FGF6

FGF7 FGF7P2 FGF8 FGF9 FGFBP1

FGFBP2 FGFBP3 FGFR1 FGFR10P FGFR10P2

FGFR4 ENS

FGFR1 ENSTOO T000002924 000425967 FGFR2 FGFR3 FGFR4 08

FGFRL1 FGG FGGY FGL1 FGL2

FGR FH FHAD1 FHDC1 FHIT

FHL1 FHL2 FHL3 FHL5 FHOD1

FHOD3 FIBCD1 FIBIN FIBP FICD

FIG4 FIGF FIGN FIGNL1 FILIP1

FILIP1 L FIP1 L1 FIS1 FITM1 FITM2

FIZ1 FKBP10 FKBP1 1 FKBP14 FKBP1 A

FKBP1 B FKBP1 C FKBP2 FKBP3 FKBP4

FKBP5 FKBP6 FKBP7 FKBP8 FKBP9

FKBP9L FKBPL FKRP FKTN FLAD1

FLCN FLG FLG2 FLU FLII

FLJ10357 FLJ 10404 FLJ 10490 FLJ 13236 FLJ13855

FLJ 14075 FLJ 14627 FLJ 14775 FLJ16165 FLJ16171

FLJ 16331 FLJ16360 FLJ16369 FLJ 16542 FLJ20184

FLJ20273 FLJ20366 FLJ20584 FLJ23356 FLJ23584

FLJ25006 FLJ2591 7 FLJ31 132 FLJ34521 FLJ35880

FLJ38348 FLJ38451 FLJ38576 FLJ39257 FLJ39369

FLJ41 131 FLJ41603 FLJ42177 FLJ42418 FLJ42957

FLJ43374 FLJ43806 FLJ43980 FLJ44048 FLJ44060

FLJ4421 6 FLJ44635 FLJ4481 7 FLJ44874 FLJ45224

FLJ45422 FLJ45455 FLJ45831 FLJ45910 FLJ45983

FLJ46321 FLJ90650 FLNA FLNB FLNC

FL0T1 FL0T2 FLRT1 FLRT2 FLRT3

FLT4 ENSTO

FLT1 FLT3 FLT3LG FLT4 0000261 937

FLVCR1 FLVCR2 FLYWCH1 FLYWCH2 FMN2

FMNL1 FMNL2 FMNL3 FM01 FM02

FM03 FM04 FM05 FM06P FMOD

FMR1 FMR1 NB FN1 FN3K FN3KRP

FNBP1 ENSTOO

FNBP1 L 000372416 FNBP4 FNDC1 FNDC3A

FNDC3B FNDC4 FNDC5 FNDC7 FNDC8

FNIP1 FNIP2 FNTA FNTB FOLH1

F0LH1 B F0LR1 F0LR2 FOS FOSB

F0SL1 F0SL2 F0XA1 FOXA2 FOXA3

F0XB1 F0XB2 F0XC1 FOXC2 FOXD2

F0XD3 F0XD4 F0XD4L1 FOXD4L2 FOXD4L3

FOXD4L4 FOXD4L6 F0XE1 FOXE3 FOXF1

F0XF2 F0XG1 F0XH1 FOXI1 FOXI2

F0XI3 F0XJ1 F0XJ2 FOXJ3 FOXK1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

FOXK2 F0XL1 F0XL2 F0XM1 FOXN1

FOXN2 F0XN3 F0XN4 F0X01 FOX03

FOX04 F0XP1 F0XP2 F0XP3 FOXP4

FOXQ1 F0XR1 F0XR2 F0XRED1 FOXRED2

FOXS1 FPGS FPGT FPR1 FPR2

FRAS1 ENSTO

FPR3 FRAG1 FRAS1 0000325942 FRAT1

FRAT2 FREM1 FREM2 FREM3 FRG1

FRG2 FRG2C FRK FRMD1 FRMD3

FRMD4A FRMD4B FRMD5 FRMD6 FRMD7

FRMD8 FRMPD1 FRMPD2 FRMPD2L1 FRMPD2L2

FRMPD3 FRMPD4 FRRS1 FRS2 FRS3

FRY FRYL FRZB FSCB FSCN1

FSCN3 FSD1 FSD2 FSHB FSHR

FSIP1 FST FSTL1 FSTL3 FSTL4

FSTL5 FTCD FTH1 FTHL17 FTHL19

FTL FTLP2 FTMT FTO FTSJ1

FTSJ2 FTSJ3 FTSJD1 FTSJD2 FUBP1

FUBP3 FUCA1 FUCA2 FUK FUNDC1

FUNDC2 FUNDC2P1 FURIN FUS FUSIP1

FUT1 FUT10 FUT1 1 FUT2 FUT3

FUT4 FUT5 FUT6 FUT7 FUT8

FUT9 FUZ FXC1 FXN FXR1

FXYD1 FXYD2 FXYD3 FXYD4 FXYD5

FXYD6 FXYD7 FXYD8 FYC01 FYN

FYTTD1 FZD1 FZD10 FZD2 FZD3

FZD4 FZD5 FZD6 FZD7 FZD8

FZD9 FZR1 G0S2 G2E3 G3BP1

G3BP2 G6PC G6PC2 G6PC3 G6PD

GAA GAB1 GAB2 GAB3 GAB4

GABARAP GABARAPL1 GABARAPL2 GABARAPL3 GABBR1

GABBR2 GABPA GABPB1 GABPB2 GABRA1

GABRA2 GABRA3 GABRA4 GABRA5 GABRA6

GABRB1 GABRB2 GABRB3 GABRD GABRE

GABRG1 GABRG2 GABRP GABRQ GABRR1

GABRR2 GABRR3 GAD1 GAD2 GADD45A

GADD45B GADD45G GADD45GIP1 GADL1 GAGE1

GAGE10 GAGE12C GAGE12E GAGE12F GAGE12G

GAGE12H GAGE12J GAGE2C GAGE2D GAGE2E

GAK GAL GAL3ST1 GAL3ST2 GAL3ST3

GAL3ST4 GALC GALE GALK1 GALK2

GALM GALNS GALNT1 GALNT10 GALNT1 1

GALNT12 GALNT13 GALNT14 GALNT2 GALNT3

GALNT5 GALNT6 GALNT7 GALNT8 GALNT9

GALNTL1 GALNTL2 GALNTL4 GALNTL5 GALNTL6

GALP GALR1 GALR2 GALR3 GALT

GAMT GAN GANAB GANC GAP43

GAPDH GAPDHS GAPT GAPVD1 GAR1

GARNL3 GARS GART GAS1 GAS2

GAS2L1 GAS2L2 GAS2L3 GAS6 GAS7 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

GAS8 GAST GATA1 GATA2 GATA3

GATA4 GATA5 GATA6 GATAD1 GATAD2A

GATAD2B GATC GATM GATS GATSL3

GBA GBA2 GBAP GBAS GBF1

GBG5L HUMAN GBGT1 GBP1 GBP2 GBP3

GBP4 GBP5 GBP6 GBP7 GBX1

GBX2 GC GCA GCAT GCC1

GCC2 GCDH GCET2 GCH1 GCHFR

GCK GCKR GCLC GCLM GCM1

GCM2 GCN1 L1 GCNT1 GCNT2 GCNT3

GCNT4 GC0M1 GCSH GDA GDAP1

GDAP1 L1 GDAP2 GDE1 GDF1 GDF10

GDF1 1 GDF15 GDF2 GDF3 GDF5

GDF6 GDF7 GDF9 GDI1 GDI2

GDNF GDPD1 GDPD2 GDPD3 GDPD4

GDPD5 GEFT GEM GEMIN4 GEMIN5

GEMIN6 GEMIN7 GEMIN8 GEN1 GFAP

GFER GFI1 GFI1 B GFM1 GFM2

GF0D1 GF0D2 GFPT1 GFPT2 GFRA1

GFRA3 GFRA4 GFRAL GGA1 GGA2

GGA3 GGCT GGCX GGH GGN

GGNBP2 GGPS1 GGT1 GGT5 GGT6

GGT7 GGTLA4 GGTLC1 GGTLC2 GH1

GH2 GHDC GHITM GHR GHRH

GHRHR GHRL GHSR GIF GIGYF1

GIGYF2 GIMAP1 GIMAP2 GIMAP4 GIMAP5

GIMAP6 GIMAP7 GIMAP8 GIN1 GINS1

GINS2 GINS3 GINS4 GIOT-1 GIP

GIPC1 GIPC2 GIPC3 GIPR GIT1

GIT2 GIYD1 GIYD2 GJA1 GJA10

GJA3 GJA4 GJA5 GJA8 GJA9

GJB1 GJB2 GJB3 GJB4 GJB5

GJB6 GJB7 GJC1 GJC2 GJC3

GJD2 GJD4 GK GK2 GK3P

GK5 GKAP1 GKN1 GKN2 GLA

GLB1 GLB1 L GLB1 L2 GLB1 L3 GLCCI1

GLCE GLDC GLDN GLE1 GLE1 L

GLG1 GLI1 GLI2 GLI3 GLI4

GLIPR1 GLIPR1 L1 GLIPR1 L2 GLIPR2 GLIS1

GLIS2 GLIS3 GLMN GL01 GL0D4

GL0D5 GLP1 R GLP2R GLRA1 GLRA2

GLRA3 GLRA4 GLRB GLRX GLRX2

GLRX3 GLRX5 GLRXP3 GLS GLS2

GLT1 D1 GLT25D1 GLT25D2 GLT28D1 GLT6D1

GLT8D1 GLT8D2 GLTP GLTPD1 GLTPD2

GLTSCR2 GLUD1 GLUD2 GLUL GLYAT

GLYATL1 GLYATL2 GLYCTK GLYR1 GM2A

GMCL1 GMDS GMEB1 GMEB2 GMFB

GMFG GMIP GML GMNN GMPPA

GMPPB GMPR GMPR2 GMPS GNA1 1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene

Name Name Name Name Name

GNA12 GNA13 GNA14 GNA15 GNAI1

GNAI2 GNAI3 GNAL GNA01 GNAQ

GNAS ENSTOOO GNAS NM 01

GNAS 00371 100 6592 1 GNAT1 GNAT2

GNAZ GNB1 GNB1 L GNB2 GNB2L1

GNB3 GNB4 GNB5 GNE GNG10

GNG1 1 GNG12 GNG13 GNG2 GNG3

GNG4 GNG5 GNG7 GNG8 GNGT1

GNGT2 GNL1 GNL2 GNL3 GNL3L

GNLY GNMT GNPAT GNPDA1 GNPDA2

GNPNAT1 GNPTAB GNPTG GNRH1 GNRH2

GNRHR GNRHR2 GNS GOLGA1 GOLGA2

GOLGA2B GOLGA3 GOLGA4 GOLGA5 GOLGA6A

GOLGA7 GOLGA7B GOLGA8A GOLGA8E GOLGA8G

GOLGB1 GOLIM4 GOLM1 GOLPH3 GOLPH3L

GOLT1 A GOLT1 B GON4L GOPC GORAB

GORASP1 GORASP2 GOSR1 GOSR2 GOT1

GOT2 GP1 BB GP2 GP5 GP6

GP9 GPA33 GPAA1 GPAM GPAT2

G PATCH 1 GPATCH2 GPATCH3 GPATCH4 G PATCH 8

GPBP1 GPBP1 L1 GPC1 GPC2 GPC3

GPC4 GPC5 GPC6 GPCPD1 GPD1

GPD1 L GPD2 GPER GPHA2 GPHB5

GPHN GPI GPIHBP1 GPKOW GPLD1

GPM6A GPM6B GPN1 GPN2 GPN3

GPNMB GPR1 GPR101 GPR107 GPR108

GPR109A GPR1 10 GPR1 1 1 GPR1 12 GPR1 13

GPR1 14 GPR1 15 GPR1 16 GPR1 1 9 GPR12

GPR120 GPR123 GPR124 GPR125 GPR126

GPR128 GPR132 GPR133 GPR135 GPR137

GPR137B GPR137C GPR139 GPR141 GPR142

GPR143 GPR146 GPR148 GPR149 GPR15

GPR150 GPR151 GPR152 GPR153 GPR155

GPR156 GPR157 GPR158 GPR160 GPR161

GPR162 GPR165P GPR17 GPR171 GPR172A

GPR172B GPR173 GPR174 GPR176 GPR179

GPR18 GPR180 GPR182 GPR183 GPR19

GPR20 GPR21 GPR22 GPR25 GPR26

GPR27 GPR3 GPR31 GPR32 GPR34

GPR35 GPR37 GPR37L1 GPR39 GPR4

GPR42 GPR44 GPR45 GPR50 GPR52

GPR55 GPR56 GPR6 GPR61 GPR62

GPR63 GPR64 GPR65 GPR68 GPR75

GPR82 ENS

T000003025

GPR77 GPR78 GPR81 GPR82 48

GPR83 GPR84 GPR85 GPR87 GPR88

GPR89A GPR89B GPR97 GPR98 GPRASP1

GPRASP2 GPRC5A GPRC5B GPRC5C GPRC5D

GPRC6A GPRIN1 GPRIN2 GPRIN3 GPS1

GPS2 GPSM1 GPSM2 GPSM3 GPT HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

GPT2 GPX1 GPX2 GPX3 GPX4

GPX5 GPX6 GPX7 GPX8 GRAMD1 A

GRAMD1 B GRAMD1 C GRAMD2 GRAMD3 GRAMD4

GRAP GRAP2 GRASP GRB10 GRB14

GREB1 ENST

GRB2 GRB7 GREB1 00000381486 GREM1

GREM2 GRHL1 GRHL2 GRHL3 GRHPR

GRIA3 ENSTO

GRIA1 GRIA2 GRIA3 0000264357 GRIA4

GRIK2 ENS T000004215

GRID1 GRID2 GRIK1 GRIK2 44

GRIK3 GRIK4 GRIK5 GRIN1 GRIN2A

GRIN2B GRIN2C GRIN2D GRIN3A GRIN3B

GRINA GRINL1 A GRINL1 B GRIP1 GRIP2

GRIPAP1 GRK1 GRK4 GRK5 GRK6

GRK7 GRLF1 GRM1 GRM2 GRM3

GRM4 ENSTOOO

GRM4 00374177 GRM5 GRM6 GRM7

GRM8 GRN GRP GRPEL1 GRPEL2

GRPR GRRP1 GRTP1 GRWD1 GRXCR1

GRXCR2 GSC GSC2 GSDMA GSDMB

GSDMC GSDMD GSG1 GSG1 L GSG2

GSK3A GSK3B GSN GSPT1 GSPT2

GSR GSS GSTA1 GSTA2 GST A3

GSTA4 GSTA5 GSTCD GSTK1 GSTM1

GSTM2 GSTM3 GSTM4 GSTM5 GST01

GST02 GSTP1 GSTT1 GSTT2 GSTT2B

GSTZ1 GSX1 GSX2 GTDC1 GTF2A1

GTF2A2 GTF2B GTF2E1 GTF2E2 GTF2F1

GTF2F2 GTF2H1 GTF2H2 GTF2H2C GTF2H3

GTF2H4 GTF2H5 GTF2I GTF2IRD1 GTF2IRD2

GTF2IRD2B GTF3C1 GTF3C2 GTF3C3 GTF3C4

GTF3C5 GTF3C6 GTPBP1 GTPBP10 GTPBP2

GTPBP3 GTPBP4 GTPBP5 GTPBP6 GTPBP8

GTSE1 GTSF1 GTSF1 L GUCA1 A GUCA1 B

GUCA1 C GUCA2A GUCA2B GUCY1 A2 GUCY1 A3

GUCY2C GUCY2D GUCY2F GUF1 GUK1

GUK1 ENSTOOO GUSL1 HUMA

0036671 9 GULP1 GUSB N GXYLT1

GYG1 GYG2 GYLTL1 B GYPA GYPB

GYPC GYS1 GYS2 GZF1 GZMA

GZMB GZMH GZMK GZMM H19

H1 F0 H1 FNT H1 FOO H1 FX H2AFB1

H2AFB2 H2AFB3 H2AFJ H2AFV H2AFX

H2AFY H2AFY2 H2AFZ H2AFZP2 H2BFM

H2BFWT H3F3A H3F3B H3F3C H6PD

HAAO HABP2 HABP4 HACE1 HACL1

HADH HADHA HADHB HAGH HAGHL

HAL HAMP HAND1 HAND2 HA01

HA02 HAP1 HAPLN1 HAPLN2 HAPLN3 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

HAPLN4 HARBI1 HARS HARS2 HAS1

HAS2 HAS3 HAT1 HAUS1 HAUS2

HAUS3 HAUS4 HAUS5 HAUS6 HAUS7

HAUS8 HAVCR1 HAVCR2 HAX1 HBA1

HBA2 HBB HBD HBE1 HBEGF

HBG1 HBG2 HBM HBP1 HBQ1

HBS1L HBXIP HBZ HCCS HCFC1

HCFC1R1 HCFC2 HCG9 HCK HCLS1

HCN1 HCN2 HCN3 HCN4 HCP1

HCP5 HCRT HCRTR1 HCRTR2 HCST

HDAC1 HDAC10 HDAC11 HDAC2 HDAC3

HDAC4 HDAC5 HDAC6 HDAC7 HDAC8

HDAC9 HDC HDDC2 HDDC3 HDGF

HDGF2 HDGFL1 HDGFRP3 HDHD1A HDHD2

HDHD3 HDLBP HDX HEATR1 HEATR2

HEATR3 HEATR4 HEATR5B HEATR6 HEATR7B1

HEATR7B2 HEBP1 HEBP2 HECA HECTD1

HECTD3 ENS

HECTD2 HECTD3 T00000372172 HECW1 HECW2

HEG1 HEJ1 HELB HELLS HELQ

HELT HELZ HEMGN HEMK1 HEPACAM

HEPACAM2 HEPH HEPHL1 HERC1 HERC2

HERC2P3 HERC3 HERC4 HERC5 HERC6

HERPUD1 HERPUD2 HERV-FRD HES1 HES2

HES3 HES4 HES5 HES6 HES7

HESX1 HEXA HEXB HEXDC HEXIM1

HEXIM2 HEY1 HEY2 HEYL HFE

HFE2 HFM1 HGD HGF HGF AC

HGSNAT ENS

HGS HGSNAT T00000458501 HHAT HHATL

HHEX HHIP HHIPL1 HHIPL2 HHLA3

HIAT1 HIATL1 HIATL2 HIBADH HIBCH

HIC1 HIC2 HIF1A HIF1AN HIF3A

HIN1L HUM

HIGD1A HIGD1B HIGD2A HIGD2BP AN

HINFP HINT1 HINT2 HINT3 HIP1

HIP1R HIPK1 HIPK2 HIPK3 HIPK4

HIRA HIRIP3 HIST1H1A HIST1H1B HIST1H1C

HIST1H1D HIST1H1E HIST1H1T HIST1H2AA HIST1H2AB

HIST1H2AC HIST1H2AD HIST1H2AE HIST1H2AG HIST1H2AH

HIST1H2AI HIST1H2AJ HIST1H2AK HIST1H2AL HIST1H2AM

HIST1H2BA HIST1H2BB HIST1H2BC HIST1H2BD HIST1H2BE

HIST1H2BF HIST1H2BG HIST1H2BH HIST1H2BI HIST1H2BJ

HIST1H2BK HIST1H2BL HIST1H2BM HIST1H2BN HIST1H2B0

HIST1H3A HIST1H3B HIST1H3C HIST1H3D HIST1H3E

HIST1H3F HIST1H3G HIST1H3H HIST1H3I HIST1H3J

HIST1H4A HIST1H4B HIST1H4C HIST1H4D HIST1H4E

HIST1H4F HIST1H4G HIST1H4H HIST1H4I HIST1H4J

HIST1H4K HIST1H4L HIST2H2AA3 HIST2H2AA4 HIST2H2AB

HIST2H2AC HIST2H2BE HIST2H2BF HIST2H3A HIST2H3C HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

HIST2H3D HIST2H4A HIST2H4B HIST3H2A HIST3H2BB

HIST3H3 HIST4H4 HIVEP1 HIVEP2 HIVEP3

HJURP HK1 HK2 HK3 HKDC1

HKR1 HLA-A HLA-B HLA-C HLA-DMA

HLA-DMB H LA- DO A HLA-DOB HLA-DPA1 HLA-DPB1

HLA-DQA1 HLA-DQA2 HLA-DQB1 HLA-DRA HLA-DRB5

HLA-E HLA-F HLA-G HLCS HLF

HLTF HLX HM13 HMBOX1 HMBS

HMCN1 HMG1 L10 HMG20A HMG20B HMGA1

HMGA2 HMGB1 HMGB1 L1 HMGB2 HMGB3

HMGB4 HMGCL HMGCLL1 HMGCR HMGCS1

HMGCS2 HMGN1 HMGN2 HMGN3 HMGN4

HMGN5 HMGXB3 HMGXB4 HMHA1 HMHB1

HMMR HMOX1 HMOX2 HMP19 HMX2

HMX3 HN1 HN1 L HNF1 A HNF1 B

HNF4A HNF4G HNMT HNRNPA0 HNRNPA1

HNRNPA1 L2 HNRNPA2B1 HNRNPA3 HNRNPAB HNRNPC

HNRNPCL1 HNRNPD HNRNPF HNRNPH1 HNRNPH2

HNRNPH3 HNRNPK HNRNPL HNRNPM HNRNPR

HNRNPU HNRNPUL1 HNRNPUL2 HNRPD HNRPDL

HNRPF HNRPH1 HNRPL HNRPLL HNRPR

HNRPU HOMER1 HOMER2 HOMER3 HOOK1

H00K2 HOOK3 HOPX HORMAD1 HOXA1

H0XA10 HOXA1 1 HOXA13 HOXA2 HOXA3

H0XA4 HOXA5 HOXA6 HOXA7 HOXA9

H0XB1 HOXB13 HOXB2 HOXB3 HOXB4

H0XB5 HOXB6 HOXB7 HOXB8 HOXB9

HOXC10 HOXC1 1 HOXC12 HOXC13 HOXC4

H0XC5 HOXC6 HOXC8 HOXC9 HOXD1

HOXD10 HOXD1 1 HOXD13 HOXD3 HOXD4

H0XD8 HOXD9 HP HP1 BP3 HPCA

HPCAL1 HPCAL4 HPD HPDL HPGD

HPGDS HPN HPR HPRT1 HPS1

HPS3 HPS4 HPS5 HPS6 HPSE

HPSE2 HPX HR HRAS HRASLS

HRAS ENSTO

HRASLS2 HRASLS5 0000397594 HRC HRCT1

HRG HRH1 HRH2 HRH3 HRH4

HRK HRNR HRSP12 HS1 BP3 HS2ST1

HS3ST1 HS3ST2 HS3ST3A1 HS3ST3B1 HS3ST4

HS3ST5 HS6ST1 HS6ST1 P HS6ST2 HS6ST3

HSCB HSD1 1 B1 HSD1 1 B1 L HSD1 1 B2 HSD1 7B1

HSD1 7B10 HSD1 7B1 1 HSD1 7B12 HSD17B13 HSD1 7B14

HSD1 7B2 HSD1 7B3 HSD1 7B4 HSD17B6 HSD1 7B7

HSD1 7B8 HSD3B1 HSD3B2 HSD3B7 HSDL1

HSDL2 HSF1 HSF2 HSF2BP HSF4

HSF5 HSFX1 HSFY1 HSFY2 HSP90AA1

HSP90AA2 HSP90AB1 HSP90AB2P HSP90AB6P HSP90B1

HSPA12A HSPA12B HSPA13 HSPA14 HSPA1 A

HSPA1 B HSPA1 L HSPA2 HSPA4 HSPA4L HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

HSPA5 HSPA6 HSPA8 HSPA9 HSPB1

HSPB1 1 HSPB2 HSPB3 HSPB6 HSPB7

HSPB8 HSPB9 HSPBAP1 HSPBP1 HSPC159

HSPD1 HSPE1 HSPG2 HSPH1 HTATIP2

HTATSF1 HTN1 HTN3 HTR1 A HTR1 B

HTR1 D HTR1 E HTR1 F HTR2A HTR2B

HTR2C HTR3A HTR3B HTR3C HTR3D

HTR3E HTR4 HTR5A HTR6 HTR7

HTRA1 HTRA2 HTRA3 HTRA4 HTT

HUMPPA HUNK HUS1 HUS1 B HUWE1

HVCN1 HYAL1 HYAL2 HYAL3 HYAL4

HYDIN HYI HYLS1 HYOU1 IAH1

IAPP IARS IARS2 IBSP IBTK

ICA1 ICA1 L ICAM1 ICAM2 ICAM3

ICAM4 ICAM5 ICK ICMT ICOS

ICOSLG ICT1 ID1 ID2 ID2B

ID3 ID4 IDE IDH1 IDH2

IDH3A IDH3B IDH3G IDI1 IDI2

ID01 IDS IDUA IER2 IER3

IER3IP1 IER5 IER5L IFF01 IFI16

IFI27 IFI27L1 IFI27L2 IFI30 IFI35

IFI44 IFI44L IFI6 IFIH1 IFIT1

IFIT1 L IFIT2 IFIT3 IFIT5 IFITM2

IFITM3 IFITM5 IFLTD1 IFNA1 IFNA1 0

IFNA13 IFNA14 IFNA1 6 IFNA17 IFNA2

IFNA21 IFNA4 IFNA5 IFNA6 IFNA7

IFNA8 IFNAR1 IFNAR2 IFNB1 IFNE

IFNG IFNGR1 IFNGR2 IFNK IFNW1

IFRD1 IFRD2 IFT122 IFT140 IFT172

IFT20 IFT52 IFT57 IFT74 IFT80

IFT81 IFT88 IGBP1 IGDCC3 IGDCC4

IGF1 IGF1 R IGF2 IGF2AS IGF2BP1

IGF2BP2 IGF2BP3 IGF2R IGFALS IGFBP1

IGFBP2 IGFBP3 IGFBP4 IGFBP5 IGFBP6

IGFBP7 IGFBPL1 IGFL3 IGFL4 IGFN1

IGHMBP2 IGHV10R15-1 IGHV10R15-5 IGJ IGLL1

IGLL3 IGSF1 IGSF10 IGSF1 1 IGSF21

IGSF22 IGSF3 IGSF5 IGSF6 IGSF8

IGSF9 IGSF9B IHH IK IKBIP

IKBKAP IKBKB IKBKE IKBKG IKZF1

IKZF4 ENSTO

IKZF2 IKZF3 IKZF4 0000262032 IKZF5

IL10 IL10RA IL10RB IL1 1 IL1 1 RA

IL12A IL12B IL12RB1 IL12RB2 IL13

IL13RA1 IL13RA2 IL15 IL15RA IL16

IL17A IL17B IL17C IL17D IL17F

IL17RA IL17RB IL17RC IL17RD IL17RE

IL17REL IL18 IL18BP IL18R1 IL18RAP

IL19 IL1 A IL1 B IL1 F10 IL1 F5

IL1 F6 IL1 F7 IL1 F8 IL1 F9 IL1 R1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

IL1 R2 IL1 RAP IL1 RAPL1 IL1 RAPL2 IL1 RL1

IL1 RL2 IL1 RN IL2 IL20 IL20RA

IL20RB IL21 IL21 R IL22 IL22RA1

IL22RA2 IL23A IL23R IL24 IL25

IL26 IL27 IL27RA IL28A IL28B

IL28RA IL29 IL2RA IL2RB IL2RG

IL2RG ENSTOOO

00374202 IL3 IL31 IL31 RA IL32

IL33 IL34 IL3RA IL4 IL4I1

IL4R IL5 IL5RA IL6 IL6R

IL6ST IL7 IL7R IL8 IL9

IL9R ILDR1 ILDR2 ILF2 ILF3

ILK ENSTOOOO

ILK ILKAP 0299421 ILVBL IMMP1 L

IMMP2L IMMT IMP3 IMP4 IMP5

IMPA1 IMPA2 IMPACT IMPAD1 IMPDH1

IMPDH2 IMPG1 IMPG2 INA INADL

INCA1 INCENP INE1 INF2 INF2 NEW

ING1 ING2 ING3 ING4 ING5

INGX INHA INHBA INHBB INHBC

INHBE INMT INO80 INO80B INO80C

INO80D INO80E INOC1 INPP1 INPP4A

INPP5B ENST

INPP4B INPP5A INPP5B 00000373026 INPP5D

INPP5E INPP5F INPP5J INPP5K INPPL1

INS INS-IGF2 INSC INSIG1 INSIG2

INSL3 INSL4 INSL5 INSL6 INSM1

INSM2 INSR INSRR INTS10 INTS12

INTS2 INTS3 INTS4 INTS5 INTS6

INTS7 INTS8 INTS9 INTU INVS

IP6K1 IP6K2 IP6K3 IPCEF1 IPMK

IP01 1 IP013 IP04 IP05 IP07

IP08 IP09 IPP IPPK IQCB1

IQCC IQCD IQCE IQCF1 IQCF2

IQCG IQCH IQCK IQGAP1 IQGAP2

IQGAP3 IQSEC1 IQSEC2 IQSEC3 IQUB

IRAKI IRAKI BP1 IRAK2 IRAK3 IRAK4

IREB2 IRF1 IRF2 IRF2BP1 IRF2BP2

IRF3 IRF4 IRF5 IRF6 IRF7

IRF8 IRF9 IRGC IRGQ IRS1

IRS2 IRS4 IRX1 IRX2 IRX3

IRX4 IRX5 IRX6 ISCA1 ISCA2

ISCU ISG15 ISG20 ISG20L2 ISL1

ISL2 ISLR ISLR2 ISM1 ISM2

ISOC1 ISOC2 ISX ISY1 ISYNA1

ITCH ITFG1 ITFG2 ITFG3 ITGA1

ITGA10 ITGA1 1 ITGA2 ITGA2B ITGA3

ITGA4 ITGA5 ITGA6 ITGA7 ITGA8

ITGA9 ITGAD ITGAE ITGAL ITGAM

ITGAV ITGAX ITGB1 ITGB1 BP1 ITGB1 BP2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ITGB1 BP3 ITGB2 ITGB3 ITGB3BP ITGB4

