Field of the Invention

The present invention is directed to a novel method for the purification of mammalian catechol-O-methyltransferase (COMT), the cloning of the cDNA representing the full-length COMT mRNA and production of the protein coded thereby by recombinant DNA technology.

BACKGROUND OF THE INVENTION ,

Catechol-0-methyltran.sferase (EC 2.1.1.6, herein "COMT") is an enzyme that catalyzes the transfer of a methyl group from S-adenosyl-L-methionine to one of the phenolic hydroxyl groups of a catechol substrate (Axelrod, J. et al., J. Biol. Chem. 233:702-705 (1958); Casey, M.L., et al . , Am. J. Obstet. Gynecol. 145:453-457 (1983)). In mammals, this O-methylation reaction is physiologically important in the enzymatic inactivation of catecholart une hormones and neurotransmitters, such as epinephrine, norepmephrine and dopamine (Ball, P. et al., J. Clin. Endocrinol. Metab. 34:736-746 (1972); Ball, P. et al., Eur. J. Biochem. 26:560-569 (1972); Guldberg, H.C. et al., Pharmacol. Rev. 27:135-206 (1975); Grossman, M.H. et al., J. Neurochem. 44:421-432 (1985)). The enzyme has also a significant role in the detoxification of xenobiotic catecholamines and inactivation of many neuroactive catechol drugs such as L-dopa, α-methyldopa, and isoproterenol (Borchardt, R.T., in Enzymatic Basis of Detoxification, Vol. 2, Jacoby, ed., pp. 43-62, Academic Press, New York (1980)). Thus, in the presence of COMT, the biological half lives of certain neuroactive drugs, like L-DOPA, α-methyl DOPA and isoproterenol is shortened.

In certain medical conditions where catecholamine hormones or neurotransmitters are in limited supply or being e.xogenously administered to a patient, it is desirable to inhibit the patient's native COMT activity. This has led to the development of COMT inhibitors that are administered, for example, to Parkinson's disease patients and which increase the efficiency of the medication in Parkinson's disease (Guldberg, H.C. et al. , Pharmacol. Rev. 27:135-206 (1975); Linden, I-B. et al., J. Pharmacol. Exp. Ther. 247:289-293 (1988); Manniεtδ, P.T. et al., Trends Phyεiol. Sci. 10:54-56 (1989)).

In addition, on the basis of immunohistochemical localization studies, it has been proposed that COMT may function as a physiological barrier for catecholamines (Kaplan, G.P., et al. Brain Res. 204:353-360 (1981)). For example, the function of COMT in placenta may be to prevent the passage through the placenta of an excessive amount of biologically active catecholamines noxius to the fetus (Castren, 0., et al., Acta Obstet. Gynec. Scand. 53:41-47 (1974); Saarikoski, S., Acta Physiol. Scand. (Suppl. ) 42:5 (1972); Nandakumaran, M. , et al. , Placenta 4:57-64 (1983); Barnea, E.R., et al., Am. J. Perinatol. 5:121-127(1988)). Decreased COMT activity in placenta has been detected in pregnancies associated with toxemia and chronic hypertension (Barnea, E.R., et al. , Am. J. Perinatol. 5:121-127 (1988)).

Research concerning COMT has mainly been directed to the rat enzyme but a few studies of the human enzyme have also been performed (Veser, J., et al., Chromatographia 22:404.406 (1986); Rhee, J., Korean Biochem. J. 21:60-67 (1988); Assicot, M., et al., Eur. J. Biochem. 12:490-495 (1970); Tong, J.H., et al., Can J. Biochem. 55:1108-1113 (1977); Borchardt, R.T., et al., Biochemica et Biophysica Acta 522:49-62 (1978); Bade, P., et al., Life Sciences

19:1833-1844 (1976); Grossman, M.H. , et al., Biochem. Biophys. Res. Comm. 158:776-782 (1989)); Tilgmann, C, et al. Febs. Letters 264:95-99 (1,990)).

Human COMT differs from rat COMT in activity levels, molecular size, kinetic properties, stability and response to some inhibitors (White, H.L., et al., Biochem. J. 145:135-143 (1975)). For example, the molecular weight of the enzyme has been reported to be 23-25 kilodaltons (kDa) for rat (Tilgmann, C, et al., Febs. Letters 264:95-99 (1990)), 59 kDa and 49 kDa for human placenta (Gugler, R. , et al . , Biochim. Biophys. Acta 220:10-21 (1970); Darmenton, P., et al., Biochimie 58:1401-1403 (1976)) and 25-28 kDa for human liver and brain (Jeffery, D.R. , et al . , J. Neurochem. 44:881-884 (1985)). The published isoelectric points are 5.0-5.2 for rat enzyme and ,5.5 for human enzyme, respectively (White, H.L., et al . , Biochem. J. 145:135-143 (1975)). S-COMT activity is expressed in the placenta from the third month of pregnancy and its level seems to be constant until the full term (Castren, O., et al., Acta Obstet. Gynec. Scand. 53:41-47 (1974)).

COMT activity is present in many mammalian tissues including liver, brain, kidney, gut, uterus and placenta. The highest COMT activities have been reported in liver, kidney, uterus and placenta (Axelrod, J., et al . , J. Neurochem. 5:68-71 (1959); Iiεalo, E., et al., Ann. Med. Exp. Fenn. 45:253-257 (1967); Guldberg, H.C., et al . , Pharmacol. Rev. 27:135-206 (1975); Inoue, K., et al . , in Structure and Function of Monoamine Enzymes, Usdin et al., eds., pp. 835-859, Dekker, NY (1977). Rivett, A.J., et al . , J. Neurochem. 40:215-219 (1983); Barnea, E.R., et al., Am. J. Perinatol. 5:121-127 (1988); Nisεinen, E., et al . , Life Sci 42:2609-2614 (1988)).

COMT exists in at least two forms in rat and human

tissues. In all rat and human tissues studied, the majority of the enzyme is found in the cytosol as a soluble form (S-COMT). S-COMT activity has been meaεured for example in human placenta (Gugler, R., et al., Biochim. Biophys. Acta 220:10-21 (1970); Darmenton, P., et al. , Biochimie 58:1401-1403 (1976)), liver (Ball, P., et al., Eur. J. Biochem. 21:517-525 (1971); Tilgman, C, et al., FEBS Lett. 264:95-99 (1990)) and brain (Jeffery, D.R., et al. , J. Neurochem. 44:881-884 (1985)) from which the enzyme haε also been partially purified and characterized.

In addition, a membrane associated form of COMT (MB-comt) activity has bee reported to be aεεociated with microsomal fractionε extracted from, for example, human brain (Jeffrey, D.R., et al., J. Neurochem. 42:826-832 (1984); Rivett, J.A., et al. Biochemiεtry 21:1740-1742 (1982)), liver (Ball, P., et al. Eur. J. Biochem 26:560-569 (1972)), lymphocytes (Sladek-Chelgren, S., et al., Biochem. Genetics 19:1037-1053 (1981)) and erythrocytes (Baron, M. , et al. , Biological Psychiatry 17:265-270 (1982)). The amount of MB-COMT varies in different tisεues from less than 1% to almost 30% of the total contents of COMT in rat and human brain (Inscoe, J.K. et al. , Biochem. Pharmacol. 14:1257-1263 (1965); Aεεicot, M. et al. , Biochemie 53:871-874 (1971); Borchardt, R.T. et al. , Life Sci. 14:1089-1100 (1974); White, H.L. et al., Biochem. J. 145:135-143 (1975); Roth, J.A., Biochem. Pharmacol. 29:3119-3122 (1980); Rivett, A.J. et al., J. Neurochem. 40:215-219 (1983); Niεsinen, E. et al. , Life Sciences 42:2609-2614 (1988)).

