Canonical and Strain-Specific SNP Genotyping of Bacillus Anthracis

Cross Reference

This application claims priority to U.S. Provisional Patent Application Serial No.60/708,869, filed August 17, 2005, which is incorporated by reference herein in its entirety.

Statement of Government Interest

Financial assistance for this project was provided by U.S. Government, Department of Justice (FBI) #JFBI02015; thus, the United States Government may have certain rights in this invention.

Background

The 2001 anthrax letter attacks resulted in five fatalities, cost several billion dollars to the US economy, and illustrated the practical efficacy of this pathogen (Bacillus anthracis) as a bioterrorism agent. Routine monitoring and genetic testing of environmental samples for B. anthracis nucleic acids is critical for early detection and response in the event of a bioterrorist attack and for subsequent forensic investigations. Yet, molecular detection of B. anthracis in the environment is particularly challenging since samples may contain complex mixtures of DNA signatures, including genetically similar innocuous organisms. In particular, the genetic similarity of B. anthracis to other common spore-forming soil bacteria, such as B. cereus and B. thuringiensis, has presented challenges to identifying B. anthracis-specific chromosomal targets (1).

Precise identification of Bacillus anthracis isolates has aided forensic and epidemiological analyses of natural anthrax cases, bioterrorism acts and industrial scale accidents by state-sponsored bioweapons programs. Because there is little molecular variation among B. anthracis isolates, identifying and using rare variation is crucial for precise strain identification. While single nucleotide polymorphisms (SNPs) occur at very low frequencies in the B. anthracis genome they can be discovered using intensive sampling methods. In comparison to other genetic markers, SNPs are exceedingly rare among even distantly related B. anthracis isolates and, therefore, would seem to have limited subtyping capacity.

the art for improved compositions for use in detecting Bacillus anthracis and in distinguishing among different isolates of Bacillus anthracis.

Summary of the Invention The present invention provides compositions and methods for using the compositions to detect Bacillus anthracis and/or to distinguish between different Bacillus anthracis isolates in a test sample.

In a first aspect, the present invention provides compositions comprising one or more purified polynucleotide probes consisting of a nucleic acid selected from the group consisting of Ames SNP2 (ASpX02), Ames SNP3 (Brl_7), Ames SNP4 (Brl_26), Ames SNP5 (Ames Brl_28), and Ames SNP6 (Brl_31), or complements thereof.

In a further aspect, the present invention provides compositions comprising one or more purified polynucleotide primers selected from the group consisting of Ames SNP2 primer 1, Ames SNP2 primer 2, Ames SNP3 primer 1, Ames SNP3 primer 2, Ames SNP4 primer 1, Ames SNP4 primer 2, Ames SNP5 primer 1, Ames SNP5 primer 2, Ames SNP6 primer 1, and Ames SNP6 primer 2, or complements thereof.

In a further aspect, the present invention provides compositions comprising one or more purified polynucleotide probes consisting of a nucleic acid according to the general formula: X1-Z20-X3 (SEQ ID NO: 15); wherein Z20 is CAAAG(C/T)GCTT(A/C)TTCGTATT (SEQ ID NO: 20), or complements thereof; wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to the SNP sequence shown in Figure 15, or its complement, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to the SNP sequence shown in Figure 15, or its complement.

In a further aspect, the present invention provides compositions comprising one or more purified polynucleotides primers consisting of a nucleic acid selected from the group consisting:

X1-TGAAGGTGAGACATAATC-X3 (SEQ ID NO: 15), or its complement and X1-TTTGCATGACAAAGCGCTAA-X3 (SEQ ID NO: 15), or its complement; wherein Xl is 0 to all of the nucleotides 5'- to the SNP sequence shown in Figure 15, or its complement, and wherein X3 is independently between 0 to all of the nucleotides of the sequence 3'- to the SNP sequence shown in Figure 15, or its complement.

In another aspect, the present invention provides compositions comprising one or more purified polynucleotide probes selected from the group consisting of Branch 1 probe,

BrMcH' S" ^l jpfδbe,"gi ¹ 'anc'h'l3'"pfόbe, Branch 4 probe, Branch 6 probe, Branch 6.2 probe, Branch 7 probe, Branch 8 probe, Branch 9 probe, Branch 10 probe, Branch 11 probe, and Branch 12 probe, or complements thereof.

In a further aspect, the present invention provides compositions comprising one or more purified polynucleotide primers consisting of a nucleic acid selected from the group consisting of Branch 1 Al primer, Branch 1 A2 primer, Branch 2 Bl primer, Branch 2 B2 primer, Branch 3 Cl primer, Branch 3 C2 primer, Branch 4 Dl primer, Branch 4 D2 primer, Branch 6 El primer, Branch 6 E2 primer, Branch 6.2 Fl primer, Branch 6.2 F2 primer, Branch 7 Gl primer, Branch 7 G2 primer, Branch 8 Hl primer, Branch 8 H2 primer, Branch 9 11 primer, Branch 912 primer, Branch 10 Jl primer, Branch 10 J2 primer, Branch 11 Kl primer, Branch 11 K2 primer, Branch 12 Ll primer, and Branch 12 k2 primer.

In another aspect, the present invention provides recombinant vectors comprising the polynucleotide probes or primers of the invention, as well as recombinant host cells comprising such recombinant vectors. In another aspect, the present invention comprises solid supports comprising a surface on which are arrays of the purified polynucleotide probe or primers of one or more of the aspects of the invention.

In a further embodiment, the present invention provides methods for detecting the presence of Bacillus anthracis in a test sample, comprising screening the test sample for the presence of a nucleic acid comprising the nucleotide sequence

AATACGAATAAGCGCTTTG (SEQ ID NO: 97) or its complement, wherein the presence in the test sample of the nucleotide sequence correlates with presence of Bacillus anthracis in the test sample.

In a further aspect, the present invention provides methods for detecting the presence of Bacillus anthracis in a test sample, comprising screening a test sample for the presence of one or more SNP selected from the group consisting of Ames SNP2 (ASpX02), Ames SNP3 (Brl_7), Ames SNP4 (Brl_26), Ames SNP5 (Ames Brl_28), and Ames SNP6 (Brl_31), or their complements, wherein the presence in the test sample of the one or more SNPs correlates with presence of a. Bacillus anthracis Ames isolate in the test sample. In a further aspect, the present invention provides methods for detection of specific

Bacillus anthracis isolates, comprising screening a test sample for the presence of one or more nucleic acids comprising a nucleotide sequence selected from the group consisting of Branch 1 probe, Branch 2 probe, Branch 3 probe, Branch 4 probe, Branch 6 probe, Branch 6.2 probe, Branch 7 probe, Branch 8 probe, Branch 9 probe, Branch 10 probe, Branch 11

prdbefaήd ftϊϊncn ¹ l'2fϊόβe ''"wherein the presence in the test sample of the nucleotide sequence correlates with presence of a specific Bacillus anthracis isolate in the test sample.

Brief Description of the Figures Figure 1 provides the sequence of the Branch 1 SNP and surrounding sequences (SEQ ID

NO: 1).

Figure 2 provides the sequence of the Branch 2 SNP and surrounding sequences (SEQ ID

NO: 2).

Figure 3 provides the sequence of the Branch 3 SNP and surrounding sequences (SEQ ID NO: 3).

Figure 4 provides the sequence of the Branch 4 SNP and surrounding sequences (SEQ ID

NO: 4).

Figure 5 provides the sequence of the Branch 6.2 SNP and surrounding sequences (SEQ ID

NO: 5). Figure 6 provides the sequence of the Branch 6 SNP and surrounding sequences (SEQ ID

NO: 6).

Figure 7 provides the sequence of the Branch 7 SNP and surrounding sequences (SEQ ID

NO: 7).

Figure 8 provides the sequence of the Branch 8 SNP and surrounding sequences (SEQ ID NO: 8).

Figure 9 provides the sequence of the Branch 9 SNP and surrounding sequences (SEQ ID

NO: 9).

Figure 10 provides the sequence of the Branch 10 SNP and surrounding sequences (SEQ ID

NO: 10). Figure 11 provides the sequence of the Branch 11 SNP and surrounding sequences (SEQ ID

NO: 11).

Figure 12 provides the sequence of the Branch 12 SNP and surrounding sequences (SEQ ID

NO: 12).

Figure 13 provides the sequence of Ames SNP2 and surrounding sequences (SEQ ID NO: 13).

Figure 14 provides the sequence of Ames SNP7 and surrounding sequences (SEQ ID NO:

14).

Figure 15 provides the sequence of an Ames isolate diagnostic SNP from the plcR gene and surrounding sequences (SEQ ID NO: 15).

FϊgWe' ¹ 16""fw ¹ bVid^ ¹ th'd's'fe ⁱ e[ύSnce of Ames SNP3 and surrounding sequences (SEQ ID NO: 16).

Figure 17 provides the sequence of Ames SNP4 and surrounding sequences (SEQ ID NO: 17). Figure 18 provides the sequence of Ames SNP5 and surrounding sequences (SEQ ID NO: 18).

Figure 19 provides the sequence of Ames SNP6 and surrounding sequences (SEQ ID NO: 19).

Detailed Description of the Invention

Within this application, unless otherwise stated, the techniques utilized may be found in any of several well-known references such as: Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press), Gene Expression Technology (Methods in Enzymology, Vol. 185, edited by D. Goeddel, 1991. Academic Press, San Diego, CA), "Guide to Protein Purification" in Methods in Enzymology (M.P. Deutshcer, ed., (1990) Academic Press, Inc.); PCi? Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, CA), Culture of Animal Cells: A Manual of Basic Technique, 2 ^nd Ed. (R.I. Freshney. 1987. Liss, Inc. New York, NY), Gene Transfer and Expression Protocols, pp. 109-128, ed. EJ. Murray, The Humana Press Inc., Clifton, NJ.), and the Ambion 1998 Catalog (Ambion, Austin, TX).

The present invention provides compositions and methods for using the compositions to detect Bacillus anthracis and/or to distinguish between different Bacillus anihracis isolates. In a first aspect, the present invention provides compositions useful, for example, in detecting an Ames strain of Bacillus anthracis. In this aspect, the compositions comprise one or more purified polynucleotide probes consisting of a nucleic acid selected from the group consisting of Ames SNP2 (ASpX02), Ames SNP3 (Brl_7), Ames SNP4 (Brl_26), Ames SNP5 (Ames Brl_28), and Ames SNP6 (Brl_31). The nucleic acid sequence of these Ames SNPs is as shown below, and includes the complements of the recited sequences:

Ames SNP2 (ASpXO2): X1-Z2-X3 (SEQ ID NO: 13), wherein Z2 is 5'- AAGGACTCCCT(C/A)TTGGTT-3 ' (SEQ ID NO: 21), wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z2 shown in Figure 13 (or their

complement); tntfWhefelifXS is independently between zero and all of the nucleotides of the sequence 3'- to Z2 shown in Figure 13 (or their complement)

This SNP is diagnostic for Ames, wherein the variable position is "C" (5'- [ATT] AAGGACTCCCTCTTGGTT-3' (SEQ ID NO: 73)(or its complement)) in a non- Ames strain and "A" (5'-AAGGACTCCCTATTGGTT-S' (SEQ ID NO: 21)(or its complement)) in an Ames strain.

Ames SNP3 (Branch IJ): X1-Z3-X3 (SEQ ID NO: 16), wherein Z3 is 5'- CAAACCAATA(C/A)CCCTTT-3 ' (SEQ ID NO: 22) or its complement, and wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z3 shown in Figure 16 (or their complement), and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z3 shown in Figure 16 (or their complement).

This SNP is diagnostic for Ames, wherein the variable position is "C" (5'- CAAACCAATACCCCTTT-3' (SEQ ID NO: 22) (or its complement)) in an Ames strain and "A" (5 '-CAAACCAATAACCCTTT-3 ' (SEQ ID NO:22) (or its complement)) in a non- Ames strain.

Ames SNP4 (Branch 1_26): X1-Z4-X3 (SEQ ID NO: 17), wherein Z4 is 5'- ATAGCTTTTTQYCjrCTATTCC-3' (SEQ ID NO: 23) or its complement, and wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to IA shown in Figure 17 (or their complement), and wherein X3 is independently between zero and all of the nucleotides of the sequence V- Xo TA shown in Figure 17 (or their complement).

This SNP is diagnostic for Ames, wherein the variable position is "T" (5'- ATAGCTTTTTTTCTATTCC-3' (SEQ ID NO: 23) (or its complement)) in an Ames strain and "C" (5'-ATAGCTTTTTCTCTATTCC-S' (SEQ ID NO: 23) (or its complement)) in a non-Ames strain.

Ames SNP5 (Branch 1_28): X1-Z5-X3 (SEQ ID NO: 18), wherein Z5 is 5'- CGTTGTAG(T/G)TATTTTAC-3 ' (SEQ ID NO: 24) or its complement, and wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z5 shown in Figure 18, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z5 shown in Figure 18.

This SNP is diagnostic for Ames, wherein the variable position is "T" (5'- CGTTGTAGTTATTTTAC-3' (SEQ ID NO: 24)(or its complement)) in an Ames strain and "G" (5'-CGTTGTAGGTATTTTAC-S' (SEQ ID NO: 24)(or its complement)) in a non- Ames strain.

Mώ'^ SNfδ'øraiicϊϊ 1_31): X1-Z6-X3 (SEQ ID NO: 19), wherein Z6 is 5'- CGGTTCACATf G/AlGCAT-3 ' (SEQ ID NO: 25) or its complement, wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z6 shown in Figure 19 (or their complement), and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z6 shown in Figure 19 (or their complement).

This SNP is diagnostic for Ames, wherein the variable position is "A" (5'- CGGTTCACATAGCAT-3' (SEQ ID NO: 25)(or its complement)) in an Ames strain and "G" (5'-CGGTTCACATGGCAT-S' (SEQ ID NO: 25)(or its complement)) in a non-Ames strain. Polynucleotide sequences according to this first of the invention are useful, for example, as probes for identifying the Bacillus anthracis Ames strain (and distinguishing it from other Bacillus anthracis strains), as the inventors have identified these sequences as each containing a single nucleotide polymorphism that distinguishes the Bacillus anthracis Ames strain from other Bacillus anthracis strains. The Ames strain is highly virulent and was used in the 2001 anthrax attacks, thus making reagents for its detection of the utmost importance. Reagents that can be used to reliably type different Bacillus anthracis Ames strains are very useful in, for example, diagnostic, epidemiological, and forensic applications, including but not limited to analyses of natural anthrax cases, bioterrorism acts, state- sponsored bioweapons programs, and industrial scale accidents. The compositions of this first aspect can comprise 1, 2, 3, 4, or 5 of the Ames SNPs recited above.

In various embodiments of this first aspect, Xl and X3 for each SNP are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the Xl and X3 sequences disclosed above.

In a second aspect, the present invention provides compositions comprising one or more purified polynucleotides primers for use to, for example, amplify Ames SNP polynucleotides disclosed in the first aspect of the invention. These polynucleotides according to the second aspect of the invention are thus useful, for example, as primers to use in PCR assays to generate a PCR product that contains a single nucleotide polymorphism to identify a Bacillus anthracis Ames isolate, as discussed above and below.

lή'VafiόuS'ibm'b'όαlments, a given primer sequences consist of a nucleotide sequence of 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs either upstream (5') or downstream (3') of the Ames SNPs described in the first aspect of the invention. The sequence of such primers can be readily identified by one of skill in the art based on the teachings herein and the nucleic acid sequences disclosed herein and described above In various embodiments, such primers are selected from the group consisting of the following, or their complements: Exemplary Ames SNP2 (ASpXO2) primer pair: Ames SNP2 Primer 1: Xl-Zl 0-X3 (SEQ ID NO: 13), wherein ZlO is 16-39 contiguous nucleotides of the nucleotide sequence 5'- GTATCCTGAAATATAAAAGTGTAAAAGG

TAAAAAATGGA-3' (SEQ ID NO: 26)(or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to ZlO as shown in Figure 13 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to ZlO up to the SNP sequence as shown in Figure 13 (or their complement); and Ames SNP2 Primer 2: Xl-Zl 1-X3 (SEQ ID NO: 13), wherein Zl 1 is 16-39 contiguous nucleotides of the nucleotide sequence 5'- GATTCTTCAACGCAATATACCCTACTAAA ATTATACTAT-3' (SEQ ID NO: 27) (or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Zl 1 as shown in Figure 13 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Zl 1 up to the SNP sequence as shown in Figure 13 (or their complement).