ITGB5 ITGB6 ITGB7 ITGB8 ITGBL1

ITIH1 ITIH2 ITIH3 ITIH4 ITIH5

ITIH5L ITK ITLN1 ITLN2 ITM2A

ITM2B ITM2C ITPA ITPK1 ITPKA

ITPKB ITPKC ITPR1 ITPR2 ITPR3

ITPRIP ITPRIPL1 ITPRIPL2 ITSN1 ITSN2

IVD IVL IVNS1 ABP IWS1 IYD

IZUM01 JAG1 JAG2 JAGN1 JAK1

JAK2 JAK3 JAKMIP1 JAKMIP2 JAKMIP3

JAM2 JAM3 JARID2 JAZF1 JDP2

JHDM1 D JMJD1 C JMJD4 JMJD5 JMJD6

JMJD7-PLA2G4B JMY J0SD1 J0SD2 JPH1

JPH2 JPH3 JPH4 JRKL JSRP1

JTB JUB JUN JUNB JUND

K0401 HUMA

JUP K0087 HUMAN N KAAG1 KAL1

KALRN KANK1 KANK2 KANK3 KANK4

KARCA1 KARS KAT2A KAT2B KAT5

KATNA1 KATNAL1 KATNAL2 KATNB1 KAZALD1

KBTBD1 0 KBTBD1 1 KBTBD2 KBTBD3 KBTBD4

KBTBD5 KBTBD6 KBTBD7 KBTBD8 KCNA1

KCNA10 KCNA2 KCNA3 KCNA4 KCNA5

KCNA6 KCNA7 KCNAB1 KCNAB2 KCNAB3

KCNB1 KCNB2 KCNC1 KCNC2 KCNC3

KCNC4 KCND1 KCND2 KCND3 KCNE1

KCNE1 L KCNE2 KCNE3 KCNE4 KCNF1

KCNG1 KCNG2 KCNG3 KCNG4 KCNH1

KCNH2 KCNH3 KCNH4 KCNH5 KCNH6

KCNH7 KCNH8 KCNIP1 KCNIP2 KCNIP3

KCNIP4 KCNJ1 KCNJ10 KCNJ1 1 KCNJ12

KCNJ13 KCNJ14 KCNJ15 KCNJ16 KCNJ2

KCNJ3 KCNJ4 KCNJ5 KCNJ6 KCNJ8

KCNJ9 KCNK1 KCNK10 KCNK12 KCNK13

KCNK15 KCNK16 KCNK17 KCNK18 KCNK2

KCNK3 KCNK4 KCNK5 KCNK6 KCNK7

KCNK9 KCNMA1 KCNMB1 KCNMB2 KCNMB3

KCNN1 ENST

KCNMB4 KCNN1 00000222249 KCNN2 KCNN3

KCNN4 KCNQ1 KCNQ2 KCNQ3 KCNQ4

KCNQ5 KCNRG KCNS1 KCNS2 KCNS3

KCNT1 KCNT2 KCNV1 KCNV2 KCP

KCTD1 KCTD10 KCTD1 1 KCTD12 KCTD13

KCTD14 KCTD15 KCTD16 KCTD17 KCTD18

KCTD19 KCTD2 KCTD20 KCTD21 KCTD3

KCTD4 KCTD5 KCTD6 KCTD7 KCTD8

KCTD9 KCTD9L KDELC1 KDELC2 KDELR1

KDELR2 KDELR3 KDM1 A KDM1 B KDM2A

KDM2B KDM3A KDM3B KDM4A KDM4B

KDM4C KDM4D KDM5A KDM5B KDM5C HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

KDM5D KDM6A KDM6B KDR KDSR

KEAP1 KEL KERA KHDC1 KHDRBS1

KHDRBS2 KHDRBS3 KHK KHNYN KHSRP

KIAA0020 KIAA0090 KIAA0100 KIAA0101 KIAA0141

KIAA0146 KIAA0174 KIAA0182 KIAA0195 KIAA0196

KIAA0226 ENST

KIAA0226 00000273582 KIAA0232 KIAA0240 KIAA0247

KIAA0284 KIAA0317 KIAA0319 KIAA0319L KIAA0355

KIAA0368 KIAA0391 KIAA0406 KIAA0408 KIAA0415

KIAA0467 E

KIAA0415 ENST NST0000037 00000450194 KIAA0427 KIAA0430 KIAA0467 2442

KIAA0494 KIAA0513 KIAA0528 KIAA0556 KIAA0562

KIAA0664 EN

ST0000032233

KIAA0564 KIAA0649 KIAA0664 5 KIAA0672

KIAA0701 KIAA0746 KIAA0748 KIAA0753 KIAA0776

KIAA0802 KIAA0831 KIAA0892 KIAA0895 KIAA0895L

KIAA0895 ENST

00000338533 KIAA0907 KIAA0913 KIAA0922 KIAA0947

KIAA0953 KIAA1 009 KIAA1 012 KIAA1024 KIAA1 033

KIAA1 045 KIAA1 109 KIAA1 143 KIAA1 147 KIAA1 161

KIAA1 191 KIAA1 199 KIAA1210 KIAA121 1 KIAA1217

KIAA1244 KIAA1267 KIAA1274 KIAA1279 KIAA1324

KIAA1324L KIAA1328 KIAA1377 KIAA1404 KIAA1407

KIAA1409 KIAA1429 KIAA1430 KIAA1432 KIAA1443

KIAA1462 KIAA1467 KIAA1468 KIAA1486 KIAA1 509

KIAA1 522 KIAA1 524 KIAA1 529 KIAA1530 KIAA1 539

KIAA1 542 KIAA1 543 KIAA1 549 KIAA1586 KIAA1 598

KIAA1 609 KIAA1 614 KIAA1 618 KIAA1632 KIAA1 644

KIAA1 671 KIAA1 683 KIAA1 688 KIAA1704 KIAA1 712

KIAA1 715 KIAA1 737 KIAA1 751 KIAA1755 KIAA1 772

KIAA1 797 KIAA1 804 KIAA1 826 KIAA1841 KIAA1 853

KIAA1 875 KIAA1 913 KIAA1 919 KIAA1949 KIAA1 958

KIAA1 967 KIAA1 984 KIAA2013 KIAA2018 KIAA2022

KIAA2026 KIDINS220 KIF1 1 KIF12 KIF13A

KIF13B KIF14 KIF15 KIF16B KIF17

KIF18A KIF18B KIF19 KIF1 A KIF1 B

KIF1 C KIF20A KIF20B KIF21 A KIF21 B

KIF22 KIF23 KIF25 KIF27 KIF2A

KIF2B KIF2C KIF3A KIF3B KIF3C

KIF4A KIF5A KIF5B KIF5C KIF6

KIF7 KIF9 KIFAP3 KIFC1 KIFC2

KIFC3 KIN KIR2DL1 KIR2DL3 KIR2DL4

KIR2DS4 KIR3DL1 KIR3DL2 KIR3DL3 KIR3DX1

KIRREL KIRREL2 KIRREL3 KISS1 KISS1 R

KIT KITLG KL KLB KLC1

KLC2 KLC3 KLC4 KLF1 KLF10

KLF1 1 KLF12 KLF13 KLF14 KLF15

KLF16 KLF17 KLF2 KLF3 KLF4

KLF5 KLF6 KLF7 KLF8 KLF9 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

KLHDC1 KLHDC10 KLHDC2 KLHDC3 KLHDC4

KLHDC5 KLHDC6 KLHDC7A KLHDC7B KLHDC8A

KLHDC8B KLHDC9 KLHL1 KLHL10 KLHL1 1

KLHL12 KLHL13 KLHL14 KLHL15 KLHL17

KLHL18 KLHL2 KLHL20 KLHL21 KLHL22

KLHL23 KLHL24 KLHL25 KLHL26 KLHL28

KLHL29 KLHL3 KLHL31 KLHL32 KLHL34

KLHL36 KLHL38 KLHL4 KLHL5 KLHL6

KLHL7 KLHL8 KLHL9 KLK1 KLK10

KLK1 1 KLK12 KLK13 KLK14 KLK15

KLK2 KLK3 KLK4 KLK5 KLK6

KLK7 KLK8 KLK9 KLKB1 KLRA1

KLRB1 KLRC1 KLRC2 KLRC3 KLRC4

KLRD1 KLRF1 KLRG1 KLRG2 KLRK1

KMO KNDC1 KNG1 KNTC1 KPNA1

KPNA2 KPNA3 KPNA4 KPNA5 KPNA6

KPNA7 KPNB1 KPRP KPTN KRAS

KRBA1 KRBA2 KRCC1 KREMEN1 KREMEN2

KRI1 KRIT1 KRR1 KRT1 KRT10

KRT12 KRT13 KRT14 KRT15 KRT16

KRT17 KRT18 KRT19 KRT2 KRT20

KRT222 KRT23 KRT24 KRT25 KRT26

KRT27 KRT28 KRT3 KRT31 KRT32

KRT33A KRT33B KRT34 KRT35 KRT36

KRT37 KRT38 KRT39 KRT4 KRT40

KRT5 KRT6A KRT6B KRT6C KRT7

KRT71 KRT72 KRT73 KRT74 KRT75

KRT76 KRT77 KRT78 KRT79 KRT8

KRT80 KRT81 KRT82 KRT83 KRT84

KRT85 KRT86 KRT9 KRTAP1 -1 KRTAP1 -3

KRTAP1 0-1 KRTAP1 0-10 KRTAP1 0-1 1 KRTAP10-12 KRTAP1 0-2

KRTAP1 0-3 KRTAP1 0-4 KRTAP1 0-5 KRTAP10-6 KRTAP1 0-8

KRTAP1 1 -1 KRTAP12-1 KRTAP12-3 KRTAP12-4 KRTAP13-1

KRTAP13-2 KRTAP13-3 KRTAP13-4 KRTAP15-1 KRTAP1 7-1

KRTAP1 9-1 KRTAP1 9-2 KRTAP1 9-3 KRTAP19-4 KRTAP1 9-5

KRTAP1 9-6 KRTAP1 9-7 KRTAP1 9-8 KRTAP2-1 KRTAP2-4

KRTAP20-1 KRTAP20-2 KRTAP21 -1 KRTAP21 -2 KRTAP22-1

KRTAP23-1 KRTAP24-1 KRTAP26-1 KRTAP27-1 KRTAP3-1

KRTAP3-2 KRTAP3-3 KRTAP4-12 KRTAP4-2 KRTAP4-3

KRTAP4-4 KRTAP4-5 KRTAP5-1 KRTAP5-10 KRTAP5-1 1

KRTAP5-2 KRTAP5-3 KRTAP5-5 KRTAP5-6 KRTAP5-7

KRTAP5-8 KRTAP6-1 KRTAP6-2 KRTAP8-1 KRTAP9-2

KRTAP9-3 KRTAP9-4 KRTAP9-8 KRTAP9L2 KRTCAP2

KRTCAP3 KRTDAP KSR1 KSR2 KTELC1

KTI12 KTN1 KYNU Klkbl4 L1 CAM

L1 TD1 L2HGDH L3MBTL L3MBTL2 L3MBTL3

L3MBTL4 LACE1 LACRT LACTB LACTB2

LAD1 LAG 3 LAGE3 LAIR1 LAIR2

LALBA LAMA1 LAMA2 LAMA3 LAMA4

LAMA5 LAMB1 LAMB2 LAMB3 LAMB4 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

LAMC1 LAMC2 LAMC3 LAMP1 LAMP2

LAMP3 LANCL1 LANCL2 LANCL3 LAP3

LAPTM4A LAPTM4B LAPTM5 LARGE LARP1

LARP1 B LARP4 LARP4B LARP6 LARP7

LARS LARS2 LAS1 L LASP1 LASS1

LASS2 LASS3 LASS4 LASS5 LASS6

LAT LAT2 LATS1 LATS2 LAX1

LAYN LBH LBP LBR LBX1

LBX2 LBXCOR1 LCA5 LCA5L LCAP

LCAT LCE1 A LCE1 B LCE1 C LCE1 D

LCE1 E LCE1 F LCE2A LCE2B LCE2C

LCE2D LCE3A LCE3B LCE3C LCE3D

LCE3E LCE4A LCE5A LCK LCLAT1

LCMT1 LCMT2 LCN1 LCN10 LCN12

LCN15 LCN2 LCN6 LCN8 LCN9

LCOR LCORL LCP1 LCT LCTL

LDB1 LDB2 LDB3 LDHA LDHAL6A

LDHAL6B LDHB LDHC LDHD LDLR

LDLRAD1 LDLRAD2 LDLRAD3 LDLRAP1 LDOC1

LDOC1 L LEAP2 LECT1 LECT2 LEF1

LEFTY1 LEFTY2 LEKR1 LELP1 LEMD1

LEMD2 LEMD3 LENEP LENG1 LENG8

LENG9 LE01 LEP LEPR LEPRE1

LEPREL1 LEPREL2 LEPROT LEPROTL1 LETM1

LETM2 LETMD1 LFNG LGALS1 LGALS12

LGALS13 LGALS14 LGALS2 LGALS3 LGALS3BP

LGALS4 LGALS7 LGALS8 LGALS9 LGALS9B

LGALS9C LGI1 LGI2 LGI3 LGI4

LGMN LGR4 LGR5 LGR6 LGSN

LGTN LHB LHCGR LHFP LHFPL1

LHFPL2 LHFPL4 LHFPL5 LHPP LHX1

LHX2 LHX3 LHX4 LHX5 LHX6

LHX8 LHX9 LIAS LIF LIFR

LIG1 LIG3 LIG4 LILRA1 LILRA2

LILRA3 LILRA4 LILRA5 LILRA6 LILRB1

LILRB2 LILRB3 LILRB4 LILRB5 LIM2

LIMA1 LIMCH1 LIMD1 LIMD2 LIME1

LIMK1 LIMK2 LIMS1 LIMS2 LIMS3

LIN28 LIN28B LIN52 LIN54 LIN7A

LIN7B LIN7C LIN9 LING01 LING02

LING04 LINS1 LIPA LI PC LIPE

LIPF LIPG LIPH LIPI LIPJ

LIPM LIPT1 LIPT2 LITAF LIX1

LL0XNC01 - LL0XNC01 -

LIX1 L 209G1 2 237H1 1 LLGL1 LLGL2

LLPH LMAN1 LMAN1 L LMAN2 LMAN2L

LMBR1 LMBR1 L LMBRD1 LMBRD2 LMCD1

LMF1 LMF2 LMLN LMNA LMNB1

LMNB2 LM01 LM02 LM03 LM04

LM07 LMOD1 LMOD2 LMTK2 LMTK3 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

LMX1 A LMX1 B LNP1 LNPEP LNX1

LNX2 LOC1 14984 LOC120364 LOC133308 LOC1391 16

LOC139249 LOC139263 LOC139431 LOC139516 LOC139542

LOC145814 LOC148213 LOC152485 LOC153328 LOC157567

LOC158572 LOC158730 LOC158825 LOC158957 LOC165186

LOC168850 LOC200420 LOC203510 LOC203604 LOC220686

LOC223075 LOC257106 LOC283232 LOC283398 LOC283412

LOC283849 LOC284023 LOC284100 LOC284288 LOC286404

LOC286408 LOC28641 1 LOC286467 LOC286478 LOC286512

LOC286528 LOC339123 LOC340096 LOC340549 LOC340571

LOC340578 LOC340581 LOC341457 LOC342541 LOC344165

LOC345630 LOC347376 LOC347381 LOC34741 1 LOC347421

LOC347424 LOC347549 LOC349136 LOC387867 LOC388972

LOC389669 LOC389841 LOC389842 LOC389846 LOC389848

LOC389858 LOC389873 LOC389888 LOC389895 LOC389899

LOC389900 LOC389901 LOC389904 LOC390335 LOC390956

LOC391370 LOC392434 LOC392439 LOC392459 LOC392467

LOC392473 LOC392487 LOC392512 LOC392528 LOC392529

LOC392531 LOC392533 LOC392539 LOC392546 LOC392549

LOC392554 LOC392556 LOC392559 LOC401052 LOC401 584

LOC401 588 LOC401 599 LOC401 605 LOC40161 1 LOC401 613

LOC401 616 LOC401 621 LOC402120 LOC402414 LOC402418

LOC439951 LOC440055 LOC440345 LOC440354 LOC440917

LOC440925 LOC440944 LOC441344 LOC441480 LOC441481

LOC441483 LOC441485 LOC441486 LOC441488 LOC441493

LOC441494 LOC441496 LOC441497 LOC441498 LOC441499

LOC441 504 LOC441 507 LOC441 510 LOC44151 1 LOC441 513

LOC441 515 LOC441 526 LOC441 795 LOC442425 LOC442439

LOC442444 LOC442447 LOC442451 LOC442452 LOC442454

LOC442456 LOC442461 LOC442464 LOC442465 LOC442466

LOC442470 LOC493829 LOC51058 LOC51059 LOC51 123

LOC51321 LOC541473 LOC55954 LOC56901 LOC57149

LOC642755 LOC643751 LOC645864 LOC646049 LOC646625

LOC646853 LOC646870 LOC646871 LOC649445 LOC649587

LOC649618 LOC649930 LOC650875 LOC65121 LOC651271

LOC651 503 LOC651 746 LOC652153 LOC652737 LOC653192

LOC653698 LOC653720 LOC728194 LOC728350 LOC728378

LOC729903 LOC730029 LOC730445 LOC730735 LOC731 028

LOC731 173 LOC731 740 LOC731 796 LOC731890 LOC81691

LOC88523 LOC91461 LOC91807 LOC92249 LOC93081

LOH12CR1 LONP1 LONP2 LONRF1 LONRF2

LONRF3 LOR LOX LOXL1 LOXL2

LOXL3 LOXL4 LPA LPAL2 LPAR1

LPAR2 LPAR3 LPAR4 LPAR5 LPAR6

LPCAT1 LPCAT2 LPCAT3 LPCAT4 LPGAT1

LPHN1 LPHN2 LPHN3 LPIN1 LPIN2

LPIN3 LPL LPO LPP LPPR2

LPPR4 LPXN LRAT LRBA LRCH1

LRCH2 LRCH3 LRCH4 LRDD LRFN1

LRFN2 LRFN3 LRFN4 LRFN5 LRG1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

LRGUK LRIG1 LRIG2 LRIG3 LRIT1

LRIT2 LRIT3 LRMP LRP1 LRP1 0

LRP1 1 LRP12 LRP1 B LRP2 LRP2BP

LRP3 LRP4 LRP5 LRP5L LRP6

LRP8 LRPAP1 LRPPRC LRRC1 LRRC10

LRRC14 LRRC14B LRRC15 LRRC1 6A LRRC16B

LRRC17 LRRC18 LRRC19 LRRC2 LRRC20

LRRC23 LRRC24 LRRC25 LRRC26 LRRC27

LRRC28 LRRC29 LRRC3 LRRC30 LRRC31

LRRC32 LRRC33 LRRC34 LRRC36 LRRC37A

LRRC37A2 LRRC37A3 LRRC37B LRRC39 LRRC3B

LRRC4 LRRC40 LRRC41 LRRC42 LRRC43

LRRC45 LRRC46 LRRC47 LRRC49 LRRC4B

LRRC4C LRRC50 LRRC52 LRRC55 LRRC56

LRRC57 LRRC59 LRRC6 LRRC61 LRRC66

LRRC67 LRRC68 LRRC7 LRRC8A LRRC8B

LRRC8C LRRC8D LRRC8E LRRCC1 LRRFIP1

LRRFIP1 ENSTO

0000392000 LRRFIP2 LRRIQ1 LRRIQ3 LRRK1

LRRK2 ENSTOO

LRRK2 000298910 LRRN1 LRRN2 LRRN3

LRRN4 LRRN4CL LRRTM1 LRRTM3 LRRTM4

LRSAM1 LRTM1 LRTM2 LRTOMT LRWD1

LSAMP LSG1 LSM1 LSM10 LSM1 1

LSM12 LSM14A LSM14B LSM2 LSM3

LSM4 LSM5 LSM6 LSMD1 LSP1

LSR LSS LST1 LTA LTA4H

LTB LTB4R LTB4R2 LTBP1 LTBP2

LTBP3 LTBP4 LTBR LTC4S LTF

LTK LTV1 LUC7L LUC7L2 LUC7L3

LUM LUZP1 LUZP2 LUZP4 LXN

LY6D LY6E LY6G5B LY6G5C LY6G6C

LY6G6D LY6G6F LY6H LY6K LY75

LY86 LY9 LY96 LYAR LYG1

LYNX1 ENS T000003175

LYG2 LYL1 LYN LYNX1 43

LYPD1 LYPD2 LYPD3 LYPD4 LYPD5

LYPD6 LYPLA1 LYPLA2 LYPLAL1 LYRM1

LYRM2 LYRM4 LYRM5 LYRM7 LYSMD1

LYSMD2 LYSMD3 LYSMD4 LYST LYVE1

LYZ LYZL1 LYZL2 LYZL4 LYZL6

LZIC LZTFL1 LZTR1 LZTS1 LZTS2

M6PR MAB21 L1 MAB21 L2 MACC1 MACF1

MACF1 ENSTOO

000361689 MACR0D1 MACR0D2 MAD1 L1 MAD2L1

MAD2L1 BP MAD2L2 MADCAM1 MADD MAEA

MAEL MAF MAF1 MAFA MAFB

MAFF MAFG MAFK MAG MAGEA1

MAGEA10 MAGEA1 1 MAGEA12 MAGEA13P MAGEA2

MAGEA2B MAGE A3 MAGEA4 MAGEA5 MAGEA6 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

MAGEA8 MAGEA9 MAGEA9B MAGEB1 MAGEB10

MAGEB16 MAGEB17 MAGEB18 MAGEB2 MAGEB3

MAGEB4 MAGEB5 MAGEB6 MAGEB6B MAGEC1

MAGEC2 MAGEC3 MAGED1 MAGED2 MAGED4B

MAGEE1 MAGEE2 MAGEF1 MAGEH1 MAG 11

MAG 11 ENSTOO

000402939 MAGI2 MAGI3 MAG IX MAGOH

MAGOHB MAGT1 MAK MAK16 MAL

MALL MALT1 MAMDC2 MAMDC4 MAML1

MAML2 MAMLD1 MAMSTR MAN1 A1 MAN1 A2

MAN1 B1 MAN1 C1 MAN2A1 MAN2A2 MAN2B1

MAN2B2 MAN2C1 MANBA MANBAL MANEA

MANEAL MANSC1 MAOA MAOB MAPI A

MAPI B MAPI D MAPI LC3A MAP1 LC3B MAPI LC3B2

MAPI LC3C MAP1 S MAP2 MAP2K1 MAP2K2

MAP2K3 MAP2K4 MAP2K5 MAP2K6 MAP2K7

MAP3K1 MAP3K10 MAP3K1 1 MAP3K12 MAP3K13

MAP3K14 MAP3K15 MAP3K2 MAP3K3 MAP3K4

MAP3K6 ENS

MAP3K5 MAP3K6 T00000374040 MAP3K7 MAP3K8

MAP3K9 MAP4 MAP4K1 MAP4K2 MAP4K3

MAP4K4 MAP4K5 MAP6 MAP6D1 MAP7

MAP7D1 MAP7D2 MAP7D3 MAP9 MAPK1

MAPK10 MAPK1 1 MAPK12 MAPK13 MAPK14

MAPK15 MAPK1 IP1 L MAPK3 MAPK4 MAPK6

MAPK7 MAPK8 MAPK8IP1 MAPK8IP2 MAPK8IP3

MAPK9 MAPKAP1 MAPKAPK2 MAPKAPK3 MAPKAPK5

MAPKBP1 MAPKSP1 MAPRE1 MAPRE2 MAPRE3

MAPT 01 -Mar 10-Mar 02-Mar 03-Mar

04-Mar 05-Mar 06-Mar 07-Mar 08-Mar

09-Mar MARCKS MARCKSL1 MARCO MARK1

MARK2 MARK3 MARK4 MARS MARS2

MARVELD2 MARVELD3 MAS1 MAS1 L MASP1

MAST2 ENST

MASP2 MAST1 MAST2 00000361297 MAST3

MAST4 MASTL MAT1 A MAT2A MAT2B

MATK MATN1 MATN4 MATR3 MAVS

MB3L2 HUMA

MAX MAZ MB N MBD1

MBD2 MBD3 MBD3L1 MBD3L2 MBD4

MBD5 MBD6 MBIP MBL2 MBLAC1

MBNL1 ENST

MBLAC2 MBNL1 00000282488 MBNL2 MBNL3

MBOAT1 MBOAT2 MBOAT4 MBOAT7 MBP

MBTD1 MBTPS1 MBTPS2 MC2R MC3R

MC4R MC5R MCAM MCART1 MCART2

MCART6 MCAT MCC MCCC1 MCCC2

MCC ENSTOOOO

MCCD1 0408903 MCEE MCF2 MCF2L

MCF2L2 MCFD2 MCHR1 MCHR2 MCL1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

MCM10 MCM2 MCM3 MCM3AP MCM4

MCM5 MCM6 MCM7 MCM8 MCM9

MCOLN1 MCOLN2 MCOLN3 MCPH1 MCRS1

MCTP1 MCTP2 MCTS1 MDC1 MDFI

MDFIC MDGA1 MDGA2 MDH1 MDH1 B

MDH2 MDK MDM1 MDM2 MDM4

MDN1 MDP1 MDS1 MDS2 ME1

ME2 ME3 MEA1 MEAF6 MECOM

MECP2 MECR MED1 MEDI O MED1 1

MED12 MED12L MED13 MED13L MED14

MED15 MED16 MED17 MED18 MED19

MED20 MED21 MED22 MED23 MED24

MED25 MED26 MED27 MED28 MED29

MED30 MED31 MED4 MED6 MED7

MED8 MED9 MEF2B MEF2C MEF2D

MEFV MEGF10 MEGF1 1 MEGF6 MEM

MEIG1 MEIS1 MEIS2 MEIS3 MELK

MEM01 MEM01 P MEN1 MEOX1 ME 0X2

MEP1 A MEP1 B MEPCE MEPE MERTK

MESDC1 MESDC2 MESP1 MESP2 MEST

MET METAP2 METRN METRNL METT10D

METT1 1 D1 METT5D1 METTL1 METTL10 METTL1 1 A

METTL12 METTL13 METTL14 METTL2A METTL2B

METTL3 METTL4 METTL5 METTL6 METTL7A

METTL7B METTL8 METTL9 MEX3A MEX3B

MEX3C MEX3D MFAP1 MFAP2 MFAP3

MFAP3L MFAP4 MFAP5 MFF MFGE8

MFHAS1 MFI2 MFN1 MFN2 MFNG

MFRP MFSD1 MFSD1 0 MFSD1 1 MFSD2A

MFSD3 MFSD4 MFSD5 MFSD6 MFSD6L

MFSD7 MFSD8 MFSD9 MGA MGAM

MGAM ENSTOO

00047301 1 MGAT1 MGAT2 MGAT3 MGAT4A

MGAT4B MGAT4C MGAT5 MGAT5B MGC15476

MGC17624 MGC33414 MGC33530 MGC421 05 MGC57359

MGC99813 MGEA5 MGLL MGMT MGP

MGRN1 MGST1 MGST2 MGST3 MIA

MICA3 HUM

MIA2 MIA3 MIB1 MIB2 AN

MICAL1 MICAL2 MICAL3 MICALCL MICALL1

MICALL2 MICB MIDI MID1 IP1 MID2

MIDN MIER1 MIER2 MIER3 MIF

MIF4GD MNP MINA MINK1 MINPP1

MIOS MIOX MIP MIPEP MIPOL1

MIS12 MITD1 MITF MIXL1 MKI67

MKI67IP MKKS MKL1 MKL2 MKLN1

MKNK2 ENST

MKNK1 MKNK2 00000250896 MKRN1 MKRN2

MKRN3 MKRN4P MKS1 MKX MLANA

MLC1 MLEC MLF1 MLF1 IP MLF2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

MLH1 MLH3 MLKL MLL MLL2

MLL3 MLL4 MLL5 MLLT1 MLLT10

MLLT1 1 MLLT3 MLLT4 MLLT6 MLN

MLST8 ENSTO

MLNR MLPH MLST8 0000301724 MLX

MLXIP MLXIPL MLYCD MM A A MMAB

MMACHC MMADHC MMD MMD2 MME

MMEL1 MMGT1 MMP1 MMP10 MMP1 1

MMP12 MMP13 MMP14 MMP15 MMP16

MMP17 MMP19 MMP2 MMP20 MMP21

MMP23B MMP25 MMP26 MMP27 MMP28

MMP3 MMP7 MMP8 MMP9 MMPL1

MMRN1 MMRN2 MN1 MNAT1 MND1

MNDA MNS1 MNT MNX1 MOAP1

MOBKL1 A MOBKL1 B MOBKL2A MOBKL2B MOBKL2C

MOBKL3 MOBP MOCOS MOCS1 MOCS2

MOCS3 MOG MOGAT1 MOGAT2 MOGAT3

MOGS MON1 A MON1 B MON2 MORC1

MORC2 MORC3 MORC4 MORF4L1 MORF4L2

MORN1 MORN3 MORN4 MORN5 MOS

MOSC1 MOSC2 MOSPD1 MOSPD2 MOSPD3

MOXD1 ENST

MOV1 0 MOV1 0L1 MOXD1 00000336749 MPDU1

MPDZ MPEG1 MPG MPHOSPH10 MPHOSPH6

MPHOSPH8 MPHOSPH9 MPI MPL MPND

MPO MPP1 MPP2 MPP3 MPP4

MPP5 MPP6 MPP7 MPPE1 MPPED2

MPRIP MPST MPV17 MPV17L MPV17L2

MPZ MPZL1 MPZL2 MPZL3 MR1

MRAP MRAP2 MR AS MRC1 MRC1 L1

MRC2 MRE1 1 A MREG MRFAP1 MRFAP1 L1

MRGPRD MRGPRE MRGPRF MRGPRG MRGPRX1

MRGPRX2 MRGPRX3 MRGPRX4 MRU MRM1

MRO MRP63 MRPL1 MRPL10 MRPL1 1

MRPL12 MRPL13 MRPL14 MRPL15 MRPL16

MRPL17 MRPL18 MRPL19 MRPL2 MRPL20

MRPL21 MRPL22 MRPL23 MRPL24 MRPL27

MRPL28 MRPL3 MRPL30 MRPL32 MRPL33

MRPL34 MRPL35 MRPL36 MRPL37 MRPL39

MRPL4 MRPL40 MRPL41 MRPL42 MRPL43

MRPL44 MRPL45 MRPL46 MRPL47 MRPL49

MRPL50 MRPL51 MRPL52 MRPL53 MRPL54

MRPL55 MRPL9 MRPS10 MRPS1 1 MRPS12

MRPS14 MRPS15 MRPS16 MRPS17 MRPS18A

MRPS18B MRPS18C MRPS2 MRPS21 MRPS22

MRPS23 MRPS24 MRPS25 MRPS26 MRPS27

MRPS28 MRPS30 MRPS31 MRPS33 MRPS34

MRPS35 MRPS36 MRPS5 MRPS6 MRPS7

MRPS9 MRRF MRRFP1 MRS2 MRT04

MRVI1 MS4A1 MS4A10 MS4A12 MS4A13 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