S-COMT and MB-COMT appear to have different molecular weights. A 23 kDa protein corresponds to the S-COMT form of the enzyme and a 25-26 kDa protein to the MB-COMT (Asεicot, M., et al., Eur. J. Biochem. 12:490-495 (1970); White, H.L. et al., Biochem. J.145:135-143 (1975); Tong, J.H. et al. , Can. J. Biochem. 55:1108-1113 (1977); Rivett, A.J. et al. , J.

Neurochem. 40:215-219 (1983); Grossman, M.H. et al. , J. Neurochem. 44:421-432 (1985); Heydorn, W.E. et al. , Neurochem. Int. 8:581-586 (1986)). In addition, larger molecular weight immunoreactive COMT polypeptides have been repeatedly found (Huh, M.M. et al., J. Biol. Chem. 254:299-308 (1979); Grossman, M.H. et al., J. Neurochem. 44:421-432 (1985)).

The 23 kDa protein can exist in three different isoelectric forms, pi 5.1, 5.2, or 5.3. The apparent MB-COMT from rat liver, kidney and brain has a pl of 6.2 and it is localized to the outer mitochondrial membrane (Grossman, M.H. et al., J. Neurochem. 44:421-432 (1985)).

The primary difference-between the two enzyme species has been the higher affinity of MB-COMT to catechol subεtrateε than that of S-COMT (Rivett, A.J. et al. , J. Neurochem. 39:1009-1016 (1982); Rivett, A.J. et al. , J. Neurochem. 40:215-219 (1983)). The molecular basiε behind the different forms of the enzyme, e.g., whether they represent separate gene products or modifications of a single polypeptide, is at present "unknown. MB-COMT is tightly associated with membranes, and can be released only by solubilization of the membranes by detergent. Even if this could indicate that MB-COMT is an intergrad membrane protein, as suggested by Jeffery and "Roth (Jeffery, D.R., et al., J. Neurochemistry 42:826-832 (1984)), the mechanism of the membrane association of the-'MB-form is still unknown.

COMT purification has historically been very difficult. For example, human COMT is highly unεtable during extraction. This has hampered development of COMT inhibitors and COMT studies in general. The art has been unable to develop a method for the purification of sufficient COMT from any source to the requisite degree of purity necessary for sequence analysiε. Such information iε necessary for the

development of better COMT inhibitors for administration to patients who would benefit from an inhibition of the activity of their native COMT. In addition, a εource and method of preparing highly purified COMT would allow the preparation of εpecific antibodieε thereto, for uεe in aεsays for measuring catecholamine hormones and neurotransmitters, such as adrenaline and dopamine.

A method for purifying COMT that would permit COMT sequence determination would greatly facilitate the cloning of COMT genetic sequences for uεe in εuch inhibitor development. Current εourceε of native COMT cannot provide the large amountε of highly purified COMT enzyme required for the development of εuch inhibitorε. A recombinant εource of COMT genetic sequence, for example, COMT DNA, and sense and antisense RNA, is also desirable for use aε diagnostic probes for monitoring COMT activity and expression in health and disease stateε.

SUMMARY OF THE INVENTION

Recognizing the medical need for a better underεtanding of S-COMT and MB-COMT action at the molecular level, and cognizant of the need for recombinant COMT εequenceε for εuch εtudieε, the inventorε have inveεtigated the inability of the art to εuccessfully purify any COMT enzyme from any εource to the degree of purity necessary for such molecular analysis. These studieε have culminated with the development of a novel method for the isolation of highly purified mammalian COMT, such isolation providing the requisite degree of purity for protein εequence analyεiε. The isolation of highly purified COMT, and the determination of COMT animo acid εequence information allowed the inventorε to clone COMT from both rat and human εources, and to identify COMT genetic sequences.

According to the invention, there is first provided a

method for the isolation of pure COMT protein, such method providing the high degree of COMT protein purity required for COMT protein sequence determinations.

According to the invention, there is further provided the amino acid sequence of COMT from rat liver and human placenta, for both the soluble form (S-COMT) and the membrane associated form (MB-Comt) of the enzyme.

According to the invention, there is furher provided COMT antibody directed against rat liver COMT and human placenta COMT.

& 1

According to the invention, there are further provided COMT genetic sequences, such genetic sequenceε including native and recombinant COMT DNA, cDNA, RNA and anti-εense RNA, of rat liver and human placenta COMT, for both the soluble form (S-COMT) and the membrane associated form (MB-COMT) of the enzyme.

According to the invention, there are further provided expression vectors containing such genetic sequences, hosts transformed with such expre-sεion vectors, and methods for producing the genetically engineered or recombinant COMT protein.

COMT cDNA, recombinant protein, antisense RNA and antibodies provided by the invention are useful as diagnostic probes for monitoring the activation and involvement of COMT protein activity expression in health and disease.

BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1. Anion exchange chromatography of rat liver COMT. MonoQ, HR 5/5 (High Resolution column with a diameter of 5 mm and a length of 5 cm) , eluted with a gradient of "100 % A, 0 % B" -> 35 % A → 65 % B" in 20 in where A = (20 mM Triethanolamine acetate, pH 7.2) and B = (20 mM triethanolamine acetate, ph 7.2 plus 1 M NaCl) .

Figure 2. Reverse phase chromatography of the COMT active fraction from anion exchange (Mono Q) chromatography on a 0.43 x 3 cm TM250 (Cl) column. Proteins were eluted with a linear gradient (0-50% in 30 min) of acetonitrile in 0.1% trifluoroacetic acid. Peakε 1 and 2 were collected.

Figure 3. Desalting of alkylated (4-vinylpyridine) peaks 1 and 2 from the reverse phase chromatography on a TSK TMS250 column (0.46 x 4 cm). A linear gradient of acetonitrile (20-50% in 30 min) in 0.1% trifluoroacetic acid was used for elution. Detection was at 218 nm. Peaks 21.48 ("X" and COMT) from both separationε were collected and the proteinε εubjected to trypεin digestion.

Figure 4. Reverse phase chromatography of the tryptic peptides from the rat liver COMT enzyme. About 5 μg of purified, alkylated (4-vinylpyridine) COMT was treated with TPCK-trypεin and the resulting peptides εeparated on a 0.46 x 10 cm Vydac 218TPB5 column. For elution, a linear gradient of acetonitrile (0-60% in 90 minuteε) in 0.1% trifluoroacetic acid waε used at a flow of 1 ml/min. Chromatography was monitored at 218 nm and peptides collected manually and dried in a vacuum centrifuge and stored dry at -20°C prior to the sequence analysiε. The numberε refer to the peptideε subjected for sequence analysis.