Exemplary Ames SNP3 (Branch 1_7) primer pair: Ames SNP3 Primer 1 X1-Z12-X3 (SEQ ID NO: 16), wherein Z12 is 16-20 contiguous nucleotides of the nucleotide sequence 5'-TCACCTCAATGACATCGCCA-S' (SEQ ID NO: 28) (or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z12 as shown in Figure 16 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z12 up to the SNP sequence as shown in Figure 16 (or their complement); and

Ames SNP3 Primer 2 X1-Z13-X3 (SEQ ID NO: 16), wherein Z13 is 16-27 contiguous nucleotides of the nucleotide sequence 5'-

TTGTTGTGAAGACGGATAACTTTTATG-S' (SEQ ID NO: 29)(or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Zl 3 as shown in Figure 16 (or their complement), and wherein X3 is between zero and all of the nucleotides

of tM Sέ'φi'dhte 3*- to ¹ 2l3""ujp"to the SNP sequence as shown in Figure 16 (or their complement).

Exemplary Ames SNP4 (Branch 1_26) primer pair: Ames SNP4 Primer 1 X1-Z14-X3 (SEQ ID NO: 17), wherein Z14 is 16-18 contiguous nucleotides of the nucleotide sequence 5'-GACGGGAGCCAACCAGA-S' (SEQ ID NO: 30)(or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z 14 as shown in Figure 17 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z14 up to the SNP sequence as shown in Figure 17 (or their complement); and

Ames SNP4 Primer 2 X1-Z15-X3 (SEQ ID NO: 17), wherein Z15 is 16-26 contiguous nucleotides of the nucleotide sequence 5'-

CCGTTGAATAAGCAGTATGAAATTTC-3' (SEQ ID NO: 31)(or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Zl 5 as shown in Figure 17 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z15 up to the SNP sequence as shown in Figure 17 (or their complement).

Exemplary Ames SNP5 (Branch 1_28) primer pair: Ames SNP5 Primer 1 X1-Z16-X3 (SEQ ID NO: 18), wherein Z16 is 16-27 contiguous nucleotides of the nucleotide sequence 5'-

AATATCTTTCATACAAGGCGCACTACT-3' (SEQ ID NO: 32) (or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Zl 6 as shown in Figure 18 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z16 up to the SNP sequence as shown in Figure 18 (or their complement); and

Ames SNP5 Primer 2 X1-Z17-X3 (SEQ ID NO: 18), wherein Z17 is 16-23 contiguous nucleotides of the nucleotide sequence 5'-CCATAATCGTGCTTGTCCAAATC- 3' (SEQ ID NO: 33)(or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z17 as shown in Figure 18 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Zl 7 up to the SNP sequence as shown in Figure 18 (or their complement).

Exemplary Ames SNP6 (Branch 1_31) primer pair:

Ames SNP6 Primer 1 X1-Z18-X3 (SEQ ID NO: 19), wherein Z18 is 16-24 contiguous nucleotides of the nucleotide sequence 5'-

GAAGAACAAGCGAAAGACGTACCT-3' (SEQ ID NO: 34)(or its complement), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z18 as shown in

Figure 19 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Zl 8 up to the SNP sequence as shown in Figure 19 (or their complement); and

Ames SNP6 Primer 2 X1-Z19-X3 (SEQ ID NO: 19), wherein Z19 is 16-32 contiguous nucleotides of the nucleotide sequence 5'-

GTAGTTCATAACGTTTGAAAAAGTAGGGA

TA-3' (SEQ ID NO: 35)(or its complement), and wherein Xl is between zero and all of _. the nucleotides of the sequence 5'- to Zl 9 as shown in Figure 19 (or their complement), and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Zl 9 up to the SNP sequence as shown in Figure 19 (or their complement).

In various embodiments of this second aspect, Xl and X3 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the Xl and X3 sequences disclosed above.

In various further embodiments, the relevant "Z" group is 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 contiguous nucleotides of the disclosed sequence, hi a further preferred embodiment of this second aspect, the primers are provided in pairs (Ames SNP2 Primers 1 and 2; Ames SNP3 Primers 1 and 2; Ames SNP4 Primers 1 and 2; Ames SNP5 Primers 1 and 2; and/or Ames SNP6 Primers 1 and 2) for use in generating a probe according to the third aspect of the invention, as noted above. The compositions of this aspect of the invention can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the recited primers; it can also include 1, 2, 3, 4, or 5 of the primer pairs disclosed above.

In a third aspect, the present invention provides compositions for distinguishing the anthracis species of Bacillus from other Bacillus species, such as cereus andthuringiensis. According to this third aspect, the compositions comprise one or more purified polynucleotide probes consisting of a nucleic acid according to the general formula:

^■ ""XT-Z20-X3" ^r (SEQ"ϊD"NO: 15), wherein Z20 is 5'- CAAAG(C/T)GCTT(A/C)TTCGTA

TT-3' (SEQ ID NO: 20), or complements thereof; wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to the SNP sequence shown in Figure 15 (or its complement), and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to the SNP sequence shown in Figure 15 (or its complement). Thus, if Xl is 2 nucleotides 5' to the SNP in Figure 15 then Xl would be the 2 nucleotides contiguous X2, or "GA"; if Xl were 3 nucleotides it would be "TGA." Those of skill in the art will clearly recognize the various possible arrangements of other polynucleotides according to the various aspects and embodiments of the invention based on this disclosure. In various embodiments of this third aspect, Xl and X3 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the sequences disclosed above, respectively.

Polynucleotides according to this third aspect of the invention provide species- specific Bacillus probes against the plcR gene, and are useful in the methods of the invention, as discussed below. Reagents that can be used to reliably type Bacillus anthracis are very useful in, for example, diagnostic, epidemiological, and forensic applications, including but not limited to analyses of natural anthrax cases, bioterrorism acts, state-sponsored bioweapons programs, and industrial scale accidents. For example, these polynucleotides can be used to distinguish between Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis as follows: 5'-CAAAGCGCTTATTCGTATT-S' (SEQ ID NO: 98) : Specific for B. anthracis;

5'-CAAAGCGCTTCTTCGTATT-S' (SEQ ID NO: 98): Specific for B. cereus and B. thuringiensis; and

5'-CAAAGTGCTTCTTCGTATT-S' (SEQ ID NO: 99): Useful as a control.

The compositions of this aspect can comprise 1, 2, 3, or 4 of the SNPs recited above.

In a fourth aspect, the present invention provides compositions comprising one or more purified polynucleotides primers consisting of a nucleic acid that can be used to generate amplification products such as the polynucleotide probes according to the third aspect of the invention. In various embodiments, an individual primer consists of a nucleotide sequence at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85,

90; ^u 95';"όf 100 baSd"pSfrs!"έitner upstream (5') or downstream (3') of the SNPs described in the third aspect of the invention (ie: Z20 see Figure 15) In one embodiment, such primers are selected from the group consisting of the following, or their complements:

Xl-TGAAGGTGAGACATAATC-XS (SEQ ID NO: 15) (PlcR.MAMA_F), and Xl-TTTGCATGACAAAGCGCTaA-XS (SEQ ID NO: 15) (PlcR.MAMA_R); wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to the recited sequence (or its complement), and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to the recited sequence up to the SNP sequence as shown in Figure 15 (or its complement).

In various embodiments of this fourth aspect, Xl and X3 are independently 0, 1, 2, 3,

4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,

31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55,

56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the Xl or X3 sequences 5' or 3' of the primer sequence recited above, respectively, as shown in Figure 15, or their complements.

Polynucleotides according to the fourth aspect of the invention are useful, for example, as primers to use in polymerase chain reaction (PCR) assays to generate a PCR product that contains a single nucleotide polymorphism to detect Bacillus anthracis and distinguish between different Bacillus species, as discussed below.

In a fifth aspect, the present invention provide compositions comprising one or more purified polynucleotide probes selected from the group consisting of Branch 1 probe, Branch 2 probe, Branch 3 probe, Branch 4 probe, Branch 6 probe, Branch 6.2 probe, Branch 7 probe, Branch 8 probe, Branch 9 probe, Branch 10 probe, Branch 11 probe, and Branch 12 probe. Polynucleotide sequences according to this fifth aspect of the invention are useful, for example, as probes for identifying various Bacillus anthracis isolates (ie: "branches"), as each probe with a "FAM" label contains an SNP that is diagnostic for a given genetic group of B. anthracis isolates, and each probe with a "VIC" label contains an SNP that is diagnostic for a different genetic group of B. anthracis isolates. Reagents that can be used to reliably type different Bacillus anthracis isolates are very useful in, for example, diagnostic, epidemiological, and forensic applications, including but not limited to analyses of natural anthrax cases, bioterrorism acts, state-sponsored bioweapons programs, and industrial scale accidents.

The''seqϋeiic'e''δT'these various polynucleotide probes is as provided below, and includes the complements to each of the recited probes:

Branch 1: X1-Z30-X3 (SEQ ID NO: 1), wherein Z30 is 5 '-ACCGAAAfC/TYTTGAAGTC- 3', (SEQ ID NO: 36) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z30 shown in Figure 1, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z30 shown in Figure 1. Exemplary Branch 1 polynucleotide probes are:

SNP295-10 494 (BrI C) FAM: 5'-ACCGAAACTTGAAGTC-S' (SEQ ID NO: 107); and

SNP295-10494 (BrI T) VIC: 5'-AAACCGAAATTTGAAGTC-S' (SEQ ID NO: 108).

Branch 2: X1-Z35-X3 (SEQ ID NO: 2), wherein Z35 is 5 '-CGCCCA(G/A)CCTAA-3 ' (SEQ ID NO: 37), wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z35 shown in Figure 2, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z35 shown in Figure 2. Exemplary Branch 2 polynucleotide probes are:

SNP318-06-495(Br2 G) FAM: 5 '-CGCCCAGCCTAA-3 ' (SEQ ID NO: 109); and SNP318-06-495(Br2 A) VIC: 5'-CGCCCAACCTAAA-3' (SEQ ID NO: 110).

Branch 3: X1-Z40-X3 (SEQ ID NO: 3), wherein Z40 is 5' -TACCTC AA(G/A)CTTAATTC- 3' (SEQ ID NO: 38), wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z40 shown in Figure 3, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- toZ40 shown in Figure 3. Exemplary Branch 3 polynucleotide probes are:

SNP269-23-493 (Br3G) FAM: 5' -TACCTC AAGCTTAATTC-3' (SEQ ID NO:

111); and

SNP269-23 -493 (Br3A) VIC: 5' -CTACCTC AAACTTAATTC-3' (SEQ ID NO: 112).

Branch 4: X1-Z45-X3 (SEQ ID NO: 4), wherein Z45 is 5 '-TTGGAATG(CZQCCCTAAT- 3', (SEQ ID NO: 39) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z45 shown in Figure 4, and wherein X3 is independently between zero

and"alT"ό"fth"e nucleosides of ^' the sequence 3'- to Z45 shown in Figure 4. Exemplary Branch 4 polynucleotide probes are:

WNA-959-02-493 (Br4C) FAM: 5'-TTGGAATGCCCCTAAT-S' (SEQ ID NO: 113); and WNA-959-02-493 (Br4T) VIC: 5'-CTTTGGAATGTCCCTAAT-S' (SEQ ID NO:

114).

Branch 6: X1-Z50-X3 (SEQ ID NO: 6), wherein Z50 is 5 '-ATATTAAATAG(C/T)ACA

TATACC-3' (SEQ ID NO: 40), wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z50 shown in Figure 6, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z50 shown in Figure 6.

Exemplary Branch 6 polynucleotide probes are:

SNP295-31 (Br6C) VIC: 5'-ATATTAAATAGCACATATACC-3' (SEQIDNO:

115); and SNP295-31 (Br6T)FAM: 5'-ATATTAAATAGTACATATACCC-3' (SEQID

NO: 116).

Branch 6.2: X1-Z55-X3 (SEQ ID NO: 5), wherein Z55 is 5'-CATCGCCT(C/A)GTGC-3'

(SEQ ID NO: 41), wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z55 shown in Figure 5, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z55 shown in Figure 5. Exemplary Branch

6.2 polynucleotide probes are:

SNP FB1084-1 (Br6.2C) VIC 5'-CATCGCCTCGTGCA-3' (SEQ ID NO:

117); and SNP FB 1084-1 (Br6.2A) FAM 5'- CCATCGCCTAGTGC-3' (SEQ ID NO:

118).

Branch 7: X1-Z60-X3 (SEQ ID NO: 7), wherein Z60 is 5'-CATATCC(A/G)CTTCACG-3',

(SEQ ID NO: 42) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z60 shown in Figure 7, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z60 shown in Figure 7. Exemplary Branch 7 polynucleotide probes are:

SNP 269-24 (Br7A) FAM 5'-ACATATCCACTTCACG-S' (SEQ ID NO: 119); and SNP 269-24 (Br7G) VIC 5'-CATATCCGCTTCACG-3' (SEQ ID NO: 120).

BrMeή ¹ "81 ID NO: 8), wherein Z65 is 5 '-CGTTACTfG/DCTG TTCC-3', (SEQ ID NO: 43) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z65 shown in Figure 8, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z65 shown in Figure 8. Exemplary Branch 8 polynucleotide probes are:

SNP14-263 (Br8G) FAM: 5'-CGTTACTGCTGTTCC-S' (SEQ ID NO: 121); and

SNP14-263 (Br8T) VIC: 5'-AACGTTACTTCTGTTCCT-S' (SEQ ID NO: 122).

Branch 9: X1-Z70-X3 (SEQ ID NO: 9), wherein Z70 is 5 '-

CGATACCTTCTTATC(C/I)TC-3', (SEQ ID NO: 44) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z70 shown in Figure 9, and wherein X3 . is independently between zero and all of the nucleotides of the sequence 3'- to Z70 shown in

Figure 9. Exemplary Branch 9 polynucleotide probes are: SNP269-14 (Br9C) FAM: 5'-CGATACCTTCTTATCCTC-S' (SEQ ID NO: 123); and

SNP269-14 (Br9C) VIC: 5'-CGATACCTTCTTATCTTC-S' (SEQ ID NO: 124).

Branch 10: X1-Z75-X3 (SEQ ID NO: 10), wherein Z75 is 5'- ATTCTTC(G/T)CCGCTTGTT-3 ', (SEQ ID NO: 45) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z75 shown in Figure 10, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z75 shown in Figure 10. Exemplary Branch 10 polynucleotide probes are:

SNP 925-01 (BrIOG)FAM: 5'-ATAATTCTTCGCCGCTTG-3' (SEQ ID NO: 125); and

SNP 925-01 (BrIOG)VIC: 5'-ATTCTTCTCCGCTTGTT-3' (SEQ ID NO: 126).

Branch 11: X1-Z80-X3 (SEQ ID NO: 11), wherein Z80 is 5'-CGGCTTT(A/G)CTTGC-3\

(SEQ ID NO: 46) wherein Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z80 shown in Figure 11, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z80 shown in Figure 11. Exemplary Branch 11 polynucleotide probes are:

SNP 853-06 (BrI IA)VIC 5'-CGGCTTTACTTGCATC-3' (SEQ ID NO: 127); and SNP 853-06 (BrI IG)FAM 5'-CGGCTTTGCTTGC-3' (SEQ ID NO: 128).

Branch 12: X1-Z85-X3 (SEQ ID NO: 12), wherein Z85 is 5'-

CTTTACTTCTArc/T)CATCCC-3 ' (SEQ ID NO: 47), Xl is independently between zero and all of the nucleotides of the sequence 5'- to Z85 shown in Figure 12, and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to Z85 shown in Figure 12. Exemplary Branch 12 polynucleotide probes are:

FB490-1 (Brl2C)VIC 5'-CTTTACTTCTACCATCCC-S' (SEQ ID NO: 129); and

FB490-1 (Brl2T)FAM 5'-CTTTACTTCTATCATCCC-S' (SEQ ID NO: 130).

In each of these above embodiments of this fifth aspect of the invention, Xl and X3 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the recited Xl and X3 sequences.

The compositions of this aspect can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 of the SNPs recited above.

In a sixth aspect, the present invention provides compositions comprising one or more purified polynucleotide primers consisting of a nucleic acid that can be used to generate amplification products, such as those according to the fifth aspect of the invention, or their complements. In various embodiments, a given primer sequences consists of a nucleotide sequence at least 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 base pairs either upstream (5 ^s ) or downstream (3') of the SNPs described in the fifth aspect of the invention (see Figures 1-12) In one embodiment, such primers are selected from the group consisting of the following, or their complements: Branch 1 primers:

Al) SNP295-10-462(Brl)F: X1-Z34-X3 (SEQ ID NO: 1), wherein Z34 is 16-24 contiguous nucleotides of the nucleotide sequence 5'- CAAGCGGAACCAAATTTAATCTTT-3 ' (SEQ ID NO: 48), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z34 as shown in Figure 1, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z34 up to the SNP as shown in Figure 1; and

A2) SNP295-10-551(Brl)R: X1-Z36-X3 (SEQ ID NO: 1), wherein Z36 is 16-26 contiguous nucleotides of the nucleotide sequence

" 5' TTCαCCGTAϋϋTCπTTGTATAATACG-3' (SEQ ID NO: 49), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z36 as shown in Figure 1, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z36 up to the SNP as shown in Figure 1.