MS4A14 MS4A15 MS4A2 MS4A3 MS4A4A

MS4A5 MS4A6A MS4A6E MS4A7 MS4A8B

MSC MSGN1 MSH2 MSH3 MSH4

MSH5 MSH6 MSI1 MSI2 MSL1

MSL2 MSL3 MSLN MSLNL MSMB

MSMP MSN MSR1 MSRA MSRB2

MSRB3 MST1 MST1 R MST4 MSTN

MST01 MSX1 MSX2 MT1 A MT1 B

MT1 E MT1 F MT1 G MT1 H MT1 M

MT1 P2 MT1 X MT2A MT3 MT4

MTA1 MTA2 MTAC2D1 MTAP MTBP

MTCH1 MTCH2 MTCP1 MTDH MTERF

MTERFD1 MTERFD2 MTERFD3 MTF1 MTF2

MTFR1 MTG1 MTHFD1 MTHFD1 L MTHFD2

MTHFD2L MTHFR MTHFS MTHFSD MTIF2

MTIF3 MTL5 MTM1 MTMR1 MTMR10

MTMR1 1 MTMR12 MTMR14 MTMR15 MTMR2

MTMR3 ENSTOO

MTMR3 000401950 MTMR4 MTMR6 MTMR7

MTMR8 MTMR9 MTNR1 A MTNR1 B MT01

MTOR MTP18 MTPAP MTPN MTR

MTRF1 MTRF1 L MTRR MTSS1 MTTP

MTUS2 ENST

MTUS1 MTUS2 00000431530 MTX1 MTX2

MUC16 ENS

T000003319

MUC1 MUC13 MUC15 MUC16 86

MUC4 ENST

MUC17 MUC2 MUC21 MUC4 00000405167

MUC5AC MUC7 MUCL1 MUDENG MUL1

MUM1 MUM1 L1 MURC MUS81 MUSK

MUT MUTED MUTYH MVD MVK

MVP MX1 MX2 MXD1 MXD3

MXD4 MXI1 MXRA5 MXRA7 MXRA8

MYADM MYADML2 MYB MYBBP1 A MYBL1

MYBL2 MYBPC1 MYBPC2 MYBPC3 MYBPH

MYB ENSTOOOO

MYBPHL 034191 1 MYC MYCBP MYCBP2

MYCL1 ENST

MYCBPAP MYCL1 00000397332 MYCL2 MYCN

MYCT1 MYD88 MYEF2 MYEOV MYEOV2

MYF5 MYF6 MYH1 MYH10 MYH1 1

MYH14 MYH15 MYH16 MYH2 MYH3

MYH4 MYH6 MYH7 MYH7B MYH8

MYH9 MYL1 MYL10 MYL12A MYL12B

MYL2 MYL3 MYL4 MYL5 MYL6

MYL6B MYL7 MYL9 MYLIP MYLK

MYLK2 MYLK3 MYLK4 MYLPF MYNN

MYO1 0 MY01 5A MY01 6 MY018A MY01 8B

MY01 A MY01 B MY01 C MY01 D MY01 E

MY01 F MY01 G MY03A MY03B MY05A HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

MY05B MY05C MY06 MY07A MY09A

MY09B ENSTOO

MY09B 000319396 MYOC MYOCD MYOD1

MYOF MYOG MYOHD1 MYOM1 MYOM2

MYOM3 MYOT MYOZ1 MYOZ2 MYOZ3

MYPN MYPOP MYRIP MYSM1 MYST1

MYST2 MYST3 MYST4 MYT1 MYT1 L

MZF1 Magmas N4BP1 N4BP2 N4BP2L1

N4BP2L2 N4BP3 N6AMT1 N6AMT2 NAA10

NAA15 NAA16 NAA20 NAA25 NAA30

NAA35 NAA38 NAA40 NAA50 NAAA

NAALAD2 NAALADL1 NAB1 NAB2 NACA

NACA2 NACA3P NACC1 NACC2 NADK

NADSYN1 NAE1 NAF1 NAG6 NAGA

NAGK NAGLU NAG PA NAGS NAIF1

NAIP NALCN NALP6 NAMPT NANOG

NANOGP1 NANOS1 NANOS2 NANOS3 NANP

NANS NAP1 L1 NAP1 L2 NAP1 L3 NAP1 L4

NAP1 L5 NAP1 L6 NAPA NAPB NAPEPLD

NAPRT1 NAPSA NAPSB NARF NARFL

NARG2 NARS NARS2 NASP NAT1

NAT10 NAT14 NAT2 NAT6 NAT8

NAT8L NAT9 NAV1 NAV2 NAV3

NBEAL1 ENS

NBAS NBEA NBEAL1 T00000449802 NBEAL2

NBL1 NBN NBPF1 1 NBPF14 NBPF15

NBPF16 NBPF3 NBPF5 NBPF7 NBR1

NCALD NCAM2 NCAN NCAPD2 NCAPD3

NCAPG NCAPG2 NCAPH NCAPH2 NCBP1

NCBP2 NCBP2L NCCRP1 NCDN NCEH1

NCF1 NCF2 NCF4 NCK1 NCK2

NCKAP5 ENS

NCKAP1 NCKAP1 L NCKAP5L T00000405974 NCKIPSD

NCL NCLN NCOA1 NCOA2 NCOA3

NCOA4 NCOA5 NCOA6 NCOA7 NCOR1

NCRNA0008

NCOR2 NCR1 NCR2 NCR3 6

NCRNA0017

NCRNA00103 NCRNA00105 NCRNA00169 NCRNA001 74 5

NCRNA00176 NCRNA00188 NCS1 NCSTN ND4

NDC80 NDE1 NDEL1 NDFIP1 NDFIP2

NDN NDNL2 NDOR1 NDP NDRG1

NDRG2 NDRG3 NDRG4 NDST1 NDST2

NDST3 NDST4 NDUFA1 NDUFA1 0 NDUFA1 1

NDUFA12 NDUFA13 NDUFA2 NDUFA3 NDUFA4

NDUFA4L2 NDUFA5 NDUFA6 NDUFA7 NDUFA8

NDUFA9 NDUFAB1 NDUFAF1 NDUFAF2 NDUFAF3

NDUFAF4 NDUFB1 NDUFB10 NDUFB1 1 NDUFB2

NDUFB3 NDUFB4 NDUFB5 NDUFB6 NDUFB7

NDUFB8 NDUFB9 NDUFC1 NDUFC2 NDUFS1

NDUFS2 NDUFS3 NDUFS4 NDUFS5 NDUFS6 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

NDUFS7 NDUFS8 NDUFV1 NDUFV2 NDUFV3

NEB NEBL NECAB1 NECAB2 NECAB3

NECAP1 NECAP2 NEDD1 NEDD4 NEDD4L

NEDD8 NEDD9 NEFH NEFL NEFM

NEGRI NEIL1 NEIL2 NEIL3 NEK1

NEK10 NEK1 1 NEK2 NEK3 NEK4

NEK5 NEK6 NEK7 NEK8 NEK9

NELF NELL1 NELL2 NENF NE01

NES NET1 NET01 NET02 NEU1

NEU2 NEU4 NEURL NEURL2 NEURL3

NEURL4 ENSTO

NEURL4 0000315614 NEUROD1 NEUROD2 NEUROD4

NEUR0D6 NEUR0G1 NEUROG2 NEUROG3 NEXN

NF1 NF2 NFAM1 NFASC NFAT5

NFATC1 NFATC2 NFATC2IP NFATC3 NFATC4

NFE2 NFE2L1 NFE2L2 NFE2L3 NFIA

NFIB ENSTOOOO

NFIB 0397581 NFIC NFIL3 NFIX

NFKB1 NFKB2 NFKBIA NFKBIB NFKBID

NFKBIE NFKBIL1 NFKBIL2 NFKBIZ NFRKB

NFS1 NFU1 NFX1 NFXL1 NFYA

NFYB NFYC NGB NGDN NGEF

NGF NGFR NGFRAP1 NGLY1 NGRN

NHEDC1 NHEDC2 NHEJ1 NHLH1 NHLH2

NHLRC1 NHLRC2 NHLRC3 NHP2 NHP2L1

NHS NHSL1 NHSL2 NICN1 NID1

NID2 NIF3L1 NIN NINJ1 NINJ2

NINL NIP7 NIPA1 NIPA2 NIPAL1

NIPAL2 NIPAL3 NIPAL4 NIPBL NIPSNAP1

NIPSNAP3A NIPSNAP3B NISCH NIT1 NIT2

NKAIN1 NKAIN2 NKAIN4 NKAP NKAPL

NKD1 NKD2 NKG7 NKIRAS1 NKIRAS2

NKPD1 NKRF NKTR NKX2-1 NKX2-2

NKX2-3 NKX2-4 NKX2-5 NKX2-6 NKX2-8

NKX3-1 NKX3-2 NKX6-1 NKX6-2 NKX6-3

NLE1 NLGN1 NLGN2 NLGN3 NLGN4X

NLGN4Y NLK NLN NLRC3 NLRC4

NLRC5 NLRP1 NLRP10 NLRP1 1 NLRP12

NLRP13 NLRP14 NLRP2 NLRP3 NLRP4

NLRP5 NLRP6 NLRP7 NLRP8 NLRP9

NLRX1 NMB NMBR NMD3 NME1

NME1 -NME2 NME2 NME2P1 NME3 NME4

NME5 NME6 NME7 NMI NMNAT1

NMNAT2 NMNAT3 NMRAL1 NMS NMT1

NM 0010129

NMT2 NMU NMUR1 NMUR2 84 2

NM 00103969 NM 00108047

NM 001013679 NM 001031 4 0 2 0 1 NM 024534

NM 024588 3 NM 032947 3 NM 1 98455 2 NNAT NNMT

NNT NOB1 NOBOX NOC2L NOC3L HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

NOC4L NOD1 NOD2 NODAL NOG

NOL1 1 NOL12 NOL3 NOL4 NOL6

NOL7 NOL9 NOLC1 NOM1 NOM01

NOM02 NOM03 NONO NOP10 NOP14

NOP16 NOP2 NOP56 NOP58 NOS1

NOS1 AP ENSTO

NOS1 AP 0000361 897 NOS2 NOS3 NOSIP

NOSTRIN NOTCH1 NOTCH2 NOTCH2NL NOTCH3

NOTCH4 NOTUM NOV NOVA1 NOVA2

NOX1 NOX3 NOX4 NOX5 NOXA1

NOX01 NP12 HUMAN NPAS1 NPAS2 NPAS3

NPAS4 NPAT NPB NPBWR1 NPBWR2

NPC1 NPC1 L1 NPC2 NPDC1 NPEPPS

NPFF NPFFR1 NPFFR2 NPHP1 NPHP3

NPHP4 NPHS1 NPHS2 NPIP NPIPL1

NPIPL2 NPL NPLOC4 NPM1 NPM2

NPM3 NPNT NPPA NPPB NPPC

NPR1 NPR2 NPR3 NPS NPSR1

NPTN NPTX1 NPTX2 NPTXR NPVF

NPW NPY NPY1 R NPY2R NPY5R

NP 001073948

NPY6R 1 NQ01 NQ02 NR0B1

NR0B2 NR1 D1 NR1 D2 NR1 H2 NR1 H3

NR1 H4 NR1 I2 NR1 I3 NR2C1 NR2C2

NR2C2AP NR2E1 NR2E3 NR2F1 NR2F2

NR2F6 NR3C1 NR3C2 NR4A1 NR4A2

NR4A3 NR5A1 NR5A2 NR6A1 NRAP

NRARP NRAS NRBF2 NRBP1 NRBP2

NRCAM NRD1 NRF1 NRG1 NRG2

NRG3 NRG4 NRGN NRIP1 NRIP2

NRIP3 NRK NRL NRM NRN1

NRN1 L NRP1 NRP2 NRSN1 NRSN2

NR 002168

NRTN NRXN1 NRXN2 NRXN3 1

NR 002781

NR 00221 7 1 NR 002453 4 NR 002730 1 NR 002733 1 1

NR 002938 2 NR 003034 1 NR 003148 2 NR 003276 1 NSA2

NSD1 NSDHL NSF NSFL1 C NSL1

NSMAF NSMCE1 NSMCE2 NSMCE4A NSUN2

NSUN3 NSUN4 NSUN5 NSUN5P1 NSUN5P2

NSUN6 NSUN7 NT5C NT5C1 A NT5C1 B

NT5C2 NT5C3 NT5C3L NT5DC1 NT5DC2

NT5DC3 NT5E NT5M NTAN1 NTF3

NTF4 NTHL1 NTM NTN1 NTN3

NTN4 NTN5 NTNG1 NTNG2 NTRK1

NTRK2 NTRK3 NTS NTSR1 NTSR2

NUAK1 NUAK2 NUB1 NUBP1 NUBP2

NUBPL NUCB1 NUCB2 NUCKS1 NUDC

NUDCD1 NUDCD2 NUDCD3 NUDT1 NUDT10

NUDT1 1 NUDT12 NUDT13 NUDT14 NUDT15

NUDT16 NUDT16L1 NUDT17 NUDT19 NUDT2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

NUDT21 NUDT22 NUDT3 NUDT4 NUDT5

NUDT6 NUDT7 NUDT8 NUDT9 NUF2

NUFIP1 NUFIP2 NUMA1 NUMB NUMBL

NUP1 07 NUP133 NUP1 53 NUP155 NUP1 60

NUP1 88 NUP205 NUP210 NUP210L NUP214

NUP35 NUP37 NUP43 NUP50 NUP54

NUP62 NUP62CL NUP85 NUP88 NUP93

NUP98 NUPL1 NUPL2 NUPR1 NUS1

NUTF2 NVL NWD1 NXF1 NXF2

NXF2B NXF3 NXF4 NXF5 NXN

NXNL1 NXNL2 NXPH1 NXPH2 NXPH3

NXPH4 NXT1 NXT2 NYNRIN NYX

O10J6 HUMA 052L2 HUMA 05AK3 HUM

000434 HUMAN O10D4 HUMAN N N AN

06041 1 HUM 075863 HUM 095014 HU

060374 HUMAN 060384 HUMAN AN AN MAN

095431 HUMAN OAF OAS1 OAS2 OAS3

OASL OAT OAZ1 OBFC1 OBFC2A

OBSCN EN ST00000359

OBFC2B OBP2A OBP2B OBSCN 599

OC90 ENSTOO

OBSL1 OC90 000262283 OCA2 OCEL1

OCIAD1 OCIAD2 OCLN OCM OCM2

OCRL ODAM ODC1 ODF1 ODF2

ODF2L ODF3 ODF3B ODF3L1 ODF3L2

ODF4 ODZ1 ODZ2 OFCC1 OFD1

OGDH OGDHL OGFOD1 OGFOD2 OGFR

OGT ENSTO

OGFRL1 OGG1 OGN OGT 0000373719

OIP5 OIT3 OLA1 OLAH OLFM1

OLFM2 OLFM3 OLFM4 OLFML1 OLFML2A

OLFML2B OLFML3 OLIG1 OLIG2 OLIG3

OLR1 OMA1 OMD OMG ONECUT1

ONECUT2 OPA1 OPA3 OPALIN OPCML

OPHN1 OPLAH OPN1 LW OPN1 MW OPN1 MW2

OPN1 SW OPN3 OPN4 OPN5 OPRD1

OPRK1 OPRL1 OPRM1 OPTC OPTN

OR10A2 OR10A3 OR10A4 OR10A5 OR10A6

OR10A7 OR10AD1 OR10AG1 OR10C1 OR10G2

OR10G3 OR10G4 OR10G6 OR10G7 OR10G8

OR10G9 OR10H1 OR10H2 OR10H3 OR10H4

OR10H5 OR10J1 OR10J3 OR10J5 OR10K1

OR10K2 OR10P1 OR10Q1 OR10R2 OR10R3P

OR10S1 OR10T2 OR10V1 OR10W1 OR10X1

OR10Z1 OR1 1 A1 OR1 1 G2 OR1 1 H1 OR1 1 H12

OR1 1 H4 OR1 1 H6 OR1 1 L1 OR12D2 OR12D3

OR13A1 OR13C2 OR13C3 OR13C4 OR13C5

OR13C8 OR13C9 OR13D1 OR13F1 OR13G1

OR13H1 OR13J1 OR14A16 OR14C36 OR14I1

OR14J1 OR1 A1 OR1 A2 OR1 B1 OR1 C1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

OR1D2 OR1D4 OR1E1 OR1E2 OR1F1

OR1G1 OR1I1 OR1J1 OR1J2 OR1J4

OR1K1 OR1L1 OR1L3 OR1L4 OR1L6

OR1L8 OR1M1 OR1N1 OR1N2 OR1Q1

OR1S1 OR1S2 OR2A12 OR2A14 OR2A2

OR2A25 OR2A4 OR2A5 OR2AE1 OR2AG1

OR2AG2 OR2AJ1 OR2AK2 OR2AP1 OR2AT4

OR2B11 OR2B2 OR2B3P OR2B6 OR2C1

OR2C3 OR2D2 OR2D3 OR2F1 OR2F2

OR2G2 OR2G3 OR2G6 OR2H1 OR2H2

OR2J3 HUMA

OR2J1 OR2J2 OR2J3 N OR2K2

OR2L13 OR2L1 P OR2L2 OR2L3 OR2L8

OR2M1P OR2M2 OR2M3 OR2M4 OR2M5

OR2M7 OR2S2 OR2T1 OR2T10 OR2T11

OR2T12 OR2T2 OR2T27 OR2T3 OR2T33

OR2T34 OR2T35 OR2T4 OR2T5 OR2T6

OR2T8 OR2V2 OR2W1 OR2W3 OR2W5

OR2Y1 OR2Z1 OR3A1 OR3A3 OR3A4

OR4A13P OR4A15 OR4A16 OR4A47 OR4A5

OR4B1 OR4C11 OR4C12 OR4C13 OR4C15

OR4C5 HUMA

OR4C16 OR4C3 OR4C46 N OR4C6

OR4D1 OR4D10 OR4D11 OR4D2 OR4D5

OR4D6 OR4D9 OR4E2 OR4F15 OR4F16

OR4F17 OR4F21 OR4F29 OR4F3 OR4F4

OR4F5 OR4F6 OR4K1 OR4K13 OR4K14

OR4K15 OR4K17 OR4K2 OR4K5 OR4L1

OR4M1 OR4M2 OR4N2 OR4N4 OR4N5

OR4P4 OR4Q3 OR4S1 OR4S2 OR4X1

OR4X2 OR51A2 OR51A4 OR51A7 OR51B2

OR51B4 OR51B5 OR51B6 OR51D1 OR51E1

OR51E2 OR51F1 OR51F2 OR51G1 OR51G2

OR51H1P OR51I1 OR51I2 OR51J1 OR51L1

OR51M1 OR51Q1 OR51S1 OR51T1 OR51V1

OR52A1 OR52A4 OR52A5 OR52B4 OR52B6

OR52D1 OR52E2 OR52E4 OR52E6 OR52E8

OR52H1 OR52I1 OR52I2 OR52J3 OR52K1

OR52K2 OR52L1 OR52M1 OR52N1 OR52N2

OR52N4 OR52N5 OR52R1 OR52W1 OR56A1

OR56A3 OR56A4 OR56B1 OR56B4 OR5A1

OR5A2 OR5AC2 OR5AK2 OR5AN1 OR5AP2

OR5AR1 OR5AS1 OR5AU1 OR5AX1 OR5B12

OR5B17 OR5B2 OR5B21 OR5B3 OR5C1

OR5D13 OR5D14 OR5D16 OR5D18 OR5D3P

OR5E1P OR5F1 OR5H1 OR5H14 OR5H15

OR5H2 OR5H6 OR5I1 OR5J2 OR5K1

OR5K2 OR5K3 OR5K4 OR5L1 OR5L2

OR5M1 OR5M3 OR5M8 OR5M9 OR5P2

OR5P3 OR5R1 OR5T1 OR5T2 OR5T3 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