Figure 5. Southern hybridization of DNAs isolated from rat cell lines L6J1 (lanes 1 and 3) and XC (laneε 2 and 4). The DNAs were digested with EcoRI (lanes 1 and 2) or Hindlll (lanes 3 and 4), analyzed in a 0.8% neutral agarose gel and blotted on a nylon membrane. The membrane waε hybridized with the same COMT-specific probe as in Figure 8. Hindlll- digested DNA from the bacteriophage lambda was used as a molecular weight marker.

Figure 6. Partial restriction map and the sequencing strategy of rat liver COMT. The upper part represents the partial restriction map where the thick line corresponds to the sequence derived from the cDNA clone and thin line the sequence derived from the genomic clone. In the middle part, the shaded box representε the rat liver COMT coding region and the open box the untranslated 3' region. The putative polyadenylation signal, poly(A) , iε εhown in the sequence derived from the rat COMT genomic clone. The arrows represent the direction and extent of the sequence data generated by each of the oligo primers used.

Figure 7. Nucleotide sequence of the rat liver COMT and the deduced amino acid sequence. The nucleotides are numbered on the left and the amino acids on the right. The nucleotides from +42 to +1340 and the 3' "a)" sequence are dreived from the rat liver cDNA clone. The nucleotides from -100 to +41 and the 3' "b)" sequence are derived from the rat genomic clone. The underlined amino acids have been verified by sequencing the tryptic peptides. The double underlined sequence is the putative polyadenylation signal. The DNA sequence is SEQ ID NO. 24. The protein sequence iε SEQ ID NO. 23.

Figure 8. Northern hybridization and in vitro translation of the mRNA f*rom rat liver. Ten μq of

polyadenylated rat liver RNA waε analyzed in a 1% agaroεe- formaldehyde gel, blotted onto a nylon filter and hybridized with a 209 bp EcoRI/Pεtl-fragment DNA fragment from the coding region of the COMT cDNA clone (lane 1). Two μg of polyadenylated RNA waε tranεlated in vitro in rabbit reticulocyte lyεate εupplemented with L-[ ³⁵ SJmethionine. Immunoprecipitation of the trahεlated proteinε waε performed uεing rabbit preimmune εerum (lane 2) or anti-COMT antiεerum (lane 3) and the precipitateε were analyzed in a 10% polyacrylamide gel.

Figure 9. Localization of the 5'end of the COMT specific transcript ^' ε by primer extension. Twenty-five μg of polyadenylated (lane 1) or total (lane 2) rat liver RNA was hybridized with an 18-mer oligonucleotide primer ( correεponding to nucleotideε 40-57 in Figure 7) and elongated by reverse transcription. The obtained cDNA fragmentε were analyzed in a 6% urea-polyacrylamide gel. A sequencing ladder was run in the same gel to determine the distances (in bp) of the 5' ends from the first nucleotide of the COMT coding region.

Figure 10. Organization and partial reεtriction map of the human placental COMT cloneε. Open boxes indicate the putative ORF for COMT and solid lines the putative noncoding sequences. The two first ATGε in clones pHPC7 and 14 are shown, the latter ATG, shown also in clones pHPC3 and 22, being the initiating codon for S-COMT. The positionε of TGA tranεlation εtop signal and AATTAA polyadenylation signal are indicated. The undefined DNA sequence (about 1 kb) in the clone pHPC22 is εhown by a dotted line.

Figure 11. DNA sequence [SEQ ID NO. 25 for panel "A" and SEQ ID NO. 27 for panel "B"] and deduced amino acid sequence [SEQ ID NO. 26 for panel "A" and SEQ ID NO. 28 for panel "B"] of the COMT cDNA clone pHPC7 (A), and of the 3'

and of the 3' end of the clone pHPC3 (B). The numbering of the nucleotides εtartε from the firεt nucleotide after the Eco RI restriction site in the clone pHPC7 (A) and, for comparison, the same numbering is shown also in the clone pHPC3 (B). The amino acidε are indicated εtarting from the firεt tranεlation initiation codon in the COMT reading frame. Tranεlation termination codon is marked with three asteriskε and the putative polyadenylation signal is underlined.

Figure 12. Hydropathy plots (according to Kyte and Doolittle (Kyte, J., et al. , J. Mol. Biol. 157:105-132 (1982)) of human and rat deduced COMT polypeptides. The human amino acid sequence (panel "A") is derived from the cDNA clone pHPC7, starting from the first AUG codon in the COMT ORF, and the rat amino acid sequence (panel "B") is combined from the liver cDNA sequence and the genomic sequence. The rat plot startε at the ATG sodon 45 amino acids upstream from the ATG codon of the S-COMT open reading frame (ORF). The position of the start of the S-COMT is indicated by an arrow. Positive values repreεent increaεed hydrophobicity.

Figure 13. Compariεon of human [SEQ ID NO. 26] and rat [SEQ ID NO. 23] COMT amino acid sequences, deduced from the DNA sequences. Identical amino acids are connected by two dots and similar amino acids by one dot. Comparison startε at the first methionine in the COMT ORF, as described in Figure 12. The sequence of the S-COMT starts at amino acid 44 in the rat and at amino acid 51 in the human sequence.

Figure 14. In vitro translation of human COMT RNAs transcribed by bacterial RNA polymerase. Translations were performed as described in rabbit reticulocyte lysate. Lane 1: marker; lane 2: clone pHPC3 without microsomal membranes; lane 3: with microsomal membranes; lane 4: clone pHPC7 without microsomal membranes; lane 5: with microsomal memranes; lane 6: β-lactamaεe without microsomal membranes;

lane 7: with microsomal membranes.

Figure 15. Sedimentation of in vitro produced human COMT polypeptides with microεomal membraneε. In vitro lyεates with microsomal membranes, shown in Figure 14, were centrifuged at 100,000 g for 1 h, and supernatant fractions and pellets analysed separately in SDS-polyacrylamide gels. Lane 1: MW marker; lane 2: pHPC3 clone, pellet fraction; lane 2: supernatant fraction; lane 3: pHPC7 pellet fraction; lane 4: supernatant fraction; lane 5: β-lactamase pellet fraction; lane 6: εupernatant fraction. ³⁵ S labelled productε were analyzed in SDS-polyacrylamide gelε and fluorographed.

Figure 16. Southern blot of chromoεomal DNA from canine, monkey and human cell lineε. The DNAε were digeεted with Eco RI (E) and Hind III (H) restriction enzymeε, analyεed in a 0.8 % agaroεe gel and blotted onto a nylon filter. Multiprimed human placenta cDNA Eco RI-Kpn I 505 bp fragment was used as a probe. Lane I: canine D-17 cells; 2: monkey Vero veils; 3: human Chang liver cells; 4: human embryonic intestine 407 cells; 5: human HeLa cells; 6: human K562 cells. The positions of Hind III restriction fragmentε of bacteriophage λ DNA are indicated.

Figure 17. Northern blotting of human placenta (lane 1) and rat liver (lane 2) poly A containing RNA. 5 μg of RNA waε analyzed in a denaturing agaroεe gel and the probe waε aε in Figure 16. The poεitionε of commercial RNA MW-εtandardε are indicated.