Branch 2 primers:

Bl) SNP318-06(Br2)F: X1-Z37-X3 (SEQ ID NO: 2), wherein Z37 is 16-27 contiguous nucleotides of the nucleotide sequence 5'ATCCAACGATACCTAAAATCGAT AAAG-3' (SEQ ID NO: 50), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z37 as shown in Figure 2, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z37 up to the SNP as shown in Figure 2; and

B2) SNP318-06(Br2)R: X1-Z38-X3 (SEQ ID NO: 2), wherein Z38 is 16-24 contiguous nucleotides of the nucleotide sequence 5'-

GAGGCAGAAGGAGC AAGTAATGTT-3' (SEQ ID NO: 51), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z38 as shown in Figure 2, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z38 up to the SNP as shown in Figure 2.

Branch 3 primers: Cl) SNP269-23 (Br3)F: X1-Z39-X3 (SEQ ID NO: 3), wherein Z39 is 16-29 contiguous nucleotides of the nucleotide sequence 5'-

GCTACTGTCATTGTATAAAAACCTCCTTT-3' (SEQ ID NO: 52), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z39 as shown in Figure 3, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z39 up to the SNP as shown in Figure 3; and

C2) SNP269-23 (Br3)R: X1-Z41, X3 (SEQ ID NO: 3), wherein Z41 is 16-20 contiguous nucleotides of the nucleotide sequence 5' -CGCTTGCC AAGCTTTTTTTC-3' (SEQ ID NO:53), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z41 as shown in Figure 3, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z41 up to the SNP as shown in Figure 3.

Branch 4 primers:

Dl) WNA-959-02(Br4)F: X1-Z42-X3 (SEQ ID NO: 4), wherein Z42 is 16-21 contiguous nucleotides of the nucleotide sequence 5'-

"CCSATACCAGTAA^CGA ^' CGACAT-S' (SEQ ID NO: 54), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z42 as shown in Figure 4, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z42 as shown in Figure 4; and D2) WNA-959-02(Br4)F: X1-Z43-X3 (SEQ ID NO: 4), wherein Z43 is 16-23 contiguous nucleotides of the nucleotide sequence 5'-CTGGAATTGGTGGAGCTATGGA- 3' (SEQ ID NO: 55), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z43 as shown in Figure 4, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z43 up to the SNP as shown in Figure 4.

Branch 6 primers

El) SNP295-31 (Br6)F: X1-Z44-X3 (SEQ ID NO: 6), wherein Z44 is 16-25 contiguous nucleotides of the nucleotide sequence 5'- CATCCATTTTCATTCCTCCTAAACA-3' (SEQ ID NO: 56) , and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z44 as shown in Figure 6, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z44 up to the SNP as shown in Figure 6; and

E2) SNP295-31 (Br6)R: X1-Z46-X3 (SEQ ID NO: 6), wherein Z46 is 16-24 contiguous nucleotides of the nucleotide sequence 5'- TAGAAACCACGCTTCTTGAATGAG-3 ' (SEQ ID NO: 57), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z46 as shown in Figure 6, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z46 up to the SNP as shown in Figure 6.

Branch 6.2 primers

Fl) SNP FB1084-1 (Br6.2) F: X1-Z47-X3 (SEQ ID NO: 5), wherein Z47 is

16-23 contiguous nucleotides of the nucleotide sequence 5'-

CCGGAAATTGCTATTAGAACGAA-3' (SEQ ID NO: 58), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z47 as shown in Figure 5, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z47 up to the SNP as shown in Figure 5; and

F2) SNP FB1084-1 (Br6.2) R: X1-Z21-X3 (SEQ ID NO: 5), wherein Z21 is

16-25 contiguous nucleotides of the nucleotide sequence 5'-

TCCCAATCTAGCGTTTTTAAGTTCA-3' (SEQ ID NO: 59), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z21 as shown in Figure 5, and wherein

X3 nucleotides of the sequence 3'- to Z21 up to the SNP as shown in Figure 5.

Branch 7 primers Gl) SNP 269-24 (Br7)F: X1-Z22-X3 (SED ID NO: 7), wherein Z22 is 16-25 contiguous nucleotides of the nucleotide sequence 5'-

CATTTATTCGCATAGAAGCAGATGA-3' (SEQ ID NO: 60), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z22 as shown in Figure 7, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z22 up to the SNP as shown in Figure 7; and

G2) SNP 269-24 (Br7)R: X1-Z23-X3 (SEQ ID NO: 7), wherein Z23 is 16-26 contiguous nucleotides of the nucleotide sequence 5'-

TGTGCCATCAAATAACTCTTTCTCAA-3' (SEQ ID NO: 61), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z23 as shown in Figure 7, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z23 up to the SNP as shown in Figure 7.

Branch 8 primers:

Hl) SNP14-263 (Br8)F: X1-Z24-X3 (SEQ ID NO: 8), wherein Z24 is 16-22 contiguous nucleotides of the nucleotide sequence 5 ' -TGTTGC ACCTTCTGTGTTCGTT-3 ' (SEQ ID NO: 62), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z24 as shown in Figure 8, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z24 up to the SNP as shown in Figure 8; and

H2) SNP14-263 (Br8)R: X1-Z25-X3 (SEQ ID NO: 8), wherein Z25 is 16-21 contiguous nucleotides of the nucleotide sequence 5'-GTAGTGGCTTCACCGAATGGA-S' (SEQ ID NO: 63), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z25 as shown in Figure 8, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z25 up to the SNP as shown in Figure 8.

Branch 9 primers:

II) SNP269-14 (Br9)F: X1-Z26-X3 (SEQ ID NO: 9), wherein Z26 is 16-29 contiguous nucleotides of the nucleotide sequence 5'-

TGCATGCTTCTTCTTACAGAGTAGTTAAT-3' (SEQ ID NO: 64), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z26 as shown in Figure 9, and

'WMMn ^' X3"ϊέ! ¹¹ betWέiB-ϊ"xSϊ ^ι biSnd all of the nucleotides of the sequence 3'- to Z26 up to the SNP as shown in Figure 9; and

12) SNP269-14 (Br9)R: X1-Z27-X3 (SEQ ID NO: 9), wherein Z27 is 16-24 contiguous nucleotides of the nucleotide sequence 5'- CGGTCATAAAAGAAATCGGTACAA-3 ' (SEQ ID NO: 65), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z27 as shown in Figure 9, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z27 up to the SNP as shown in Figure 9.

Branch 10 primers:

Jl) SNP 925-01 (BrIO)R: X1-Z28-X3 (SEQ ID NO: 10), wherein Z28 is 16-27 contiguous nucleotides of the nucleotide sequence 5'-

TTCGCAACTACGCTATACGTTTTAGAT-3' (SEQ ID NO: 66), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z28 as shown in Figure 10, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z28 up to the SNP as shown in Figure 10; and

J2) SNP 925-01 (BrIO)F: X1-Z29-X3 (SEQ ID NO: 10), wherein Z29 is 16-28 contiguous nucleotides of the nucleotide sequence 5'-

CAAACGGTGAAAAAGTTACAAATATACG-S' (SEQ ID NO: 67), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z29 as shown in Figure 10, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z29 up to the SNP as shown in Figure 10.

Branch 11 primers: Kl) SNP 853-06 (BrI 1) F: X1-Z48-X3 (SEQ ID NO: 11), wherein Z48 is 14-18 contiguous nucleotides of the nucleotide sequence 5'-GGCAATCGGCCACTGTTT-S' (SEQ ID NO: 68), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z48 as shown in Figure 11, and wherein X3 is between zero and all of the nucleotides of the sequence 3 '- to Z48 up to the SNP as shown in Figure 11; and K2) SNP 853-06 (BrI 1) R: X1-Z31-X3 (SEQ ID NO: 11), wherein Z31 is 21-32 contiguous nucleotides of the nucleotide sequence 5'- GGGTTTCTACTGTGTATGTTGTTAA

TAAAAAG-3' (SEQ ID NO: 69), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z31 as shown in Figure 11, and wherein X3 is between zero and all of the nucleotides of the sequence 3 ' - to Z31 up to the SNP as shown in Figure 11.

Branch 12 primers:

Ll) FB490-1 (Brl2)F: X1-Z32-X3 (SEQ ID NO: 12), wherein Z32 is 16-28 contiguous nucleotides of the nucleotide sequence 5'-GAAGTTAAGTATCAACCAGCAGA AGAAA-3 ' (SEQ ID NO: 70), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z32 as shown in Figure 12, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z32 up to the SNP as shown in Figure 12; and

L2) FB490-1 (Brl2)R: X1-Z33-X3 (SEQ ID NO: 12), wherein Z33 is 14-16 contiguous nucleotides of the nucleotide sequence 5'-CCGCCGCCTTGAGCTT-S' (SEQ ID NO: 71), and wherein Xl is between zero and all of the nucleotides of the sequence 5'- to Z33 as shown in Figure 12, and wherein X3 is between zero and all of the nucleotides of the sequence 3'- to Z33 up to the SNP as shown in Figure 12.

In various preferred embodiments of this sixth aspect, Xl and X3 are independently 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 61, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the sequences disclosed above.

In various other preferred embodiments of this sixth aspect, the relevant "Z" group is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39 contiguous nucleotides of the nucleotide sequence recited. In a further preferred embodiment, the primers are provided as pairs to generate a probe of interest; for example, Al and A2 (Branch 1); Bl and B2 (Branch 2), Cl and C2 (Branch 3), Dl and D2 (Branch 4); El and E2 (Branch 6); Fl and F2 (Branch 6.2); Gl and G2 (Branch 7); Hl and H2 (Branch 8); Il and 12 (Branch 9); Jl and J2 (Branch 10); Kl and K2 (Branch 11); Ll and L2 (Branch 12). Thus, the composition may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 of the recited primer pairs.

These polynucleotides according to the sixth aspect of the invention are useful, for example, as primers to use in PCR assays to generate PCR product, such as the polynucleotide probes of the fifth aspect of the invention that contains a single nucleotide polymorphism to distinguish between various Bacillus anthracis isolates, as discussed below.

The compositions of each aspect and embodiment of the invention may further comprise other polynucleotide components that are beneficial for use in combination with the polynucleotides of the invention, such as competitor nucleic acids and other control sequences (such as sequences to provide a standard of hybridization for comparison in the

meinoαs or tne ¹ invδtttitmjirstifoh sequences are not considered as part of the "probe" or "primer" for purposes of the invention. The compositions may optionally comprise other components, including but not limited to buffer solutions, hybridization solutions, and reagents for storing the nucleic acid compositions. The term "polynucleotide" as used herein with respect to each aspect and embodiment of the invention refers to DNA, in either single- or double-stranded form. It includes the recited sequences as well as their complementary sequences, which will be clearly understood by those of skill in the art. The term "polynucleotide" encompasses nucleic acids containing known analogues of natural nucleotides which have similar or improved binding properties, for the purposes desired, as the reference polynucleotide. The term also encompasses nucleic-acid-like structures with synthetic backbones. DNA backbone analogues provided by the invention include phosphodiester, phosphorothioate, phosphorodithioate, methylphosphonate, phosphoramidate, alkyl phosphotriester, sulfamate, 3'-thioacetal, methylene(methylimino), 3'-N-carbamate, morpholino carbamate, and peptide nucleic acids (PNAs), methylphosphonate linkages or alternating methylphosphonate and phosphodiester linkages (Strauss-Soukup (1997) Biochemistry 36:8692-8698), and benzylphosphonate linkages, as discussed in US 6,664,057; see also Oligonucleotides and Analogues, a Practical Approach, edited by F. Eckstein, IRL Press at Oxford University Press (1991); Antisense Strategies, Annals of the New York Academy of Sciences, Volume 600, Eds. Baserga and Denhardt (NYAS 1992); Milligan (1993) J. Med. Chem. 36:1923-1937; Antisense Research and Applications (1993, CRC Press).

In each of the aspects and embodiments of the compositions and methods of the present invention, it is further preferred that the purified polynucleotides are labeled with a detectable label, particularly when the polynucleotide is a probe as disclosed above. In an embodiment where different polynucleotides of the invention are to be used simultaneously (for example, where using multiple probes to simultaneously distinguish between Bacillus anthracis isolates in a test sample, or to combine multiple probes (such as Ames SNP probes) to increase the confidence level of assay results), the detectable labels on the different polynucleotides are preferably distinguishable, to facilitate simultaneous detection methods. Useful detectable labels include but are not limited to radioactive labels such as ³² P, ³ H, and ¹⁴ C; fluorescent dyes such as fluorescein isothiocyanate (FITC), rhodamine, lanthanide phosphors, Texas red, and ALEXIS™ (Abbott Labs), CY™ dyes (Amersham); electron- dense reagents such as gold; enzymes such as horseradish peroxidase, beta-galactosidase, luciferase, and alkaline phosphatase; colorimetric labels such as colloidal gold; magnetic labels such as those sold under the mark DYNABEADS™; biotin; dioxigenin; or haptens and

" proteins for whicK ^' antϊsera or monoclonal antibodies are available. The label can be directly incorporated into the polynucleotide, or it can be attached to a molecule which hybridizes or binds to the polynucleotide. The labels may be coupled to the purified polynucleotides by any means known to those of skill in the art. In a various embodiments, the isolated polynucleotides are labeled using nick translation, PCR, or random primer extension (see, e.g., Sambrook et al. supra). Methods for detecting the label include, but are not limited to spectroscopic, photochemical, biochemical, immunochemical, physical or chemical techniques.

A "purified" polynucleotide as used herein for all of the aspects and embodiments of the invention is one which is separated from other nucleic acid molecules which are present in the natural source of the polynucleotide, and is free of sequences that naturally flank the polynucleotide in the genomic DNA of the organism from which the nucleic acid is derived, except as otherwise described herein. Moreover, a "purified" polynucleotide is substantially free of other cellular material, gel materials, and culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized (ie: at least 70% purified, preferably at least 75%, 80%, 85%, 90%, 95% or 98% purified). The polynucleotides of the invention may be purified from a variety of sources, such as by PCR amplification from Bacillus genomic DNA, using standard techniques; or they may be synthesized in vitro, by methods well known to those of skill in the art, as discussed in US 6,664,057 and references disclosed therein. Synthetic polynucleotides can be prepared by a variety of solution or solid phase methods. Detailed descriptions of the procedures for solid phase synthesis of polynucleotide by phosphite- triester, phosphotriester, and H-phosphonate chemistries are widely available. (See, for example, US 6,664,057 and references disclosed therein). Methods to purify polynucleotides include native acrylamide gel electrophoresis, and anion-exchange HPLC, as described in

Pearson (1983) J. Chrom. 255:137-149. The sequence of the synthetic polynucleotides can be verified using standard methods.

In another embodiment, the present invention provides vectors comprising a polynucleotide of the invention as described above. One type of vector is a "plasmid", which refers to a circular double stranded DNA into which polynucleotides of the invention may be cloned. Another type of vector is a viral vector, wherein polynucleotides of the invention may be cloned into the viral genome. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors), are integrated into the genome of a host cell upon introduction into the host cell, and

tϋefe'by" Sϊ'e'f'€ipliD&.ted: ^•l kIblcig"λvitli the host genome. The vector may also contain additional sequences, such as a polylinker for subcloning of additional nucleic acid sequences.