OR5V1 OR5W2 OR6A2 OR6B1 OR6B3

OR6C1 OR6C2 OR6C3 OR6C4 OR6C6

OR6C65 OR6C68 OR6C70 OR6C74 OR6C75

OR6J1 HUMA

OR6C76 OR6F1 N OR6K2 OR6K3

OR6K6 OR6M1 OR6N1 OR6N2 OR6P1

OR6Q1 OR6S1 OR6T1 OR6W1 P OR6X1

OR6Y1 OR7A10 OR7A17 OR7A5 OR7C1

OR7C2 OR7D2 OR7D4 OR7E24 OR7E5P

OR7G1 OR7G2 OR7G3 OR8A1 OR8B12

OR8B2 OR8B3 OR8B4 OR8B8 OR8D1

OR8D2 OR8D4 OR8H1 OR8H2 OR8H3

OR8I2 OR8J1 OR8J3 OR8K1 OR8K3

OR8K5 OR8S1 OR8U1 OR9A2 OR9A4

OR9G1 OR9G4 OR9I1 OR9K2 OR9Q1

OR9Q2 ORAM ORAI2 ORAI3 ORAOV1

ORC1 L ORC2L ORC3L ORC4L ORC5L

ORC6L ORM1 ORM2 ORMDL1 ORMDL2

ORMDL3 OS9 OSBP OSBP2 OSBPL1 0

OSBPL1 0 ENST

00000396556 OSBPL1 1 OSBPL1 A OSBPL2 OSBPL3

OSBPL5 OSBPL6 OSBPL7 OSBPL8 OSBPL9

OSCAR OSCP1 OSGEP OSGIN1 OSGIN2

OSM OSMR OSR1 OSR2 OSTC

OSTCL OSTF1 OSTM1 OSTN OSTalpha

OTOF ENST

OSTbeta OTC OTOA OTOF 00000361394

OTOG OTOP1 OTOP2 OTOP3 OTOR

OTOS OTP OTUB1 OTUB2 OTUD1

OTUD5 ENST

OTUD3 OTUD4 OTUD5 00000453548 OTUD6A

OTUD7A OTUD7B OTX1 OTX2 OVCH1

OVCH2 OVGP1 OVOL1 OVOL2 OXA1 L

OXCT1 OXCT2 OXER1 OXGR1 OXNAD1

OXR1 OXSM OXSR1 OXT OXTR

P1 1 7 P2RX1 P2RX2 P2RX3 P2RX4

P2RX5 P2RX7 P2RXL1 P2RY1 P2RY10

P2RY1 1 P2RY12 P2RY13 P2RY14 P2RY2

P2RY4 P2RY6 P2RY8 P461 HUMAN P4HA1

P78389 HU

P4HA2 P4HA3 P4HB P4HTM MAN

P78561 HUMAN PA2G4 PAAF1 PABPC1 PABPC1 L

PABPC1 L2A PABPC1 L2B PABPC3 PABPC4 PABPC5

PABPCP2 PABPN1 PACRG PACRG L PACS1

PACS2 PACSIN1 PACSIN2 PACSIN3 PADI1

PADI2 PADI3 PADI4 PADI6 PAEP

PAF1 PAFAH1 B1 PAFAH1 B2 PAFAH1 B3 PAFAH2

PAG1 PAGE1 PAGE2 PAGE2B PAGE3

PAGE4 PAGE5 PAH PAICS PAIP1

PAIP2 PAIP2B PAK1 PAK1 IP1 PAK2

PAK3 PAK4 PAK6 PAK7 PALB2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PALLD PALM PALM2 PALM2-AKAP2 PALMD

PAM PAMR1 PAN2 PAN3 PANK1

PANK2 PANK3 PANK4 PANX1 PANX2

PAOX ENST0

PANX3 PAOX 0000357296 PAP2D PAPD4

PAPD5 ENSTOO

PAPD5 000436909 PAPD7 PAPLN PAPOLA

PAPOLB PAPOLG PAPPA PAPPA2 PAPSS1

PAPSS2 PAQR3 PAQR4 PAQR5 PAQR6

PAQR7 PAQR8 PAQR9 PARD3 PARD3B

PARD6A PARD6B PARD6G PARG PARK2

PARK7 PARL PARP1 PARP1 0 PARP1 1

PARP12 PARP14 PARP15 PARP1 6 PARP2

PARP3 PARP4 PARP6 PARP8 PARP9

PARS2 PARVA PARVB PARVG PASD1

PASK PATE1 PATE2 PATZ1 PAWR

PAX1 PAX2 PAX3 PAX4 PAX5

PAX6 PAX7 PAX8 PAX9 PAXIP1

PBK PBLD PBRM1 PBX1 PBX2

PBX3 PBX4 PBXIP1 PC PCBD1

PCBD2 PCBP1 PCBP2 PCBP3 PCBP4

PCCA PCCB PCDH1 PCDH10 PCDH1 1 X

PCDH1 1 Y PCDH12 PCDH1 5 PCDH17 PCDH1 8

PCDH1 9 NM 02

PCDH1 9 0766 1 PCDH20 PCDH24 PCDH7

PCDHA10 E NST0000050

PCDH8 PCDH9 PCDHA1 PCDHA10 5235

PCDHA1 1 PCDHA13 PCDHA2 PCDHA3 PCDHA4

PCDHA5 PCDHA6 PCDHA7 PCDHA8 PCDHA9

PCDHAC1 PCDHAC2 PCDHB1 PCDHB10 PCDHB1 1

PCDHB12 PCDHB13 PCDHB14 PCDHB15 PCDHB16

PCDHB18 PCDHB2 PCDHB3 PCDHB4 PCDHB5

PCDHB6 PCDHB7 PCDHB8 PCDHGA1 PCDHGA12

PCDHGA12 EN

ST00000252085 PCDHGA2 PCDHGA3 PCDHGA6 PCDHGB7

PCDHGC5 E

PCDHGC3 ENS NST0000025

PCDHGC3 T00000308177 PCDHGC4 PCDHGC5 2087

PCF1 1 PCGF1 PCGF2 PCGF3 PCGF5

PCGF6 PCID2 PCIF1 PCK1 PCK2

PCM1 PCMT1 PCMTD1 PCMTD2 PCNA

PCNP PCNT PCNX PCNXL2 PCNXL3

PCOLCE PCOLCE2 PCP2 PCP4 PCQAP

PCSK1 PCSK1 N PCSK2 PCSK4 PCSK5

PCSK5 ENSTOO

000376767 PCSK7 PCSK9 PCTP PCYOX1

PCYOX1 L PCYT1 A PCYT1 B PCYT2 PDAP1

PDC PDCD1 PDCD1 0 PDCD1 1 PDCD1 LG2

PDCD2 PDCD2L PDCD4 PDCD5 PDCD6

PDCD6IP PDCD7 PDCD8 PDCL PDCL3 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PDDC1 PDE10A PDE1 1 A PDE12 PDE1 A

PDE1 B PDE1 C PDE2A PDE3A PDE3B

PDE4B ENST

PDE4A PDE4B 00000423207 PDE4C PDE4D

PDE4DIP PDE5A PDE6A PDE6B PDE6C

PDE6D PDE6G PDE6H PDE7A PDE7B

PDE8A PDE8B PDE9A PDGFA PDGFB

PDGFC PDGFD PDGFRA PDGFRB PDGFRL

PDHA1 PDHA2 PDHB PDHX PDIA2

PDIA3 PDIA4 PDIA5 PDIA6 PDIK1 L

PDILT PDK1 PDK2 PDK3 PDK4

PDLIM1 PDLIM2 PDLIM3 PDLIM4 PDLIM5

PDLIM7 PDP1 PDP2 PDPK1 PDPN

PDPR PDRG1 PDS5B PDSS1 PDSS2

PDX1 PDXDC1 PDXDC2 PDXK PDXP

PDYN PDZD1 1 PDZD2 PDZD3 PDZD4

PDZD7 PDZD8 PDZK1 PDZK1 IP1 PDZRN3

PDZRN4 PEA15 PEAR1 PEBP1 PEBP4

PECI PECR PEF1 PEG10 PEG3

PELI1 PELI2 PELI3 PELO PELP1

PEMT PENK PEPD PER1 PER2

PER3 PERP PES1 PET1 12L PEX1

PEX10 PEX1 1 A PEX1 1 B PEX1 1 G PEX12

PEX13 PEX14 PEX16 PEX19 PEX2

PEX26 PEX3 PEX5 PEX5L PEX6

PEX7 PF4 PF4V1 PFAS PFDN1

PFDN2 PFDN4 PFDN5 PFDN6 PFKFB1

PFKFB2 PFKFB3 PFKFB4 PFKL PFKM

PFKP PFN1 PFN2 PFN3 PFN4

PGAM1 HU

PGA3 PGA4 PGA5 PGAM1 MAN

PGAM2 PGAM4 PGAM5 PGAP1 PGAP3

PGBD1 PGBD2 PGBD3 PGBD4 PGBD5

PGC PGCP PGD PGF PGGT1 B

PGK1 PGK2 PGLS PGLYRP1 PGLYRP2

PGLYRP3 PGLYRP4 PGM1 PGM2 PGM2L1

PGM3 PGM5 PGP PGPEP1 PGR

PGRMC1 PGRMC2 PGS1 PHACTR2 PHACTR3

PHACTR4 PHAX PHB PHC1 PHC1 B

PHC2 PHC3 PHEX PHF1 PHF10

PHF1 1 PHF12 PHF13 PHF14 PHF15

PHF16 PHF17 PHF19 PHF2 PHF20

PHF20L1 PHF21 A PHF21 B PHF23 PHF3

PHF5A PHF6 PHF7 PHF8 PHGDH

PHIP PHKA1 PHKA2 PHKB PHKG1

PHKG2 PHLDA1 PHLDA2 PHLDA3 PHLDB1

PHLDB2 PHLDB3 PHLPP PHLPP2 PHOSPH01

PH0SPH02 PH0X2A PH0X2B PHPT1 PHTF1

PHYH PHYHD1 PHYHIP PHYHIPL PI15

PI16 PI3 PI4K2A PI4K2B PI4KA HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PI4KAP2 PI4KB PIAS1 PIAS2 PIAS3

PIAS4 PIBF1 PICALM PICK1 PID1

PIF1 PIGA PIGB PIGC PIGF

PIGG PIGH PIGK PIGL PIGM

PIGN PIGO PIGP PIGQ PIGR

PIGS PIGT PIGU PIGV PIGW

PIGX PIGZ PIH1 D1 PIH1 D2 PIK3AP1

PIK3C2A PIK3C2B PIK3C2G PIK3C3 PIK3CA

PIK3CB PIK3CD PIK3CG PIK3IP1 PIK3R1

PIK3R2 PIK3R3 PIK3R4 PIK3R5 PIKFYVE

PILRA PILRB PIM1 PIM2 PIM3

PIN1 PIN4 PINK1 PINX1 PION

PIP PIP4K2A PIP4K2B PIP4K2C PIP5K1 A

PIP5K1 B PIP5K1 C PIP5KL1 PI POX PIR

PISD PITPNA PITPNB PITPNC1 PITPNM1

PITPNM2 PITPNM3 PITRM1 PITX1 PITX2

PITX3 PIWIL1 PIWIL2 PIWIL3 PIWIL4

PJA1 PJA2 PKD1 PKD1 L1 PKD1 L2

PKD1 L2 ENSTO

0000360678 PKD1 L3 PKD2 PKD2L1 PKD2L2

PKDREJ PKHD1 PKHD1 L1 PKIA PKIB

PKIG PKLR PKM2 PKMYT1 PKN1

PKN2 PKN3 PKNOX1 PKNOX2 PKP1

PKP2 PKP3 PKP4 PLA1 A PLA2G10

PLA2G12A PLA2G12B PLA2G15 PLA2G16 PLA2G1 B

PLA2G2A PLA2G2C PLA2G2D PLA2G2E PLA2G2F

PLA2G3 PLA2G4A PLA2G4C PLA2G4D PLA2G4F

PLA2G5 PLA2G6 PLA2G7 PLA2R1 PLAA

PLAC1 PLAC1 L PLAC8 PLAC8L1 PLAC9

PLAG1 PLAGL1 PLAGL2 PLAT PLAU

PLAUR PLB1 PLBD1 PLBD2 PLCB1

PLCB2 PLCB3 PLCB4 PLCD1 PLCD3

PLCD4 PLCE1 PLCG1 PLCG2 PLCH1

PLCH2 PLCL1 PLCL2 PLCXD1 PLCXD2

PLCXD3 PLCZ1 PLD1 PLD2 PLD3

PLD4 PLD5 PLD6 PLDN PLEC

PLEK PLEK2 PLEKHA1 PLEKHA3 PLEKHA4

PLEKHA5 ENST

PLEKHA5 00000429027 PLEKHA6 PLEKHA7 PLEKHA8

PLEKHA9 PLEKHB1 PLEKHB2 PLEKHF1 PLEKHF2

PLEKHG1 PLEKHG2 PLEKHG3 PLEKHG4 PLEKHG4B

PLEKHG4B ENS

T00000283426 PLEKHG5 PLEKHG6 PLEKHG7 PLEKHH1

PLEKHH2 PLEKHH3 PLEKHJ1 PLEKHM1 PLEKHN1

PLEKH01 PLEKH02 PLG PLGLB1 PLGLB2

PLIN1 PLIN2 PLIN3 PLIN4 PLIN5

PLK1 PLK2 PLK3 PLK4 PLLP

PLN PLOD1 PLOD2 PLOD3 PLP1

PLP2 PLRG1 PLS1 PLS3 PLSCR1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PLSCR3 ENS

PLSCR2 PLSCR3 T00000324822 PLSCR4 PLTP

PLUNC PLVAP PLXDC1 PLXDC2 PLXNA1

PLXNA2 PLXNA3 PLXNA4 PLXNB1 PLXNB2

PLXNB3 PLXNC1 PLXND1 PM20D1 PM20D2

PMAIP1 PMCH PMEPA1 PMF1 PMFBP1

PML PMM1 PMM2 PMP2 PMP22

PMPCA PMPCB PMS1 PMS2 PMS2L1

PMS2L1 1 PMS2L3 PMS2L4 PMS2L5 PMVK

PNCK PNKD PNKP PNLDC1 PNLIP

PNLIPRP1 PNLIPRP2 PNLIPRP3 PNMA1 PNMA2

PNMA3 PNMA5 PNMA6A PNMAL1 PNMAL2

PNMT PNN PN01 PNOC PNP

PNPLA1 PNPLA2 PNPLA3 PNPLA4 PNPLA5

PNPLA6 PNPLA7 PNPLA8 PNPO PNPT1

PNRC1 PNRC2 PODN PODNL1 PODXL

P0DXL2 POF1 B POFUT1 POFUT2 POGK

POGZ POL3S POLA1 POLA2 POLB

POLD1 POLD2 POLD3 POLD4 POLDIP3

POLE POLE2 POLE3 POLE4 POLG

POLG2 POLH POLI POLK POLL

POLM POLN POLO POLR1 A POLR1 B

POLR1 C POLR1 D POLR1 E POLR2A POLR2B

POLR2C POLR2D POLR2E POLR2F POLR2G

POLR2H POLR2I POLR2J POLR2J2 POLR2K

POLR2L POLR3A POLR3B POLR3C POLR3D

POLR3E POLR3F POLR3G POLR3GL POLR3H

POLR3K POLRMT POM121 POM121 L3 POMC

POMGNT1 POMP POMT1 POMT2 POMZP3

PON1 PON2 PON3 POP1 POP4

POP5 POP7 POPDC2 POPDC3 POR

POT14 HUMA POTE2 HUM

PORCN POSTN POT1 N AN

POTEA POTEB POTED POTEF POTEG

POU1 F1 POU2AF1 POU2F1 POU2F2 POU2F3

POU3F1 POU3F2 POU3F3 POU3F4 POU4F1

POU4F2 POU4F3 POU5F1 POU6F1 POU6F2

PPA1 PPA2 PPAN PPAN-P2RY1 1 PPAP2A

PPAP2B PPAP2C PPAPDC1 A PPAPDC2 PPAPDC3

PPARA PPARD PPARG PPARGC1 A PPARGC1 B

PPAT PPBP PPCDC PPCS PPDPF

PPEF1 PPEF2 PPFIA1 PPFIA2 PPFIA3

PPFIA4 PPFIBP1 PPFIBP2 PPHLN1 PPIA

PPIAL4A PPIAL4G PPIA HUMAN PPIB PPIC

PPID PPIE PPIF PPIG PPIH

PPIL1 PPIL2 PPIL3 PPIL4 PPIL5

PPIL6 PPIP5K1 PPIP5K2 PPL PPM1 A

PPM1 B PPM1 D PPM1 E PPM1 F PPM1 G

PPM1 H PPM1 J PPM1 K PPM1 L PPOX

PPP1 CA PPP1 CB PPP1 CC PPP1 R10 PPP1 R1 1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PPP1R12A PPP1R12B PPP1R12C PPP1R13B PPP1R13L

PPP1R14A PPP1R14B PPP1R14C PPP1R14D PPP1R15A

PPP1R15B PPP1R16A PPP1R16B PPP1R1A PPP1R1B

PPP1R1C PPP1R2 PPP1R2P9 PPP1R3A PPP1R3B

PPP1R3C PPP1R3D PPP1R3E PPP1R3F PPP1R3G

PPP1R7 PPP1R8 PPP1R9A PPP1R9B PPP2CA

PPP2CB PPP2R1A PPP2R1B PPP2R2A PPP2R2B

PPP2R2C PPP2R2D PPP2R3A PPP2R3B PPP2R3C

PPP2R4 PPP2R5A PPP2R5B PPP2R5C PPP2R5D

PPP2R5E PPP3CA PPP3CB PPP3CC PPP3R1

PPP3R2 PPP4C PPP4R1 PPP4R1L PPP4R2

PPP4R4 PPP5C PPP6C PPPDE1 PPPDE2

PPRC1 PPT1 PPT2 PPTC7 PPWD1

PPY PPYR1 PQBP1 PQLC1 PQLC2

PQLC3 PRAF2 PRAME PRAMEF1 PRAMEF10

PRAMEF12 PRAMEF13 PRAMEF14 PRAMEF16 PRAMEF17

PRAMEF18 PRAMEF19 PRAMEF2 PRAMEF20 PRAMEF21

PRAMEF22 PRAMEF3 PRAMEF4 PRAMEF5 PRAMEF6

PRAMEF7 PRAMEF8 PRAMEF9 PRAMEL PRAP1

PRB1 PRB2 PRB4 PRC1 PRCC

PRCC ENSTOOO

00353233 PRCD PRCP PRDM1 PRDM10

PRDM11 PRDM12 PRDM13 PRDM14 PRDM15

PRDM16 PRDM2 PRDM4 PRDM5 PRDM7

PRDM8 PRDM9 PRDX1 PRDX2 PRDX3

PRDX4 PRDX5 PRDX6 PREB PRELID1

PRELID2 PRELP PREP PREPL PREX1

PREX2 PRF1 PRG-3 PRG2 PRG3

PRG4 PRH2 PRIC285 PRICKLE1 PRICKLE2

PRICKLE3 PRICKLE4 PRIM2 PRIMA1 PRKAA1

PRKAA2 ENSTO

PRKAA2 0000371244 PRKAB1 PRKAB2 PRKACA

PRKACB ENSTO

PRKACB 0000370685 PRKACG PRKAG1 PRKAG2

PRKAG3 PRKAR1A PRKAR1B PRKAR2A PRKAR2B

PRKCA PRKCB PRKCD PRKCDBP PRKCE

PRKCG PRKCH PRKCI PRKCQ PRKCSH

PRKD1 ENST

PRKCZ PRKD1 00000331968 PRKD2 PRKD3

PRKDC PRKG1 PRKG2 PRKRA PRKRIP1

PRKRIR PRKX PRKY PRL PRLH

PRLHR PRLR PRM1 PRM2 PRMT1

PRMT10 PRMT2 PRMT3 PRMT5 PRMT6

PRMT7 PRMT8 PRND PRNP PRO1073

PROC PROCA1 PROCR PRODH PRODH2

PROK1 PROK2 PROKR1 PROKR2 PROL1

PROM1 PROM2 PROP1 PROS1 PROSC

PROX1 PROX2 PROZ PRPF18 PRPF19

PRPF3 PRPF31 PRPF38A PRPF38B PRPF39 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PRPF4B EN ST00000337

PRPF4 PRPF40A PRPF40B PRPF4B 659

PRPF6 PRPF8 PRPH PRPH2 PRPS1

PRPS2 PRPSAP1 PRPSAP2 PRR1 1 PRR12

PRR13 PRR14 PRR1 5 PRR15L PRR1 6

PRR1 8 PRR1 9 PRR20A PRR21 PRR22

PRR23B PRR23C PRR25 PRR3 PRR4

PRR5 ENSTOO

PRR5 PRR5-ARHGAP8 PRR5L 000432186 PRR7

PRR8 PRRC1 PRRG1 PRRG2 PRRG3

PRRG4 PRRT1 PRRT2 PRRT3 PRRX1

PRRX2 PRSS1 PRSS12 PRSS1 6 PRSS2

PRSS21 PRSS22 PRSS23 PRSS27 PRSS3

PRSS33 PRSS35 PRSS36 PRSS37 PRSS38

PRSS42 PRSS50 PRSS7 PRSSL1 PRTFDC1

PRUNE2 EN ST00000376

PRTG PRTN3 PRUNE PRUNE2 718

PRX PRY PRY2 PSAP PSAPL1

PSAT1 PSD PSD2 PSD3 PSD4

PSD ENSTOOOO

0020673 PSEN1 PSEN2 PSENEN PSG1

PSG1 ENST000

00312439 PSG2 PSG3 PSG4 PSG5

PSIP1 ENST

PSG6 PSG8 PSG9 PSIP1 00000380733

PSKH1 PSKH2 PSMA1 PSMA2 PSMA3

PSMA4 PSMA5 PSMA6 PSMA7 PSMA8

PSMB1 PSMB10 PSMB2 PSMB3 PSMB4

PSMB5 PSMB6 PSMB7 PSMB8 PSMB9

PSMC1 PSMC2 PSMC3 PSMC3IP PSMC4

PSMC5 PSMC6 PSMD1 PSMD10 PSMD1 1

PSMD13 ENS

PSMD12 PSMD13 T00000431206 PSMD2 PSMD3

PSMD4 PSMD5 PSMD6 PSMD7 PSMD8

PSMD9 PSME1 PSME2 PSME3 PSME4

PSMF1 PSMG1 PSMG2 PSMG3 PSORS1 C1

PSORS1 C2 PSPC1 PSPH PSPN PSRC1

PSTK PSTPIP2 PTAFR PTAR1 PTBP1

PTBP2 PTCD1 PTCD2 PTCD3 PTCH1

PTCH1 ENSTOO

000331920 PTCH2 PTCHD1 PTCHD2 PTCHD3

PTCRA PTDSS1 PTDSS2 PTEN PTER

PTF1 A PTGDR PTGDS PTGER1 PTGER2

PTGER3 PTGER4 PTGES PTGES2 PTGES3

PTGFR ENST

PTGFR PTGFRN 00000370758 PTGIR PTGIS

PTGR1 PTGS1 PTGS2 PTH PTH1 R

PTH2 PTH2R PTHLH PTK2 PTK2B HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

PTK2B ENSTOO

000397497 PTK6 PTK7 PTMA PTMS

PTN PTOV1 PTP4A1 PTP4A2 PTP4A3

PTPDC1 PTPLA PTPLAD1 PTPLAD2 PTPLB

PTPMT1 PTPN1 PTPN1 1 PTPN12 PTPN13

PTPN14 PTPN18 PTPN2 PTPN20A PTPN20B

PTPN21 PTPN22 PTPN23 PTPN3 PTPN4

PTPN5 PTPN6 PTPN7 PTPN9 PTPRA

PTPRB ENSTOO

PTPRB 000334414 PTPRC PTPRCAP PTPRD

PTPRE PTPRF PTPRG PTPRH PTPRJ

PTPRK PTPRM PTPRN PTPRN2 PTPRO

PTPRR PTPRS PTPRT PTPRU PTPRZ1

PTRF PTRH1 PTRH2 PTS PTTG1

PTTG1 IP PTX3 PUM1 PUM2 PURA

PURG ENSTO

PURB PURG 0000475541 PUS1 PUS10

PUS3 PUS7 PUS7L PUSL1 PVALB

PVR PVRIG PVRL1 PVRL2 PVRL3

PVRL4 PWP1 PWP2 PWWP2A PWWP2B

PXDN PXDNL PXK PXMP2 PXMP4

PXN PXT1 PYCARD PYCR1 PYCR2

PYCRL PYDC1 PYGB PYGL PYGM

PYG01 PYG02 PYHIN1 PYROXD1 PYROXD2

QOVFXO HU

PYY PYY3 PZP ProSAPiPI MAN

Q15202 HUM Q16370 HUM Q1 A5X8 HU

Q13034 HUMAN Q13209 HUMAN AN AN MAN

Q2M2F3 HUMA Q2QD04 HUMA Q2VIK4 HUMA Q2VIK8 HUMA Q2VIL1 HU N N N N MAN

Q3SX88 HUMA Q3ZCN4 HUMA Q49A61 HUM Q49AQ9 HUM Q4G0P5 HU N N AN AN MAN

Q4G0S1 HUMA Q4G129 HUMA Q4G197 HUM Q4TT42 HUM Q4VXG5 HU N N AN AN MAN

Q4VXZ3 HUMA Q5JSM7 HUM Q5JUV9 HUM Q5JV89 HU N Q5I0X0 HUMAN AN AN MAN

Q5JXA8 HUMA Q5JY96 HUM Q5JYU7 HUM Q5SWJ0 HU

Q5JX50 HUMAN N AN AN MAN

Q5T6S7 HUM Q5T740 HUM Q5T7C0 HU

Q5T344 HUMAN Q5T669 HUMAN AN AN MAN

Q5TBE2 HUMA Q5TFB2 HUM Q5VVH2 HUM Q5VZ27 HU

Q5T909 HUMAN N AN AN MAN

Q5W1 B9 HUMA Q69YG7 HUM Q69YJ1 HUM Q6AI01 HU

Q5VZ43 HUMAN N AN AN MAN

Q6GMT2 HUMA Q6I955 HUMA Q6IPT3 HUMA Q6NSH2 HU

Q6AI40 HUMAN N N N MAN

Q6NUR6 HUMA Q6NZ63 HUMA Q6P094 HUM Q6P462 HUM Q6PEB8 HU N N AN AN MAN

Q6RGF6 HUMA Q6TXQ4 HUMA Q6UXU0 HUM Q6VEP2 HUM Q6YL47 HU N N AN AN MAN HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

Q6ZMS4 HUMA Q6ZNB5 HUMA Q6ZNL0 HUM Q6ZNV0 HUM Q6ZQP8 HU N N AN AN MAN

Q6ZQU9 HUMA Q6ZRG5 HUMA Q6ZRP8 HUM Q6ZRU5 HUM Q6ZSP4 HU N N AN AN MAN

Q6ZSU1 HUMA Q6ZSY1 HUMA Q6ZTY5 HUM Q6ZU04 HUM Q6ZU24 HU N N AN AN MAN

Q6ZUD9 HUMA Q6ZUG5 HUMA Q6ZUQ5 HUM Q6ZUR4 HUM Q6ZUS2 HU N N AN AN MAN

Q6ZV65 HUMA Q6ZV72 HUM Q6ZVE3 HUM Q6ZVS6 HU

Q6ZV46 HUMAN N AN AN MAN

Q6ZW54 HUMA Q6ZWB7 HUMA Q6ZWC0 HUM Q71 RG6 HUM Q75L30 HU N N AN AN MAN

Q75MH1 HUMA Q75MM1 HUMA Q76B61 HUM Q7M4M3 HUM Q7Z2M6 HU N N AN AN MAN

Q7Z2Q7 HUMA Q7Z2S2 HUMA Q7Z3M5 HUM Q7Z4Q0 HUM Q7Z4S1 HU N N AN AN MAN

Q7Z7K7 HUMA Q86TT0 HUM Q86TU9 HUM Q86U10 HU

Q7Z5Z2 HUMAN N AN AN MAN

Q86U89 HUMA Q86V52 HUM Q86V94 HUM Q86VG7 HU

Q86U47 HUMAN N AN AN MAN

Q86XG0 HUMA Q86YR2 HUM Q86YX8 HU

Q86X61 HUMAN N Q86Y87 AN MAN

Q8IVN4 HUM Q8IVR1 HUM Q8IXE5 HU

Q8IVE0 HUMAN Q8IVF9 HUMAN AN AN MAN

Q8MH63 HUM Q8N0U1 HUM Q8N0W1 HU

Q8IXE7 HUMAN Q8IXV1 HUMAN AN AN MAN

Q8N1 B8 HUMA Q8N1 G8 HUM Q8N1 I6 HUMA Q8N1 L4 HU

Q8N164 HUMAN N AN N MAN

Q8N1 R6 HUMA Q8N1 T0 HUMA Q8N1 X6 HUM Q8N214 HUM Q8N266 HU N N AN AN MAN

Q8N2D2 HUMA Q8N2E2 HUMA Q8N2W8 HUM Q8N3U1 HUM Q8N4W5 HU N N AN AN MAN

Q8N5Q1 HUMA Q8N642 HUMA Q8N646 HUM Q8N6L5 HUM Q8N6V7 HU N N AN AN MAN

Q8N6X1 HUMA Q8N6X9 HUMA Q8N799 HUM Q8N7D3 HUM Q8N7N0 HU N N AN AN MAN

Q8N7N2 HUMA Q8N7P5 HUMA Q8N7Q6 HUM Q8N7Z9 HUM Q8N800 HU N N AN AN MAN

Q8N822 HUMA Q8N843 HUM Q8N849 HUM Q8N867 HU

Q8N81 1 HUMAN N AN AN MAN

Q8N8C5 HUMA Q8N8C9 HUMA Q8N8F0 HUM Q8N8H9 HUM Q8N8K0 HU N N AN AN MAN

Q8N8P5 HUMA Q8N8S3 HUMA Q8N8S4 HUM Q8N950 HUM Q8N997 HU N N AN AN MAN

Q8N9F6 HUMA Q8N9G5 HUMA Q8N9G9 HUM Q8N9H1 HUM Q8N9I1 HU N N AN AN MAN

Q8N9K3 HUMA Q8N9Z1 HUM Q8N9Z5 HUM Q8NA17 HU

Q8N9J4 HUMAN N AN AN MAN

Q8NA34 HUMA Q8NAG9 HUMA Q8NAP4 HUM Q8NAP5 HUM Q8NAQ8 HU N N AN AN MAN HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

Q8NAT4 HUMA Q8NAV9 HUMA Q8NAZ9 HUM Q8NB20 HUM Q8NB83 HU N N AN AN MAN

Q8NBE0 HUMA Q8NCA1 HUMA Q8NCK2 HUM Q8NEQ2 HUM Q8NFX8 HU N N AN AN MAN

Q8NGC8 HUMA Q8NGD7 HUMA Q8NGE6 HUM Q8NGF2 HUM Q8NGG1 H N N AN AN UMAN

Q8NGK8 HUMA Q8NGM0 HUMA Q8NGM4 HU Q8NGM6 HU Q8NGP1 HU N N MAN MAN MAN

Q8NGP5 HUMA Q8NGP7 HUMA Q8NGQ7 HUM Q8NGY4 HUM Q8NH06 HU N N AN AN MAN

Q8NH08 HUMA Q8NH1 1 HUMA Q8NH32 HUM Q8NH33 HUM Q8NH46 HU N N AN AN MAN

Q8NH47 HUMA Q8NH58 HUMA Q8NH68 HUM Q8NH71 HUM Q8NH75 HU N N AN AN MAN

Q8NH77 HUMA Q8NH80 HUMA Q8NH82 HUM Q8NH88 HUM Q8NH95 HU N N AN AN MAN

Q8NH98 HUMA Q8NHA6 HUMA Q8NHB0 HUM Q8NHB3 HUM Q8NHB5 HU N N AN AN MAN

Q8NHC0 HUMA Q8NHC1 HUMA Q8NHC2 HUM Q8TAF5 HUM Q8TBR1 HU N N AN AN MAN

Q8TDK1 HUMA Q8TDP9 HUM Q8TE05 HUM Q8WM95 H

Q8TCI8 HUMAN N AN AN UMAN

Q8WTY6 HUMA Q8WYW5 HUM Q8WYX1 HUM Q8WZ27 HUM

N AN AN AN Q8WZ91

Q96AM0 HUMA Q96CK5 HUMA Q96DR3 HUM Q96HF5 HUM Q96HZ0 HU N N AN AN MAN

Q96M56 HUM Q96M66 HUM Q96M92 HU

Q96IP2 HUMAN Q96K91 HUMAN AN AN MAN

Q96MC4 HUMA Q96MT0 HUMA Q96MZ3 HUM Q96NE0 HUM Q96NP5 HU N N AN AN MAN

Q96PS2 HUMA Q96PS6 HUMA Q96QE0 HUM Q96RF1 HUM Q96RI3 HU N N AN AN MAN

Q96RW6 HUMA Q96RY6 HUMA Q96RY9 HUM Q9BRP9 HU N N AN Q99543-2 MAN

Q9BSD4 HUMA Q9BSM8 HUMA Q9BSY8 HUM Q9BVW6 HUM Q9BVX4 HU N N AN AN MAN

Q9BZU6 HUMA Q9C0K3 HUMA Q9GZQ9 HUM Q9H2C7 HUM Q9H354 HU N N AN AN MAN

Q9H521 HUMA Q9H5Q3 HUM Q9H614 HUM Q9H693 HU

Q9H4I0 HUMAN N AN AN MAN

Q9H6A9 HUMA Q9H6K5 HUMA Q9H6S2 HUM Q9H6Z8 HUM Q9H8C5 HU N N AN AN MAN

Q9H8D1 HUMA Q9H960 HUMA Q9HAB5 HUM Q9HAC4 HUM Q9HAD2 HU N N AN AN MAN

Q9HAJ0 HUMA Q9HAZ8 HUMA Q9HBS9 HUM Q9NQ39 HUM Q9NRE4 HU N N AN AN MAN

Q9NRE7 HUMA Q9NSQ0 HUM Q9NT31 HUM Q9NU36 HU N Q9NSI3 HUMAN AN AN MAN

Q9NW32 HUMA Q9NWP0 HUMA Q9NYD3 HUM Q9NYS9 HUM

N N AN AN Q9NZ01 -2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

Q9P0C7 HUMA Q9P147 HUM Q9P156 HUM Q9P184 HU N Q9P143 HUMAN AN AN MAN

Q9P1 D0 HUMA Q9P1 G6 HUMA Q9P1 L5 HUM Q9P1 M5 HUM Q9P2A3 HU N N AN AN MAN

Q9UHU1 HUMA Q9UHU9 HUMA Q9UI72 HUMA Q9UJN8 HUM Q9UK71 HU N N N AN MAN

Q9Y6V0-3 QARS QDPR QKI QPCT

QPCTL QPRT QRFP QRFPR QRICH1

QRICH2 QRSL1 QSER1 QS0X1 QS0X2

QTRT1 QTRTD1 R3HCC1 R3HDM1 R3HDM2

R3HDML RAB10 RAB1 1 A RAB1 1 B RAB1 1 FIP1

RAB1 1 FIP2 RAB1 1 FIP3 RAB1 1 FIP4 RAB1 1 FIP5 RAB12

RAB13 RAB14 RAB15 RAB17 RAB18

RAB19 RAB19B RAB1 A RAB1 B RAB20

RAB21 RAB22A RAB23 RAB24 RAB25

RAB26 RAB27A RAB27B RAB28 RAB2A

RAB2B RAB30 RAB31 RAB32 RAB33A

RAB33B RAB34 RAB35 RAB36 RAB37

RAB38 RAB39 RAB39B RAB3A RAB3B

RAB3C RAB3D RAB3GAP1 RAB3GAP2 RAB3IL1

RAB3IP RAB40A RAB40AL RAB40B RAB40C

RAB41 RAB42 RAB43 RAB44 RAB4A

RAB4B RAB5A RAB5B RAB5C RAB6A

RAB6B RAB6C RAB7A RAB7L1 RAB8A

RAB8B RAB9A RAB9B R ABACI RABEP1

RABEP2 RABEPK RABGAP1 RABGAP1 L RABGEF1

RABGGTB RABIF RABL2A RABL2B RABL3

RABL4 RABL5 RAC1 RAC1 P4 RAC2

RAC3 RACGAP1 RAD1 RAD17 RAD1 8

RAD21 RAD23A RAD23B RAD50 RAD51

RAD51 AP1 RAD51 AP2 RAD51 C RAD51 L1 RAD51 L3

RAD52 RAD54B RAD54L RAD54L2 RAD9A

RAD9B RADIL RAE1 RAET1 E RAET1 G

RAET1 L RAF1 RAG1 RAG1 AP1 RAG 2

RAGE RAM RAM 4 RAM 6 RAI2

RALA RALB RALBP1 RALGAPA1 RALGAPB

RALGDS RALGPS1 RALGPS2 RALY RAMP1

RAMP2 RAMP3 RAN RANBP1 RANBP10

RANBP17 RANBP2 RANBP3 RANBP3L RANBP6

RANBP9 RANGAP1 RANGRF RAP1 A RAP1 B

RAP1 GAP ENS

RAP1 GAP T00000374761 RAP1 GDS1 RAP2A RAP2B

RAP2C RAPGEF1 RAPGEF2 RAPGEF3 RAPGEF4

RAPGEF5 ENST

RAPGEF5 00000344041 RAPGEF6 RAPGEFL1 RAPH1

RAPSN RARA RARB RARG RARRES1

RARRES2 RARRES3 RARS RARS2 RASA1

RASA2 RASA3 RASA4 RASAL1 RASAL2

RASD1 RASD2 RASEF RASGEF1 A RASGEF1 B

RASGEF1 C RASGRF1 RASGRF2 RASGRP1 RASGRP2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