DEFINITIONS

In the description that follows, a number of terms used in recombinant DNA (rDNA) technology are extensively utilized. In order to provide ¹ a clear and consistent understanding of the specification and claims, including the εcope to be given such terms, the following definitions are provided.

Gene. A DNA εequence containing a template for a RNA polymeraεe. The RNA transcribed from a gene may or may not code for a protein. RNA that codes for a protein is termed messenger RNA (mRNA) and, iτι eukaryotes, iε tranεcribed by RNA polymerase II. However, it is also known to conεtruct a gene containing a RNA polymerase II template wherein a RNA sequence is transcribed which has a sequence complementary to that of a specific RNA but is not normally translated. Such a gene construct is herein termed an "antisense RNA gene" and such a RNA transcript is termed an "antisense RNA." Antisense RNAs are not normally translatable due to the presence of translational stop codons in the antisense RNA sequence.

A "complementary DNA" or "cDNA" gene includes recombinant genes εynthesized by reverse transcription of mRNA lacking intervening sequenceε (intronε).

Cloning vehicle. A plaεmid or phage DNA or other DNA εequence which is able to replicate autonomously in a host cell, and which is characterized by one or a small number of endonuclease recognition sites at which εuch DNA sequences may be cut in a determinable fashion without losε of an essential biological function of the vehicle, and into which DNA may be spliced in order to bring about its replication and cloning. The cloning vehicle may further contain a

marker suitable for use in the identification of cells transformed with the cloning vehicle. Markers, for example, are tetracycline resistance or ampicillin resistance. The word "vector" is sometimeε uεed for "cloning vehicle."

Expression vehicle. A vehicle or vector similar to a cloning vehicle but which is capable of expresεing a gene which haε been cloned into it, after tranεformation into a host. The cloned gene is uεually placed under the control of (i.e., operably linked to) certain control εequenceε such aε promoter sequenceε. Expreεεion control sequences will vary depending on whether the vector is designed to expresε the operably linked gene in a prokaryotic or eukaryotic hoεt and may additionally contain tranεcriptional elementε εuch aε enhancer elementε, termination sequenceε, tissue-specificity elements, and/or tranεlational initiation and termination εiteε.

The preεent invention pertainε both to expreεεion of recombinant COMT protein, and to the functional derivativeε of thiε protein.

Functional Derivative. A "functional derivative" of COMT protein iε a protein which poεsesses a biological activity (either functional or structural) that is substantially similar to a biological activity of non-recombinant COMT protein. A functional derivative of COMT protein may or may not contain post-translational modificationε such aε covalently linked carbohydrate, depending on the necessity of such modifications for the performance of a specific function. The term "functional derivative" iε intended to include the "fragments," "variants," "analogues," or "chemical derivativeε" of a molecule.

As used herein, a molecule is said to be a "chemical

derivative" of another molecule when it contains additional chemical moieties not normally a part of the molecule. Such moieties may improve the molecule's εolubility, abεorption, biological half life, etc. The moietieε may alternatively decrease the toxicity of the molecule, eliminate or attenuate any undesirable side effect of the molecule, etc. Moieties capable of mediating such effects are disclosed in Remington's PharmaceuticalJβciences (1980). Procedure for coupling such moieties to a ϊnolecule are well known in the art.

Fragment. A "fragment" of a molecule such as COMT protein is meant to refer to any variant of the molecule, such as the peptide core, or a variant of the peptide core.

Variant. A "variant" of a molecule εuch as COMT protein is meant to refer to a molecule substantially similar in structure and biological activity to either the entire molecule, or to a fragment thereof. Thus, provided that two molecules posεeεε a εimilar activity, they are considered variants as that term is used herein even if the composition or secondary, tertiary, or cjuaternary structure of one of the molecules is not identical to that found in the other, or if the sequence of amino acid residues is not identical.

Analog. An "analog" of COMT protein or genetic sequenceε iε meant to refer to a protein or genetic sequence subtantially εimilar in function to the COMT protein or genetic sequence herein. For example, analogs of the COMT protein described herein include COMT isozymes and analogs of the COMT genetic sequences described herein include COMT alleles.

DESCRIPTION OF THE PREFERRED EMBODIMENTS

Although there have been previouε reportε of "purified" COMT protein, the present inventors found that the COMT protein preparations described therein, and the methods used to isolate that protein, failed to achieve COMT protein preparations of the requisite degree of purity needed to clone and sequence the COMT genetic sequences. The inventors have overcome this problem and describe, for the firεt time, a unique and useful method for the isolation of pure COMT protein which provides the requisite high degree of purity and quantity of COMT protein needed for COMT protein sequence determinationε. As a direct result of the method of the invention for the isolation of COMT protein, and of the εequence information gathered from the protein sequence data, the inventors were able to identify cloned cDNA conεtructε which carry the COMT genetic εequenceε.

a. Isolation of COMT Protein

COMT protein may be isolated from frozen or fresh tisεueε. All purification εtepε εhould be performed at refrigerated temperatureε (for example, +4°C). For extraction of COMT from human tiεεueε, it iε alεo neceεsary to add an agent that stabilizeε the enzyme against changes in its sulfhydryl oxidation state, such as 20 mM cyεteine, throughout the extraction procedure.

Homogenization of the tissue is performed in a neutral, low salt buffer, such as 20 mM sodium phoεphate, pH 7.2 buffer and in the presence of a proteolysiε inhibitor εuch aε PMSF(phenylmethylsulfonylfluoride) . Any mechanical device, such as a blender, may be used for the homogenization. Homogenization conditions εhould not be εo εevere as to denature the enzyme, however such conditions muεt be thorough

enough to break the membranes of the tisεue being homogenized.

To remove insoluble membranes, the homogenate is clarified by ultracentrifugation at 100,000 x g for 1 hr. The supernatant fraction is used for εubεequent purification steps. If desired, the homogenate may be centrifuged first at a low speed centrifugation (25,000 x g for 25 minuteε) to remove heavy homogenization debris before performing the ultracentrifugation.

If desired, acetate fractionation may be performed prior to hydroxyapatite treatment on the supernatant fraction recovered from the ultracentrifugation. Acetate fractionation is performed by adjusting the pH of the 100,000 x g supernatant fraction to pH 5.1 with acetic acid, storing the εample at 0°C for at leaεt 30 minuteε and collecting the precipitate by centrifugation at 15,000 x g for 20 minutes. The supernatant fraction contains the COMT activity.

Alternatively, the ultracentrifugation step may be directly followed by hydroxyapatite treatment wherein hydroxyapatite (2:1, v/v) is mixed with the sample, after adjusting the sample to pH 7.2 with 1 M NaOH if necesεary. The mixture is shaken for 20 minuteε to keep the hydroxyapatite in suspension and the hydroxyapatite is removed by centrifugation at 15,000 x g for 20 minutes.

Hydroxyapatite treatment is preferably followed by ammonium sulfate precipitation wherein the hydroxyapatite- treated supernatant fraction is adjusted to 65% saturation (at 0°C). The presipitate iε collected after centrifugation at 30,000 x g for 20 minuteε and is disεolved in 20 mM εodium acetate, pH 4.8.