In a further embodiment, the present invention provides recombinant host cells in which the vectors disclosed herein have been introduced. As used herein, the term "host cell" is intended to refer to a cell into which a nucleic acid of the invention, such as a vector of the invention, has been introduced. Such cells may be prokaryotic or eukaryotic. It should be understood that "host cells" include not only the particular subject cell but the progeny or potential progeny of such a cell. Since certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

The host cells can be transiently or stably transfected with one or more of the vectors of the invention. Such transfection of vectors into prokaryotic and eukaryotic cells can be accomplished via any technique known in the art, including but not limited to standard bacterial transformations, calcium phosphate co-precipitation, electroporation, or liposome mediated-, DEAE dextran mediated-, polycationic mediated-, or viral mediated transfection. (See, for example, Molecular Cloning: A Laboratory Manual (Sambrook, et al., 1989, Cold Spring Harbor Laboratory Press; Culture of Animal Cells: A Manual of Basic Technique, 2 ^nd Ed. (R.I. Freshney. 1987. Liss, Inc. New York, NY). The compositions of the various aspects and embodiments of the invention can be in lyophilized form, or in solution containing the purified polynucleotides that can further comprise, for example, buffer solutions, hybridization solutions, and solutions for keeping the compositions in storage. Such a solution can be made as such, or the composition can be prepared at the time of using the polynucleotides. Alternatively, the compositions of the various aspects and embodiments can be placed on a solid support, such as in a microarray, bead, or microplate format. The term "microarray" as used herein comprises a plurality of polynucleotide compositions of the invention, such as those of the first, third, and fifth aspects of the invention, immobilized on a solid surface to which sample nucleic acids are hybridized. Thus, in a seventh aspect, the present invention provides a solid support comprising a surface on which are arrayed a plurality of polynucleotide compositions of the invention, such as those of the first, third, and/or fifth aspects of the invention (or the second, fourth, and/or sixth aspects of the invention), as disclosed above. In this aspect, a single polynucleotide composition can be present at one or more locations on the support, or a plurality of polynucleotides according to the compositions of the invention set can be present

ai dMerent and defined"lδcatϊbns on the support. Other nucleic acid sequences, such as reference or control nucleic acids, can be optionally immobilized on the solid surface as well. Methods for immobilizing nucleic acids on a variety of solid surfaces are well known to those of skill in the art. A wide variety of materials can be used for the solid surface. Examples of such solid surface materials include, but are not limited to, nitrocellulose, nylon, glass, quartz, diazotized membranes (paper or nylon), silicones, polyformaldehyde, cellulose, cellulose acetate, paper, ceramics, metals, metalloids, semiconductive materials, coated beads, magnetic particles; plastics such as polyethylene, polypropylene, and polystyrene; and gel-forming materials, such as proteins (e.g., gelatins), lipopolysaccharides, silicates, agarose and polyacrylamides.

A variety of different materials may be used to prepare the solid surface to obtain various properties. For example, proteins (e.g., bovine serum albumin) or mixtures of macromolecules (e.g., Denhardt's solution) can be used to minimize non-specific binding, simplify covalent conjugation, and/or enhance signal detection. If covalent bonding between a compound and the surface is desired, the surface will usually be functionalized or capable of being functionalized. Functional groups which may be present on the surface and used for linking include, but are not limited to, carboxylic acids, aldehydes, amino groups, cyano groups, ethylenic groups, hydroxyl groups, and mercapto groups. Methods for linking a wide variety of compounds to various solid surfaces are well known to those of skill in the art.

In an eight aspect, the present invention provides methods for detecting the presence of Bacillus anthracis in a test sample, comprising screening the test sample for the presence of a nucleic acid comprising the nucleotide sequence 5-AATACGAATAAGCGCTTTG-S' (SEQ ID NO: 97) and/or its complement, wherein the presence in the test sample of the nucleotide sequence correlates with presence of Bacillus anthracis in the test sample.

The inventors herein have for the first time determined that the SNP 5'- AATACGAATAAGCGCTTTG-3' (SEQ ID NO: 97) is shared by all known Bacillus anthracis isolates and is not present in other Bacillus species. Thus, the present invention provides the first demonstration that the methods of the invention can be used to discriminate Bacillus anthracis in a sample from other Bacillus species. Various embodiments of this eighth aspect of the invention are described below.

In a ninth aspect, the present invention provides methods for detecting the presence of Bacillus anthracis in a test sample, and/or distinguishing between different species of Bacillus, comprising screening a test sample for the presence of a nucleic acid comprising the nucleotide sequence 5'-CAAAGCGCTTATTCGTATT-S' (SEQ ID NO: 98) and/or its

'cbnϊprsϊn'Shϊ''(όee'''th'e'tli'M ¹ 'as ¹ pect of the invention), wherein the presence in the test sample of the nucleotide sequence correlates with presence of Bacillus anthracis in the test sample, and distinguishes it from, for example, closely related Bacillus cereus and Bacillus thuringiensis. This method can further (or alternatively) comprise screening the sample for the presence of a nucleic acid comprising the nucleotide sequence 5 '-CAAAGCGCTTATTCGTATT-3 ' (SEQ ID NO: 98) and/or its complement (see the third aspect of the invention), wherein the presence in the test sample of the nucleotide sequence correlates with presence of Bacillus cereus and/or Bacillus thuringiensis in the test sample, and distinguishes it from closely related Bacillus anthracis. While not required, a control sequence (including, but not limited to 5'-CAAAGTGCTTCTTCGTATT-S' (SEQ ID NO: 99); (see the third aspect of the invention)) can be used, where the method further comprises screening the sample for the presence of a nucleic acid comprising the nucleotide sequence 5'- CAAAGTGCTTCTTCGTATT-3' (SEQ ID NO: 99) and/or its complement, wherein the presence in the test sample of the nucleotide sequence correlates with a false positive. The methods of this ninth aspect of the invention can be carried out in conjunction with the methods of the eighth aspect to provide increased statistical confidence in the assay. By way of non-limiting example, the methods of the eighth and ninth aspects (and any embodiments thereof described above and below) can be carried out in parallel or sequentially; the order in which the methods are conducted in not limiting. Various embodiments of this ninth aspect of the invention are described below.

In a tenth aspect, the present invention provides methods for detecting a Bacillus anthracis Ames isolate in a test sample, comprising screening the test sample for the presence of nucleic acid comprising one or more nucleotide sequences selected from the group consisting of Ames SNP2, Ames SNP3, Ames SNP4, Ames SNP5, Ames SNP5, and Ames SNP6 (see the first aspect of the invention) wherein the presence in the test sample of the nucleotide sequence correlates with presence of the Bacillus anthracis Ames strain in the test sample. The relevant sequences of the various Ames SNPs are described above in the first aspect of the invention, including diagnostic and control sequences. Thus, the methods can comprise screening for the diagnostic probe only, or can further comprise screening for the control probe as well. The methods can comprise screening for just one of the Ames SNPs recited above, or can comprise screening for 2, 3, 4, or 5 of the Ames SNPs (and may include or exclude one or more control screening, as discussed above).

In this aspect, each embodiment of the methods may further comprise screening the test sample for the presence of nucleic acid comprising Ames SNP7, with a nucleic acid sequence as follows:

""AIn ¹ S SNFT-Xαmes pX01A)-493 FAM: X1-Z100-X3 (SEQ ID NO: 14), wherein ZlOO is 5'-AAGGGTC(AZGICAACTC-S' (SEQ ID NO: 72), or its complement; Xl is independently between zero and all of the nucleotides of the sequence 5'- to ZlOO shown in Figure 14 (or their complement), and wherein X3 is independently between zero and all of the nucleotides of the sequence 3'- to ZlOO shown in Figure 14 (or their complement).

Ames SNP7 is diagnostic for the Ames isolate, wherein the variable position is "A" (5'-AAGGGTCACAACTC-S') (SEQ ID NO: 72) (or its complement)), in an Ames strain, and "G" ((5'-AAGGGTCGCAACTC-S') (SEQ ID NO: 72) (or its complement)) in a non- Ames strain. In various preferred embodiments, Xl and X3 for Ames SNP7 are independently 0, 1,

2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleotides of the sequences disclosed above, respectively.

The methods of this tenth aspect of the invention can be carried out in conjunction with the methods of the eighth and/or ninth aspects to provide increased functionality of the methods. By way of non-limiting example, the methods of the eighth and/or ninth aspects (and any embodiments thereof described above and below) can be carried out in parallel (separately or together) or sequentially; the order in which the methods are conducted in not limiting, to identify the presence of Bacillus anthracis in the test sample, after which the methods of the tenth aspect can be carried out to detect the presence of an Ames isolate in the test sample. Alternatively, the methods of the tenth aspect can be carried out in parallel (or together with) the methods of the eighth and/or ninth aspects of the invention, including any embodiments described above and below. Various embodiments of this tenth aspect of the invention are described below.

In an eleventh aspect, the present invention provides methods for detection of specific Bacillus anthracis isolates, comprising screening the test sample for the presence of nucleic acid comprising one or more nucleotide sequence selected from the group consisting of Branch 1 probe, Branch 2 probe, Branch 3 probe, Branch 4 probe, Branch 6 probe, Branch 6.2 probe, Branch 7 probe, Branch 8 probe, Branch 9 probe, Branch 10 probe, Branch 11 probe, and Branch 12 probe, wherein the presence in the test sample of the nucleotide sequence correlates with presence of a specific Bacillus anthracis isolate (denoted by the different branch probes) in the test sample. The relevant sequences of the various Branch probe SNPs are described above in the fifth aspect of the invention, including diagnostic and

cbntfoϊ'sfefytoces ¹ ! ''Thu'sV'ϊnf methods can comprise screening for the diagnostic probe only, or can further comprise screening for the control probe as well. The methods can comprise screening for just one of the Branch SNPs recited above, or can comprise screening for 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 24 of the Branch probe SNPs (and may include or exclude one or more control screening, as discussed above).

The methods of this eleventh aspect of the invention can be carried out in conjunction with the methods of the eighth, ninth and/or tenth aspects to provide increased functionality of the methods. By way of non-limiting example, the methods of the eighth and/or ninth aspects (and any embodiments thereof described above and below) can be carried out in parallel or sequentially; the order in which the methods are conducted in not limiting, to identify the presence of Bacillus anthracis in the test sample, after which the methods of the eleventh aspect can be carried out to detect the presence of specific Bacillus anthracis isolates in the test sample. In such embodiments, the eleventh aspect can be carried out alone, or together with the methods of the tenth aspect of the invention (sequentially or in parallel (separately or together)) for detecting the presence of an Ames isolate in the test sample. Alternatively, the methods of the eleventh aspect can be carried out sequentially or in parallel (separately or together) with the methods of the eighth, ninth, and/or tenth aspects of the invention, including any embodiments described above and below. Various embodiments of this eleventh aspect of the invention are described below. As discussed herein, the inventors for the first time herein have identified specific

SNPs that can be used to reliably type different Bacillus anthracis isolates. The methods of the invention are useful in diagnostic, epidemiological, and forensic applications, including but not limited to analyses of natural anthrax cases, bioterrorism acts, state-sponsored bioweapons programs, and industrial scale accidents. Test samples for use with the methods of the present invention include any such test sample that could or is suspected of containing B. anthracis, including but not limited to patient samples such as blood, urine, nasal swabs, sputum, and tissue samples, environmental samples from the site of possible industrial accidents; for routine monitoring of air, water or soil samples to detect a bioterrorism event; or from laboratory facilities suspected of bioweapons or bioterrorism activity.

Any method for SNP detection can be used in accordance with the methods of the invention. A wide variety of techniques have been developed for SNP detection and analysis, see, e.g. Sapolsky et al. (1999) U.S. Pat. No. 5,858,659; Shuber (1997) U.S. Pat. No. 5,633,134; Dahlberg (1998) U.S. Pat. No. 5,719,028; Murigneux (1998) WO98/30717; Shuber (1997) WO97/10366; Murphy et al. (1998) WO98/44157; Lander et al. (1998)

^f WOS>'8-/201'65;"Gθέl¥t etal! (ϊ995) WO95/12607 and Cronin et al. (1998) WO98/30883. In addition, ligase based methods are described by Barany et al. (1997) WO97/31256 and Chen et al. Genome Res. 1998;8(5):549-56; mass-spectroscopy-based methods by Monforte (1998) WO98/12355, Turano et al. (1998) WO98/14616 and Ross et al. (1997) Anal Chem. 15, 4197-202; PCR-based methods by Hauser, et al. (1998) Plant J. 16,117-25; exonuclease- based methods by Mundy U.S. Pat. No. 4,656,127; dideoxynucleotide-based methods by Cohen et al. WO91/02087; Genetic Bit Analysis or GBA.TM. by Goelet et al. WO92/15712; Oligonucleotide Ligation Assays or OLAs by Landegren et al.(1988) Science 241:1077-1080 andNickerson et al.(1990) Proc. Natl. Acad. Sci. (U.S.A.) 87:8923-8927; and primer-guided nucleotide incorporation procedures by Prezant et al.(1992) Hum. Mutat. 1:159-164;

Ugozzoli et al.(1992) GATA 9:107-112; Nyreen et al. (1993) Anal. Biochem. 208:171-175.

In one embodiment of the methods of the invention, the screening comprises amplification of a genomic Bacillus locus (if present in the test sample) including the SNP prior to detection. In one example, PCR primers adjacent to one or more SNP to be detected (such as those described above in the second, fourth, and sixth embodiments of the invention) are used to amplify one or more genomic regions and produce one or more PCR products that include the relevant SNP sequence(s). This amplified product can, for example, be sequenced as appropriate to identify the SNP, or can be subjected to a hybridization reaction using appropriate probes, such as those described herein in the first, third, and fifth embodiments of the invention, that can distinguish the amplified product as containing the SNP. Exemplary amplification and analysis techniques include, but are not limited to, Taq polymerase based mismatch amplification assays, allelic discrimination assays, and multi- locus variable number of tandem repeat analysis. These techniques are described in more detail in the Examples that follow. In another example, mass spectroscopy methods involve the amplification of the region followed by sequence composition determination (calculated deconvoluted mono-isotopic molecular weights and corresponding base pair compositions).

In a further embodiment of the methods of the invention, nucleic acid in the test sample is isolated prior to the testing. In this embodiment, the "isolation" does not require purification (although purified nucleic acid can be used), but can comprise, for example, lysing of cells in the sample to release nucleic acids therefrom, and/or removal of debris from the test samples.

In a further embodiment of the eighth aspect of the invention, the screening comprises contacting a test sample with a composition according to the third aspect of the invention, wherein the contacting is conducted under conditions to promote hybridization of the purified polynucleotide sequence of the composition with aplcR gene or portion thereof from Bacillus

ώ«/M^^; ^ι 4f'it ^' is"'tiΫfe'δ6'ήt'1n ^;; i:he test sample to form a hybridization complex, but not with a plcR nucleic acid sequence from other Bacillus species. The composition may comprise 1, 2, 3, or 4 of the recited polynucleotides of the third aspect; in this embodiments, it is preferred that the purified polynucleotide is labeled to facilitate detection. In a further embodiment of the methods of the invention, the screening comprises contacting a test sample with a composition according to the first aspect of the invention, and/or their complements, and also optionally with Ames SNP7, wherein the contacting is conducted under conditions to promote hybridization of the purified polynucleotide sequence of the composition with a complementary nucleic acid sequence from a Bacillus anthracis Ames isolate, if it is present, in the test sample to form a hybridization complex, but not with a nucleic acid sequence from other Bacillus anthracis isolates. The composition may comprise 1, 2, 3, 4, or 5 of the recited polynucleotides of the third aspect alone or together with Ames SNP7; in this embodiments, it is preferred that the purified polynucleotide is labeled to facilitate detection. In a further embodiment of the methods of the invention, the screening comprises contacting a test sample with a composition according to the fifth aspect of the invention, and/or their complements, wherein the contacting is conducted under conditions to promote hybridization of the purified polynucleotide sequence of the composition with a complementary nucleic acid sequence from a Bacillus anthracis isolate, if it is present, in the test sample to form a hybridization complex, but not with a nucleic acid sequence from other Bacillus anthracis isolates. In this embodiment, it is preferred that the purified polynucleotide is labeled to facilitate detection.

As discussed above, when the screening comprises the use of multiple probes, it is preferred that the probes are differentially labeled to facilitate identification of, for example, hybridization products including the probe.

As discussed above, the methods of the invention do not require the use of control probes or a requirement to remove unbound probe, although one or both of these may be optionally included in the method. Exemplary controls are discussed above, and those of skill in the art will readily be able to identify other useful controls based on the teachings of the present invention.

As used herein with respect to each aspect and embodiment of the invention, the term "under conditions to promote hybridization" means that the purified polynucleotides bind to the relevant SNP and not to nucleic acid sequences from other Bacillus species or Bacillus anthracis isolates that do not contain the SNP. The exact conditions used can vary, as is known to those of skill in the art.

"M'a "further pleferred'embodiment of the methods of the invention and their various embodiments, the methods further comprise initiating prophylactic therapy against Bacillus anthracis infection in individuals exposed to test samples that contain Bacillus anthracis. The current prophylactic therapy for individuals exposed to anthrax is an antibiotic regimen. The specific antibiotic is determined by sensitivity testing of the isolate. Thus, the methods of the invention are ideal for identifying which isolates an individual has been exposed to, information that an attending physician can use in determining an appropriate course of therapy for the individual.

In a twelfth aspect, the present invention provides kits for identifying Bacillus anthracis is a sample, or for identifying an isolate of Bacillus anthracis, comprising one or more of the compositions of the first, second, third, fourth, fifth, or sixth aspects of the invention (and all embodiments thereof) and instructions for their use in identifying Bacillus anthracis in a sample, or for identifying an isolate of Bacillus anthracis, as disclosed above in the eighth, ninth, tenth, and eleventh aspects of the invention, and all embodiments thereof.

Example 1.