RASGRP3 RASGRP4 RASIP1 RASL10A RASL10B

RASL2 HUMA

RASL1 1 A RASL1 1 B RASL12 N RASSF1

RASSF5 EN ST00000304

RASSF2 RASSF3 RASSF4 RASSF5 534

RASSF6 RASSF7 RASSF8 RAVER1 RAVER2

RAX RAX2 RB1 RB1 CC1 RBAK

RBBP4 RBBP5 RBBP6 RBBP7 RBBP8

RBBP9 RBCK1 RBKS RBL1 RBL2

RBM10 RBM12 RBM12B RBM14 RBM15

RBM15B RBM16 RBM17 RBM18 RBM19

RBM22 RBM23 RBM24 RBM25 RBM26

RBM34 ENS

T000004088

RBM27 RBM28 RBM3 RBM34 88

RBM39 RBM4 RBM41 RBM42 RBM43

RBM45 RBM46 RBM47 RBM4B RBM5

RBM6 RBM7 RBM8A RBM9 RBMS1

RBMS2 RBMS3 RBMX RBMX2 RBMXL2

RBMY1 A1 RBMY1 B RBMY1 D RBMY1 E RBMY1 F

RBMY1 J RBP1 RBP2 RBP3 RBP4

RBP5 RBP7 RBPJ RBPJL RBPMS

RBPMS2 RBX1 RC3H1 RC3H2 RCAN1

RCAN2 RCAN3 RCBTB1 RCBTB2 RCC1

RCC2 RCCD1 RCE1 RCHY1 RCL1

RCN1 RCN2 RCN3 RC0R1 RC0R2

RCOR3 RCSD1 RCVRN RD3 RDBP

RDH10 RDH1 1 RDH12 RDH13 RDH14

RDH16 RDH5 RDH8 RDM1 RDX

REC8 RECK RECQL RECQL4 RECQL5

REEP1 REEP2 REEP4 REEP5 REEP6

REEP6 ENSTOO

000395484 REG1 A REG1 B REG3A REG3G

REG4 REL RELA RELB RELL1

RELL2 RELN RELT REM1 REM2

RENBP ENST

REN RENBP 00000393700 REP15 REPIN1

REPS1 REPS2 RER1 RERE RERG

RERGL RESP18 REST RET RETN

RETNLB RETS AT REV1 REV3L REX01

REX02 REX04 RFC1 RFC2 RFC3

RFC4 RFC5 RFESD RFFL RFK

RFNG RFPL1 RFPL2 RFPL3 RFPL4A

RFPL4B RFT1 RFTN1 RFTN2 RFWD2

RFWD3 RFX1 RFX2 RFX3 RFX4

RFX5 RFX6 RFX7 RFXANK RFXAP

RG9MTD1 RG9MTD2 RG9MTD3 RGAG1 RGAG4

RGL3 ENSTOO

RGL1 RGL2 RGL3 000380456 RGL4

RGMA RGN RGPD2 RGPD5 RGPD6 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

RGPD7 RGR RGS1 RGS10 RGS1 1

RGS12 RGS13 RGS14 RGS16 RGS17

RGS18 RGS19 RGS2 RGS20 RGS21

RGS22 RGS3 RGS4 RGS5 RGS6

RGS7 RGS7BP RGS8 RGS9 RGS9BP

RGSL1 RGSL2 RHAG RHBDD1 RHBDD2

RHBDD3 RHBDF1 RHBDF2 RHBDL1 RHBDL2

RHBDL3 RHBG RHCE RHCG RHD

RHEB RHEBL1 RHO RHOA RHOB

RHOBTB1 RHOBTB2 RHOBTB3 RHOC RHOD

RHOF RHOG RHOH RHOJ RHOQ

RHOT1 RHOT2 RHOU RHOV RHOXF1

RHOXF2 RHOXF2B RHPN1 RHPN2 RIBC1

RIBC2 RIC3 RIC8A RIC8B RICTOR

RIF1 RILP RILPL2 RIMBP2 RIMKLA

RIMS2 ENSTO

RIMS1 RIMS2 0000436393 RIMS3 RIMS4

RIN1 RIN2 RIN3 RING1 RINL

RINT1 RIOK1 RIOK2 RIOK3 RIPK1

RIPK2 RIPK3 RIPK4 RIPPLY1 RIPPLY2

RIT1 RIT2 RL17 HUMAN RL41 HUMAN RLBP1

RLBP1 L1 RLF RLIM RLN1 RLN2

RLTPR ENST

RLN3 RLTPR 00000334583 RMI1 RMND1

RMND5A RMND5B RNASE1 RNASE1 0 RNASE1 1

RNASE12 RNASE13 RNASE2 RNASE3 RNASE4

RNASE6 RNASE7 RNASE8 RNASE9 RNASEH1

RNASEH2A RNASEH2B RNASEH2C RNASEK RNASEL

RNASEN RNASET2 RND1 RND2 RND3

RNF10 RNF103 RNF1 1 RNF1 1 1 RNF1 12

RNF1 13A RNF1 13B RNF1 14 RNF1 15 RNF121

RNF122 RNF123 RNF125 RNF126 RNF128

RNF13 RNF130 RNF133 RNF134 RNF135

RNF138 RNF139 RNF14 RNF141 RNF144A

RNF144B RNF145 RNF146 RNF148 RNF149

RNF150 RNF151 RNF152 RNF157 RNF160

RNF165 RNF166 RNF167 RNF168 RNF169

RNF17 RNF170 RNF180 RNF181 RNF182

RNF183 RNF185 RNF186 RNF187 RNF19A

RNF19B RNF2 RNF20 RNF207 RNF208

RNF212 RNF213 RNF214 RNF215 RNF216

RNF217 RNF219 RNF220 RNF222 RNF24

RNF25 RNF26 RNF31 RNF32 RNF34

RNF38 RNF39 RNF4 RNF40 RNF41

RNF43 RNF44 RNF5 RNF6 RNF7

RNF8 RNFT1 RNGTT RNH1 RNLS

RNMT RNMTL1 RNPEP RNPEPL1 RNPS1

ROB01 ENST

ROBLD3 ROB01 00000305299 ROB02 ROB03

ROB04 ROCK1 ROCK2 ROD1 ROGDI HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ROM1 ROM01 ROPN1 ROPN1B ROPN1L

ROR1 ROR2 RORA RORB RORC

RP1-

21018 1 NE

ROS1 RP1 RP1-19N1 1 RP1-21018 1 W

RP11- RP11-

RP1-241P17 4 RP1 -32110.10 274K13 2 RP11-45B20 2 529110 4

RP13-

RP11-551L14.1 RP11-9816 3 218H24 1 RP13-36C9 1 RP1L1

RP4-

RP2 RP3-364I1 1 RP3-402G11 5 RP3-527F8 2 545K15 3

RP4-765F13 3 RP5-113911 4 RP6-149D17 1 RP9 RPA1

RPA2 ENSTOOO

RPA2 00313433 RPA3 RPA4 RPAIN

RPAP1 RPAP2 RPAP3 RPE RPE65

RPF1 RPF2 RPGR RPGRIP1 RPGRIP1L

RPH3A RPH3AL RPIA RPL10 RPL10A

RPL10AP3 RPL10L RPL11 RPL12 RPL13

RPL13A RPL13AP25 RPL14 RPL14P5 RPL15

RPL17P39 RPL18 RPL18A RPL19 RPL21

RPL21P128 RPL21P20 RPL21P44 RPL22 RPL23

RPL23A RPL23AP82 RPL24 RPL26 RPL26L1

RPL27 RPL27A RPL27AP6 RPL28 RPL29

RPL29P12 RPL3 RPL30 RPL31 RPL32

RPL32P3 RPL32P36 RPL34 RPL35 RPL35A

RPL35P1 RPL36 RPL36A RPL36AL RPL36P14

RPL37 RPL37A RPL38 RPL39 RPL39L

RPL3L RPL4 RPL41 RPL5 RPL6

RPL7 RPL7A RPL7L1 RPL8 RPL9

RPL9P7 RPLPO RPLP1 RPLP1P3 RPLP2

RPN1 RPN2 RPP14 RPP21 RPP25

RPP30 RPP38 RPP40 RPRD1A RPRD1B

RPRM RPRML RPS10 RPS11 RPS12

RPS13 RPS14 RPS15 RPS15A RPS15P4

RPS16 RPS17 RPS18 RPS19 RPS19BP1

RPS2 RPS20 RPS20P14 RPS21 RPS23

RPS24 RPS25 RPS26 RPS26P11 RPS26P3

RPS27 RPS27A RPS27AP17 RPS27L RPS28

RPS29 RPS2P55 RPS3 RPS3A RPS3AP6

RPS4X RPS4Y1 RPS4Y2 RPS5 RPS6

RPS6KA1 RPS6KA2 RPS6KA3 RPS6KA4 RPS6KA5

RPS6KA6 RPS6KB1 RPS6KB2 RPS6KC1 RPS6KL1

RPS6P1 RPS7 RPS7P4 RPS8 RPS9

RPSA RPTN RPTOR RPUSD1 RPUSD2

RPUSD3 RPUSD4 RQCD1 RRAD RRAGA

RRAGB RRAGC RRAGD RRAS RRAS2

RRBP1 RREB1 RRH RRM1 RRM2

RRM2B RRN3 RRP1 RRP12 RRP15

RRP1B RRP7A RRP8 RRP9 RRS1

RS1 RSAD1 RSAD2 RSBN1 RSBN1L

RSC1A1 RSF1 RSL1D1 RSL24D1 RSPH1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

RSPH10B RSPH10B2 RSPH3 RSPH4A RSPH6A

RSPH9 RSP01 RSP02 RSP03 RSP04

RSPRY1 RSRC1 RSRC2 RSU1 RTBDN

RTCD1 RTDR1 RTEL1 RTF1 RTKN

RTKN2 RTN1 RTN2 RTN3 RTN4

RTN4IP1 RTN4R RTN4RL2 RTP1 RTP2

RTP3 RTP4 RTTN RUFY1 RUFY2

RUFY3 RUNDC1 RUNDC2A RUNDC2B RUNDC3B

RUNX1 T1 EN

ST0000026581

RUNX1 RUNX1 T1 4 RUNX2 RUNX3

RUSC1 RUSC2 RUVBL1 RUVBL2 RWDD1

RWDD2A RWDD2B RWDD3 RWDD4A RXFP1

RXFP2 RXFP3 RXFP4 RXRA RXRB

RXRG RYK RYR1 RYR2 RYR3

S100A1 S100A10 S100A1 1 S100A12 S100A13

S100A14 S100A16 S100A2 S 100 A3 S100A4

S100A5 S100A6 S100A7 S100A7A S100A7L2

S100A8 S100A9 S100B S100G S100P

S100PBP S100Z S1 PR1 S1 PR2 S1 PR3

S1 PR4 S1 PR5 SAA1 SAA2 SAA3P

SAA4 SAAL1 SAC3D1 SACM1 L SACS

SAE1 SAFB SAFB2 SAGE1 SALL1

SALL2 SALL3 SALL4 SAMD10 SAMD1 1

SAMD12 SAMD13 SAMD14 SAMD3 SAMD4A

SAMD8 ENS

T000003726

SAMD4B SAMD5 SAMD7 SAMD8 90

SAMD9 SAMD9L SAMHD1 SAMM50 SAMSN1

SAP130 SAP18 SAP30 SAP30BP SAP30L

SAPS1 SAPS2 SAPS3 SAR1 A SAR1 B

SARDH SARNP SARS SARS2 SART1

SART3 SASH1 SASH3 SASS6 SAT1

SAT2 SATB1 SATB2 SATL1 SAV1

SBDS SBF1 SBF2 SBK1 SBK2

SBN01 SBSN SC4MOL SC5DL SC65

SCAF1 SCAI SCAMP2 SCAMP3 SCAMP4

SCAND1 SCAND3 SCAP SCAPER SCARA3

SCARA5 SCARB1 SCARB2 SCARF1 SCARF2

SCCPDH SCD SCD5 SCEL SCFD1

SCFD2 SCG2 SCG3 SCGB1 A1 SCGB1 C1

SCGB1 D1 SCGB1 D2 SCGB1 D4 SCGB2A1 SCGB2A2

SCGB3A1 SCGB3A2 SCGBL SCGN SCHIP1

SCLT1 SCLY SCMH1 SCML1 SCML2

SCML4 SCN1 0A SCN1 1 A SCN1 A SCN1 B

SCN2A SCN2B SCN3A SCN3B SCN4A

SCN4B SCN5A SCN7A SCN9A SCNM1

SCNN1 A SCNN1 B SCNN1 D SCNN1 G SC01

SC02 SCOC SCP2 SCPEP1 SCRG1

SCRIB SCRN1 SCRN2 SCRN3 SCRT1

SCRT2 SCTR SCUBE1 SCUBE2 SCUBE3 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene

Name Name Name Name Name

SCXB SCYL1 SCYL2 SCYL3 SDAD1

SDC1 SDC2 SDC3 SDC4 SDCBP

SDCBP2 SDCCAG1 SDCCAG3 SDCCAG3L SDCCAG8

SDF2 SDF2L1 SDF4 SDHA SDHAF1

SDHAF2 SDHB SDHC SDHD SDK1

SDPR SDR1 6C5 SDR42E1 SDR9C7 SDS

SDSL SEC1 1 B SEC1 1 C SEC13 SEC14L1

SEC14L2 SEC14L3 SEC14L4 SEC16B SEC22A

SEC22C SEC23A SEC23B SEC23IP SEC24A

SEC24B SEC24C SEC24D SEC31 A SEC31 B

SEC61 A1 SEC61 A2 SEC61 B SEC61 G SEC62

SEC63 SECISBP2 SECISBP2L SECTM1 SEH1 L

SEL1 L SEL1 L2 SELE SELENBP1 SELI

SELL SELM SELP SELPLG SELV

SEMA3A SEMA3B SEMA3C SEMA3D SEMA3E

SEMA3F SEMA3G SEMA4A SEMA4B SEMA4C

SEMA4D SEMA4F SEMA4G SEMA5A SEMA5B

SEMA6A SEMA6B SEMA6C SEMA6D SEMA7A

SEMG1 SEMG2 SENP1 SENP2 SENP3

SENP5 SENP6 SENP7 SENP8 15-Sep

SEPHS1 SEPHS2 SEPN1 SEPP1 SEPSECS

01 -Sep 10-Sep 1 1 -Sep 12-Sep 02-Sep

03-Sep 04-Sep 05-Sep 06-Sep 08-Sep

09-Sep SEPX1 SERAC1 SERBP1 SERF1 A

SERF1 B SERF2 SERGEF SERHL SERHL2

SERINC1 SERINC2 SERINC3 SERINC4 SERP1

SERP1 ENSTOO

000491660 SERP2 SERPINA1 SERPINA10 SERPINA1 1

SERPINA12 SERPINA13 SERPINA2 SERPINA3 SERPINA4

SERPINA9

ENST000003

SERPINA5 SERPINA6 SERPINA7 SERPINA9 37425

SERPINB1 SERPINB1 0 SERPINB1 1 SERPINB12 SERPINB13

SERPINB2 SERPINB3 SERPINB4 SERPINB5 SERPINB6

SERPINB7 SERPINB8 SERPINB9 SERPINC1 SERPIND1

SERPINE1 SERPINE2 SERPINF1 SERPINF2 SERPING1

SERPINH1 SERPINI1 SERPINI2 SERTAD1 SERTAD2

SERTAD3 SERTAD4 SESN1 SESN2 SESN3

SESTD1 SET SETBP1 SETD1 A SETD1 B

SETD2 ENSTOO

SETD2 000409792 SETD3 SETD4 SETD5

SETD6 SETD7 SETD8 SETDB1 SETDB2

SETMAR SETX SEZ6 SEZ6L SEZ6L2

SF1 SF3A1 SF3A2 SF3A3 SF3B1

SF3B14 SF3B2 SF3B3 SF3B4 SF3B5

SF4 SFI1 SFMBT1 SFMBT2 SFN

SFPQ SFRP1 SFRP2 SFRP4 SFRP5

SFRS1 SFRS1 1 SFRS12 SFRS12IP1 SFRS13B

SFRS14 SFRS15 SFRS16 SFRS17A SFRS18

SFRS2 SFRS2IP SFRS3 SFRS4 SFRS5

SFRS6 SFRS7 SFRS8 SFRS9 SFT2D1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

SFT2D2 SFT2D3 SFTA2 SFTPA1 B SFTPA2

SFTPA2B SFTPB SFTPC SFTPD SFXN1

SG223 HUM

SFXN2 SFXN3 SFXN4 SFXN5 AN

SG269 HUMAN SGCA SGCB SGCE SGCG

SGCZ SGEF SGIP1 SGK1 SGK2

SGK3 SGMS1 SGMS2 SGOL1 SGOL2

SGPL1 SGPP1 SGPP2 SGSH SGSM1

SGSM2 SGSM3 SGTA SGTB SH2B1

SH2B3 SH2D1 A SH2D1 B SH2D2A SH2D3A

SH2D3C SH2D4A SH2D4B SH2D5 SH2D6

SH3BGR SH3BGRL SH3BGRL2 SH3BGRL3 SH3BP1

SH3BP2 SH3BP4 SH3BP5 SH3BP5L SH3D19

SH3D20 SH3GL1 SH3GL2 SH3GL3 SH3GLB1

SH3GLB2 SH3KBP1 SH3PXD2A SH3PXD2B SH3RF1

SH3RF2 SH3TC1 SH3TC2 SH3YL1 SHANK1

SHANK2 SHANK3 SHARPIN SHB SHBG

SHC1 ENSTOOO

SHC1 004481 1 6 SHC2 SHC3 SHC4

SHCBP1 SHD SHE SHF SHFM1

SHH SHISA2 SHIS A3 SHISA4 SHISA5

SHKBP1 SHMT1 SHMT2 SHOC2 SHOX

SHOX2 SHPK SHPRH SHQ1 SHROOM1

SHROOM2 SHROOM3 SHROOM4 SI SIAE

SIAH1 SIAH1 L SIAH2 SIAH3 SIDT1

SIDT2 SIGIRR SIGLEC1 SIGLEC10 SIGLEC1 1

SIGLEC12 ENS

SIGLEC12 T00000439889 SIGLEC14 SIGLEC15 SIGLEC5

SIGLEC6 SIGLEC7 SIGLEC8 SIGLEC9 SIGMAR1

SIK1 SIK2 SIK3 SIKE1 SIL1

SILV SIM1 SIM2 SIN3A SIN3B

SIP1 SIPA1 SIPA1 L1 SIPA1 L2 SIPA1 L3

SIRPA SIRPB1 SIRPB2 SIRPD SIRPG

SIRT1 SIRT2 SIRT3 SIRT4 SIRT5

SIRT6 SIRT7 SIT1 SIVA1 SIX1

SIX2 SIX3 SIX4 SIX5 SIX6

SK681 SKA1 SKA3 SKAP1 SKAP2

SKI SKIL SKIP SKIV2L SKIV2L2

SKP1 SKP2 SLA SLA2 SLAIN1

SLAMF1 SLAMF6 SLAMF7 SLAMF8 SLAMF9

SLBP SLC1 0A1 SLC1 0A2 SLC10A3 SLC1 0A4

SLC1 0A5 SLC1 0A6 SLC1 0A7 SLC1 1 A1 SLC1 1 A2

SLC12A1 SLC12A2 SLC12A3 SLC12A4 SLC12A5

SLC12A6 SLC12A7 SLC12A8 SLC12A9 SLC13A1

SLC13A2 SLC13A3 SLC13A4 SLC13A5 SLC14A1

SLC14A2 SLC1 5A1 SLC1 5A2 SLC15A3 SLC1 5A4

SLC1 6A1 SLC1 6A10 SLC1 6A1 1 SLC16A12 SLC1 6A13

SLC1 6A14 SLC1 6A2 SLC1 6 A3 SLC16A4 SLC1 6A5

SLC1 6A6 SLC1 6A7 SLC1 6A8 SLC16A9 SLC1 7A1

SLC1 7A2 SLC1 7A3 SLC1 7A4 SLC17A5 SLC1 7A6 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

SLC1 7A7 SLC1 7A8 SLC1 7A9 SLC18A1 SLC1 8A2

SLC1 8 A3 SLC1 9A1 SLC1 9A2 SLC19A3 SLC1 A1

SLC1 A2 SLC1 A3 SLC1 A4 SLC1 A5 SLC1 A6

SLC1 A7 SLC20A1 SLC20A2 SLC22A1 SLC22A10

SLC22A1 1 SLC22A12 SLC22A13 SLC22A14 SLC22A15

SLC22A16 SLC22A17 SLC22A18 SLC22A2 SLC22A20

SLC22A23 SLC22A25 SLC22A3 SLC22A4 SLC22A5

SLC22A6 SLC22A7 SLC22A8 SLC22A9 SLC23A1

SLC23A2 SLC23A3 SLC24A2 SLC24A3 SLC24A4

SLC24A5 SLC24A6 SLC25A1 SLC25A10 SLC25A1 1

SLC25A12 SLC25A13 SLC25A14 SLC25A15 SLC25A16

SLC25A17 SLC25A18 SLC25A19 SLC25A2 SLC25A20

SLC25A21 SLC25A22 SLC25A23 SLC25A24 SLC25A25

SLC25A27 SLC25A28 SLC25A29 SLC25A3 SLC25A30

SLC25A31 SLC25A32 SLC25A33 SLC25A34 SLC25A35

SLC25A36 SLC25A37 SLC25A38 SLC25A39 SLC25A4

SLC25A40 SLC25A42 SLC25A43 SLC25A44 SLC25A45

SLC25A46 SLC25A5 SLC25A6 SLC26A1 SLC26A10

SLC26A1 1 SLC26A2 SLC26A3 SLC26A4 SLC26A5

SLC26A6 SLC26A7 SLC26A8 SLC26A9 SLC27A1

SLC27A2 SLC27A3 SLC27A4 SLC27A5 SLC27A6

SLC28A1 SLC28A2 SLC28A3 SLC29A1 SLC29A2

SLC29A3 SLC29A4 SLC2A1 SLC2A10 SLC2A1 1

SLC2A12 SLC2A13 SLC2A14 SLC2A2 SLC2A3

SLC2A4 SLC2A4RG SLC2A5 SLC2A6 SLC2A7

SLC2A8 SLC2A9 SLC30A1 SLC30A10 SLC30A2

SLC30A3 SLC30A4 SLC30A5 SLC30A6 SLC30A7

SLC30A8 SLC30A9 SLC31 A1 SLC31 A2 SLC32A1

SLC33A1 SLC34A1 SLC34A2 SLC34A3 SLC35A1

SLC35A2 SLC35A3 SLC35A4 SLC35A5 SLC35B1

SLC35B2 SLC35B3 SLC35B4 SLC35C1 SLC35C2

SLC35D1 SLC35D2 SLC35D3 SLC35E1 SLC35E2

SLC35E3 SLC35E4 SLC35F1 SLC35F2 SLC35F3

SLC35F5 SLC36A1 SLC36A2 SLC36A3 SLC36A4

SLC37A1 SLC37A2 SLC37A3 SLC37A4 SLC38A1

SLC38A10 SLC38A1 1 SLC38A2 SLC38A3 SLC38A4

SLC38A5 SLC38A6 SLC38A7 SLC38A8 SLC38A9

SLC39A1 SLC39A10 SLC39A1 1 SLC39A12 SLC39A13

SLC39A14 SLC39A2 SLC39A3 SLC39A4 SLC39A5

SLC39A6 SLC39A7 SLC39A8 SLC39A9 SLC3A1

SLC3A2 SLC40A1 SLC41 A1 SLC41 A2 SLC41 A3

SLC43A1 SLC43A2 SLC43A3 SLC44A1 SLC44A2

SLC44A3 SLC44A4 SLC44A5 SLC45A1 SLC45A2

SLC45A3 SLC45A4 SLC46A2 SLC46A3 SLC47A1

SLC47A2 SLC48A1 SLC4A1 SLC4A10 SLC4A1 1

SLC4A1 AP SLC4A2 SLC4A3 SLC4A4 SLC4A5

SLC4A9 ENST

SLC4A7 SLC4A8 SLC4A9 00000506757 SLC5A1

SLC5A1 0 SLC5A1 1 SLC5A12 SLC5A2 SLC5A3

SLC5A4 SLC5A5 SLC5A6 SLC5A7 SLC5A8 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

SLC5A9 SLC6A1 SLC6A1 1 SLC6A12 SLC6A13

SLC6A14 SLC6A1 5 SLC6A1 6 SLC6A17 SLC6A1 8

SLC6A1 9 SLC6A2 SLC6A20 SLC6A3 SLC6A4

SLC6A5 SLC6A6 SLC6A7 SLC6A8 SLC6A9

SLC7A1 SLC7A1 0 SLC7A1 1 SLC7A13 SLC7A14

SLC7A2 SLC7A3 SLC7A4 SLC7A5 SLC7A6

SLC7A60S SLC7A7 SLC7A8 SLC7A9 SLC8A1

SLC8A2 SLC8A3 SLC9A1 SLC9A10 SLC9A1 1

SLC9A2 SLC9A3 SLC9A3R1 SLC9A3R2 SLC9A4

SLC9A5 SLC9A6 SLC9A7 SLC9A8 SLC9A9

SLC01 A2 SLC01 B1 SLC01 B3 SLC01 C1 SLC02A1

SLC02B1 SLC03A1 SLC04A1 SLC04C1 SLC05A1

SLC06A1 SLFN1 1 SLFN12 SLFN13 SLFN14

SLFN5 SLFNL1 SLIT1 SLIT2 SLIT3

SLITRK1 SLITRK2 SLITRK3 SLITRK4 SLITRK5

SLITRK6 SLK SLMAP SLM01 SLM02

SLN SLPI SLTM SLU7 SLURP1

SMAD1 SMAD2 SMAD3 SMAD4 SMAD5

SMAD50S SMAD6 SMAD7 SMAD9 SMAP1

SMAP2 SMARCA1 SMARCA2 SMARCA4 SMARCA5

SMARCAD1 SMARCAL1 SMARCB1 SMARCC1 SMARCC2

SMARCD1 SMARCD2 SMARCD3 SMARCE1 SMC1 A

SMC1 B SMC2 SMC2L1 SMC3 SMC4

SMC5 SMC6 SMCHD1 SMCP SMCR7

SMEK1 ENST

SMCR7L SMCR8 SMEK1 00000417249 SMEK2

SMG1 SMG5 SMG6 SMG7 SMN1

SMN2 SMNDC1 SMO SMOC1 SMOC2

SMOX SMPD1 SMPD2 SMPD3 SMPD4

SMPDL3A SMPDL3B SMPX SMR3A SMR3B

SMS SMTN SMTNL2 SMU1 SMUG1

SMURF1 SMURF2 SMYD1 SMYD2 SMYD3

SMYD4 SMYD5 SNAI1 SNAI2 SNAI3

SNAP23 SNAP25 SNAP29 SNAP47 SNAPC1

SNAPC2 SNAPC3 SNAPC4 SNAPC5 SNAPIN

SNCA SNCAIP SNCB SNCG SND1

SNED1 SNF8 SNIP1 SNN SNPH

SNRK SNRNP200 SNRNP25 SNRNP27 SNRNP35

SNRNP48 SNRNP70 SNRPA SNRPA1 SNRPB

SNRPB2 SNRPC SNRPD1 SNRPD2 SNRPD3

SNRPE SNRPEL1 SNRPF SNRPG SNRPN

SNTA1 SNTB1 SNTB2 SNTG1 SNTG2

SNTN SNUPN SNURF SNW1 SNX1

SNX10 SNX1 1 SNX12 SNX13 SNX14

SNX15 SNX16 SNX17 SNX18 SNX19

SNX2 SNX20 SNX21 SNX22 SNX24

SNX25 SNX27 SNX3 SNX30 SNX31

SNX32 SNX33 SNX4 SNX5 SNX6

SNX7 SNX8 SNX9 SOAT1 SOAT2

SOBP SOCS1 SOCS2 SOCS3 SOCS4 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