The ammonium εulfate preεipitate iε diεsolved in a

mildly acidic, low salt buffer such as 20 mM sodium acetate, pH 4.8 or in a neutral, low salt buffer such aε 20 mM triethanolamine-chloride, pH 7.2, and applied to a gel filtration column to remove the salt from the εample. An example of a εuitable gel filtration column iε a Bio-Gel P-100 column or equivalent that haε been equilibrated in the εame buffer. The εize of the column will depend upon and amount of εample being applied to the column and can be easily determined by techniqueε known in the art. Fractionε that elute from the column and contain COMT activity are pooled and concentrated, if deεired, by ultrafiltration with a membrane that haε a cut-off (i.e., retainε will not let pasε through) of proteinε of 10,000 daltons or larger.

If desired, a high performance cation exchange chromatography step may be performed following the gel filtration. Cation-exchange chromatography on a Mono S (HR 5/4, Pharmacia, Sweden) column, equilibrated with 20 mM sodium acetate, pH 4.8, and run with a linear gradient of 1 M sodium chloride (0→50 % in 20 minutes) is preferred. COMT activity eluting from this column may be concentrated and adjusted to 20 mM triethanolamine acetate, pH 7.2 by the ultrafiltration procedure utilized above.

COMT recovered from the cation-exchange chromatography, or, if the cation-exchange chromatography is omitted, gel filtration, is further purified by anion exchange chromatography. Anion exchange chromatography may be performed on a Mono Q (HR 5/5, Pharmacia, Sweden) column using a linear gradient of 1 M εodium chloride (0-65 % in 25 min) in 20 mM triethanolamine acetate, pH 7.2. After this stage, by enzymatic activity, COMT activity should be purified at least 1000 to 1400-fold.

Subsequent determinations of purity were performed by immunological techniques rather than enzymatic asεays, with

the criteria for purity being the presence of one protein band that reacts with COMT,antib -dy.

COMT activity recovered from the anion exchange chromatography is further purified by reversed phase (RP) chromatography, preferably performed on a TSK TMS 250 cl column and using a linear gradient of acetonitrile (0-100 % in 60 min) in 0.1 % trifluoroacetic acid. Elution of proteins may be monitored at 218 nm, enzymatic aεεay and immunoblotting.

The RP chromatography fraction that eluteε the COMT protein still contains another polypeptide, (determined to be human sphingolipid activatq.r protein 1 precurεor in the human COMT preparation) that is detectable on a gel but does not react with liver COMT antibody in Western blotting. COMT may be purified from this contaminant by alkylation and desalting through a second RP-chromatography. Alkylation may be performed by techniques known in the art, using buffered 6 M guanidine hydrochloride followed by reduction in dithiothreitol and addition of 4-vinylpyridine. Alkylation is stopped by addition of more dithiothreitol, and the alkylated protein desalted on a TSK TMS 250 column using a linear gradient of acetonitrile (20-50 %) in 30 min) in 0.1 % trifluoroacetic acid. COMT elutes as the second component and is immunologically active.

COMT protein purified in the above manner, or in a manner wherein equivalents' of the above εeσuence of steps are utilized, is purified to an extent capable of being εequenced by techniques known in the art. No protein other than COMT is believed to be in this preparation.

b. Construction and Identification of Antibodies ^" to COMT Protein

In the following description, reference will be made to various methodologies well-known to thoεe skilled in the art of immunology. Standard reference works εetting forth the general principleε of immunology include the work of Catty, D. (Antibodieε, A Practical Approach, Vol. 1, IRL Press, Washington, DC (1988)); Klein, J. (Immunology: The Science of Cell-Noncell Discrimination, John Wiley & Sonε, New York (1982)); Kennett, R., et al. in Monoclonal Antibodieε, Hybridoma: A New Di enεion in Biological Analyεeε, Plenum Press, New York (1980)); Campbell, A. ("Monoclonal Antibody Technology," in: Laboratory Techniques in Biochemistry and Molecular Biology, Volume 13 (Burdon, R. , et al. , eds. ) , Elsevier, Amsterdam (1984)); and Eisen, H.N., in: Microbiology, 3rd Ed. (Davis, B.D., et al., Harper & Row, Philadelphia (1980)).

An antibody is said to be "capable of binding" a molecule if it iε capable of εpecifically reacting with the molecule to thereby bind the molecule to the antibody. The term "epitope" iε meant to refer to that portion of a hapten which can be recognized and bound by an antibody. An antigen may have one, or more than one epitope. An "antigen" iε capable of inducing an animal to produce antibody capable of binding to an epitope of that antigen. The εpecific reaction referred to above iε meant to indicate that the antigen will react, in a highly εelective manner, with its correεponding antibody and not with the multitude of other antibodies which may be evoked by other antigenε.

The term "antibody" (Ab) or "monoclonal antibody" (Mab) aε used herein iε meant to include intact moleculeε aε well aε fragmentε thereof (such as, for example, Fab and F(ab') ₂

fragments) which are capable of binding an antigen. Fab and F(ab') ₂ fragments lack the Fc fragment of intact antibody, clear more rapidly from the. circulation, and may have lesε non-specific tisεue binding of an intact antibody (Wahl et al., J. Nucl. Med. 24:316-325 (1983)).

The antibodieε of the present invention are prepared by any of a variety of methods. Preferably, purified COMT protein, or a fragment thereof, is administered to an animal in order to induce the production of sera containing polyclonal antibodies that are capable of binding COMT.

Cells expresεing COMT protein, or a fragment thereof, or, a mixture of proteinε containing COMT or such fragments, can also be adminiεtered to an animal in order to induce the production of sera containing polyclonal antibodieε, εome of which will be capable of binding COMT protein. If deεired, εuch COMT antibody may be purified from the other polyclonal antibodieε by εtandard protein purification techniques and especially by affinity chromatography with purified COMT or fragments thereof.

A COMT protein fragment may also be chemically εyntheεized and purified by HPLC to render it substantially free of contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of high specific activity.

Monoclonal antibodies can be prepared using hybridoma technology (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al. , Eur. J. Immunol. 6:292 (1976); Hammferling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)). In general, such procedures involve immunizing an animal with COMT protein antigen. The splenocytes of such animals are extracted and fused with a suitable myeloma cell

line. Any εuitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP20), available from the American Type Culture Collection, Rockville, Maryland. After fusion, the reεulting hybridoma cellε are εelectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands, J.R., et al. , Gastroenterology 80:225-232 (1981), which reference is herein incorporated by reference. The hybridoma cells obtained through such a εelection are then aεεayed to identify cloneε which εecrete antibodieε capable of binding the COMT protein antigen.

Through application of the above-deεcribed methodε, additional cell lineε capable of producing antibodieε which recognize epitopeε of the COMT protein can be obtained.