The genetic similarities among the pathogenic spore-forming soil bacteria Bacillus cereus, B. thuringiensis, and B. anthracis has resulted in the suggestion that they be considered members of the same species (3). Interestingly, this group of bacteria exhibit phenotypic differences and express virulence in diverse ways. B. cereus and B. thuringiensis are opportunistic pathogens in mammals due to the secretion of non-specific virulence factors, such as haemolysins, the expression of which are regulated by the transcriptional activator, PIcR (8). In B. anthracis, PIcR is inactivated due to a nonsense mutation in the gene (1), and its virulence in mammals is attributed to the expression of specific toxins under the control of the AtxA regulator (2).

The nonsense mutation in the plcR gene of B. anthracis may represent an evolutionary stable, species-specific marker (9). Research by Mignot et al. (8), in which a functional PIcR was expressed in B. anthracis, demonstrated that PIcR and AtxA- controlled regulons were incompatible, asplcR expression interfered with sporulation in B. anthracis. Since sporulation is a critical component of the ecology of B. anthracis, the authors speculated that a functional PIcR is counter-selected in this species.

To initially test the utility of the nonsense mutation in PIcR as a species-specific marker for B. anthracis, we examined the plcR gene fragments that surround the nonsense mutation in several Bacillus spp. The strains examined included: eight genetically diverse B.

'ahtfiracϊsj''mnό ^' Brc'ereus^six B. thuringiensis, and one unidentified near-neighbor (TET 2b- 3) (4). Sequences obtained either from Genbank, or from sequencing efforts in our laboratory, were compared using MegAlign. The primers and probes used in the assay were derived from: B. anthracis strains Ames, Vollum, A2012, A1055, AUS94, CNEVA9066, Kruger, Sterne, and WNA6153; B. cereus strains 3A, and S2-8, and B. thuringensis strain HDlOl 1; B. thuringensis strain 97-27; near-neighbor strain TET 2b-3; B. cereus strain AH- 527; B. cereus strain D 17, and B. thuringensis strains HD682, HD571, and HD44; B. cereus strains F3502/72 and R6; B. cereus strain F2-1; and B. cereus strains R4 and ATCC 33018, and B. thuringensis strain HD 1012.. The nonsense mutation was present in all nine of the B. anthracis sequences and was absent in the 16 near-neighbor sequences.

Based upon these sequences, we designed a TaqMan®-minor groove binding (MGB) allelic discrimination assay around the nonsense mutation. The TaqMan®-MGB probes were designed using Primer Express software (Applied Biosystems, Foster City CA). One probe was designed to specifically hybridize to the B. anthracis sequence (5'-VIC- CAAAGCGCTTATTCGTATT-S'-MGB) (SEQ ID NO: 98) and the other was designed to hybridize to the alternate allele (5'-FAM-AAAGCGCTTCTTCGTATT-S '-MGB) (SEQ ID NO: 103) (see Fig. 16 for probe locations). Real-time PCR reactions were conducted in 10.0 μL reactions which contained 600 nM of both forward (5'- CCAATCAATGTCATACTATTAATTTGACAC-3') (SEQ ID NO: 104) and reverse primer (5'-ATGCAAAAGCATTATACTTGGACAAT-S') (SEQ ID NO: 105) (see Fig. 16 for primer locations), 250 nM of each probe, IX Invitrogen™ Platinum® qPCR SuperMix-UDG, and 1.0 μl of template. Thermal cycling was performed on an ABI 7900 HT sequence detection system (Applied Biosystems) under the following conditions: 50° C for 2:00min, 95° C for 2:00, and 40 cycles of 95° C for 15 sec and 60° C for 1:00 min. To further evaluate the nonsense mutation mplcR as a species-specific marker for B. anthracis, we used the assay described above to genotype a collection of B. anthracis strains representing 89 unique genetic lineages (6). In addition, we genotyped 29 strains that were identified as genetic near neighbors of B. anthracis by amplified fragment length polymorphism (AFLP) analysis (4) (see Table 1 for strain list). All of the B. anthracis isolates supported amplification and were shown to have the plcR nonsense mutation genotype ('T' allele). Not surprisingly, genetic near neighbors that had mutations in the priming site either failed to exhibit amplification, or amplified with lower efficiency relative to the four strains that had identical sequence identity to B. anthracis except for the nonsense mutation (Table 1). Of the 29 near-neighbors, 16 failed to exhibit amplification and the remaining 13 exhibited the 'G' allele genotype (Table 1). The presence of the 'G' allele in 5

assay was confirmed via sequencing with flanking primers.

Table 1. List of Bacillus spp. strains examined using the assay developed in this study.

Species"'" Strain" plcR gene Average TaqMan Result fragment Threshold (Allele) sequence ^d Cycle (Ct) ^e BA 89 diverse strains ⁰ 2 26.0 ^f + (T)

BC ATCC 4342 NA No Amp -

BC ATCC 14579 NA No Amp

BC D17 . 7 No Amp - (G) ⁸ BC F3-27 NA No Amp

BC F3502/72 8 27.1 + (G)

BC R6 8 27.6 + (G)

BC ATCC 33018 10 38.5 + (G)

BC D5 NA 28.4 + (G)

BC 3A 3 24.8 + (G)

BC S2-8 3 27.0 + (G)

BC F3350/87 NA No Amp -

BC S2-4 NA 34.9 + (G)

BC R4 10 34.7 + (G)

BC F2-1 9 No Amp - (G) ⁸

BC AH 527 6 30.0 + (G)

BT HD 1015 NA No Amp -

BT HD 681 NA No Amp -

BT HD 288 NA No Amp -

BT HD 526 NA No Amp -

BT 97-27 4 33.0 + (G)

BT HD 1011 3 26.7 + (G)

BT HD 571 7 No Amp -(G) ⁸

BT HD 682 7 No Amp • -(G) ⁸

BT HD 974 , NA No Amp -

BT HD 44 7 No Amp - (G) ⁸

BT HD 30 NA No Amp -

BT HD 1012 10 33.0 + (G)

I* .. ^■ ^ U b / HD ^u 50" ^{JL U} " NA No Amp -

UNK TET-2B 5 33.3 + (G) ^a BA ₅ B. anthracis; BC, B. cereus; BT, B. thuringiensis; UNK, unknown Bacillus spp. ^b Species and strain designations according to (4) ^c The 89 diverse B. anthracis strains are described in (6) ^d As represented in Fig 1. NA, strain not sequenced. ^e 10 pg input, average of triplicate Ct values. No Amp, no amplification ^f Average of triplicate Ct values from 10 pg input of B. anthracis Ames strain. ^g plcR genotypes were determined via sequencing using flanking primers

To test the limit of detection of the assay, we utilized a dilution series generated from DNAs from three diverse B. anthracis isolates [Ames (A0462), Kruger Bl (A0442), and Vollum (A0488)]. DNA was quantified using a picogreen assay and template levels ranging from 100 pg to 10.0 fg were used in the plcR TaqMan assay. The average threshold cycle (Ct) values across three replicates were as follows: 100 pg, 21.4; lOpg, 24.7; lpg, 28.2; lOOfg, 31.2; 10 fg, 34.3. The average Ct values for strains A0488 and A0462 were similar (data not shown), although amplification at the 10 fg level was not consistent.

Thus, the assay reliably detected and genotyped Bacillus anthracis DNA template at levels as low as 100 fg, with 10 fg samples exhibiting sporadic amplification.

Our data provide further evidence that the nonsense mutation in the plcR gene of B. anthracis is an evolutionarily stable, species-specific marker. Although additional genetic changes, such as deletions, could render a non-functional PlcR in B. anthracis and potentially cause false negative results in our assay, this was not observed. The presence of this mutation in the 89 genetically diverse B. anthracis lineages examined here, as well as the known genetic homogeneity of the species (5), limits the likelihood of alternate genetic mechanisms for plcR inactivation in B. anthracis. The recent findings of Slamti et al.(9), which demonstrated that this specific plcR nonsense mutation was not responsible for the nonhemolytic properties of B. cereus and B. thuringiensis strains, further supports the concept that this nonsense mutation is a defining or 'canonical' SNP (canSNP) (7) in B. anthracis.

The real-time assay presented here represents a potentially valuable diagnostic tool in the event of a future bioterrorist attack. From a biodefense perspective, diagnostic assays allowing rapid and specific identification of B. anthracis are critical to initiate appropriate first response actions, such as remediation measures and prophylactic therapies. As thcplcR assay targets a biologically-relevant SNP, it limits the likelihood of false negative or positive results, which can lead to misallocation of resources during an attack scenario. Furthermore, this assay is amenable to high-throughput real-time PCR platforms that are currently used in

h'bnigm'nd" ^: cl ^l fefdnsg"ϊhltfatiVes;" ¹ such as Bio Watch.

In summary, our results indicate that the plcR nonsense mutation is ubiquitous in ^• globally and genetically, diverse B. anthracis isolates and thereby represents an excellent target for diagnostic assays.

References for Example 1

1. Agaisse, H., M. Gominet, O. A. økstad, A. Kolstø, and D. Lereclus. 1999. PIcR is a pleiotropic regulator of extracellular virulence factor gene expression in Bacillus thuringiensis. MoI. Microbiol. 32:1043-1053. 2. Guignot, J., M. Mock, and A. Fouet. 1997. AtxA activates the transcription of genes harbored by both Bacillus anthracis virulence plasmids. FEMS Microbiol. Lett. 147:203- 207.

3. Helgason, E., O. A. økstad, D. A. Caugant, H. A. Johansen, A. Fouet, M. Mock, I. Hegna, and A. Kolstø. 2000. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis — one species on the basis of genetic evidence. Appl. Environ. Microbiol.

66:2627-2630.

4. Hill, K. K., L. O. Ticknor, R. T. Okinaka, M. Asay, H. Blair, K. A. Bliss, M. Laker, P. E. Pardington, A. P. Richardson, M. Tonks, D. J. Beecher, J. D. Kemp, A. Kolstø, A. C. Lee Wong, P. Keim, and P. J. Jackson. 2004. Fluorescent amplified fragment length polymorphism analysis of Bacillus anthracis, Bacillus cereus, and Bacillus isolates. Appl. Environ. Microbiol. 70:1068-1080.

5. Keim, P., A. Caliph, J. Schupp, K. Hill, S. E. Travis, K. Richmond, D. M. Adair, M. Hugh- Jones, C. Kuske, and P. Jackson. 1997. Molecular evolution and diversity in Bacillus anthracis as detected by AFLP markers. J. Bacteriol. 179:818-824. 6. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P. J. Jackson, and M. E. Hugh-Jones. 2000. Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J. Bacteriol. 182:2928- 2936.

7. Keim, P., M. N. Van Ert, T. Pearson, A. J. Vogler, L. Y. Huynh, and D. M. Wagner. 2004. Anthrax molecular epidemiology and forensics: using the appropriate marker for different evolutionary scales. Infect. Genet. Evol. 4:205-213

8. Mignot, T., M. Mock, D. Robichon, A. Landier, D. Lereclus, and A. Fouet. 2001. The incompatibility between the PIcR- and AtxA-controlled regulons may have selected a nonsense mutation in Bacillus anthracis. MoI. Microbiol. 42: 1189-1198. 9. Slamti, L., S. Perchat, M. Gominet, G. Vilas-Bδas, A. Fouet, M. Monk, V. Sanchis, J.

'€h&u1a''u'i, MVGό'tiar", and D. Lereclus. 2004. Distinct mutation in PIcR explain why some strains of the Bacillus cereus group are nonhemolytic. J. Bacteriol. 186:3531-3538.

Example 2. Summary:

We designed a TAQMAN® mismatch amplification mutation assay (TaqMAMA) around a single nucleotide polymorphism in the plcR gene of B. anthracis. The assay permits specific, low-level detection (25 fg DNA) of this B. anthracisspscific SNP, even in the presence of environmental DNA extracts containing a 20,000-fold excess of the alternate allele.

From a biodefense and bioforensic perspective, using SNP markers for biological threat agent identification should require clear detection of the targeted SNP sequence in the presence of a background of DNA containing the alternate allele. A recent advance in the area of SNP specific detection was the combination of the fluorogenic 5' nuclease polymerase chain reaction (TaqMan®) and the mismatch amplification mutation assay (MAMA) (9,10). Developed by Glaab and Skopek (10), this novel approach, termed TaqMAMA, utilizes the MAMA to exploit mismatched bases between the PCR primers and the targeted SNP template to support allele-specific amplification, while TaqMan fluorescence allows monitoring of amplification in a real-time, quantitative manner. A powerful attribute of this technique is that it allows for the amplification of low-copy templates with a single nucleotide change in 1,000 fold excess of wild type DNA (10). Here we demonstrate the use of TaqMAMA to selectively amplify and detect B. anthracis-spscific DNA in the presence of complex mixtures of DNA signatures, including signatures from genetically similar near- neighbors.

Materials and Methods

TaqMAMA Primer and Probe Design Sequences flanking the plcR nonsense mutation were obtained either from Genbank, or from sequencing efforts in our laboratory and were aligned using DNASTAR software (DNASTAR, Inc., Madison, Wis.) Primer and probe sequences used were derived from: B. anthracis; B. cereus 3 A, S2-8, and B. thuringiensis HDlOl 1; B. cereus D5; B. cereus AH527; B. cereus D17, B. thuringiensis HD571, HD44; B. cereus F3502/72, R6; B. cereus F2-1; B. cereus R4, ATCC 33018, B. thuringiensis HD1012; B. thuringiensis 97-27; Bacillus spp.

TET2b'-3?a1fid B: "'ϊhWihgtertsis HD682. Additional information on strains is presented in Hill et al. (8). To promote B. anthracis specific amplification, the MAMA primer was designed so that the ultimate 3' base was complementary to the plcR nonsense mutation. The penultimate 3' base was designed to mismatch with the shared sequence between B. anthracis and the near-neighbors sequences (10). The TaqMan® minor groove binding probe and the reverse primer were designed using Primer Express software (Applied Biosystems, Foster City CA) to exploit additional nucleotide differences between B. anthracis and near-neighbor sequences that were proximal to the nonsense mutation (Figure 2).

TaqMAMA PCR protocol

In all experiments, TaqMAMA PCR was conducted in 10.0 μL reactions that contained 600 nM of both forward (TTTGCATGACAAAGCGCTaA) (SEQ ID NO: 100) and reverse primer (G AGTTTG ATGTG AAG GTG AG ACATAATC) (SEQ ID NO: 101) ,25OnM of probe (FAM-TACTTGGACAATCAA-MGB) (SEQ ID NO: 102), IX Invitrogen™ Platinum® qPCR SuperMix-UDG (5 mM MgCl ₂ ), and 1.0 μl of template. Thermal cycling was performed on an ABI 7900 sequence detection system (Applied Biosystems, Foster City CA) with the following conditions: 50° C for 2:00 min, 95° C for 2:00 min, and 40 cycles of 95° C for 15 sec, 60° C for 1:00 min.

Specificity Tests

To initially test the specificity of the assay, 10 pg of DNA from the Bacillus anthracis Ames strain and 29 genetic near-neighbors (see Figure 1 for strains and sequence information) were used as templates in the assay. We also performed PCR on genomic DNA from B. cereus strain 3 A and B. thuringiensis strain HDlOl 1 at 10 pg, 100 pg, 500 pg and 1.0 ng input. We performed 32 replicates of each DNA input level for each strain, with the exception of HDlOl 1 at 500 pg input, which we tested at 64 replicates (288 reactions total).

Sensitivity tests

Sensitivity was determined by analyzing serial ten-fold dilutions of genomic DNA from the B. anthracis Ames strain ranging from 250 pg to 25 fg. To determine assay sensitivity in non- target DNA backgrounds we performed analysis on the same B. anthracis template ranges in the presence of; 50 or 500 pg of DNA from the B. thuringiensis strain HDlOl 1, air filter DNA extracts from a Biodefense monitoring program and a combination of air filter DNA extracts and HDlOl 1 DNA (50 or 500 pg). Results and Discussion

10 pgB. anthracis DNA but did not amplify any of the 10 pg near neighbor DNA templates after 50 thermal cycles. The 29 near neighbors include the 17 listed above and the following isolates: B. cereus strains ATCC 4342, ATCC 14579, F3-27, F3350/87, S2-4 and; B. thuringiensis strains HD 1015, HD 681, HD 288, HD 526, HD 974, HD 30 and HD 50. B. anthracis DNA amplified at an average threshold cycle of 28.46, whereas the near-neighbor templates did not exhibit amplification. Additional information on strains is presented in Hill et al. (8).