SOCS5 SOCS6 SOCS7 SOD1 SOD2

SOD3 SOHLH1 SOHLH2 SOLH SON

SORBS1 SORBS2 SORBS3 SORCS1 SORCS2

SORCS3 SORD SORL1 SORT1 SOS1

SOS2 SOST SOSTDC1 SOX1 SOX10

SOX1 1 SOX12 SOX13 SOX14 SOX15

SOX17 SOX18 SOX2 SOX21 SOX3

SOX30 SOX4 SOX5 SOX6 SOX7

SOX8 SOX9 SP1 SP100 SP1 10

SP140 SP140L SP2 SP3 SP4

SP5 SP6 SP8 SPA17 SPACA1

SPACA3 SPACA4 SPACA5 SPACA5B SPAG1

SPAG1 1 A SPAG1 1 B SPAG16 SPAG17 SPAG4

SPAG5 SPAG6 SPAG7 SPAG8 SPAG9

SPAM1 SPANX-N1 SPANXA1 SPANXA2 SPANXB1

SPANXC SPANXD SPANXN1 SPANXN2 SPANXN3

SPANXN4 SPANXN5 SPARC SPARCL1 SPAST

SPATA1 SPATA12 SPATA13 SPATA16 SPATA17

SPATA18 SPATA19 SPATA2 SPATA20 SPATA21

SPATA22 SPATA2L SPATA4 SPATA5 SPATA5L1

SPATA6 SPATA7 SPATA8 SPATA9 SPATC1

SPATS1 SPATS2 SPC25 SPCS1 SPCS2

SPDEF SPDYA SPDYC SPDYE1 SPDYE2

SPEF2 ENSTO

SPEF1 SPEF2 0000356031 SPEG SPEM1

SPEM1 ENSTOO

000323383 SPEN SPERT SPESP1 SPFH1

SPG1 1 SPG20 SPG21 SPG7 SPHAR

SPHK1 SPHK2 SPHKAP SPI1 SPIB

SPIC SPIN1 SPIN2A SPIN2B SPIN3

SPIN4 SPINK1 SPINK2 SPINK4 SPINK5

SPINK5L2 SPINK5L3 SPINK6 SPINK7 SPINK9

SPINLW1 ENST

SPINLW1 00000336443 SPINT1 SPINT2 SPINT4

SPIRE1 SPIRE2 SPN SPNS1 SPNS2

SPNS3 SP01 1 SPOCD1 SPOCK1 SPOCK2

SPOCK3 SPON2 SPOP SPOPL SPP1

SPP2 SPPL2A SPR SPRED1 SPRED2

SPRED3 SPRN SPRR1 A SPRR1 B SPRR2A

SPRR2B SPRR2D SPRR2E SPRR2F SPRR2G

SPRR3 SPRR4 SPRY1 SPRY2 SPRY3

SPRYD5 EN ST00000327

SPRY4 SPRYD3 SPRYD4 SPRYD5 733

SPSB1 SPSB2 SPSB3 SPSB4 SPTA1

SPTAN1 SPTB SPTBN1 SPTBN2 SPTBN4

SPTBN5 SPTLC1 SPTLC2 SPTLC3 SPTY2D1

SR140 HUM

SPZ1 SQLE SQRDL SQSTM1 AN

SRA1 SRBD1 SRC SRCAP SRCRB4D

SRD5A1 SRD5A3 SREBF1 SREBF2 SRF HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

SRFBP1 SRGAP1 SRGAP2P1 SRGAP3 SRGN

SRI SRL SRM SRMS SRP14

SRP19 SRP54 SRP68 SRP72 SRP9

SRPK3 ENS T000004894

SRP9L1 SRPK1 SRPK2 SRPK3 26

SRPR SRPRB SRPX SRPX2 SRR

SRRD SRRM1 SRRM2 SRRT SRXN1

SRY SS18 SS18L1 SS18L2 SSB

SSBP1 SSBP2 SSBP3 SSBP4 SSFA2

SSH1 SSH2 SSH3 SSNA1 SSPN

SSR1 SSR2 SSR3 SSR4 SSRP1

SSSCA1 SST SSTR1 SSTR2 SSTR3

SSTR4 SSTR5 SSU72 SSX1 SSX2

SSX2IP SSX3 SSX4 SSX4B SSX5

SSX6 SSX7 SSX9 ST13 ST14

ST18 ST20 ST3GAL1 ST3GAL2 ST3GAL3

ST3GAL4 ST3GAL5 ST3GAL6 ST5 ST6GAL1

ST6GALNAC

ST6GAL2 ST6GALNAC1 ST6GALNAC2 ST6GALNAC3 4

ST6GALNAC5 ST6GALNAC6 ST7 ST7L ST8SIA1

ST8SIA2 ST8SIA3 ST8SIA4 ST8SIA5 ST8SIA6

STAB1 STAB2 STAC STAC2 STAC3

STAG1 STAG2 STAG3 STAG3L1 STAG3L3

STAG3L4 STAM STAM2 STAM BP STAMBPL1

STAP1 STAP2 STAR STARD10 STARD13

STARD3 STARD3NL STARD4 STARD5 STARD6

STARD8 ENS

STARD7 STARD8 T00000252336 STARD9 STAT1

STAT2 STAT3 STAT4 STAT5A STAT5B

STAT6 STATH STAU1 STAU2 STBD1

STC1 STC2 STEAP1 STEAP2 STEAP3

STEAP4 STIL STIM1 STIM2 STIP1

STK10 STK1 1 STK1 1 IP STK16 STK17A

STK17B STK19 STK24 STK25 STK3

STK31 STK32A STK32B STK32C STK33

STK35 STK36 STK38 STK38L STK39

STK4 STK40 STMN1 STMN2 STMN3

STMN4 STOM STOML1 STOML2 STOML3

STON1 -

ST0N1 GTF2A1 L STON2 STOX1 STOX2

STRA13 STRA6 STRA8 STRADA STRADB

STRAP STRBP STRC STRN STRN3

STRN4 STS STT3A STT3B STUB1

STX10 STX1 1 STX12 STX16 STX17

STX18 STX19 STX1 A STX1 B STX2

STX3 STX4 STX5 STX6 STX7

STX8 STXBP1 STXBP2 STXBP3 STXBP4

STXBP5 STXBP5L STXBP6 STYK1 STYX

STYXL1 SUB1 SUCLA2 SUCLG1 SUCLG2

SUCNR1 SUDS3 SUFU SUGT1 SULF1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

TASP1 TAT TATDN1 TATDN2 TATDN3

TAX1 BP1 TAX1 BP3 TAZ TBC1 D1 TBC1 D10A

TBC1 D10C TBC1 D12 TBC1 D13 TBC1 D14 TBC1 D15

TBC1 D16 TBC1 D17 TBC1 D19 TBC1 D2 TBC1 D20

TBC1 D21 TBC1 D22A TBC1 D22B TBC1 D23 TBC1 D24

TBC1 D25 TBC1 D26 TBC1 D28 TBC1 D29 TBC1 D2B

TBC1 D3 TBC1 D30 TBC1 D3B TBC1 D3C TBC1 D3E

TBC1 D3F TBC1 D3G TBC1 D3H TBC1 D3P2 TBC1 D4

TBC1 D5 TBC1 D7 TBC1 D8B TBC1 D9B TBCA

TBCB TBCC TBCCD1 TBCD TBCE

TBCEL TBCK TBK1 TBKBP1 TBL1 X

TBL1 XR1 TBL1 Y TBL2 TBL3 TBP

TBPL1 TBPL2 TBR1 TBRG1 TBRG4

TBX1 TBX10 TBX15 TBX18 TBX19

TBX2 TBX20 TBX21 TBX22 TBX3

TBX4 TBX5 TBX6 TBXA2R TBXAS1

TC2N TCAP TCEA1 TCEA2 TCEAL1

TCEAL2 TCEAL3 TCEAL4 TCEAL5 TCEAL6

TCEAL7 TCEAL8 TCEANC TCEB1 TCEB2

TCEB3 TCEB3B TCEB3C TCERG1 TCERG1 L

TCF12 TCF15 TCF19 TCF20 TCF21

TCF23 TCF25 TCF3 TCF4 TCF7

TCF7L1 TCF7L2 TCFL5 TCHH TCHHL1

TCHP TCIRG1 TCL1 A TCL1 B TCL6

TCN1 TCN2 TC0F1 TCP1 TCP10

TCP10L TCP1 1 TCP1 1 L1 TCP1 1 L2 TCTA

TCTE1 TCTE3 TCTEX1 D1 TCTEX1 D2 TCTEX1 D4

TCTN1 TCTN2 TCTN3 TDG TDGF1

TDH TD02 TDP1 TDRD1 TDRD10

TDRD3 TDRD5 TDRD6 TDRD7 TDRD9

TDRKH TEAD1 TEAD2 TEAD4 TEC

TECPR1 TECPR2 TECR TECRL TECTA

TECTB TEDDM1 TEF TEK TEKT1

TEKT2 TEKT3 TEKT4 TEKT5 TEL02

TENC1 TEP1 TEPP TERF1 TERF2

TERF2IP TERT TES TESC TESK1

TESK2 TET1 TET2 TEX10 TEX101

TEX1 1 TEX12 TEX13A TEX13B TEX14

TEX15 TEX19 TEX2 TEX261 TEX264

TEX28 TEX9 TF TFAM TFAP2A

TFAP2B TFAP2C TFAP2D TFAP2E TFAP4

TFB1 M TFB2M TFCP2 TFCP2L1 TFDP1

TFDP2 TFDP3 TFE3 TFEB TFEC

TFF1 TFF2 TFF3 TFG TFIP1 1

TFPI TFPI2 TFPT TFR2 TFRC

TFSM1 HUMAN TG TGDS TGFA TGFB1

TGFB1 I1 TGFB2 TGFB3 TGFBI TGFBR1

TGFBR2 TGFBR3 TGFBRAP1 TGIF1 TGIF2

TGIF2LX TGIF2LY TGM1 TGM2 TGM3

TGM4 TGM5 TGM6 TGM7 TG0LN2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

TGS1 TH TH1 L THADA THAP1

THAP10 THAP1 1 THAP2 THAP3 THAP4

THAP5 THAP6 THAP7 THAP8 THAP9

THBD THBS1 THBS2 THBS3 THBS4

THEG THEM4 THEM5 THEMIS THG1 L

THNSL1 THNSL2 THOC1 THOC2 THOC3

THOC4 THOC5 THOC6 THOC7 THOP1

THPO THRA THRAP3 THRB THRSP

THSD1 THSD4 THSD7A THSD7B THTPA

THUMPD1 THUMPD2 THUMPD3 THY1 THYN1

TIA1 TIAF1 TIAL1 TIAM1 TIAM2

TICAM1 TICAM2 TIE1 TIF1 TIFA

TIFAB TIGD1 TIGD2 TIGD3 TIGD4

TIGD5 TIGD6 TIGD7 TIGIT TIMD4

TIMELESS TIMM10 TIMM13 TIMM17A TIMM17B

TIMM22 TIMM23 TIMM44 TIMM50 TIMM8A

TIMM8B TIMM9 TIMP1 TIMP2 TIMP3

TIMP4 TINAG TINAGL1 TINF2 TIPARP

TIPIN TIPRL TIRAP TJAP1 TJP1

TJP2 TJP3 TK1 TK2 TKT

TKTL1 TKTL2 TLCD1 TLCD2 TLE1

TLE3 TLE4 TLE6 TLK1 TLK2

TLL1 TLL2 TLN1 TLN2 TLR1

TLR10 TLR2 TLR3 TLR4 TLR5

TLR6 TLR7 TLR8 TLR9 TLX1

TLX2 TLX3 TM2D1 TM2D2 TM2D3

TM4SF1 TM4SF18 TM4SF19 TM4SF2 TM4SF20

TM4SF5 TM6SF1 TM6SF2 TM7SF2 TM7SF3

TM7SF4 TM9SF1 TM9SF2 TM9SF3 TM9SF4

TMBIM1 TMBIM4 TMBIM6 TMC1 TMC2

TMC3 TMC4 TMC5 TMC6 TMC7

TMC8 TMCC1 TMCC2 TMCC3 TMC01

TMC02 TMC03 TMC04 TMC05A TMC06

TMC07 TMED1 TMED10 TMED2 TMED3

TMED4 TMED5 TMED6 TMED7 TMED8

TMED9 TMEFF1 TMEFF2 TMEM100 TMEM101

TMEM102 TMEM104 TMEM105 TMEM106A TMEM106B

TMEM106C TMEM107 TMEM108 TMEM109 TMEM1 1

TMEM1 10 TMEM1 1 1 TMEM1 15 TMEM1 16 TMEM1 17

TMEM1 19 TMEM120B TMEM121 TMEM123 TMEM125

TM EM 126 A TMEM126B TMEM127 TMEM128 TMEM129

TMEM130 TMEM131 TMEM132A TMEM132B TMEM132C

TMEM132D TMEM132E TMEM133 TMEM134 TMEM135

TMEM136 TMEM138 TMEM139 TMEM140 TMEM141

TMEM143 TMEM144 TMEM145 TMEM146 TMEM147

TMEM149 TMEM14A TMEM14B TMEM14C TMEM150A

TMEM150B TMEM151 A TMEM154 TMEM155 TMEM156

TMEM159 TMEM160 TMEM161 A TMEM161 B TMEM163

TMEM164 TMEM165 TMEM167A TMEM167B TMEM168

TMEM169 TMEM17 TMEM170A TMEM170B TMEM171 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

TMEM173 TMEM174 TMEM175 TMEM176A TMEM176B

TMEM177 TMEM178 TMEM179 TMEM179B TMEM18

TMEM180 TMEM181 TMEM182 TMEM183A TMEM184A

TMEM184B TMEM184C TMEM185A TMEM185B TMEM186

TMEM189-

TMEM187 TMEM189 UBE2V1 TMEM19 TMEM190

TMEM192 TM EM 194 A TMEM195 TMEM196 TMEM198

TMEM199 TMEM2 TMEM20 TMEM200A TMEM200B

TMEM201 TMEM202 TMEM203 TMEM204 TMEM205

TMEM206 TMEM207 TMEM209 TMEM21 1 TMEM214

TMEM215 TMEM217 TMEM218 TMEM219 TMEM22

TMEM220 TMEM222 TMEM225 TMEM229B TMEM25

TMEM26 TMEM27 TMEM30A TMEM30B TMEM31

TMEM33 TMEM35 TMEM37 TMEM38A TMEM38B

TMEM39A TMEM39B TMEM40 TMEM41 A TMEM41 B

TMEM42 TMEM43 TMEM44 TMEM45A TMEM45B

TMEM47 TMEM48 TMEM49 TMEM5 TMEM50A

TMEM50B TMEM51 TMEM52 TMEM53 TMEM54

TMEM55A TMEM55B TMEM56 TMEM57 TMEM59

TMEM59L TMEM60 TMEM61 TMEM62 TMEM63A

TMEM63B TMEM64 TMEM65 TMEM66 TMEM67

TMEM68 TMEM69 TMEM70 TMEM71 TMEM72

TMEM74 TMEM78 TMEM79 TMEM80 TMEM81

TMEM82 TMEM85 TMEM86A TMEM86B TMEM87A

TMEM87B TMEM88 TMEM89 TMEM8A TMEM8B

TMEM8C TMEM9 TMEM90A TMEM90B TMEM91

TMEM92 TMEM93 TMEM95 TMEM97 TMEM98

TMEM99 TMEM9B TMF1 TMIE TMIGD1

TMIGD2 TMLHE TMOD1 TMOD2 TMOD3

TMPO ENSTO

TMOD4 TMPO 0000266732 TMPPE TMPRSS1 1 A

TMPRSS1 1 B TMPRSS1 1 D TMPRSS1 1 E TMPRSS1 1 E2 TMPRSS1 1 F

TMPRSS2 EN

ST0000033214

TMPRSS13 TMPRSS2 9 TMPRSS3 TMPRSS4

TMPRSS6 TMPRSS7 TMPRSS9 TMSB10 TMSB15A

TMSB15B TMSB4X TMSB4Y TMSL2 TMSL3

TMTC1 TMTC2 TMTC3 TMTC4 TMUB1

TMUB2 TMX1 TMX2 TMX3 TMX4

TNAP TNC TNF TNFAIP1 TNFAIP2

TNFAIP3 TNFAIP6 TNFAIP8L1 TNFAIP8L2 TNFAIP8L3

TNFRSF10A TNFRSF10B TNFRSF10C TNFRSF10D TNFRSF1 1 A

TNFRSF1 1 B TNFRSF12A TNFRSF13B TNFRSF13C TNFRSF14

TNFRSF17 TNFRSF18 TNFRSF19 TNFRSF1 A TNFRSF1 B

TNFRSF21 TNFRSF25 TNFRSF4 TNFRSF6B TNFRSF8

TNFSF12-

TNFRSF9 TNFSF10 TNFSF1 1 TNFSF12 TNFSF13

TNFSF13 TNFSF13B TNFSF14 TNFSF15 TNFSF18

TNFSF4 TNFSF8 TNFSF9 TNIK TNIP1

TNK2 ENST

TNIP2 TNIP3 TNK1 TNK2 00000381916 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

TNKS TNKS1 BP1 TNKS2 TNMD TNN

TNNC1 TNNC2 TNNI1 TNNI2 TNNI3

TNNI3K TNNT1 TNNT2 TNNT3 TNP1

TNP01 TNP02 TNP03 TNR TNRC18

TNRC6A TNRC6B TNS1 TNS3 TNS4

TNXB ENSTOOO

TNXB 00375247 TOB1 TOB2 TOB2P1

TOE1 TOLLIP TOM1 TOM1 L1 TOM1 L2

TOMM20 TOMM20L TOMM22 TOMM34 TOMM40

TOMM40L TOMM5 TOMM7 TOMM70A TOP1

TOP1 MT TOP2A TOP2B TOP3A TOP3B

TOP3B ENSTOO

0003571 79 TOPBP1 TOPORS TOR1 A TOR1 AIP1

TOR1 AIP2 TOR1 B TOR2A TOR3A TOX

TOX2 TOX3 TOX4 TP53 TP53AIP1

TP53BP1 TP53BP2 TP53I1 1 TP53I13 TP53I3

TP53INP1 TP53INP2 TP53RK TP53TG1 TP53TG5

TP63 TP73 TPBG TPCN1 TPCN2

TPD52 TPD52L1 TPD52L2 TPD52L3 TPH1

TPH2 TPI1 TPK1 TPM1 TPM2

TPM4 ENSTOO

TPM3 TPM4 000344824 TPMT TPO

TPP1 TPP2 TPPP TPPP2 TPPP3

TPR TPRA1 TPRG1 TPRG1 L TPRKB

TPRX1 TPRXL TPSAB1 TPSD1 TPSG1

TPST1 TPST2 TPT1 TPTE TPTE2

TPX2 TRA2A TRA2B TRABD TRAD

TRADD TRAF1 TRAF2 TRAF3 TRAF3IP1

TRAF3IP2 TRAF3IP3 TRAF4 TRAF5 TRAF6

TRAF7 TRAFD1 TRAIP TRAK1 TRAK2

TRAM1 TRAM1 L1 TRAM2 TRANK1 TRAP1

TRAPPC1 TRAPPC1 0 TRAPPC2 TRAPPC2L TRAPPC3

TRAPPC4 TRAPPC5 TRAPPC6A TRAPPC6B TRAPPC9

TRAT1 TRDMT1 TRDN TREM1 TREM2

TREML1 TREML2 TREML4 TRERF1 TREX1

TREX2 TRH TRHDE TRHR TRIAP1

TRIB1 TRIB2 TRIB3 TRIM10 TRIM1 1

TRIM13 TRIM14 TRIM15 TRIM16 TRIM16L

TRIM17 TRIM2 TRIM21 TRIM22 TRIM23

TRIM24 TRIM25 TRIM26 TRIM27 TRIM28

TRIM29 TRIM3 TRIM31 TRIM32 TRIM33

TRIM34 TRIM35 TRIM36 TRIM37 TRIM38

TRIM39 TRIM4 TRIM40 TRIM41 TRIM42

TRIM43 TRIM44 TRIM45 TRIM46 TRIM47

TRIM48 TRIM49 TRIM5 TRIM50 TRIM52

TRIM54 TRIM55 TRIM56 TRIM58 TRIM59

TRIM6 TRIM6-TRIM34 TRIM60 TRIM61 TRIM62

TRIM63 TRIM64C TRIM65 TRIM66 TRIM67

TRIM68 TRIM69 TRIM7 TRIM71 TRIM72

TRIM73 TRIM74 TRIM8 TRIM9 TRIML1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

TRIOBP ENST

TRIML2 TRIO TRIOBP 00000344404 TRIP10

TRIP1 1 TRIP12 TRIP13 TRIP4 TRIP6

TRIT1 TRMT1 TRMT1 1 TRMT1 12 TRMT12

TRMT2A TRMT2B TRMT5 TRMT6 TRMT61 A

TRMT61 B TRMU TRNAU1 AP TRNP1 TRNT1

TRO TROAP TROVE2 TRPA1 TRPC1

TRPC3 TRPC4 TRPC4AP TRPC5 TRPC6

TRPM1 TRPM2 TRPM3 TRPM4 TRPM5

TRPM6 TRPM7 TRPM8 TRPS1 TRPT1

TRPV2 TRPV3 TRPV4 TRPV5 TRPV6

TRRAP TRUB1 TRUB2 TRYX3 TSC1

TSC2 TSC22D1 TSC22D2 TSC22D3 TSC22D4

TSC2 ENSTOOO

00219476 TSEN15 TSEN2 TSEN34 TSEN54

TSFM TSG101 TSGA10 TSGA10IP TSGA13

TSGA14 TSHB TSHR TSHZ1 TSHZ2

TSHZ3 TSKS TSKU TSLP TSN

TSNARE1 TSNAX TSNAXIP1 TSPAN1 TSPAN1 1

TSPAN12 TSPAN13 TSPAN14 TSPAN15 TSPAN1 6

TSPAN1 7 TSPAN1 8 TSPAN2 TSPAN3 TSPAN31

TSPAN32 TSPAN33 TSPAN4 TSPAN5 TSPAN6

TSPAN7 TSPAN8 TSPAN9 TSPO TSP02

TSPY2 TSPY3 TSPYL1 TSPYL2 TSPYL5

TSPYL6 TSR1 TSR2 TSSC1 TSSC4

TSSK1 B TSSK2 TSSK3 TSSK4 TSSK6

TST TSTA3 TSTD2 TTBK1 TTBK2

TTC1 TTC12 TTC13 TTC14 TTC15

TTC16 TTC17 TTC18 TTC19 TTC21 A

TTC21 B TTC22 TTC23 TTC26 TTC27

TTC29 TTC3 TTC30A TTC31 TTC32

TTC33 TTC35 TTC36 TTC37 TTC38

TTC39A TTC39B TTC39C TTC3L TTC4

TTC5 TTC6 TTC7A TTC7B TTC8

TTC9B TTC9C TTF1 TTF2 TTK

TTL TTLL1 TTLL10 TTLL1 1 TTLL12

TTLL13 TTLL2 TTLL3 TTLL4 TTLL5

TTLL6 ENSTOOO

TTLL6 00393382 TTLL7 TTLL9 TTN

TTN ENSTOOOOO TTN ENST0000

356127 0360870 TTPA TTPAL TTR

TTRAP TTYH1 TTYH2 TTYH3 TUB

TUBA1 A TUBA1 B TUBA1 C TUBA3C TUBA3D

TUBA4A ENS

TUBA3E TUBA4A T00000392088 TUBA8 TUBAL3

TUBB TUBB1 TUBB2A TUBB2B TUBB2C

TUBB3 TUBB4 TUBB4Q TUBB6 TUBB8

TUBD1 TUBE1 TUBG1 TUBG2 TUBGCP2

TUBGCP3 TUBGCP4 TUBGCP5 TUBGCP6 TUFM

TUFT1 TULP1 TULP2 TULP3 TULP4 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

TUSC1 TUSC2 TUSC3 TUSC4 TUSC5

TUT1 TWF1 TWF2 TWIST1 TWISTNB

TWSG1 TXK TXLNA TXLNB TXN

TXN2 TXNDC1 1 TXNDC12 TXNDC15 TXNDC16

TXNDC17 TXNDC2 TXNDC3 TXNDC5 TXNDC6

TXNDC8 TXNDC9 TXNIP TXNL1 TXNL2

TXNL4A TXNL4B TXNRD1 TXNRD2 TXNRD3IT1

TYK2 TYMP TYMS TYR TYR03

TYROBP TYRP1 TYSND1 TYW1 TYW3

U2D3L HUM

U258 HUMAN U2AF1 U2AF1 L4 U2AF2 AN

U66061 1 EN

ST0000039039

U464 HUMAN U66061 1 6 UACA UAP1

UAP1 L1 UBA1 UBA2 UBA3 UBA5

UBA52 UBA6 UBA7 UBAC1 UBAC2

UBAP1 UBAP2 UBAP2L UBASH3A UBASH3B

UBB UBC UBD UBE2A UBE2B

UBE2C UBE2CBP UBE2D1 UBE2D2 UBE2D3

UBE2D4 UBE2E1 UBE2E2 UBE2E3 UBE2F

UBE2G1 UBE2G2 UBE2H UBE2I UBE2J1

UBE2J2 UBE2K UBE2L3 UBE2L6 UBE2M

UBE2N UBE2NL UBE20 UBE2Q1 UBE2Q2

UBE2R2 UBE2S UBE2T UBE2U UBE2V1

UBE2V2 UBE3A UBE3B UBE3C UBE4A

UBE4B UBFD1 UBIAD1 UBL3 UBL4A

UBL4B UBL5 UBL7 UBLCP1 UBN1

UBN2 UBOX5 UBP1 UBQLN1 UBQLN2

UBQLN3 UBQLN4 UBQLNL UBR1 UBR2

UBR3 ENSTOOO

UBR3 00272793 UBR4 UBR5 UBR7

UBTD1 UBTD2 UBTF UBXN1 UBXN10

UBXN1 1 UBXN2A UBXN2B UBXN4 UBXN6

UBXN7 UBXN8 UCHL1 UCHL3 UCHL5

UCK1 UCK2 UCKL1 UCMA UCN

UCN2 UCN3 UCP1 UCP2 UCP3

UEVLD UFC1 UFD1 L UFM1 UFSP1

UFSP2 UGCG UGDH UGGT1 UGGT2

UGP2 UGT1 A1 UGT1 A10 UGT1 A3 UGT1 A4

UGT1 A5 UGT1 A6 UGT1 A7 UGT1 A8 UGT1 A9

UGT2A1 UGT2A3 UGT2B1 1 UGT2B15 UGT2B17

UGT2B28 UGT2B4 UGT2B7 UGT3A1 UGT3A2

UGT8 UHMK1 UHRF1 UHRF1 BP1 UHRF1 BP1 L

UHRF2 UIMC1 ULBP1 ULBP2 ULBP3

ULK1 ULK2 ULK3 ULK4 UMOD

UMODL1 UMPS UNC1 19 UNC1 1 9B UNC13B

UNC13D UNC45A UNC45B UNC50 UNC5A

UNC5B UNC5C UNC5CL UNC5D UNC80

UNG ENSTO

UNC93A UNC93B6 UNCX UNG 0000242576

UNK UNKL UNQ1887 UNQ3045 UNQ9391 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

UPB1 UPF1 UPF2 UPF3A UPF3B

UPK1 A UPK1 B UPK2 UPK3A UPK3B

UPP1 UPP2 UPRT UQCC UQCR1 1

UQCRB UQCRC1 UQCRC2 UQCRFS1 UQCRH

UQCRQ URB2 URGCP URM1 UROC1

UROD UROS URP2 USF1 USF2

USH1 C USH1 G USH2A USHBP1 USMG5

USMG5P1 US01 USP1 USP10 USP1 1

USP12 USP13 USP14 USP15 USP16

USP17L2 USP18 USP19 USP2 USP20

USP21 USP22 USP24 USP25 USP26

USP27X USP28 USP29 USP3 USP30

USP31 USP32 USP33 USP34 USP35

USP35 ENSTOO

00026331 1 USP36 USP37 USP38 USP39

USP4 USP41 USP42 USP43 USP44

USP45 USP46 USP47 USP48 USP49

USP5 USP50 USP51 USP53 USP54

USP54 ENSTOO

000408019 USP6 USP6NL USP7 USP8

USP9X USP9Y USPL1 UST UTF1

UTP1 1 L UTP14A UTP14C UTP15 UTP18

UTP20 UTP23 UTP3 UTP6 UTRN

UTS2 UTS2D UTS2R UTY UVRAG

UXT VAC 14 VAMP1 VAMP2 VAMP3

VAMP4 VAMP5 VAMP7 VAMP8 VANGL1

VANGL2 VAPA VAPB VARS VARS2

VASH1 VASH2 VASN VASP VAT1

VAT1 L VAV1 VAV2 VAV3 VAX1

VAX2 VBP1 VCAM1 VCAN VCL

VCP VCPIP1 vex VCX2 VCX3A

VCY VCY1 B VDAC1 VDAC2 VDAC3

VDAC4 VDR VEGFA VEGFB VEGFC

VENTX VEPH1 VEZF1 VGF VGLL1

VGLL2 VGLL3 VGLL4 VHL VHLL

VIL1 VILL VIM VIP VI PAR

VIPR1 VIPR2 VIT VKORC1 VKORC1 L1

VLDLR VMA21 VMAC VM01 VN1 R1

VN1 R2 VN1 R4 VN2R1 P VNN1 VNN2

VNN3 VPRBP VPREB1 VPREB3 VPS1 1

VPS13A VPS13B VPS13C VPS13D VPS16

VPS18 VPS24 VPS25 VPS26A VPS26B

VPS28 VPS29 VPS33A VPS33B VPS35

VPS36 VPS37A VPS37B VPS37C VPS37D

VPS39 VPS41 VPS45 VPS4B VPS52

VPS53 VPS54 VPS72 VPS8 VRK1

VRK2 VRK3 VSIG1 VSIG2 VSIG4

VSIG7 VSIG8 VSNL1 VSTM1 VSTM2B

VSTM2L VSX1 VSX2 VTA1 VTCN1

VTI1 A VTI1 B VTN VWA1 VWA2 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