Antibodieε againεt both highly conεerved and poorly conserved regions of the COMT protein are uεeful for studies on the control of biosyntheεiε and cataboliεm of COMT protein in normal and pathologic conditionε. Further, theεe antibodies can be used clinically to monitor the progresε of disease states wherein the expresεion of COMT protein iε aberrant.

c. Cloning of COMT Genetic Sequenceε

The proceεs for genetically engineering COMT protein sequenceε, according to the invention, iε facilitated through the isolation and sequencing of pure COMT protein and by the cloning of genetic sequenceε which are capable of encoding the COMT protein and through the expresεion of εuch genetic sequenceε. As used herein, the term "genetic εequences" is intended to refer to a nucleic acid molecule (preferably DNA). Genetic sequenceε which are capable of encoding COMT protein are derived from a variety of sources. These sources

include genomic DNA, cDNA, εynthetic DNA, and combinationε thereof. The preferred εource of the COMT genomic DNA iε a rat or human genomic library. The preferred source of the COMT cDNA is a rat liver or human placenta cDNA library.

The COMT protein recombinant cDNA of the invention will not include naturally occurring introns if the cDNA was transcribed from mature COMT mRNA. The COMT protein genomic DNA of the invention may or may not include naturally occurring introns. Moreover, such genomic DNA may be obtained in association with the 5' promoter region of the COMT protein gene sequenceε and/or with the 3' tran scriptional termination region. Further, such genomic DNA may be obtained in association with the genetic sequences which encode the 5' non-translated region of the COMT protein mRNA and/or with the genetic sequenceε which encode the 3' non-tranεlated region. To the extent that a host cell can recognize the transcriptional and/or translational regulatory signals asεociated with the expression of the mRNA and protein, then the 5' and/or 3' non-transcribed regionε of the native gene, and/or, the 5' and/or 3' non-tranεlated regionε of the mRNA, may be retained and employed for tranεcriptional and tranεlational regulation. COMT protein genomic DNA can be extracted and purified from any cell which naturally expreεεes COMT protein by means well known in the art (for example, see Guide to Molecular Cloning Techniques, S.L. Berger et al., edε., Academic Presε (1987). Preferably, the mRNA preparation uεed will be enriched in mRNA coding for COMT protein, either naturally, by isolation from cellε which are producing large amounts of the protein, or in vitro, by techniqueε commonly uεed to enrich mRNA preparations for specific sequences, such as sucrose gradient centrifugation, or both. Cell types which are known to be enriched in COMT protein and which are preferred aε a εource of COMT mRNA include liver, kidney, uterus and placenta cells. Either rat or human cellε are preferred aε εourceε.

For cloning into a vector, εuch εuitable DNA preparationε (either genomic DNA or cDNA) are randomly εheared or enzymatically cleaved, reεpectively, and ligated into appropriate vectors to form a recombinant gene (either genomic or cDNA) library.

A DNA sequence encoding COMT protein or its functional derivativeε may be inserted into a DNA vector in accordance with conventional techniques, including blunt-ending or staggered-ending termini for ligation, reεtriction enzyme digestion to provide appropriate termini, filling in of cohesive ends as appropriate,- alkaline phosphataεe treatment to avoid undeεirable joining, and ligation with appropriate ligaseε. Techniques for such manipulations are disclosed by Maniatis, T., (Maniatiε, T. et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition, 1988) and are well known in the art.

Librarieε containing εequenceε coding for COMT may be εcreened and a εequence coding for COMT identified by any meanε which εpecifically εelectε for a sequence coding for COMT such aε, for example, a) by hybridization with an appropriate nucleic acid probe(ε) containing a εequence εpecific for the DNA of thiε protein, or b) by hybridization-selected translational a nalyεiε in which native mRNA which hybridizeε to the clone in queεtion iε tranεlated in vitro and the tranεlation productε are further characterized, or, c) if the cloned genetic sequences are themselves capable of expresεing mRNA, by immunoprecipitation of a tranεlated COMT protein product produced by the host containing the clone.

Oligonucleotide probes εpecific for COMT protein which can be uεed to identify cloneε to thiε protein can be raiεed against purified forms of thiε enzyme or deεigned from

knowledge of the amino acid sequence of the COMT protein. The sequence of amino acid residueε in a peptide iε deεignated herein either through the uεe of their commonly employed three-letter deεignations or by their single-letter designations. A listing of these three-letter and one-letter designations may be found in textbooks such as Biochemiεtry, Lehninger, A., Worth Publiεherε, New York, NY (1970). When the amino acid sequence is listed horizontally, unlesε otherwiεe εtated, the amino terminuε iε intended to be on the left end and the carboxy terminuε iε intended to be at the right end.

Becauεe the genetic code is degenerate, more than one codon may be used to encode a particular amino acid (Watson, J.D., In: Molecular Biology of the Gene, 3rd Ed., W.A. Benjamin, Inc., Menlo Park, CA (1977), pp. 356-357). The peptide fragments are analyzed to identify εequenceε of amino acidε which may be encoded by oligonucleotideε having the lowest degree of degeneracy. This is preferably accomplished by identifying sequences that contain amino acids which are encoded by only a single codon.

Although occasionally an amino acid sequence may be encoded by only a εingle oligonucleotide εequence, frequently the amino acid εequence may be encoded by any of a εet of similar oligonucleotides. Importantly, whereas all of the members of this set contain oligonucleotide sequences which are capable of encoding the same peptide fragment and, thus, potentially contain the same oligonucleotide εeσuence as the gene which encodes the peptide fragment, only one member of the set contains the nucleotide sequence that iε identical to the exon coding sequence of the gene. Because this member is present within the set, and is capable of hybridizing to DNA even in the presence of the other memberε of the εet, it iε poεεible to employ the unfractionated εet of oligonucleotides in the same manner in which-one would employ a single

oligonucleotide to clone the gene that encodeε the peptide.

Using the genetic code (Watson, J.D., in: Molecular Biology of the Gene, 3rd Ed., W.A. Benjamin, Inc., Menlo Park, CA (1977)), one or more different oligonucleotides can be identified from the amino acid sequence, each of which would be capable of encoding COMT. The probability that a particular oligonucleotide will, in fact, constitute an actual COMT protein encoding εequence can be eεtimated by considering abnormal baεe pairing relationships and the frequency with which a particular codon is actually -uεed (to encode a particular amino acid) in eukaryotic cellε. Such "codon usage ruleε" are diεcloεed by Lathe, R., et al. , J. Molec. Biol. 183:1-12 (1985). Uεing the "codon uεage ruleε" of Lathe, a εingle oligonucleotide εequence, or a εet of oligonucleotide εequences, that contain a theoretical "most probable" nucleotide sequence capable of encoding the COMT protein sequenceε iε identified.

The suitable oligonucleotide, or set of oligonucleotides, which iε capable of encoding a fragment of a COMT gene (or which iε complementary to εuch an oligonucleotide, or εet of oligonucleotideε) may be εyntheεized by eanε well known in the art (see, for example, Synthesis and Application of DNA and RNA, S.A. Narang, ed., 1987, Academic Press, San Diego, CA) and employed aε a probe to identify and iεolate a cloned COMT gene by techniqueε known in the art. Techniqueε of nucleic acid hybridization and clone identification are disclosed by Maniatiε, T.. et al., in: Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Laboratories, Cold Spring Harbor, NY (1982)), and by Hames, B.D., et al., in: Nucleic Acid Hybridization, A Practical Approach, IRL Presε, Waεhington, DC (1985)), which referenceε are herein incorporated by reference. Thoεe memberε of the above-deεcribed gene library which are found to be capable of εuch hybridization are then analyzed to

determine the extent and nature of COMT encoding sequenceε which they contain.