To evaluate if the assay would cross react with higher levels of near-neighbor DNA templates that differed by only the plcR nonsense mutation, we performed extensive PCR analysis of genomic DNA from B. thuringiensis HDlOl 1 and B. cereus 3 A. We tested 64 replicates of these near-neighbor templates at 10 pg, 100 pg, 500 pg and 1.0 ng per PCR. The assay did not amplify any of the near-neighbor templates at 10 or 100 pg. However, 2 of the 96 replicates at 500pg input (B. cereus 3A) and one at 1.0 ng (B. cereus 3A) exhibited weak amplification after 40 amplification cycles (mean Ct = 42.9, Ct range = 41.6-45.0). Although these results indicate exceptional specificity of the assay, the rare, low-level cross reactivity with B. cereus 3A at 1.0 ng and 500pg indicates that a weak false positive result could occur in certain instances. In our estimation, this scenario is unlikely to occur during routine environmental monitoring in that it requires fairly high concentrations of a template that differs by only a single nucleotide. B. cereus 3 A and B. thuringiensis HDlOl 1 isolates were selected for specificity testing since they shared identical sequence in the plcR gene fragment with B. anthracis, with the exception of the single nonsense mutation. In our sequence analysis of the plcR gene fragment of near-neighbors, the majority (26/29) of isolates had additional mutations in the sequence fragment that is targeted by the assay. We have not observed the plcR assay to cross-react with these isolates at 1.0 ng input levels (data not shown). Therefore, analyzing 500pg-1.0 ng of genomic DNA from B. cereus 3A and B. thuringiensis HDlOl 1, which we estimate corresponds to approximately 100,000- 200,000 genome equivalents, represents a rare, worse case scenario. Despite this, we suggest that weak positive results in the TaqMAMA assay could be rapidly investigated by using a dual- probe system (as discussed above) that detects the alternate SNP state. This control would differentiate between a very infrequent misamplification of a near neighbor or the legitimate detection of very low levels of the real target.

We then conducted TaqMAMA PCR analysis of 10 fold serial dilutions of B. anthracis DNA (triplicate samples). The average ct values (triplicate analysis) in molecular grade water were as follows: 250 pg, 25.5; 25 pg, 29.0; 2.5 pg, 32.4; 250fg, 35.7; and 25 fg, 39.0 The TaqMAMA assay thus exhibited quantitative detection of the B. anthracis

t ^' eni'plat ^' e'over'a dynamic'r ari'ge and permitted sensitive detection in PCR reactions containing different backgrounds. We compared the sensitivity of the TaqMAMA assay in PCR reactions containing: no background; 50 or 500pg of B. thuringenesis HDlOIl genomic DNA; air filter DNA extracts and; a combination 50 or 500pg of B. thuringenesis HDlOl 1 genomic DNA and air filter extracts. We used HDlOl 1 genomic DNA in these experiments since we did not observe any cross-reactivity at any concentration (see above) in these templates despite extensive PCR analysis. The average threshold cycle values were similar among treatments, although we did consistently measure a slight increase in threshold cycles in samples containing 500 pg HDlOl 1 background and/or air filter extracts, suggesting weak inhibition of the reaction. This inhibition was not alleviated by the addition of 400 ng/ul of BSA to the PCR reaction (11). Interestingly, this apparent inhibition did not impact the threshold of detection of the assay, which permitted routine detection of the B. anthracis specific SNP at template levels as low as 25 fg, even in the presence of air filter extracts containing a 20,000 fold excess of DNA containing the alternate allele (Table 2). It is important to note that the air filter extracts did not cross-react with the assay or impact the specificity of the assay as illustrated by the lack of amplification in air filter extracts and air filter extracts spiked with 100 or 500pg of HDlOl 1 template.

Table 2. Average Threshold cycle (Ct) values for sensitivity test

B. anthracis Experiment" Average Ct (Ct - Ct of control sample) Template

Control Sample HDlOIl Air Filter Air Filter (No Background) DNA Extract ⁰ Extract and HDlOIl DNA

250 pg Expl 24.9 24.4 (-0.5) 26.2 (+1.3) 26.4 (+1.5)

2 25.7 26.9 (+1.2) 26.8 (+1.1) 27.5 (+2.2)

25 pg Expl 28.2 28.2 (0.0) 29.5 (+1.3) 28.9 (+0.7)

2 28.8 30.0 (+1.2) 29.8 (+1.0) 31.6 (+2.8)

2.5 pg Expl 31.0 31.4 (+0.4) 32.8 (+1.8) 33.6 (+2.6)

2 31.9 32.3 (+0.4) 32.6 (+0.7) 34.1 (+2.2)

" 25cng '"ExpT "' 34.6 35.0 (+0.4) 36.4 (+2.2) 35.8 (+1.2) 2 34.2 35.4 (+1.2) 35.4 (+1.2) 35.3 (+1.1)

25 fg ^d Expl 40.4 ^e 40.5 ^f (+0.1) 40.7 ^h (+0.3) 41. l ^f (+0.7)

2 40.6 ^f 41.7 ^g (+l.l) 42.3 ^h (+1.7) 40.9 ^f (+0.3)

^a Ct values are an average of duplicate reactions unless otherwise noted

Experiment: Expl HDlOl 1 DNA background = 50 pg per PCR reaction; Exp2 HDlOl 1 DNA background = 500 pg per PCR reaction

⁰ LO ul of Air Filter DNA extract spiked into PCR reaction. ^d All 25 fg samples were replicated 10 times, the Cts from samples that amplified were averaged. ^e Of the 10 replicates, 7 amplified. ¹ Of the 10 replicates, 9 amplified. ⁸ Of the 10 replicates, 10 amplified. ^h Of the 10 replicates, 8 amplified.

This B. anthracis detection assay represents a significant advance in rapid and specific detection of B. anthracis for several reasons. First, the assay is based upon a well- studied chromosomal marker that is present in B. anthracis but absent in genetic near neighbors. The presence of the plcR nonsense mutation in globally and genetically diverse B. anthracis lineages (8) limits the likelihood of false negative results, whereas the absence of the mutation in B. cereus and B. thuringiensis strains and the specificity of the reaction decreases the probability of false positive results. Second, the sensitivity and specificity of the assay permits low-level detection of the targeted SNP, even in the presence of environmental DNA extracts containing 20,000-fold excess of the alternate allele. Third, the assay is amenable to high-throughput real-time PCR platforms that are currently the mainstay of homeland defense initiatives, such as Biowatch.

In conclusion, the use of the TaqMAMA method to detect the plcR mutation in B. anthracis permits the specific, low-level detection of this biological threat agent in samples containing environmental extracts and/or genetic near neighbor DNA. We anticipate that this ability to selectively amplify and detect low copy number bio-threat agent DNAs with single nucleotide specificity will represent a valuable tool in the arena of biodefense and bioforensics.

References for Example 2: 8. Hill, K. K., L. O. Ticknor, R. T. Okinaka, M. Asay, H. Blair, K. A. Bliss, M. Laker, P. E. Pardington, A. P. Richardson, M. Tonks, D. J. Beecher, J. D. Kemp, A. Kolstø, A. C. Lee Wong, P. Keim, and P. J. Jackson. 2004. Fluorescent amplified fragment length

fϊolyMφhϊsM ^' aMfjβitόf Bacillus anthracis, Bacillus cereus, and Bacillus isolates. Appl. Environ. Microbiol. 70:1068-1080.

9. Cha, R.S., H. Zarbal, P. Keohavong, and W. G. Thilly. 1992. Mismatch amplification mutation assay (MAMA): application to the c-H-ras gene. PCR Methods Appl. 2:14-20. 10. Glaab, W.E., T.R. Skopek. 1999. A novel assay for allelic discrimination that combines the fluorogenic 5' nuclease polymerase chain reaction (TaqMan) and mismatch amplification mutation assay. Mutat. Res. ¥30:1-12.

11. CA. Kreader. 1996. Relief of amplification inhibition in PCR with bovine serum albumin or T4 gene 32 protein. Appl Environ Microbiol. 62:1102-1106.

Example 3.

The rarity of SNPs makes them important diagnostic markers in B. anthracis. SNP evolution suggests unique origins, as it is likely that each point mutation occurred just once in the phylogenetic history of the species. Thus, SNP markers are evolutionarily stable and unlikely to mutate again to either a novel or the ancestral state. This stability can be invaluable for broadly defining strain groups, such as major phylogenetic divisions, as well as specifically defining a particular terminal branch strain. If SNP discovery procedures are intensive and yield a relatively large number of SNPs (hundreds to thousands), multiple loci will be identified along individual phylogenetic branches. As these SNPs provide the same phylogenetic information, they are diagnostically redundant and optimized subtyping assays can be developed by eliminating this redundancy. Following optimization, a relatively small number of SNPs can be used to define major genetic groups (one per group) in a bacterium like B. anthracis.

Canonical characters are diagnostic features that can be used for identifying a particular phylogenetic point in the evolutionary history of a species or set of organisms. In the case of long-branch lengths, there may be multiple phylogenetic characters that could be used, but designating one as canonical greatly reduces diagnostic redundancy. In the evolution of B. anthracis, there are many SNPs that meet these conditions. Hence, we have developed a set of canonical SNPs (canSNP) that identify the deeper nodes in our phylogenetic hypotheses for B. anthracis. To develop these can SNPs, we first had to discover rare SNPs and then determine their phylogenetic positions.

Identification of canSNPs is more efficient if there is 1) an independent initial phylogenetic hypothesis to guide the discovery process, 2) discovery of a large number of SNPs, and 3) an extensive strain collection against which the discovered SNPs can be

φeWe'dV'Sel&tiorf bfthdiniϊial phylogenetic hypothesis is critical, as SNPs are selected as canonical based largely on the fact that they reproduce the major patterns within the initial hypothesis. In the case of B. anthracis, both AFLP (Keim et al., 1997) and VNTR (Keim et al., 2000) markers provided this structure, dividing the B. anthracis phylogeny into several major clades (Keim et al., 2000, Van Ert and Keim, unpublished data). Our goal, therefore, in identifying canSNPs in B. anthracis was to find SNPs that uniquely defined major clades. We achieved this goal by first querying a large number of SNPs against a diverse set of 26 strains from our existing collection of over 1,300 B. anthracis isolates. We then mapped the position of each SNP on our existing, initial phylogenetic hypothesis. One representative SNP marker from each of the major evolutionary branches was then selected as the defining SNP for that clade. Finally, each canSNP was tested against our strain collection of over 1,300 isolates to ensure the validity of its canonical designation.

Routine analysis of SNPs for molecular typing requires an assay that is robust, as well as high capacity. Our preferred system for scoring known SNPs is an allelic discrimination assay using real-time PCR in conjunction with TaqMan-minor groove binding (MGB) proves. This assay is particularly attractive for high-throughput genotyping efforts (large number of samples coupled with a relatively small number of SNPs) since it combines the PCR amplification and detection steps and is also amenable to automation. Taqman-MGB allelic discrimination assays can be rapidly designed around canSNP markers and allow thousands of samples to be analyzed in a single workday. An additional advantage of applying this technology to SNP scoring is that it can be performed on samples with very low DNA levels (sub picogram), making it effective for environmental sampling. The ability to simultaneously perform low-level detection and genotyping of B. anthracis may prove to be an invaluable tool in forensic and biodefense applications. The real-time PCR assays described here evaluate canonical and strain specific SNP loci in the Bacillus anthracis genome. The assays rely upon differential cleavage of allele specific probes to score the SNP state of unknown B. anthracis DNA templates. The real-time and endpoint analysis is performed on an ABI 7900 instrument.

Assay Synopsis:

Canonical SNP assay: The canonical SNP assays are designed to differentiate isolates of Bacillus anthracis and to provide confirmatory analysis of MLVA genotyping of unknown Bacillus anthracis strains. Since amplification of some, but not all, of the canonical SNP markers has been observed in near neighbors of B. anthracis, preliminary analysis of unknown isolates with the plcR B. anthracis-speciRc SNP is recommended prior to

' ^v perfdrmϊng ^' 'fhese'assays. ^' 'αlsb, while the canonical SNP assays described here are capable of differentiating B. anthracis strains into 11 major genetic lineages, the canSNPs collectively provide lower discriminatory power than MLVA. It must be emphasized that the real-time PCR assays only detect differential probe cleavage during PCR amplification of the locus of interest. Unexpected sequence variants, such as SNPs in the priming site can impact amplification efficiency resulting in a false negative result. Also, template quantity and quality can impact assay success and complicate interpretation of the results. Since we do not make efforts to standardize input template amounts, we evaluate samples individually using both real-time and endpoint fluorescent measurements and score the SNP state based upon the preferential cleavage of the allele specific probe.

The Canonical SNP assays appear robust and have been successfully performed on genomic DNA that has been prepared by chloroformύsoamyl alcohol (24:1) extraction as well as simple heat lysis DNA extraction protocols. PCR amplification of genomic DNA is typically performed on material that has been diluted 1:200 in either IX TRIS-EDTA (pH 8.0) or molecular grade water. DNA from heat lysis protocols is typically diluted 1:10 before PCR amplification. Quantification of DNA by pico-green analysis has demonstrated that as little as 10 fg of DNA is sufficient to support the assays.

This assay has been designed to facilitate the amplification and detection of chromosomal SNP markers that are found in the B. anthracis genome. As previously stated, the analysis of these amplicons is performed on an ABI 7900 sequence detection system.

Summary of SNP identification (All in 5'-3' orientation):

B. anthracis specific SNPS: plcR dual probe Bacillus anthracis specific assay (See Figure 16)

CCAATCAATGTCATACTATTAATTTGACAC,PlcR_F2 (SEQ ID NO: 104)

ATGCAAAAGCATTATACTTGGACAAT,PlcR_R2 (SEQ ID NO: 105) PlcRjta, -VIC-CAAAGCGCTTATTCGTATT-MGB (SEQ ID NO: 98) PlcR_ttc,-6FAM-AAAGCGCTTCTTCGTATT-MGB (SEQ ID NO: 103)

Expected product from plcR dual probe

CCAATCAATGTCATACTATTAATTTGAC/ACGATAGTTCAATAGCTTTATTTGCAT

GA/CAAAGCGCTTMTTCGTATT/G/ATTGTCCAAGTATAATGCTTTTGCAT (SEQ ID NO: 106)

CANONICAL SNPST

Branch 1: (See Figure 1) PRIMERS: SNP295- 10-462F: CAAGCGGAACCAAATTTAATCTTT (44) (SEQ ID NO: 48)

SNP295- 10-55 IR: TTCACCGTACGTCATTGTATAATACG (45) (SEQ ID NO:

39)

TAQMAN Probes: SNP295-10 494C FAM: ACCGAAACTTGAAGTC (14) (SEQ ID NO: 36) SNP295-10 494T VIC: AAACCGAAATTTGAAGTC (15) (SEQ ID NO: 74)

PCR Product (90 nt)

CAAGCGGAACCAAATTTAATCTTT/aaagg/AAAACCGAAAYTTGAAGTC/GA TGATAAGGGAAAC/CGTATTAATACAATGACGTACGGTGAA (102) (SEQ ID NO: 75)

Branch 2: fSee Figure 2) PRIMERS:

SNP318-06(Br2)-46 IF: AACGATACCTAAAATCGATAAAG(46) (SEQ ID

NO: 76)

SNP318-06(Br2)-536R: GGCAGAAGGAGCAAGTAATGTT (47) (SEQ ID

NO: 77)

TAQMAN Probes:

SNP318-06(Br2)-495G FAM: CGCCCAGCCTAA (16) (SEQ ID NO: 37)

SNP318-06(Br2)-495A VIC: CGCCCAACCTAAA (17) (SEQ ID NO: 37) PCR Product (70 nt)

AACGATACCTAAAATCGATAAAG/CGACTGC/CGCCCARCCTAAA/CCTAT AACATTACTTGCTCCTTCTGCC (103) (SEQ ID NO: 78)

Branch 3: (See Figure 3)

PRIMERS:

SNP269-23 Br3-46 IF: GCTACTGTCATTGTATAAAAACCTCCTTT (48) (SEQ ID

NO: 52)

SNP269-23 Br3-563R: CGCTTGCCAAGCTTTTTTTC (49) (SEQ ID NO: 56)

TAQMAN Probes:

SNP269-23Br3-493G FAM: TACCTCAAGCTTAATTC (18) (SEQ ID NO: 38)

SNP269-23 Br-493A VIC: CTACCTCAAACTTAATTC (19) (SEQ ID NO: 79)

PCR Product (103 nt)

GCTACTGTCATTGTATAAAAACCTCCTTT/TTC/TACCTCAARCTTAATTC/G ACACGAAAATCTAAATTCCTTTTATATATAATA/GAAAAAAAGCTTGGCAAGCG

(104) (SEQ ID NO: 80)

Branch 4: (See Figure 4) PRIMERS:

WNA-959-02Br4-458F: CCGATACCAGTAAACGACGACAT (50) (SEQ ID NO: 54)

WNA-959-02Br4-533F: CTGGAATTGGTGGAGCTATGGA (51) (SEQ ID NO: 55)