VWA3A VWA3B VWA5A VWC2 VWCE

VWDE VWF WAC WAPAL WARS

WARS2 WAS WASF1 WASF2 WASF3

WASF4 WASL WBP1 WBP1 1 WBP2

WBP2NL WBP4 WBP5 WBSCR16 WBSCR17

WBSCR22 WBSCR27 WBSCR28 WDFY1 WDFY2

WDFY3 WDFY4 WDHD1 WDR1 1 WDR12

WDR13 WDR16 WDR17 WDR18 WDR19

WDR20 WDR23 WDR24 WDR25 WDR26

WDR27 ENSTOO

WDR27 000333572 WDR3 WDR31 WDR33

WDR34 WDR35 WDR36 WDR37 WDR38

WDR44 ENS

T000004353

WDR4 WDR41 WDR43 WDR44 84

WDR45 WDR45L WDR46 WDR47 WDR48

WDR49 WDR5 WDR51 A WDR51 B WDR52

WDR52 ENSTOO

000393845 WDR53 WDR54 WDR55 WDR57

WDR59 WDR5B WDR6 WDR60 WDR61

WDR62 WDR63 WDR64 WDR65 WDR66

WDR67 WDR69 WDR7 WDR70 WDR72

WDR73 WDR75 WDR76 WDR77 WDR78

WDR82 ENST

WDR8 WDR81 WDR82 00000296490 WDR83

WDR85 WDR88 WDR89 WDR90 WDR91

WDR92 WDR93 WDSUB1 WDTC1 WDYHV1

WEE1 WEE2 WFDC1 WFDC10A WFDC10B

WFDC1 1 WFDC12 WFDC13 WFDC2 WFDC3

WFDC5 WFDC6 WFDC8 WFDC9 WFIKKN1

WHAMM ENS

WFIKKN2 WFS1 T00000234505 WHSC1 WHSC1 L1

WHSC2 WIF1 WIPF1 WIPF2 WIPF3

WIPI1 WIPI2 WISP1 WISP2 WISP3

WIT1 WIZ WLS WNK1 WNK2

WNK3 WNK4 WNT1 WNT10A WNT10B

WNT1 1 WNT16 WNT2 WNT2B WNT3

WNT3A WNT4 WNT5A WNT5B WNT6

WNT7A WNT7B WNT8A WNT8B WNT9A

WNT9B WRAP53 WRB WRN WRNIP1

WSB1 WSB2 WSCD1 WSCD2 WT1

WTAP WTIP WWC1 WWC2 WWC3

WWOX WWP1 WWP2 WWTR1 XAB1

XAB2 XAF1 XAGE1 C XAGE1 D XAGE2

XAGE3 XAGE5 XBP1 XCL1 XCL2

XCR1 XDH XG XIAP XIRP1

XIRP2 ENSTOOO

XIRP2 00409728 XK XKR3 XKR4

XKR5 XKR6 XKR7 XKR8 XKR9

XKRX XPA XPC XPNPEP1 XPNPEP2

XPNPEP3 XP01 XP04 XP05 XP06 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

XP07 XPOT XPR1 XRCC1 XRCC2

XRCC3 XRCC4 XRCC5 XRCC6 XRCC6BP1

XXyac-

XRN1 XRN2 XRRA1 YX155B6 1 XYLB

XYLT1 XYLT2 YAF2 YAP1 YARS

YARS2 YBX1 YBX2 YDJC YEATS2

YEATS4 YES1 YIF1 A YIF1 B YIPF1

YIPF2 YIPF3 YIPF4 YIPF5 YIPF6

YJEFN3 YKT6 YLPM1 YME1 L1 YOD1

YPEL1 YPEL2 YPEL3 YPEL4 YPEL5

YSK4 ENSTOO

YRDC YSK4 000375845 YTHDC1 YTHDC2

YV009 HUMA

YTHDF1 YTHDF2 N YWHAB YWHAE

YWHAG YWHAH YWHAQ YWHAZ YY1

YY1 AP1 YY2 ZACN ZADH1 ZADH2

ZAK ZAN ZAP70 ZAR1 ZAR1 L

ZBBX ENSTOOO

ZBBX 00455345 ZBED1 ZBED2 ZBED3

ZBED4 ZBP1 ZBTB1 ZBTB10 ZBTB1 1

ZBTB12 ZBTB16 ZBTB17 ZBTB2 ZBTB20

ZBTB22 ZBTB24 ZBTB25 ZBTB26 ZBTB3

ZBTB32 ZBTB33 ZBTB34 ZBTB37 ZBTB38

ZBTB39 ZBTB4 ZBTB40 ZBTB41 ZBTB43

ZBTB44 ZBTB45 ZBTB46 ZBTB48 ZBTB49

ZBTB5 ZBTB6 ZBTB7A ZBTB7B ZBTB7C

ZBTB8B ENSTO

ZBTB8A 0000291374 ZBTB80S ZBTB9 ZC3H10

ZC3H12B ENS

ZC3H1 1 A ZC3H12A ZC3H12B T00000338957 ZC3H12C

ZC3H13 ZC3H14 ZC3H15 ZC3H18 ZC3H3

ZC3H4 ZC3H6 ZC3H7A ZC3H7B ZC3H8

ZC3HAV1 ZC3HAV1 L ZC3HC1 ZC4H2 ZCCHC10

ZCCHC1 1 ZCCHC12 ZCCHC13 ZCCHC14 ZCCHC16

ZCCHC17 ZCCHC24 ZCCHC3 ZCCHC4 ZCCHC5

ZCCHC6 ZCCHC7 ZCCHC8 ZCCHC9 ZCRB1

ZDHHC1 1 E NST0000042

ZCWPW1 ZCWPW2 ZDHHC1 ZDHHC1 1 4784

ZDHHC12 ZDHHC13 ZDHHC14 ZDHHC15 ZDHHC16

ZDHHC18 ZDHHC19 ZDHHC21 ZDHHC23 ZDHHC24

ZDHHC3 ZDHHC4 ZDHHC5 ZDHHC6 ZDHHC7

ZDHHC8 ZDHHC9 ZEB1 ZEB2 ZER1

ZFAND1 ZFAND2A ZFAND2B ZFAND3 ZFAND5

ZFAND6 ZFAT ZFC3H1 ZFHX3 ZFHX4

ZFP1 ZFP106 ZFP1 12 ZFP14 ZFP161

ZFP2 ZFP28 ZFP3 ZFP30 ZFP36

ZFP36L1 ZFP36L2 ZFP37 ZFP41 ZFP42

ZFP64 ENSTO

ZFP57 ZFP64 0000361387 ZFP82 ZFP90

ZFP91 ZFP91 -CNTF ZFP92 ZFPL1 ZFPM1 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ZFPM2 ZFR ZFR2 ZFX ZFY

ZFYVE1 ZFYVE16 ZFYVE19 ZFYVE20 ZFYVE21

ZFYVE26 ZFYVE27 ZFYVE28 ZFYVE9 ZG16B

ZGPAT ZHX1 ZHX2 ZHX3 ZIC1

ZIC2 ZIC3 ZIC4 ZIC5 ZIK1

ZIM2 ZIM3 ZKSCAN1 ZKSCAN2 ZKSCAN3

ZKSCAN4 ZKSCAN5 ZMAT1 ZMAT2 ZMAT3

ZMAT4 ZMAT5 ZMIZ1 ZMIZ2 ZMPSTE24

ZMYM1 ZMYM2 ZMYM3 ZMYM4 ZMYM5

ZMYM6 ZMYND10 ZMYND1 1 ZMYND12 ZMYND15

ZMYND17 ZMYND19 ZMYND8 ZNF10 ZNF100

ZNF10 ENSTO

ZNF101 ZNF107 0000228289 ZNF1 14 ZNF1 17

ZNF12 ZNF121 ZNF123 ZNF124 ZNF131

ZNF132 ZNF133 ZNF134 ZNF135 ZNF136

ZNF138 ZNF14 ZNF140 ZNF141 ZNF142

ZNF143 ZNF146 ZNF148 ZNF154 ZNF155

ZNF157 ZNF16 ZNF160 ZNF165 ZNF167

ZNF169 ZNF17 ZNF174 ZNF175 ZNF177

ZNF18 ZNF180 ZNF181 ZNF182 ZNF184

ZNF185 ZNF189 ZNF19 ZNF192 ZNF193

ZNF195 ZNF197 ZNF198 ZNF2 ZNF20

ZNF200 ZNF202 ZNF205 ZNF207 ZNF21 1

ZNF212 ZNF213 ZNF214 ZNF215 ZNF217

ZNF219 ZNF22 ZNF221 ZNF222 ZNF223

ZNF224 ZNF227 ZNF229 ZNF23 ZNF230

ZNF232 ZNF233 ZNF235 ZNF236 ZNF238

ZNF239 ZNF24 ZNF248 ZNF25 ZNF251

ZNF257 EN ST00000435

ZNF253 ZNF254 ZNF256 ZNF257 820

ZNF259 ZNF26 ZNF260 ZNF263 ZNF264

ZNF266 ZNF267 ZNF271 ZNF273 ZNF274

ZNF275 ZNF276 ZNF277 ZNF278 ZNF28

ZNF280A ZNF280B ZNF280C ZNF280D ZNF281

ZNF282 ZNF283 ZNF285A ZNF286A ZNF287

ZNF292 ZNF295 ZNF296 ZNF3 ZNF30

ZNF300 ZNF304 ZNF31 1 ZNF317 ZNF318

ZNF319 ZNF32 ZNF320 ZNF321 ZNF322A

ZNF322B ZNF323 ZNF324 ZNF324B ZNF326

ZNF329 ZNF330 ZNF331 ZNF333 ZNF334

ZNF335 ZNF337 ZNF33A ZNF33B ZNF34

ZNF341 ZNF343 ZNF345 ZNF346 ZNF347

ZNF35 ZNF350 ZNF354A ZNF354B ZNF354C

ZNF358 ZNF362 ZNF365 ZNF366 ZNF367

ZNF37A ZNF382 ZNF383 ZNF384 ZNF385

ZNF385A ZNF385B ZNF385C ZNF385D ZNF391

ZNF394 ZNF395 ZNF396 ZNF397 ZNF3970S

ZNF398 ZNF407 ZNF408 ZNF41 ZNF410

ZNF414 ENSTO

ZNF414 0000393927 ZNF415 ZNF416 ZNF417 HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ZNF418 ZNF419 ZNF420 ZNF423 ZNF425

ZNF426 ZNF428 ZNF429 ZNF43 ZNF430

ZNF432 ENST

ZNF431 ZNF432 00000354939 ZNF434 ZNF436

ZNF438 ZNF439 ZNF440 ZNF441 ZNF442

ZNF443 ZNF444 ZNF445 ZNF446 ZNF449

ZNF45 ZNF451 ZNF454 ZNF460 ZNF462

ZNF467 ZNF468 ZNF470 ZNF471 ZNF473

ZNF474 ZNF479 ZNF48 ZNF480 ZNF483

ZNF484 ZNF485 ZNF486 ZNF488 ZNF490

ZNF492 ENST

ZNF491 ZNF492 00000456783 ZNF493 ZNF496

ZNF497 ZNF498 ZNF500 ZNF501 ZNF502

ZNF503 ZNF506 ZNF507 ZNF510 ZNF51 1

ZNF512 ZNF512B ZNF513 ZNF514 ZNF516

ZNF517 ZNF518B ZNF519 ZNF521 ZNF524

ZNF526 ZNF527 ZNF528 ZNF529 ZNF530

ZNF532 ZNF534 ZNF536 ZNF540 ZNF541

ZNF543 ZNF544 ZNF546 ZNF547 ZNF548

ZNF549 ZNF550 ZNF551 ZNF552 ZNF554

ZNF555 ZNF556 ZNF557 ZNF558 ZNF559

ZNF560 ZNF561 ZNF562 ZNF563 ZNF564

ZNF565 ZNF566 ZNF567 ZNF568 ZNF569

ZNF57 ZNF570 ZNF571 ZNF572 ZNF573

ZNF574 ZNF575 ZNF576 ZNF577 ZNF579

ZNF580 ZNF581 ZNF582 ZNF583 ZNF584

ZNF585A ZNF585B ZNF586 ZNF587 ZNF589

ZNF592 ZNF593 ZNF594 ZNF596 ZNF597

ZNF599 ZNF600 ZNF605 ZNF606 ZNF607

ZNF608 ZNF609 ZNF610 ZNF61 1 ZNF613

ZNF614 ZNF615 ZNF616 ZNF618 ZNF619

ZNF620 ZNF621 ZNF622 ZNF623 ZNF624

ZNF628 EN ST00000391

ZNF625 ZNF626 ZNF627 ZNF628 718

ZNF630 ZNF638 ZNF639 ZNF641 ZNF642

ZNF643 ZNF644 ZNF645 ZNF646 ZNF648

ZNF649 ZNF652 ZNF653 ZNF654 ZNF655

ZNF658 ZNF658B ZNF660 ZNF662 ZNF664

ZNF665 ZNF667 ZNF668 ZNF669 ZNF67

ZNF670 ZNF671 ZNF672 ZNF673 ZNF674

ZNF675 ZNF676 ZNF677 ZNF678 ZNF680

ZNF682 ZNF684 ZNF687 ZNF688 ZNF689

ZNF697 EN ST00000271

ZNF69 ZNF691 ZNF692 ZNF696 263

ZNF699 ZNF7 ZNF70 ZNF700 ZNF701

ZNF703 ZNF704 ZNF705A ZNF705D ZNF706

ZNF707 ZNF708 ZNF709 ZNF71 ZNF710

ZNF71 1 ZNF713 ZNF714 ZNF738 ZNF74

ZNF746 ZNF747 ZNF750 ZNF75A ZNF75D HGNC Gene HGNC Gene HGNC Gene HGNC Gene HGNC Gene Name Name Name Name Name

ZNF76 ZNF761 ZNF763 ZNF764 ZNF765

ZNF765 ENSTOO

000396408 ZNF767 ZNF768 ZNF77 ZNF770

ZNF772 ZNF773 ZNF774 ZNF775 ZNF776

ZNF777 ZNF780A ZNF781 ZNF782 ZNF784

ZNF785 ZNF786 ZNF787 ZNF788 ZNF789

ZNF79 ZNF790 ZNF791 ZNF793 ZNF799

ZNF8 ZNF80 ZNF800 ZNF804A ZNF804B

ZNF81 ZNF816A ZNF821 ZNF826 ZNF827

ZNF828 ZNF829 ZNF83 ZNF830 ZNF831

ZNF833 ZNF834 ZNF835 ZNF836 ZNF837

ZNF841 ENST

ZNF839 ZNF84 00000359973 ZNF843 ZNF846

ZNF90 ENS T000004180

ZNF85 ZNF862 ZNF879 ZNF90 63

ZNF91 ENSTOO

ZNF91 000300619 ZNF92 ZNF93 ZNFX1

ZNHIT1 ZNHIT2 ZNHIT3 ZNHIT6 ZNRD1

ZNRF1 ZNRF2 ZNRF3 ZNRF4 ZP1

ZP2 ZP3 ZP4 ZPBP ZPBP2

ZPLD1 ZRANB1 ZRANB2 ZRANB3 ZRSR2

ZSCAN1 ZSCAN10 ZSCAN16 ZSCAN18 ZSCAN2

ZSCAN20 ZSCAN21 ZSCAN22 ZSCAN23 ZSCAN29

ZSCAN4 ZSCAN5A ZSWIM1 ZSWIM2 ZSWIM3

ZSWIM4 ZSWIM5 ZSWIM7 ZUFSP ZW10

ZWILCH ZWINT ZXDA ZXDB ZXDC

ZYG1 1 B ZYX ZZEF1 ZZZ3 dJ341 D10 1 hCG 179363 hCG 1642425 hCG 1644301 hCG 17324 hCG 1757335 9 hCG 2000329 hCG 2015269 hCG 2023776 hCG 2026038 hCG 38941 mir-223 mir-424

Table 4 Exemplary transposable elements in GBM microvesicles

Name GenBank

Accession No.

Homo sapiens transposon-derived Busterl [NM_021211] transposase-like protein gene (LOC58486)

Human endogenous retrovirus H [U88896] protease/integrase-derived ORF1, ORF2, and

putative envelope protein mRNA, complete cds

Human endogenous retrovirus type C oncovirus [M74509] sequence

Human endogenous retroviral H [U88898] protease/integrase-derived ORF1 mRNA,

complete cds, and putative envelope protein

mRNA, partial cds.

Homo sapiens Cas-Br-M (murine) ecotropic [NM_005188] retroviral transforming sequence (CBL)

Homo sapiens endogenous retroviral sequence K, [NM_001007236] 6 (ERVK6)

Homo sapiens endogenous retroviral family W, [NM_014590] env(C7), member 1 (syncytin) (ERVWE1)

Homo sapiens Cas-Br-M (murine) ecotropic [NM_170662] retroviral transforming sequence b (CBLB)

Homo sapiens mRNA containing human [AF026246] endogenous retrovirus H and human endog

retrovirus E sequences

Homo sapiens cDNA FLJ11804 fis, clone [AK021866] HEMBA 1006272, moderately similar to

RETRO VIRUS-RELATED PROTEASE (EC

3.4.23.-).

Human DN A/endogenous retroviral long terminal [M32220] repeat (LTR) junction mRNA, clone lambda- LTR22

ALU8_HUMAN (P39195) Alu subfamily SX [THC2390306] sequence contamination warning entry, partial

(7%)

AA436686 zv59al2.sl Soares_testis_NHT Homo [AA436686] sapiens cDNA clone IMAGE:757918 3' similar to

contains Alu repetitive element

ALU6_HUMAN (P39193) Alu subfamily SP [THC2314369] sequence contamination warning entry, partial

(19%)

ALU 1 _HUM AN (P39188) Alu subfamily J [THC2320431] sequence contamination warning entry, partial

(8%)

BF476310 naa21a07.xl NCI_CGAP_Pr28 Homo [BF476310] sapiens cDNA clone IMAGE:3255444 3' similar

to contains Alu repetitive element;contains

element MIR MIR repetitive element Name GenBank

Accession No.

ALU4_HUMAN (P39191) Alu subfamily SB2 [THC2284657] sequence contamination warning entry, partial

(4%)

LINl_NYCCO (P08548) LINE-1 reverse [THC2379144] transcriptase homolog, partial (5%)

od56h08.sl NCI_CGAP_GCB1 Homo sapiens [AA827885] cDNA clone IMAGE: 1371999 3' similar to

gb:M19503 LINE-1 REVERSE

TRANSCRIPTASE HOMOLOG (HUMAN)

B28096 line-1 protein ORF2 - human (Homo [THC2281068] sapiens), partial (4%)

Homo sapiens LINE-1 type transposase domain [NM_019079] containing 1 (L1TD1)

Q6D545 (Q6D545) Transposase transposon [THC2407148] tnl721 (Fragment), partial (12%)

Human clone 279131 defective mariner [U92025] transposon Hsmar2 mRNA sequence

Homo sapiens retrotransposon gag domain [NM_001024455] containing 4 (RGAG4)

Homo sapiens transposon-derived Buster3 [NM_022090] transposase-like (LOC63920)

Homo sapiens retrotransposon gag domain [NM_020769] containing 1 (RGAG1)

Human EST clone 251800 mariner transposon [U80770] Hsmarl sequence

Homo sapiens SET domain and mariner [NM_006515] transposase fusion gene (SETMAR)

Homo sapiens tigger transposable element derived [NM_032862] 5 (TIGD5)

Homo sapiens tigger transposable element derived [NM_145702] 1 (TIGD1)

Homo sapiens pogo transposable element with [NM_017542] KRAB domain (POGK)

Homo sapiens pogo transposable element with [NM_015100] ZNF domain (POGZ), transcript variant 1

Homo sapiens tigger transposable element derived [NM_030953] 6 (TIGD6)

Homo sapiens piggyBac transposable element [NM_152595] derived 4 (PGBD4) Table 5 Human transposable elements. Type of Transposon ID

The list is adapted from Repbase-GIRI. Endogenous Retrovirus HUERS-P3B

Endogenous Retrovirus MER31 http://www.girinst.org/, accessed January 31,

Endogenous Retrovirus MER31_I 2011.

Endogenous Retrovirus MER34B_I

Endogenous Retrovirus MER41F

Endogenous Retrovirus MER41I

Endogenous Retrovirus MER4BI

Endogenous Retrovirus MER57A_I

Endogenous Retrovirus MER57I

Endogenous Retrovirus MER61A

Endogenous Retrovirus MER84I

Endogenous Retrovirus PRIMA4_I

Endogenous Retrovirus PRIMA41

Endogenous Retrovirus PRIMAXJ

ERV1 HARLEQUIN

ERV1 HERV17

ERV1 HERV19I

ERV1 HERV3

ERV1 HERV35I

ERV1 HERV4_I

ERV1 HERV49I

ERV1 HERV9

ERV1 HERVE

ERV1 HER VI

ERV1 HERVIP10F

ERV1 HERVIP10FH

ERV1 LOR1I

ERV1 LTR06

ERV1 LTR1

ERV1 LTR10B

ERV1 LTR10B2

ERV1 LTR10C

ERV1 LTR10D

ERV1 LTR10F

ERV1 LTR12B

ERV1 LTR12C

ERV1 LTR12D

ERV1 LTR12E

ERV1 LTR15

ERV1 LTR17

ERV1 LTR1B Type of Transposon ID Type of Transposon ID

ERV1 LTR1B1 ERV1 LTR39

ERV1 LTR1C ERV1 LTR4

ERV1 LTR1C2 ERV1 LTR43

ERV1 LTR1D ERV1 LTR43B

ERV1 LTR1E ERV1 LTR44

ERV1 LTR1F ERV1 LTR45

ERV1 LTR2 ERV1 LTR45B

ERV1 LTR21A ERV1 LTR45C

ERV1 LTR21B ERV1 LTR46

ERV1 LTR21C ERV1 LTR48

ERV1 LTR23 ERV1 LTR48B

ERV1 LTR24 ERV1 LTR49

ERV1 LTR24B ERV1 LTR51

ERV1 LTR24C ERV1 LTR56

ERV1 LTR25 ERV1 LTR58

ERV1 LTR26 ERV1 LTR59

ERV1 LTR26E ERV1 LTR60

ERV1 LTR27 ERV1 LTR60B

ERV1 LTR2752 ERV1 LTR61

ERV1 LTR27B ERV1 LTR64

ERV1 LTR27C ERV1 LTR65

ERV1 LTR27D ERV1 LTR6A

ERV1 LTR27E ERV1 LTR6B

ERV1 LTR28 ERV1 LTR70

ERV1 LTR28B ERV1 LTR71A

ERV1 LTR28C ERV1 LTR71B

ERV1 LTR29 ERV1 LTR72

ERV1 LTR2B ERV1 LTR72B

ERV1 LTR2C ERV1 LTR73

ERV1 LTR30 ERV1 LTR76

ERV1 LTR31 ERV1 LTR77

ERV1 LTR34 ERV1 LTR78B

ERV1 LTR35 ERV1 LTR8

ERV1 LTR35B ERV1 LTR81AB

ERV1 LTR36 ERV1 LTR8A

ERV1 LTR37A ERV1 LTR8B

ERV1 LTR37B ERV1 LTR9

ERV1 LTR38 ERV1 LTR9A1

ERV1 LTR38A1 ERV1 LTR9B

ERV1 LTR38B ERV1 LTR9C

ERV1 LTR38C ERV1 LTR9D Type of Transposon ID Type of Transposon ID

ERV1 MER101 ERV1 MER57A1

ERV1 MER101B ERV1 MER57B2

ERV1 MER110 ERV1 MER57F

ERV1 MER110A ERV1 MER61B

ERV1 MER110I ERV1 MER61C

ERV1 MER21I ERV1 MER65B

ERV1 MER31B ERV1 MER65C

ERV1 MER34 ERV1 MER65D

ERV1 MER34B ERV1 MER66_I

ERV1 MER34C ERV1 MER66A

ERV1 MER34C2 ERV1 MER66B

ERV1 MER39 ERV1 MER66C

ERV1 MER39B ERV1 MER66D

ERV1 MER41A ERV1 MER67A

ERV1 MER41B ERV1 MER67B

ERV1 MER41C ERV1 MER67C

ERV1 MER41D ERV1 MER67D

ERV1 MER41G ERV1 MER72

ERV1 MER48 ERV1 MER72B

ERV1 MER49 ERV1 MER83

ERV1 MER4A ERV1 MER83AI

ERV1 MER4A1 ERV1 MER83B

ERV1 MER4B ERV1 MER83BI

ERV1 MER4C ERV1 MER83C

ERV1 MER4CL34 ERV1 MER84

ERV1 MER4D ERV1 MER87

ERV1 MER4D1 ERV1 MER87B

ERV1 MER4E ERV1 MER89

ERV1 MER4E1 ERV1 MER89I

ERV1 MER50 ERV1 MER90

ERV1 MER50B ERV1 MER92A

ERV1 MER50I ERV1 MER92B

ERV1 MER51A ERV1 PABL_A

ERV1 MER51B ERV1 PABL_AI

ERV1 MER51C ERV1 PABL_B

ERV1 MER51D ERV1 PABL_BI

ERV1 MER51E ERV1 PRIMA4_LTR

ERV1 MER52A ERV1 PrimLTR79

ERV1 MER52AI ERV2 HERVK11DI

ERV1 MER52C ERV2 HERVK11I

ERV1 MER52D ERV2 HERVK13I Type of Transposon ID Type of Transposon ID

ERV2 HERVK3I ERV3 LTR19B

ERV2 HERVK9I ERV3 LTR19C

ERV2 LTR 13 ERV3 LTR32

ERV2 LTR13A ERV3 LTR40A

ERV2 LTR 14 ERV3 LTR40B

ERV2 LTR14A ERV3 LTR40C

ERV2 LTR14B ERV3 LTR41

ERV2 LTR14C ERV3 LTR41B

ERV2 LTR22A ERV3 LTR41C

ERV2 LTR22B ERV3 LTR42

ERV2 LTR22B1 ERV3 LTR47A

ERV2 LTR22B2 ERV3 LTR47A2

ERV2 LTR22C2 ERV3 LTR47B

ERV2 LTR22E ERV3 LTR47B2

ERV2 LTR3 ERV3 LTR50

ERV2 LTR3B ERV3 LTR52

ERV2 LTR5 ERV3 LTR53

ERV2 LTR5B ERV3 LTR53B

ERV2 MER11A ERV3 LTR55

ERV2 MER11C ERV3 LTR57

ERV2 MER11D ERV3 LTR62

ERV2 MER9 ERV3 LTR66

ERV2 MER9B ERV3 LTR69

ERV2 RLTR10B ERV3 LTR75

ERV2 RLTR10C ERV3 LTR75B

ERV3 ERV3-16A3_I ERV3 LTR77B

ERV3 ERV3-16A3_LTR ERV3 LTR7A

ERV3 ERVL ERV3 LTR7B

ERV3 HERV16 ERV3 LTR7C

ERV3 HERVL ERV3 MER21

ERV3 HERVL74 ERV3 MER21A

ERV3 LTR 16 ERV3 MER54_EC

ERV3 LTR16A1 ERV3 MER54A

ERV3 LTR16A2 ERV3 MER54B

ERV3 LTR16C ERV3 MER68B

ERV3 LTR16D ERV3 MER68C

ERV3 LTR16E ERV3 MER70A

ERV3 LTR18A ERV3 MER70B

ERV3 LTR18B ERV3 MER70C

ERV3 LTR18C ERV3 MER73

ERV3 LTR19A ERV3 MER74B Type of Transposon ID Type of Transposon ID

ERV3 MER74C hAT MER103C

ERV3 MER76 hAT MER106

ERV3 MER77 hAT MER106B

ERV3 MER88 hAT MER107

ERV3 MLT1G hAT MER112

ERV3 MLT1G1 hAT MER113

ERV3 MLT1G2 hAT MER113B

ERV3 MLT1G3 hAT MER117

ERV3 MLT1H hAT MER119

ERV3 MLT1H1 hAT MER1A

ERV3 MLT1H2 hAT MER1B

ERV3 MLT1I hAT MER20

ERV3 MLT1K hAT MER20B

ERV3 MLT1L hAT MER30B

ERV3 MLT1N2 hAT MER33

ERV3 MLT2A1 hAT MER45

ERV3 MLT2A2 hAT MER45C

ERV3 MLT2C2 hAT MER5B

ERV3 MLT2D hAT MER63D

ERV3 MSTB hAT MER80B

ERV3 MSTD hAT MER81

ERV3 RMER10B hAT MER94

ERV3 THE1A hAT MER94B

ERV3 THE1C hAT MER96

ERV3 THE ID hAT MER96B hAT CHARLIE 10 hAT MER97A hAT CHARLIE2A hAT MER97B hAT CHARLIE2B hAT MER97C hAT CHARLIE3 L1 HAL IB hAT CHARLIE5 L1 IN25 hAT CHARLIE6 L1 LI hAT CHARLIE7 L1 L1HS hAT CHARLIE8 L1 L1M1B_5 hAT CHARLIE9 L1 L1M2_5 hAT CHESHIRE L1 L1M2A_5 hAT CHESHIRE_A L1 L1M2A1_5 hAT CHESHIRE_B L1 L1M2B_5 hAT FORDPREFECT L1 L1M2C_5