To facilitate the detection of a desired COMT protein DNA encoding sequence, the above-described DNA probe is labeled with a detectable group. Such detectable group can be any material having a detectable physical or chemical property. Such materials have been well-developed in the field of nucleic acid hybridization and in general most any label useful in such methods can be applied to the present invention. Particularly useful are radioactive labels, such as ³² P, ³ H, ¹⁴ C, ³⁵ S, ¹²⁵ I, or the like. Any radioactive label may be employed which provides for an adequate signal and has a εufficient half-life. If εingle stranded, the oligonucleotide may be radioactively labelled using kinaεe reactions.

Alternatively, polynucleotides are alεo useful aε nucleic acid hybridization probes when labeled with a non-radioactive marker such as biotin, an enzyme or a fluorescent group. See, for example,, Leary, J.J. et al.,

Proc. Natl. Acad. Sci. USA 80:4045 (1983); Renz, M. et al.,

Nucl. Acidε Res. 12:3435 (1984); and Renz, M., EMBO J. 6:817 (1983).

Thus, in εummary, the actual identification of COMT protein sequenceε permits the identification of a theoretical "most probable" DNA sequence, or a set of such sequences, capable of encoding such a peptide. By constructing an oligonucleotide complementary to thiε theoretical sequence (or by constructing a set of oligonucleotideε complementary to the set of "most probable" oligonucleotideε), one obtains a DNA molecule (or set of DNA moleculeε), capable of functioning aε a probe(ε) for the identification and isolation of cloneε containing a COMT gene.

In an alternative way of cloning a COMT gene, a library is prepared using an expression vector, by cloning DNA or, more preferably cDNA prepared from a cell capable of expresεing COMTprotein into an expresεion vector. The library iε then εcreened for memberε which expreεε COMT protein, for example, by εcreening the library with antibodieε to the protein.

The above diεcussed methodε are, therefore, capable of identifying genetic sequences which are capable of encoding COMT protein or fragments of this protein. In order to further characterize such genetic sequences, and, in order to produce the recombinant protein, it is desirable to express the proteins which these sequenceε encode. Such expreεsion identifies those clones which express proteins posεessing characteristics of COMT protein. Such characteristics may include the ability to specifically bind COMT protein antibody, the ability to elicit the production of antibody which are capable of binding to COMT protein, the ability to provide COMT protein enzymatic activity to a cell, and the ability to provide a COMT protein-function to a recipient cell, among others.

d. Expression of COMT Protein and its Functional Derivativeε

To expreεs COMT protein and/or its active derivatives, transcriptional and translational signals recognizable by an appropriate host are necessary. The cloned COMT protein encoding sequenceε, obtained through the methodε described above, and preferably in a double-stranded form, may be operably linked to sequences controlling transcriptional expression in an expression vector, and introduced into a host cell, either prokaryote or eukaryote, to produce recombinant COMT protein or a functional derivative thereof. Depending upon which strand of the COMT protein encoding

sequence is operably linked to the sequences controlling transcriptional expression, it is also posεible to express COMT protein antisenεe RNA or a functional derivative thereof.

Expression of the COMT protein in different hosts may result in different post-translational modifications which may alter the properties of the protein. Preferably, the present invention encompasεes the expresεion of the COMT protein or a functional derivative thereof, in eukaryotic cellε, and especially mammalian, insect and yeast cells. Especially prefer'red eukaryotic hosts are mammalian cellε either in vivo, or in tissue culture. Mammalian cellε provide poεt-translational modifications to recombinant COMT protein which include folding at sites similar or identical to that found for the native protein. Most preferably, mammalian host cells include human HeLa, K-562 and hamster CHO-Kl cellε.

A nucleic acid molecule, εuch as DNA, iε said to be "capable of expreεsing" a polypeptide if it contains expreεεion control εequenceε which contain tranεcriptional regulatory information and such sequen ces are "operably linked" to the nucleotide sequence which encodes the polypeptide.

An operable linkage is a linkage in which a sequence iε connected to a regulatory sequence (or sequenceε) in εuch a way aε to place expression of the sequence under the influence or control of the regulatory sequence. Two DNA sequences (such as a COMT protein encoding sequence and a promoter region sequence linked to the 5' end of the encoding sequence) are said to be operably linked if induction of promoter function resultε in the tranεcription of the COMT protein encoding sequence mRNA and if the nature of the linkage between the two DNA εequenceε doeε not (1) reεult in

the introduction of a frame-shift mutation, (2) interfere with the ability of the expresεion regulatory εequenceε to direct the expreεεion of the COMT protein, antiεenεe RNA, or protein, or (3) interfere with the ability of the COMT protein template to be tranεcribed by the promoter region sequence. Thus, a promoter region would be operably linked to a DNA sequence if the promoter were capable of effecting transcription of that DNA sequence.

The precise nature of the regulatory regionε needed for gene expression may vary between species or cell types, but shall in general include, aε neceεεary, 5' non-tranεcribing and 5' non-tranεlating (non-coding) εequences involved with initiation of transcription and translation reεpectively, such aε the TATA box, capping εequence, CAAT εequence, and the like. Eεpecially, εuch 5' non-tranεcribing control sequences will include a region which contains a promoter for transcriptional control of the operably linked gene. Such transcriptional control sequenceε may alεo include enhancer εequenceε or upεtream activator εequenceε, as desired.

Expresεion of the COMT protein in eukaryotic hoεts requires the use of regulatory regions functional in such hosts, and preferably eukaryotic regulatory systems. A wide variety of transcriptional and translational regulatory εequenceε can be employed, depending upon the nature of the eukaryotic hoεt. The transcriptional and tranεlational regulatory εignalε can also be derived from the genomic sequences of viruseε which infect eukaryotic cellε, εuch aε adenoviruε, bovine papilloma viruε, Simian virus, herpes virus, or the like. Preferably, these regulatory εignalε are aεεociated with a particular gene which is capable of a high level of expression in the host cell.

In eukaryoteε, where transcription is not linked to translation, εuch control regionε may or may not provide an

initiator methionine (AUG) codon, depending on whether the cloned sequence contains such a methionine. Such regions will, in general, include a promoter region sufficient to direct the initiation of RNA synthesis in the host cell. Promoters from heterologous mammalian geneε which encode a mRNA product capable of translation are preferred, and especially, strong promoters such as the promoter for actin, collagen, myosin, etc., can be employed provided they also function as promoters in the host cell. Preferred eukaryotic promoters include the promoter of the mouse metallothionein I gene (Hamer, D., et al. , J. Mol. Appl. Gen. 1:273-288 (1982)); the TK promoter of Herpes virus (McKnight, S., Cell 31:355-365 (1982)); the SV40 early promoter (Benoist, C, et al., Nature (London) 290:304-310 (1981)); in yeast, the yeast gal4 gene promoter (Johnston, S.A., et al. , Proc. Natl. Acad. Sci. (USA) 79:6971-6975 (1982); Silver, P.A., et al. , Proc. Natl. Acad. Sci. (USA) 81:5951-5955 (1984)) or a glycolytic gene promoter may be used.