TAQMAN Probes: WNA-959-02Br4-493C FAM: TTGGAATGCCCCTAAT (20) (SEQ ID NO: 39)

WNA-959-02Br4-493T VIC: CTTTGGAATGTCCCTAAT (21) (SEQ ID NO: 81)

PCR Product (76 nt)

CCGATCCAGTAAACGACGCAT/CGCCGTCATA/CTTTGGAATGYCCCTAAT/ CCTTCCATAGCTCCACCAATTCCAG (105) (SEQ ID NO: 82)

Branch 6: (See Figure 6) PRIMERS: SNP3 IF: CATCCATTTTCATTCCTCCTAAACA (52) (SEQ ID NO: 56)

SNP3 IR: TAGAAACCACGCTTCTTGAATGAG (53) (SEQ ID NO: 57)

TAQMAN Probes:

SNP31C VIC: ATATTAAATAGCACATATACC (22) (SEQ ID NO: 40)

SNP3 IT FAM: ATATTAAATAGTACATATACCC (23) (SEQ ID NO: 40)

PCR Product (H i nt)

CATCCATTTTCATTCCTCCTAAACA/AAAAAATATTTTTACACTTTTCTCCTCTCTT ATACAT/ATATTAAATAGYACATATACC/CATC/CTCATTCAAGAAGCGTGGTTTCT A (106) (SEQ ID NO: 83)

Branch 6.2: (See Figure 5)

PRIMERS:

SNP6.2 F: CCGGAAATTGCTATTAGAACGAA (54) -MGB (SEQ ID NO: 58) SNP6.2 R: TCCCAATCTAGCGTTTTTAAGTTCA (55) -MGB (SEQ ID NO:

59)

TAQMAN Probes:

VIC CATCGCCTCGTGCA (24)-MGB (SEQ ID NO: 41) 6FAM CCATCGCCTAGTGC (25)-MGB (SEQ ID NO: 41)

PCR Product (137 nt)

''CeB'βA^TtGϋfαTTAGAACGAA/AAAATATATTGGAATCAAAGAATATA

TCTTCAAAAAATTCTTTGATCAATATGTTGTTGATCATT/CCATCGCCTMGTGCA/ TGGGTATGA/TGAACTTAAAAACGCTAGATTGGGA (107) (SEQ ID NO: 84)

Branch 7: fSee Figure 7) PRIMERS:

SNP24 Br7F: CATTTATTCGCATAGAAGCAGATGA (56) (SEQ ID NO: 60)

SNP24 Br7R: TGTGCCATCAAATAACTCTTTCTCAA (57) (SEQ ID NO: 61)

TAQMAN Probes: SNP24 Br7A FAM ACATATCCACTTCACG (26)-MGB (SEQ ID NO: 85) SNP24 Br7G VIC CATATCCGCTTCACG (27)-MGB (SEQ ID NO: 42)

PCR Product (89 nt)

CATTTATTCGCATAGAAGCAGATGA/GCTTA/CATATCCRCTTCACG/TTAT GGTTCGTTATGAAC/TTGAGAAAGAGTTATTTGATGGCACA (108) (SEQ ID NO: 87)

Branch 8: fSee Figure 81 PRIMERS: SNP14-263 Br8F: TGTTGCACCTTCTGTGTTCGTT (58) (SEQ ID NO: 62)

SNP14-263 Br8R: GTAGTGGCTTCACCGAATGGA (59) (SEQ ID NO: 63)

TAQMAN Probes:

SNP14-263 BrSG 6FAM: CGTTACTGCTGTTCC (28) (SEQ ID NO: 43) SNP14-263 Br8T VIC: AACGTTACTTCTGTTCCT (29) (SEQ ID NO: 86)

PCR Product (78 nt) TGTTGCACCTTCTGTGTTCGTT/GTT/AACGTTACTKCTGTTCCT/TTTGCAA

CTTCTCC/TCCATTCGGTGAAGCCACTAC (109) (SEQ ID NO: 88)

Branch 9: CSee Figure 9) PRIMERS:

SNP14 Br9F: TGCATGCTTCTTCTTACAGAGTAGTTAAT(OO) (SEQ ID NO: 64)

SNP14 Br9R: CGGTCATAAAAGAAATCGGTACAA (61) (SEQ ID NO: 65)

TAQMAN Probes:

SNP14 Br9C FAM: CGATACCTTCTTATCCTC (30) (SEQ ID NO: 44)

SNP14 Br9C VIC: CGATACCTTCTTATCTTC (31) (SEQ ID NO: 44) PCR Product (101 nt)

^• TO'CXTGCTTCTTCTTACAGAGTAGTTAAT/TGTTCAAAAGGTTCGGATATGA TAC/CGATACCTTCTTATCYTC/TTCTATTGTACCGATTTCTTTTATGACCG (110) (SEQ ID NO: 89)

Branch 10: fSee Figure 10) PRIMERS:

SNP925-1F: TTCGCAACTACGCTATACGTTTTAGAT (62) (SEQ ID NO: 66)

SNP925-1R: CAAACGGTGAAAAAGTTACAAATATACG (63) (SEQ ID NO: 67)

TAQMAN Probes:

FAM: ATAATTCTTCGCCGCTTG (32) (SEQ ID NO: 90)

VIC: ATTCTTCTCCGCTTGTT (33) (SEQ ID NO: 45)

PCR Product (82 nt)

TTCGCAACTACGCTATACGTTTTAGAT/GGAG/ATAATTCTTCKCGCTTG/TT AAA/CGTATATTTGTAACTTTTTCACCGTTTG (111) (SEQ ID NO: 91)

Branch 11: ( ^" See Figure 11) PRIMERS: Br 11 853-06F: GGCAATCGGCCACTGTTT (64) (SEQ ID NO: 68)

Br 11 853-06R: GGGTTTCTACTGTGTATGTTGTTAATAAAAAG (65)

(SEQ ID NO: 69) TAQMAN Probes:

VIC CGGCTTTACTTGCATC (34)-MGB (SEQ ID NO: 92)

6FAM CGGCTTTGCTTGC (35)-MGB (SEQ ID NO: 46)

PCR Product (101 nt) GGCAATCGGCCACTGTTT/TTGAA/CGGCTTTRCTTGCATC/ATCCGCAGTTA

ATATACCTAAAAATTCATA/CTTTTTATTAACAACATACACAGTAGAAACCC (112) (SEQ ID NO: 93)

Branch 12: fSee Figure 12) PRIMERS: Brl2 F : GAAGTTAAGTATCAACCAGCAGAAGAAA(66) (SEQ ID NO: 70)

Brl2 R: CCGCCGCCTTGAGCTT (67) (SEQ ID NO: 71)

TAQMAN Probes:

VIC CTTTACTTCTACCATCCC (36)-MGB (SEQ ID NO: 47)

6FAM CTTTACTTCTATCATCCC (37)-MGB (SEQ ID NO: 47) PCR Product (122 nt)

"GXΆGTTAλGTΆTCAACCAGCAGAAGAAA/CAAGTGCTTGGGTAACCTT/CT TTACTTCTAYCATCCC/GTTTGTCATTATCTTCATTTTATTCTTCTTCTTATTAAACC AAGCTCAAGGCGGCGG (113) (SEQ ID NO: 94)

Example 4: Single nucleotide polymorphism assays for highly-specific detection of the Bacillus anthracis Ames strain

Here we identified SNPs that define the lineage of B. anthracis that contains the Ames strain: the strain used in the 2001 bioterrorist attacks in the United States. Sequencing and real-time PCR were used to validate these SNPs across B. anthracis strains including: 1) 88 globally and genetically diverse isolates; 2) isolates that were shown to be genetic relatives of the Ames strain by Multiple-locus Variable Number of Tandem Repeat Analysis (MLVA); and 3) several different lab stocks of the Ames strain, including a clinical isolate from the 2001 letter attack. Six SNPs were found to be highly specific for the Ames strain; four on the chromosome, one on the pXOl plasmid and one on the pX02 plasmid. All six SNPs differentiated the B. anthracis Ames strain from the 88 unique B. anthracis strains while five of the six separated Ames from its close genetic relatives. The use of these SNPs coupled with real-time PCR allows specific and sensitive (< 100 fg of template DNA) identification of the Ames strain. Significantly, this evolutionary and genomics-based approach provides a framework for the discovery of strain-specific SNPs in other bacterial pathogens.

In this study, we used a subset of about 1,000 previously published SNPs (14,16) to identify canSNPs that effectively define the B. anthracis lineage that contains the Ames strain. To locate SNPs with the highest specificity for the Ames strain, we screened these SNPs across a panel of isolates that were identified as close genetic relatives of the Ames strain using high-resolution MLVA subtyping (6, 16; Van Ert and Keim, unpublished). Here we demonstrate the use of strain-specific canSNPs for subtyping B. anthracis for epidemiological and forensic applications. Importantly, this approach can be used to discover additional strain-specific markers in B. anthracis and other clonal pathogens.

Materials and Methods Strains used in this study:

We selected a panel of 89 B. anthracis strains that represents 89 unique MLVA genotypes as described in Keim et al. (6) and includes an Ames strain isolate (Genotype 62).

"In ^" ad'dffl'b'ff, We" iricTϋaea'twb Isolates that were previously identified as Ames [δ Ames (A0814) and a clinical isolate from the 2001 letter attack, (A2012)] and an additional 10 isolates previously shown to be genetically related to the Ames strain by sequencing and MLVA analysis (16; Van Ert and Keim, unpublished).

DNA isolation and quantitation:

DNA was isolated using one of three methods. In the first method, cultures were grown for 24-48 hours in 1.0 ml Brain Heart Infusion media. Cells were pelleted by centrifugation at 5,000 x g for 2 min., and the broth supernatant was removed. Cells were resuspended in 200 μl ATL buffer containing 10% Proteinase K and subjected to 3 freeze thaw cycles (-8O ⁰ C to 95 ⁰ C). Following this, the DNA was purified using a DNeasy Kit according to the manufacturer's instructions (DNeasy protocol, Qiagen, Inc.Valencia, CA). DNA was also isolated using a previously described heat-lysis method (6). In the last method, genomic DNA was prepared as follows (all DNA isolation reagents were obtained from Sigma Chemical Co., St. Louis, Mo unless otherwise noted). Lawn cultures of each isolate were prepared by streaking the individual strains on Trypticase Soy Agar with 5% sheep blood (Hardy Diagnostics, Santa Maria, CA) and grown overnight at 37 ⁰ C. The cells were then harvested and suspended in 11 mL of TE buffer (1OmM Tris [pH 8.0], ImM EDTA). The cell suspension was frozen in liquid nitrogen for 5 min and then thawed in a 65 ⁰ C water bath. This freeze-thaw step was repeated twice. Upon the addition of 225 μL of 10% sodium dodecyl sulfate and 45 μL of proteinase K (20mg/mL), the lysate was rocked gently for 5 min and then incubated in a 65 ⁰ C water bath for 1 hr. Next, 1.5 mL of 5M NaCl was added and the mixture was rocked for 10 min. Then, 1.2 mL of a solution consisting of 10% (wt/vol) hexadecyltrimethyammonium bromide (CTAB) in 0.7 M NaCl was added to the suspension and mixed thoroughly by inversion followed by 5 min incubation at 65 ⁰ C. An equal volume chloroform-isoamyl alcohol (24:1) was then mixed by inversion for 10- 15 min followed by a centrifugation step for 5 min at 5,000 X g. Following centrifugation, the upper viscous phase was collected and again extracted with chloroform-isoamyl alcohol as before. After the final centrifugation step, the upper viscous layer was collected and gently mixed with 0.6 volumes of isopropyl alcohol and the DNA was left to precipitate overnight at -20 ⁰ C. The precipitated DNA was then centrifuged at 5,000 X g for 5 min. The supernatant was removed, the DNA pellet was air dried and resuspended in 500ul TE buffer. DNA was quantified using a Picogreen dsDNA Quantitation Kit (Molecular Probes, Inc., Eugene, OR) according to the manufacturer's protocol. Sample

fl ^' uorescence"\vas"riife'asill(ir&d tiling a TBS-300 Mini-fluorometer (Turner Biosystems, Inc. Sunnyvale, CA).

Identification and screening of Ames strain-specific SNPs About 3,500 SNPs located on the B. anthracis chromosome and plasmids were previously discovered by whole-genome comparative sequencing (16, J. Ravel, unpublished). Using a subset of about 1,000 SNP, Pearson et al. (14) identified thirty-two chromosomal SNPs that were positioned on the phylogenetic branch containing the Ames strain (Figure 1). SNPs located on the B. anthracis plasmids were identified by Read et al. (16) by comparing the sequence of the Ames strain pXOl and pXO2 plasmids to that of the previously published pXOl [B. anthracis Sterne, (12)] and pXO2 [B. anthracis Pasteur, (13)]. The authors indicated that the SNPs exhibited specificity for the Ames strain in relation to the other strains involved in the study, including the closely related A0394 'Texas goat' isolate (see Table 1). Based upon this, two SNPs located on the pXOl plasmid (PS-I, PS-32), and one SNP located on the pX02 plasmid (PS-52) were selected as candidates.

Initial Screening of Ames strain-specific chromosomal SNPs

We used DNA sequencing to screen the thirty-two chromosomal SNPs across a panel of DNA from the Ames strain, from isolates that were genetically similar to the Ames strain, and from two distantly related B. anthracis strains. DNA sequencing was performed according to the manufacturer's protocol (Applied Biosystems, Foster City, CA, USA). The SNPs located on the pXOl and PX02 plasmids were screened against these strains using allelic discrimination real-time PCR.

TaqMan™ Allelic Discrimination assays: TaqMan™ -Minor Groove Binding (MGB) allelic discrimination assays were designed around four of the 32 chromosomal SNPs which exhibited the highest specificity for the Ames strain. In addition, TaqMan™ -Minor Groove Binding (MGB) allelic discrimination assays were designed around the three plasmid SNPs, PS-I, PS-32 and PS-52, reported by Read et al. (16). TaqMan™ MGB probes and primers for the four chromosomal SNPs and the pXOl SNP were designed using ABI Primer Express software and guidelines, with the exception that allele-specific probe lengths were manually adjusted to match melting temperatures (11). The pX02 assay was designed by Applied Biosystems. Probe and primer sequences are listed in Table 3. Each 10.0 μl reaction contained IX ABI Universal Master Mix, 250 nM of each probe, and 600 nM forward and

reverse ^' prϊmers arid 1.0 ^" ul ^" of approximately 350 pg/μl template DNA. For all assays, thermal cycling parameters were 50° C for 2 min., 95° C for 10 min., followed by 40 cycles of 95° C for 15 sec and 60° C for 1 min. The TaqMan™ -MGB assays were used to genotype a DNA collection representing a worldwide panel of 88 diverse B. anthracis strains, Ames relatives and a panel of Ames strains. Real-time and endpoint fluorescent data were collected on the ABI 7900 to confirm robust allele-specific detection of the target sequences and clear endpoint allelic discrimination.

Table 3. Sequences of the primers and probes for the Ames-specific SNPs

SNP Primer Sequences 5 '-^ 3' Probe Sequences 5'->3' SNP change (Ames<→ Non-Ames), Genome Position (GENBANK Accession #)

ASpXOl TGATGGTTTTGATTTCTTAGGCTTT (SEQ 6FAM-AAGGGTCACAACTC

ID NO 95) (SEQ ID NO 72) A - G . 7452 (NC 003980)

CACTTTGGTTGGATGGTTTAATGA (SEQ VIC-AAGGGTCGCAACTC

ID NO 96) (SEQ ID NO 72) ASpX02 GTATCCTGAAATATAAAAGTGTAAAAG VIC-

GTAAAAAATGGA (SEQ ID NO 26) ATTAAGGACTCCCTCJTGG A-C .72924

TT (SEQ ID NO 21) (NC 003981)

GATTCTTCAACGCAATATACCCTACTAA 6FAM- AATTATACTAT (SEQ ID NO 27) AAGGACTCCCTATTGGTT

(SEQ ID NO 21)

Branchl_7 TCACCTCAATGACATCGCCA (SEQ ID 6FAM- NO 28) CAAACCAATACCCCTTT C-A .433287

(SEQ ID NO 22) πsrc 003997)

TTGTTGTGAAGACGGATAACTTTTATG VIC- (SEQ ID NO 29) CAAACCAATAACCCTTT

(SEQ ID NO 22)

Branchl_26 GACGGGAGCCAACCAGAA (SEQ ID NO 6FAM- 30) ATAGCTTTTTTTCTATTCC T-C _^ 4624132

(SEQ ID NO 23) (NC 003997)

CCGTTGAATAAGCAGTATGAAATTTC VIC- (SEQ ID NO 31) ATAGCTTTTTCTCTATTCC

(SEQ ID NO 23)

Branchl_28 AATATCTTTCATACAAGGCGCACTACT 6FAM- (SEQ ID NO 32) CGTTGTAGTTATTTTAC A-C _^ 4929186

(SEQ ID NO 24) (NC 003997)

CCATAATCGTGCTTGTCCAAATC (SEQ VIC- IDNO 33) CGTTGTAGQTATTTTAC

(SEQ ID NO 24)

Branchl_31 GAAGAACAAGCGAAAGACGTACCT VIC-CGGTTCACATfiGCAT (SEQ ID NO 34) (SEQ ID NO 25) A-G _^ 2749543

GTAGTTCATAACGTTTGAAAAAGTAGG 6FAM- (NC 003997) GATA (SEQ ID NO 35) TCGGTTCACATAGCAT (SEQ

ID NO 25)

Sensitivity and Level of detection of Ames-specific TaqMan Assays To determine the limit of detection of the assays, serial dilutions of DNA from an

Ames strain (A0462) and a non-Ames strain (A0488, Vollum), ranging from 100 pg to 10 fg were used as template for the TaqMan™ -MGB assays.