FORDPREFECT_ L1 L1M3B_5 hAT A L1 L1M3C_5 hAT MER103B L1 L1M4B Type of Transposon ID Type of Transposon ID

L1 LlM6B_5end L1 L1PA12

L1 L1MA1 L1 L1PA12_5

L1 L1MA2 L1 L1PA13

L1 L1MA3 L1 L1PA13_5

L1 L1MA4 L1 L1PA14

L1 L1MA4A L1 L1PA14_5

L1 L1MA5 L1 L1PA15

L1 L1MA5A L1 L1PA16

L1 L1MA6 L1 L1PA16_5

L1 L1MA7 L1 L1PA17_5

L1 L1MA8 L1 L1PA2

L1 L1MA9 L1 L1PA3

L1 L1MB1 L1 L1PA4

L1 L1MB2 L1 L1PA5

L1 L1MB3 L1 L1PA6

L1 L1MB3_5 L1 L1PA7

L1 L1MB4 L1 L1PA7_5

L1 L1MB5 L1 L1PA8

L1 L1MB8 L1 L1PB1

L1 L1MC1 L1 L1PB2

L1 L1MC2 L1 LlPB2c

L1 L1MC4 L1 L1PB3

L1 L1MCA_5 L1 L1PB4

L1 L1MCB_5 L1 L1PBA_5

L1 L1MCC_5 L1 L1PBA1_5

L1 L1MD1 L1 L1PBB_5

L1 L1MD2 L1 L1PREC1

L1 L1MD3 L1 L1PREC2

L1 L1MDB_5 LTR Retrotransposon HARLEQUINLTR

L1 L1ME_0RF2 LTR Retrotransposon HERV-K14CI

L1 L1ME1 LTR Retrotransposon HERV-K14I

L1 L1ME2 LTR Retrotransposon HUERS-P3

L1 L1ME3 LTR Retrotransposon LOR1

L1 L1ME3A LTR Retrotransposon LTR 11

L1 L1ME4A LTR Retrotransposon MER4I

L1 L1MEA_5 LTR Retrotransposon MER51I

L1 L1MEB_5 LTR Retrotransposon MER52B

L1 L1MED_5 LTR Retrotransposon MER61D

L1 L1MEE_5 LTR Retrotransposon MER61E

L1 L1PA10 LTR Retrotransposon MER61F

L1 L1PA11 LTR Retrotransposon MER61I Type of Transposon ID

LTR Retrotransposon MER95

LTR Retrotransposon PTR5

LTR Retrotransposon THE1_I ariner/Tc1 GOLEM_A ariner/Tc1 GOLEM_C ariner/Tc1 HSMAR1 ariner/Tc1 HSMAR2

Mariner/Tc1 HSTC2 ariner/Tc1 KANGA2_A ariner Tc1 MADE1

Mariner/Tc1 MARINER 1 _EC ariner/Tc1 MARNA

Mariner/Tc1 MER44A

Mariner/Tc1 MER44B ariner/Tc1 MER44C

Mariner/Tc1 MER6B ariner/Tc1 MER8 ariner Tc1 TIGGER1 ariner/Tc1 TIGGER2 ariner/Tc1 TIGGER5

Mariner/Tc1 TIGGER6B ariner/Tc1 TIGGER7 ariner Tc1 TIGGER8 ariner/Tc1 TIGGER9 ariner/Tc1 ZOMBI_A

Merlin Merlinl_HS

SINE SVA

SINE1 /7SL AluYa5

SINE1 /7SL AluYb8

SINE1 /7SL AluYb9

SINE1 /7SL AluYkl3

SINE3/5S AmnSINEl_HS

Transposable Element MER54

Transposable Element TARE Table 6 Satellite correlated genes. Adapted from Ting et al.(Ting et al., 2011)

Gene Names Gene Names Gene Names

A2ML1 DCHS2 KIAA1245

ABCA9 DDO KIAA1257

ACADSB DHRS4L2 KIAA1328

ACBD7 DKFZP434L187 KIR3DX1

ADAMTSL3 DKFZP779L1853 LEPRE1

ALG11 DNAH5 LOC147804

ANGEL2 DNAH8 LOC349196

ANKRD20A1 DSG3 LOC440313

API S3 DUSP19 LOC441242

APOL4 DZIP3 LOC441426

APOL6 EEF2K LOC642980

ATP10B F2RL3 LOC643406

BNC1 FAMl l lB LOC649305

C110RF72 FAM122C LOC91948

C110RF74 FAM22G LRRC2

C120RF5 FAM75A2 LTV1

C130RF29 FAM83D LYRM2

C150RF2 FAT3 LYRM7

C150RF28 FBX015 MCFD2

C170RF77 FBXW10 MED 18

C1ORF130 FCF1 MORC4

C10RF69 FER MSH5

C10RF84 FGF5 MTBP

C210RF82 FLJ 11292 MX2

C3ORF20 FLJ41649 MYH1

C6ORF170 FLJ43763 MY03B

C70RF44 FUT1 MYOM3

C70RF46 GALNT13 NBPF1

C80RF12 GBP4 NEB

C90RF68 GK5 NHEDC1

CAGE1 GLIPR1L2 NIPSNAP3B

CCBP2 GPR110 NME7

CCDC122 GPR157 NMNAT1

CCDC52 GTPBP10 NUP43

CD3EAP GTSE1 ODF2L

CDON GUSBP1 OR11H1

CENPM HERC4 OR11H12

CES3 HESRG OR4F16

CES7 HIF3A OR4K15

CHRM5 HMGA2 OR7D2

CLCC1 HRH4 OR7E156P

COX 18 HUNK ORC6L

CPM HYDIN PCBD2

CPSF2 IL12RB1 PDDC1

CYP46A1 IP09 PGPEP1

DBF4B KCTD18 PHACTR4 Gene Names Gene Names Gene Names

PHTF1 ZNF431 BIRC4BP

PLA2G2D ZNF445 AK054836

PLEKHA5 ZNF471 AX747417

PRKRIR ZNF480 AY314745

PRND ZNF490 NR 001318

PXMP4 ZNF492 AX747586

QTRTD1 ZNF493 AK125128

RASGRP3 ZNF528 AK055694

REX01L1 ZNF562 BC035084

RGR ZNF621 WUGSC:H DJ0855D2

RNF125 ZNF623 1.2

SIGLEC10 ZNF667 CR596262

SIGLEC8 ZNF670 AX746734

SIRPB1 ZNF7 AK024378

SLC13A2 ZNF720 BC037952

SLC14A2 ZNF804B BC041998

SLC16A12 BC029464 BC008050

SLC19A3 BC082237 NR 003133

SLC1A6 BC050580 AX748369

SLC27A1 BC039319 BC043541

SLC31A1 AK096834 AK131347

SMU1 BC042893 FLJ00140

SP100 BC043508 CR620525

STRC HBET1 AX748243

STX17 NR 003246 AX747639

TAOK1 LOC643079 AX746484

TCL6 BC040190 CR605783

TEX9 AK095450 AK097143

TGFB2 BC036442 BC052952

TIGD1 DKFZP761G18121 AK124179

TNFRSF19 AK092337 FLJ 16008

TRIM43 IAA0379 BC073807

TRPM3 FLJ44076 BC015784

TTN AX748237 CR592225

ULBP1 AX747345 BC031280

USPL1 AX747165 DKFZP686F19123

UTP14C CR627148 AX747440

WDR17 UNQ2963 AK096469

WDR31 DKFZP667M2411 AK124893

XKR9 AK125319 AX747721

XRCC2 AK 125996 AK123584

ZFYVE20 AK026805 NR 003263

ZMYM1 AK 129982 DKFZP762C213

ZMYND17 CR592614 BC094791

ZNF100 AK095077 CR627394

ZNF192 BC035989 AK124673

ZNF208 CR623134 NR 002910

ZNF273 AK026100 FRABIN

ZNF320 RP1-140A9.6 BC069727

ZNF331 AX747405 BC037884

ZNF37A NR 002828 BX648696

ZNF383 NR 003130 CR627383 Gene Names Gene Names Gene Names

BC034569 UNQ9369 LOC441282

AX747308 PFDN6L BOZF1

AK123585 AK 125042 AK026825

BC011779 AK 125489 AK128305

DKFZP686H1615 BC013681 AL713649

BC070093 AK056866 DQ573949

BX537874 AX747590 AK091996

AX748226 AX746620 CR606964

CR598144 FLJ00310 HSKRP1

BC040189 NM 001042703 AX747556

AL832479 AK094618 NR 003266

NR 002939 AX748002 CR749689

AL833449 BC041646 BC049371

BC047600 AJ617629 AX747988

KIAA1031 AL833139 FLJ35848

AK095766 AK097428 WHDC1L1

AL832786 AK056105 AK126491

BC035181 MGC 13098 AK024841

NR 002220 AK127557 AX746688

DQ596646 KIAA1456 FLJ37357

NM 001001704 BC069809 FLJ44955

AL832797 LOC441108 BC040631

AK 129672 NM 001039909 CR62 135

AK123838 AK096291 DKFZP451M2119

AX746771 BX537710 CR627206

C20ORF38 BC041449 AK127460

AX746989 NR 002836 BC019672

LOC285382 CR598129 HERV-HHHL A 1

MGC 102966 BC035112 FUSION

AK124194 CR613732 AK057632

FLJ45337 DQ597733 FLJ00264

AK 126334 AX747172 NY-REN-7

AK057596 AK 128266 AK125288

NR 003128 TCAM-1 AF086203

AK096077 BC050344 LOC94431

DERP7 BC047380 BC043415

AK098126 AL832439 AK098333

BC033330 BC042121 BC042588

BC029555 BC041426 AX747864

LOCI 29881 C15ORF20 AY314747

AK097527 AK125310 AK128216

BX648961 DKFZP434P055 BC044257

AK096499 KIAA0010 AX747062

AK097777 COX18HS BX649144

AK091028 BC038578 AL137270

FLJ37953 AY314748 PP8961

PTPN1L AK023134 AK056558

AK096196 AK131313 AK094845

AK056351 BC041865 AX747742

AX746750 AX746851 AK095981

LOC440053 LOC606495 CTRP6

BC068605 AK 127238 NR 002821 Gene Names Gene Names Gene Names

AX746880 MBL1P1 LOC339809

AK125817 BC071776 AK128523

AK056417 AK127888 AK094859

AK026469 NR 002943 PJCG6

AK090984 AX747340 AX748371

AK131520 LOC401252 UNQ3037

AL833246 AX746585 AK054880

AK 125832 AK091594 AK094224

BC041455 AK096412 AL833510

AF380582 FLJ34047 KENAE1

AX747658 AX747756 BC012110

AX721193 BC090058 BC052779

BC047626 CR611653 AK097893

FLJ44060 AL137733 BC105727

KIAA0982 BX537706 AK091527

AK093513 NR 001565 WBSCR23

BC038431 MGC4836 BC043378

BX161428 MGC29891 AK056246

DKFZP6860248 AK098240 LOC401898

AK096335 AX748249 AK023856

BX640887 C1ORF140 UNQ1849

BC009626 AK055868 BC048997

AY338954 BC122562 FLJ36492

BC036412 BC041363 KIAA2023

NM 001001681 BC047625 AK054869

AK056892 BC021741 CR749689

DQ573361 AK056524 BC029555

BC041466 BX647358 AK024378

NR_002210 AK023515 NR_002821

FLJ33706 AK125311 DKFZP686F19123

KIAA1767 AK123891

Table 7 Categories of repeated DNA.

Size of

Class Major chromosomal location(s) repeat hypervariable family 9-64 bp All chromosomes, often near telomeres

Microsatellite DNA (blocks often

1-4 bp Dispersed throughout all chromosomes less than 150 bp)

Table 8 Repeated DNA Name of Repeat Name of Repeat elements. The list is (GGAGAA)n >HSATI adapted from Repbase- (GGCA)n >HSATII

(GGCCC)n >LSAU

GIRI.

(GGGA)n >MSR1 http://www.girinst.org/, (GGGAGA)n >REP522 accessed January 31, (GGGGA)n >SAR

2011. (GGGGGA)n >SATR1

(TAA)n >SATR2

Name of Repeat (TAAA)n >SN5

(AC)n (TAAAA)n >SUBTEL_sat

(AG)n (TAAAAA)n >SUBTEL2_sat

(AT)n (TACA)n >SVA2

(C)n (TACAA)n >TAR1

(CAA)n (TAGA)n

(CAAA)n (TAGAA)n

(CAAAA)n (TATACA)n

(CAAAAA)n (TCA)n

(CCA)n (TCAA)n

(CCCCA)n (TCACCA)n

(CCCCAA)n (TCCA)n

(CCCCCA)n (TCCCA)n

(CCCGAA)n (TCTAA)n

(CCCTAA)n (TGAA)n

(CCCTCA)n (TGGAA)n

(CCTA)n (TGGCCC)n

(CG)n (TTAA)n

(CGAA)n (TTAAA)n

(CGGA)n ACROl

(CTA)n ALR

(CTCCA)n ALR_

(GAA)n ALRl

(GAAA)n ALR2

(GAAAA)n ALRa

(GAAAAA)n ALRa_

(GACA)n ALRb

(GAGACA)n BSR

(GCA)n BSRa

(GCC)n >BSRb

(GCCA)n >BSRd

(GCCC)n >BSRf

(GCCCA)n >CER

(GCCCC)n >D20S16

(GCCCCA)n >GGAAT

(GCCCCC)n >GSAT

(GCGCA)n >GSATII

(GCTCA)n >GSATX

(GGA)n >HSAT4

(GGAA)n >HSAT5

(GGAGA)n >HSAT6 Table 9 Examples of non-coding RNAs in nature.

References:

Aitken, C.E., A. Petrov, and J.D. Puglisi. 2010. Single ribosome dynamics and the

mechanism of translation. Annu Rev Biophys. 39:491-513.

Alessi, D.R., L.R. Pearce, and J.M. Garcia-Martinez. 2009. New insights into mTOR

signaling: mTORC2 and beyond. Sci Signal. 2:pe27.

Asch, H.L., E. Eliacin, T.G. Fanning, J.L. Connolly, G. Bratthauer, and B.B. Asch. 1996.

Comparative expression of the LINE-1 p40 protein in human breast carcinomas and normal breast tissues. Oncol Res. 8:239-47.

Bartel, D.P. 2009. MicroRNAs: target recognition and regulatory functions. Cell. 136:215-33. Bergsmedh, A., A. Szeles, M. Henriksson, A. Bratt, M.J. Folkman, A.L. Spetz, and L.

Holmgren. 2001. Horizontal transfer of oncogenes by uptake of apoptotic bodies.

Proc Natl Acad Sci U S A. 98:6407-11.

Cheng, G.Z., S. Park, S. Shu, L. He, W. Kong, W. Zhang, Z. Yuan, L.H. Wang, and J.Q.

Cheng. 2008. Advances of AKT pathway in human oncogenesis and as a target for anti-cancer drug discovery. Curr Cancer Drug Targets. 8:2-6.

Cotton, R.G., N.R. Rodrigues, and R.D. Campbell. 1988. Reactivity of cytosine and thymine in single-base-pair mismatches with hydroxylamine and osmium tetroxide and its application to the study of mutations. Proc Natl Acad Sci U S A. 85:4397-401.

Co well, J.K., and K.C. Lo. 2009. Application of oligonucleotides arrays for coincident

comparative genomic hybridization, ploidy status and loss of heterozygosity studies in human cancers. Methods Mol Biol. 556:47-65.

Cristofanilli, M., and J. Mendelsohn. 2006. Circulating tumor cells in breast cancer:

Advanced tools for "tailored" therapy? Proc Natl Acad Sci U S A. 103:17073-4.

Day, J.R., M. Jost, M.A. Reynolds, J. Groskopf, and H. Rittenhouse. 2011. PC A3: from basic molecular science to the clinical lab. Cancer Lett. 301:1-6.

Dinger, M.E., K.C. Pang, T.R. Mercer, and J.S. Mattick. 2008. Differentiating protein-coding and noncoding RNA: challenges and ambiguities. PLoS Comput Biol. 4:el000176. Dowling, R.J., I. Topisirovic, T. Alain, M. Bidinosti, B.D. Fonseca, E. Petroulakis, X. Wang,

O. Larsson, A. Selvaraj, Y. Liu, S.C. Kozma, G. Thomas, and N. Sonenberg.

mTORCl -mediated cell proliferation, but not cell growth, controlled by the 4E-BPs.

Science. 328:1172-6.

Elbashir, S.M., W. Lendeckel, and T. Tuschl. 2001. RNA interference is mediated by 21- and

22-nucleotide RNAs. Genes Dev. 15:188-200.

Ender, C, A. Krek, M.R. Friedlander, M. Beitzinger, L. Weinmann, W. Chen, S. Pfeffer, N.

Rajewsky, and G. Meister. 2008. A human snoRNA with microRNA-like functions.

Mol Cell. 32:519-28.

Feng, J., W.D. Funk, S.S. Wang, S.L. Weinrich, A.A. Avilion, CP. Chiu, R.R. Adams, E.

Chang, R.C. Allsopp, J. Yu, and et al. 1995. The RNA component of human telomerase. Science. 269:1236-41.

Golan, M., A. Hizi, J.H. Resau, N. Yaal-Hahoshen, H. Reichman, I. Keydar, and I. Tsarfaty.

2008. Human endogenous retrovirus (HERV-K) reverse transcriptase as a breast cancer prognostic marker. Neoplasia. 10:521-33.

Goodier, J.L., and H.H. Kazazian, Jr. 2008. Retrotransposons revisited: the restraint and

rehabilitation of parasites. Cell. 135:23-35. Gribaldo, S., and C. Brochier-Armanet. 2006. The origin and evolution of Archaea: a state of the art. Philos Trans R Soc Lond B Biol Sci. 361:1007-22.

Guatelli, J.C., K.M. Whitfield, D.Y. Kwoh, K.J. Barringer, D.D. Richman, and T.R.

Gingeras. 1990. Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc Natl Acad Sci U SA. 87:1874-8.

Guerrier-Takada, C, K. Gardiner, T. Marsh, N. Pace, and S. Altman. 1983. The RNA moiety of ribonuclease P is the catalytic subunit of the enzyme. Cell. 35:849-57.

Gupta, R.A., N. Shah, K.C. Wang, J. Kim, H.M. Horlings, D.J. Wong, M.C. Tsai, T. Hung, P.

Argani, J.L. Rinn, Y. Wang, P. Brzoska, B. Kong, R. Li, R.B. West, M.J. van de Vijver, S. Sukumar, and H.Y. Chang. 2010. Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis. Nature. 464:1071-6.

Hahn, P.J. 1993. Molecular biology of double-minute chromosomes. Bioessays. 15:477-84.

Halicka, H.D., E. Bedner, and Z. Darzynkiewicz. 2000. Segregation of RNA and separate packaging of DNA and RNA in apoptotic bodies during apoptosis. Exp Cell Res. 260:248-56.

Hanahan, D., and R.A. Weinberg. 2000. The hallmarks of cancer. Cell. 100:57-70.

Hildebrandt, M.A., H. Yang, M.C. Hung, J.G. Izzo, M. Huang, J. Lin, J.A. Ajani, and X. Wu.

2009. Genetic variations in the PI3K/PTEN/AKT/mTOR pathway are associated with clinical outcomes in esophageal cancer patients treated with chemoradiotherapy. J

Clin Oncol. 27:857-71.

Jarrous, N., and R. Reiner. 2007. Human RNase P: a tRNA-processing enzyme and

transcription factor. Nucleic Acids Res. 35:3519-24.

Jemal, A., R. Siegel, E. Ward, Y. Hao, J. Xu, T. Murray, and M.J. Thun. 2008. Cancer

statistics, 2008. CA Cancer J Clin. 58:71-96.

Ji, P., S. Diederichs, W. Wang, S. Boing, R. Metzger, P.M. Schneider, N. Tidow, B. Brandt,

H. Buerger, E. Bulk, M. Thomas, W.E. Berdel, H. Serve, and C. Muller-Tidow. 2003.

MALAT-1, a novel noncoding RNA, and thymosin beta4 predict metastasis and survival in early-stage non-small cell lung cancer. Oncogene. 22:8031-41.

Kapranov, P., J. Cheng, S. Dike, D.A. Nix, R. Duttagupta, A.T. Willingham, P.F. Stadler, J.

Hertel, J. Hackermuller, I.L. Hofacker, I. Bell, E. Cheung, J. Drenkow, E. Dumais, S.

Patel, G. Helt, M. Ganesh, S. Ghosh, A. Piccolboni, V. Sementchenko, H. Tammana, and T.R. Gingeras. 2007. RNA maps reveal new RNA classes and a possible function for pervasive transcription. Science. 316:1484-8.

Katayama, S., Y. Tomaru, T. Kasukawa, K. Waki, M. Nakanishi, M. Nakamura, H. Nishida,

C.C. Yap, M. Suzuki, J. Kawai, H. Suzuki, P. Carninci, Y. Hayashizaki, C. Wells, M.

Frith, T. Ravasi, K.C. Pang, J. Hallinan, J. Mattick, D.A. Hume, L. Lipovich, S.

Batalov, P.G. Engstrom, Y. Mizuno, M.A. Faghihi, A. Sandelin, A.M. Chalk, S.

Mottagui-Tabar, Z. Liang, B. Lenhard, and C. Wahlestedt. 2005. Antisense transcription in the mammalian transcriptome. Science. 309:1564-6.

Kiss, T. 2002. Small nucleolar RNAs: an abundant group of noncoding RNAs with diverse cellular functions. Cell. 109:145-8.

Klemke, R.L., S. Cai, A.L. Giannini, P.J. Gallagher, P. de Lanerolle, and D.A. Cheresh. 1997.

Regulation of cell motility by mitogen- activated protein kinase. J Cell Biol. 137:481-

92.

Kwoh, D.Y., G.R. Davis, K.M. Whitfield, H.L. Chappelle, L.J. DiMichele, and T.R.

Gingeras. 1989. Transcription-based amplification system and detection of amplified human immunodeficiency virus type 1 with a bead-based sandwich hybridization format. Proc Natl Acad Sci U S A. 86:1173-7.

Lakkaraju, A., and E. Rodriguez-Boulan. 2008. Itinerant exosomes: emerging roles in cell and tissue polarity. Trends Cell Biol. 18:199-209. Lerner, M.R., J.A. Boyle, J.A. Hardin, and J. A. Steitz. 1981. Two novel classes of small ribonucleoproteins detected by antibodies associated with lupus erythematosus.

Science. 211:400-2.

Li, J., L. Wang, H. Mamon, M.H. Kulke, R. Berbeco, and G.M. Makrigiorgos. 2008.

Replacing PCR with COLD-PCR enriches variant DNA sequences and redefines the sensitivity of genetic testing. Nat Med. 14:579-84.

Li, X., D.N. Frank, N. Pace, J.M. Zengel, and L. Lindahl. 2002. Phylogenetic analysis of the structure of RNase MRP RNA in yeasts. RNA. 8:740-51.

Lipson, D., T. Raz, A. Kieu, D.R. Jones, E. Giladi, E. Thayer, J.F. Thompson, S. Letovsky, P.

Milos, and M. Causey. 2009. Quantification of the yeast transcriptome by single- molecule sequencing. Nat Biotechnol. 27:652-8.

Lower, R., J. Lower, and R. Kurth. 1996. The viruses in all of us: characteristics and

biological significance of human endogenous retrovirus sequences. Proc Natl Acad

Sci U SA. 93:5177-84.

Mariner, P.D., R.D. Walters, C.A. Espinoza, L.F. Drullinger, S.D. Wagner, J.F. Kugel, and J.A. Goodrich. 2008. Human Alu RNA is a modular transacting repressor of mRNA transcription during heat shock. Mol Cell. 29:499-509.

Mattick, J.S. 2004. RNA regulation: a new genetics? Nat Rev Genet. 5:316-23.

Maxam, A.M., and W. Gilbert. 1977. A new method for sequencing DNA. Proc Natl Acad Sci U SA. 74:560-4.

Miele, E.A., D.R. Mills, and F.R. Kramer. 1983. Autocatalytic replication of a recombinant

RNA. / Mol Biol. 171:281-95.

Miranda, K.C., D.T. Bond, M. McKee, J. Skog, T.G. Paunescu, N. Da Silva, D. Brown, and

L.M. Russo. 2010. Nucleic acids within urinary exosomes/microvesicles are potential biomarkers for renal disease. Kidney Int. 78:191-9.

Myers, R.M., Z. Larin, and T. Maniatis. 1985. Detection of single base substitutions by

ribonuclease cleavage at mismatches in RNA:DNA duplexes. Science. 230:1242-6. Ng, K., D. Pullirsch, M. Leeb, and A. Wutz. 2007. Xist and the order of silencing. EMBO

Rep. 8:34-9.

Nilsson, J., J. Skog, A. Nordstrand, V. Baranov, L. Mincheva-Nilsson, X.O. Breakefield, and

A. Widmark. 2009. Prostate cancer-derived urine exosomes: a novel approach to biomarkers for prostate cancer. Br J Cancer. 100:1603-7.

Orita, M., H. Iwahana, H. Kanazawa, K. Hayashi, and T. Sekiya. 1989. Detection of

polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci U S A. 86:2766-70.

Orozco, A.F., and D.E. Lewis. 2010. Flow cytometric analysis of circulating microparticles in plasma. Cytometry A. 77:502-14.

Pelloski, C.E., K.V. Ballman, A.F. Furth, L. Zhang, E. Lin, E.P. Sulman, K. Bhat, J.M.

McDonald, W.K. Yung, H. Colman, S.Y. Woo, A.B. Heimberger, D. Suki, M.D.

Prados, S.M. Chang, F.G. Barker, 2nd, J.C. Buckner, CD. James, and K. Aldape.

2007. Epidermal growth factor receptor variant III status defines clinically distinct subtypes of glioblastoma. J Clin Oncol. 25:2288-94.

Rinn, J.L., M. Kertesz, J.K. Wang, S.L. Squazzo, X. Xu, S.A. Brugmann, L.H. Goodnough,

J.A. Helms, P.J. Farnham, E. Segal, and H.Y. Chang. 2007. Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs. Cell.

129:1311-23.

Sanger, F., S. Nicklen, and A.R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc Natl Acad Sci U S A. 74:5463-7. Sarbassov, D.D., S.M. Ali, S. Sengupta, J.H. Sheen, P.P. Hsu, A.F. Bagley, A.L. Markhard, and D.M. Sabatini. 2006. Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell. 22:159-68.

Simons, M., and G. Raposo. 2009. Exosomes— vesicular carriers for intercellular

communication. Curr Opin Cell Biol. 21:575-81.

Sliva, K., and B.S. Schnierle. Selective gene silencing by viral delivery of short hairpin RNA.

Virol J. 7:248.

Srikantan, V., Z. Zou, G. Petrovics, L. Xu, M. Augustus, L. Davis, J.R. Livezey, T. Connell, LA. Sesterhenn, K. Yoshino, G.S. Buzard, F.K. Mostofi, D.G. McLeod, J.W. Moul, and S. Srivastava. 2000. PCGEM1, a prostate-specific gene, is overexpressed in prostate cancer. Proc Natl Acad Sci U S A. 97:12216-21.

Steemers, F.J., W. Chang, G. Lee, D.L. Barker, R. Shen, and K.L. Gunderson. 2006. Whole- genome genotyping with the single-base extension assay. Nat Methods. 3:31-3.

Storey, J.D., and R. Tibshirani. 2003. Statistical methods for identifying differentially

expressed genes in DNA microarrays. Methods Mol Biol. 224:149-57.

Taft, R.J., K.C. Pang, T.R. Mercer, M. Dinger, and J.S. Mattick. 2010. Non-coding RNAs: regulators of disease. J Pathol. 220:126-39.

Tez, S., A. Koktener, G. Guler, and P. Ozisik. 2008. Atypical teratoid/rhabdoid tumors:

imaging findings of two cases and review of the literature. Turk Neurosurg. 18:30-4.

Ting, D.T., D. Lipson, S. Paul, B.W. Brannigan, S. Akhavanfard, E.J. Coffman, G. Contino, V. Deshpande, A.J. Iafrate, S. Letovsky, M.N. Rivera, N. Bardeesy, S. Maheswaran, and D.A. Haber. 2011. Aberrant overexpression of satellite repeats in pancreatic and other epithelial cancers. Science. 331:593-6.

Valadkhan, S. 2010. Role of the snRNAs in spliceosomal active site. RNA Biol. 7:345-53.

Velculescu, V.E., L. Zhang, B. Vogelstein, and K.W. Kinzler. 1995. Serial analysis of gene expression. Science. 270:484-7.

Voisset, C, R.A. Weiss, and D.J. Griffiths. 2008. Human RNA "rumor" viruses: the search for novel human retroviruses in chronic disease. Microbiol Mol Biol Rev. 72:157-96, table of contents.