Results' Identification and screening of Ames strain-specific SNPs

Of the thirty-two chromosomal SNPs located along the B. anthracis Ames strain lineage (10), four SNPs (Branchl_7, Branchl_26, Branchl_28 and Branchl_31) separated the Ames MLVA type from all remaining genetic relatives. Notably, this includes a separation of Ames from three closely related Texas isolates. These four SNPs were selected for further testing based upon their specificity for the Ames strain. Of the three plasmid SNPs, PS-52 separated the Ames MLVA type from all remaining genetic relatives, whereas PS-I exhibited less specificity and grouped the Ames strain with a single Chinese strain and the three closely related Texas isolates. The PS-32 SNP exhibited much lower specificity for the Ames strain.

TaqMan™ Allelic Discrimination genotyping assays: To confirm the specificity of SNPs Branch 1_7, Branch 1 26, Branch 1_28, Branch 1_31, PS-I and PS-52 for the Ames strain we used the TaqMan™ allelic discrimination assays to genotype a panel of isolates representing 88 globally and genetically diverse B. anthracis genotypes. The threshold cycle (Ct) values observed in the real-time data were similar among the chromosomal and pX02 assays (Branchl_7, mean = 21.1 Ct, SD± 0.96, range= 18.3-23.3; Branch 1_26, mean = 23.6 Ct, SD± 0.91, range= 20.5-26.0; Branch 1_28 mean = 21.5 Ct, SD± 0.93, range= 18.8-23.2 and Branch 1 31 mean = 22.6 Ct, SD± 1.01, range= 19.5-24.7; and PS- 52, mean = 22.9 Ct, SD± 1.2, range= 19.6-27.7). The pXOl assay exhibited lower Ct values (PS-I, mean = 18.8 Ct, SD± 0.90, range= 16.2-21.3). The post-PCR allelic discrimination plot from these experiments illustrates the unambiguous separation of genotypes for the Ames strain and remaining 'non-Ames' diverse 88 strains. All six SNPs separated the Ames strains from the remaining 88 globally diverse B. anthracis genotypes. Although the PS-I SNP separates Ames from the remaining 88 global strains, it will cluster Ames with three closely related Texas isolates and a single Chinese isolate.

Level of Detection of TaqMan™ Ames-specific assays The TaqMan™ MGB allelic discrimination assays were used to reliably detect and genotype samples containing as little as 100 fg of template DNA (ca. 17 genome equivalents), whereas samples containing 10 fg of template DNA (ca. 1.7 genome equivalents) could be detected and genotyped sporadically. Real-time amplification plots were generated from analysis of a 10-fold serial dilution of template DNA from the Ames strain with the PS-I real-time dual-probe TaqMan™ assay. The post-PCR allelic

discrimination ^' plot ^' from Me ^" same experiment illustrated the unambiguous separation of genotypes for both the Ames and 'non-Ames' (Vollum) strain over a range of template DNA quantities from 100 pg to 10 fg.

Discussion

The identification of strain-specific SNP markers in B. anthracis permits the development of rapid diagnostics to greatly assist in the investigation of biocrimes and natural outbreaks. Forensic and epidemiological investigations can require the analysis of hundreds or even thousands of specimens, including environmental and clinical samples. During the 2001 anthrax outbreak, the CDC used MLVA to subtype over one hundred B. anthracis isolates and several dozen clinical samples (3). Significantly, these researchers used MLVA to include or exclude B. anthracis strains from the epidemiological investigation. Since MLVA requires PCR, post-PCR processing, electrophoresis and fragment sizing, there is a practical limit to the number of samples that can be strain-typed in a timely manner. In contrast, Ames-specific real-time assays allow thousands of DNA samples to be genotyped in a day.

The combination of Ames strain-specific SNPs and real-time PCR also allows for the development of assays that are both specific and sensitive. Five SNPs we identified were highly specific and were only observed in the Ames strains (A2102, A0462, A0814), whereas a single SNP located on the pXOlplasmid (PS-I) partitioned the Ames strain with three closely related Texas isolates and a single Chinese strain. The pXOl assay is still valuable because of its ability to monitor the plasmid composition of an isolate. Our data suggest that the SNPs which define the Ames genetic lineage are evolutionarily stable, since SNPs found in the Ames strain, but not close genetic relatives, were strain-specific when evaluated across a more comprehensive isolate collection (ie. the diverse 88 B. anthracis strains). The stability of these SNPs as diagnostic markers is likely a function of the low mutation rates of nucleotide substitutions in B. anthracis [10-10 per site per generation (20)], B. anthracis's recent evolutionary derivation from B. cereus, and the lack of recombination due to B. anthracis's highly clonal nature (7,14). The rarity of these mutational events within B. anthracis limits the likelihood of a SNP mutating again to a novel or ancestral state and lowers the probability of observing a false positive in the assay (i.e. a non-Ames strain sharing the allele with Ames). The lack of recombination ensures that the few mutational events are restricted to a particular clade. Our combinatorial use of six SNPs vastly increases confidence in the inclusion/exclusion of a sample as the Ames strain. We have optimized and used one chromosomal marker (Branch 1_31) and two plasmid markers (PS-I, PS-52) on 266

bliή'dea'pfbϊicϊeri'cy'sampres'and achieved 100% accuracy in discriminating Ames versus non-Ames strain templates over a range of DNA levels (data not shown). The Ames-strain specific PCR assays were sensitive; allowing reliable detection and genotyping of samples containing 100 fg of template DNA, which we estimate corresponds to approximately 17 genome equivalents. It is important to point out that the distinct genotypic clustering of samples in the endpoint analysis and the similar Ct values observed among B. anthracis strains argues against the presence of unexpected sequence variants (unexpected polymorphisms in probe/primer sites) in our diverse B. anthracis strain panel. If present, unexpected sequence variation among diverse strains can dramatically impact assay performance that ultimately results in less sensitivity and higher thresholds of detection.

One limitation of real-time PCR is its inability to quantitatively identify minor genetic variations in a mixture of molecules. For example, a mixture of Ames strain DNA and a non- Ames strain DNA would be detectable as a "heterozygote" if these were equally represented (e.g., 50:50). In our experience (data not presented), real-time PCR mixture detection is sensitive to 75 :25, but not consistently for 90: 10 mixtures. This is important because bacteria can easily reach very large populations sizes making even rare events somewhat plausible. However, if a single cell in a large colony (e.g., >109 cells) mutated at one of the six Ames SNP loci, real-time PCR would not detect this one in a billion variant. The real-time PCR genotyping result would correctly identify the colony as Ames or non-Ames depending upon its progenitor cell. Hence, the chimeric nature of very large bacterial populations is largely ignored by current technologies due to a lack of mixture resolution capacity (for a possible technological exception see reference 2). The likelihood that a different lineage of B. anthracis would convergently evolve to match this six-loci genotype is vanishingly small (e.g., the product of the individual 6 individual loci mutation rates : ~ 10-60) .

Examining SNPs with varying specificity for the Ames strain also provides insights on the phylogeny of the Ames evolutionary lineage. Based upon our SNP analyses, the nearest relatives to the Ames strain include two isolates cultivated from cattle in Texas in 2001 (Source: Alex Hoffinaster, CDC) and a previously reported isolate cultivated from a goat in Texas in 1997 (12). These findings are supported by MLVA data and are consistent with the knowledge that the Ames strain was originally isolated from cattle in Bill Hogg County, Texas in 1981. The isolation of two of these Ames relatives in 1997 and 2001 suggests the Ames lineage is endemic in this region. It is interesting that the remaining genetic near relatives to the Ames strain were isolated from human outbreaks in China (1957, 1962), suggesting the Chinese and Texas isolates share a common ancestral lineage.

"lnterMtϊόn"aI"tfadg""όT 'spore contaminated products (bone meal, wool, etc.) can facilitate such long distance dispersal of B. anthracis and may explain this geographically distant relationship. Evaluating SNP data in relation to higher resolution genotyping data (MLVA genotypes) provides for fine scale phylogenetic hypotheses which can be used to guide strain- specific SNP discovery. The applicability of this approach is not limited to B. anthracis, and we expect this strategy will be used to identify strain specific SNPs in other pathogens and biowarfare agents. For example, high resolution VNTR markers have been identified in Yersinia pestis (8) and whole-genome sequence comparisons of this pathogen are currently underway. As whole-genome sequences and high resolution molecular typing methods become available for biological threat agents, this strategy could be readily applied in the forensic and biodefense arena to develop assays coupling low-level detection with highly- specific strain typing.

In conclusion, our strategy permits identification of SNPs that are diagnostic for narrowly defined B. anthracis genetic lineages. The Ames strain-specific assays are based on six selected genomic differences (out of 32) between Ames and its genetic relatives and work at the single molecule limit. Hence, we are approaching the theoretical limits for both specificity (single nucleotide) and sensitivity (single molecule) for strain sub-typing.

References 1. Easterday, W. R., M. N. Van Ert, T. S. Simonson, D. M. Wagner, L. J. Kenefic, C. J. AHender, and P. Keim. 2005. Use of single nucleotide polymorphisms in the plcR gene for specific identification of Bacillus anthracis. J. Clin. Microbiol. 43:1995-1997.

2. Easterday, W. R., M. N. Van Ert, S. Zanecki, and P. Keim. 2005. Specific detection of Bacillus anthracis using a TaqMan™ mismatch amplification mutation assay. Biotechniques. 38:731-735.

3. Hoffmaster, A. R., C. C. Fitzgerald, E. Ribot, L. W. Mayer, and T. Popovic. 2002. Molecular subtyping of Bacillus anthracis and the 2001 bioterrorism-associated anthrax outbreak, United States. Emerg. Infect. Dis. 8:1111-1116.

4. Hurtle, W., E. Bode, D. A. Kulesh, R. S. Kaplan, J. Garrison, D. Bridge, M. House, M. S. Frye, B. Loveless, and D. Norwood. 2004. Detection of the Bacillus anthracis gyrA gene by using a minor groove binder probe. J. Clin. Microbiol. 42:179-85.

5. Keim, P., A. Kalif, J. Schupp, K. Hill, S. E. Travis, K. Richmond, D. M. Adair, and M. Hugh- Jones. 1997. Molecular evolution and diversity in Bacillus anthracis as detected by amplified fragment length polymorphism markers. J. Bacteriol. 179:818-824. 6. Keim, P., L. B. Price, A. M. Klevytska, K. L. Smith, J. M. Schupp, R. Okinaka, P.

J. jacksόή, and Ml ETHugH-Jones.2000. Multiple-locus variable-number tandem repeat analysis reveals genetic relationships within Bacillus anthracis. J. Bacteriol. 182:2928-2936.

7. Keim, P., M. N. Van Ert, T. Pearson, A. J. Vogler, L. Y. Huynh, and D. M. Wagner. 2004. Anthrax molecular epidemiology and forensic: using the appropriate marker for different evolutionary scales. Infect. Genet. Evol. 4:205-213.

8. Klevytska, A. M., L. B. Price, J. M. Schupp, P. L. Worsham, J. Wong, and P. Keim.2001. Identification and characterization of variable-number tandem repeats in the Yersinia pestis genome. J. Clin. Microbiol. 39:3179-3185. 9. Lowe, C. A., M. A. Diggle, and S. C. Clarke. 2004. A single nucleotide polymorphism identification assay for the genotypic characterisation of Neisseria meningitidis using MALDI-TOF mass spectrometry. Br. J. Biomed. Sci. 61(l):8-10.

10. Moorehead, S. M., G. A. Dykes, and R. T. Cursons. 2003. An SNP-based PCR assay to differentiate between Listeria monocytogenes lineages derived from phylogenetic analysis of the sigB gene. J. Microbiol. Methods. 55:425-432.

11. Morin, P. A., R. Saiz, and A. Monjazeb. 1999. High-throughput single nucleotide polymorphism genotyping by fluorescent 5' exonuclease activity. Biotechniques.27:538- 552.

12. Okinaka, R.T., K. Cloud, O. Hampton, A. R. Hoffmaster, K. K. Hill, P. Keim, T. M. Koehler, G. Lamke, S. Kumano, J. Mahillon, D. Manter., Y. Martinez,

D. Ricke, R. Svensson and P. J. Jackson. 1999. Sequence and organization of pXOl, the large Bacillus anthracis plasmid harboring the anthrax toxin genes. J. Bacteriol. 181: 6509-15.

13. Okinaka, R., K. Cloud, O. Hampton, A. Hoffmaster, K. Hill, P. Keim, T. Koehler, G. Lamke, S. Kumano, D. Manter, Y. Martinez, D. Ricke, R. Svensson, and P. Jackson. 1999. Sequence, assembly and analysis of pXOl and pX02. J. Appl. Microbiol. 87 (2):261-262.

14. Pearson, T., J. D. Busch, J. Ravel, T. D. Read, S. D. Rhoton, J. M. U'Ren,

T. S. Simonson, S. M. Kachur, R. R. Leadem, M. L. Cardon, M. N. Van Ert., L. Y. Huynh, C. M. Fraser, and P. Keim.2004. Phylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms from whole-genome sequencing. Proc. Natl. Acad. Sci. 101:13536-13541.

15. Price, L. B., M. E. Hugh-Jones, P. J. Jackson, and P. Keim. 1999. Genetic diversity in the protective antigen gene of Bacillus anthracis. J. Bacteriol. 181:2358- 2362.

T6. iKea^ ^" ¥i ^" !b ^' ., S ^' i'fc $aϊzberg, M. Pop, M. Shumway, L. Umayam, L. Jiang, E. Holtzapple, J. D. Busch, K. L. Smith, J. M. Schupp, D. Solomon, P. Keim, and C. M. Fraser. 2002. Comparative genome sequencing for discovery of novel polymorphisms in Bacillus anthracis. Science. 296:2028-2033. 17. Stephens, A. J., F. Huygens, J. Inman-Bamber, E. P. Price, G. R. Nimmo, J. Schooneveld, W. Munckhof, and P. M. Gifford. 2006. Methicillin-resistant Staphylococcus aureus genotyping using a small number of polymorphisms. J. Med. Microbiol. 55:43-51.

18. U'ren J.M., M. N. Van Ert, J. M. Schupp, W. R. Easterday, T. S. Simonson, R. T. Okinaka, T. Pearson, and P. Keim. 2005. Use of a real-time PCR TaqMan™ assay for rapid identification and differentiation of Burkholderia pseudomallei and Burkholderia mallei. J. Clin. Microbiol. 43:5771-5774.

19. Van Ert, M. N., S. A. Hofstadler, Y. Jiang, J. D. Busch, D. M. Wagner, J. J. Drader, D. J. Ecker, J. C. Hannis, L. Y. Huynh, J. M. Schupp, T. S. Simonson, and P. Keim. 2004. Mass spectrometry provides accurate characterization of two genetic marker types in Bacillus anthracis. Biotechniques.37:642-651.

20. Vogler, A. J., J. D. Busch, S. Percy-Fine, C. Tipton-Hunton, K. L. Smith, and P. Keim. 2002. Molecular analysis of rifampin resistance in Bacillus anthracis and Bacillus cereus. Antimicrob. Agents Chemother. 46(2):511-513. 21. Wahab, T. S. Hjalmarsson, R. Wollin, and L. Engstrand. 2005. Pyrosequencing

Bacillus anthracis. Emerg. Infect. Dis. 11:1527-1531.

22. Walters J. J. , W. Muhammad, K. F. Fox, A. Fox, D. Xie, K. E. Creek, and L.

Pirisi.2001. Genotyping single nucleotide polymorphisms using intact polymerase chain reaction products by electrospray quadrupole mass spectrometry. Rapid Commun. Mass Spectrom. 15 (18): 1752-1759.