As is widely known, translation of eukaryotic mRNA iε initiated at the codon which encodeε the first methionine. For this reason, it is preferable to ensure that the linkage between a eukaryotic promoter and a DNA sequence which encodes the COMT protein, or a functional derivative thereof, does not contain any intervening codons which are capable of encoding a methionine. The preεence of such codons results either in a formation of a fusion protein (if the AUG codon is in the same reading frame as COMT protein encoding DNA sequence) or a frame-shift mutation (if the AUG codon is not in the same reading frame as the COMT protein encoding sequence) .

If desired, a fusion product of the COMT protein may be constructed. For example, the sequence coding for COMT protein may be linked to a signal sequence which will allow secretion of the protein from, or the compartmentalization of

the protein in, a particular host. Such signal sequenceε may be deεigned with or without εpecific protease siteε εuch that the signal peptide sequence iε amenable to εubsequent removal. Alternatively, the native signal sequence may be used if that form of COMT possesses such a sequence.

Transcriptional initiation regulatory signals can be selected which allow for repression or activation, so that expression of the operably linked genes can be modulated. Of interest are regulatory signalε which are temperature-εensitive so that by varying the temperature, expression can be repressed or initiated, or are subject to chemical regulation, e.g., metabolite. Alεo of intereεt are constructs wherein both the COMT protein mRNA and antisense RNA are provided in a transcribable form but with different promoters or other transcriptional regulatory elements such that induction of COMT protein mRNA expression is accompanied by repression of antisense RNA expression, and/or, represεion of COMT protein mRNA expression is accompanied by induction of antisense RNA expresεion.

Translational signalε are not neceεεary when it is desired to expresε COMT protein antiεense RNA sequenceε.

If deεired, the non-transcribed and/or non-translated regions 3' to the sequence coding for COMT protein can be obtained by the above-described cloning methods. The 3'-non-transcribed region may be retained for its transcriptional termination regulatory εeσuence elementε; the 3-non-translated region may be retained for its translational termination regulatory sequence elements, or for thoεe elements which direct polyadenylation in eukaryotic cells. Where the native expression control sequences signalε do not function satisfactorily host cell, then sequenceε functional in the host cell may be substituted.

The vectors of the invention may further comprise other operably linked regulatory elements such as DNA elements which confer tissue or cell-type specific expresεion on an operably linked gene.

To transform a mammalian cell with the DNA constructε of the invention many vector εystems are available depending upon whether it is desired to insert the COMT protein DNA construct into the host cell chromosomal DNA, or to allow it to exist in an extrachromosomal form.

If the COMT protein encoding εequence and an operably linked promoter iε introduced into a recipient eukaryotic cell as a non-replicating DNA (or RNA) molecule, the expression of the COMT protein may occur through the transient expression of the introduced sequence. Such a non-replicating DNA (or RNA) molecule may be a linear molecule or, more preferably, a closed covalent circular molecule which is incapable of autonomous replication.

In a preferred embodiment, genetically stable transformantε may be constructed w th vector εyεtemε, or tranεformation εyεtems, whereby COMT protein DNA is integrated into the hoεt chromoεome. Such integration may occur de novo within the cell or, in a oεt preferred embodiment, be assiεted by tranεformation with a vector which functionally inserts itself into the host chromosome, for example, with retroviral vectorε, tranεposons or' other DNA elements which promote integration of DNA sequences in chromosomeε. A vector iε employed which iε capable of integrating the desired gene sequenceε into a mammalian host cell chromosome.

Cells which have s.tably integrated the introduced-DNA into their chromosomeε are selected by also introducing one or more markers which allow, for selection of host cells which

contain the expreεεion vector in the chromoεome, for example the marker may provide biocide resistance, e.g., resiεtance to antibioticε, or heavy metalε, εuch as copper, or the like. The selectable marker gene can either be directly linked to the DNA gene sequenceε to be expresεed, or introduced into the same cell by co-tranεfection.

In another embodiment, the introduced sequence is incorporated into a plasmid or viral vector capable of autonomouε replication in the recipient hoεt. Any of a wide variety of vectorε may be employed for this purpose, aε outlined below.

Factorε of importance in selecting a particular plasmid or viral vector include: the ease with which recipient cells that contain the vector may be recognized and selected from those recipient cells which do not contain the vector; the number of copies of the vector which are desired in a particular host; and whether it is desirable to be able to "shuttle" the vector between host cells of different specieε.

Preferred eukaryotic plaεmidε include thoεe derived from the bovine papilloma viruε, vaccinia viruε, SV40, and, in yeaεt, plasmids containing the 2-micron circle, etc., or their derivativeε. Such plaεmidε are well known in the art (Botεtein, D., et al. , Miami Wntr. Symp. 19:265-274 (1982); Broach, J.R., in: The Molecular Biology of the Yeaεt Saccharomyceε: Life Cycle and Inheritance, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, p. 445-470 (1981); Broach, J.R., Cell 28:203-204 (1982); Bollon, D.P., et al., J. Clin. Hematol. Oncol. 10:39-48 (1980); Maniatiε, T. , In: Cell Biology: A Comprehenεive Treatiεe, Vol. 3, Gene Expresεion, Academic Preεε, NY, pp. 563-608 (1980)), and are commercially available. For example, mammalian expreεεion vector systems which utilize the MSV-LTR promoter to drive expression of the cloned gene, and in which it is posεible to

cotransfect with a helper virus to amplify plasmid copy number, and, integrate the plasmid into the chromosomes of hoεt cellε have been deεcribed (Perkinε, A.S. et al., Mol. Cell Biol. 3:1123 (1983); Clontech, Palo Alto, California).

In a preferred embodiment, the human cytomegaloviruε enhancer and SV-40 viruε promoter are uεed. in the moεt preferred embodiment, pKTH 539 iε- used as the expresεion vector. Plasmid pKTH539 is fully described in U.S. patent application serial number 07/052,827, the contents of which are incorporated herein by Reference. Plasmid pKTH539 waε depoεited under the terms of the Budapest Treaty on March 19, 1987 at the Deutsche Sammlung von Mikroorganismen, Griεebachεtraεεe 8, D-3400 Gottingen, and given acceεsion number DSM4030.

Once the vector or DNA sequence containing the construct(ε) is prepared for expression, the DNA construct(s) is introduced into an appropriate host cell by any of a variety of suitable meanε, including tranεfection. After the introduction of the vector, recipient cellε are grown in a εelective medium, which εele'ctε for the growth of vector-containing cellε. Expreεεion of the cloned gene εequence(ε) results in the production of the COMT protein, or in the production of a fragment of this protein. This expression can take place in a continuous manner in the transformed cells, or in a controlled manner, for example, expression which follows induction of differentiation of the transformed cellε (for example, by administration of bromodeoxyuracil to neuroblastoma cellε or the like).

The expressed protein iε iεolated and purified in accordance with conventional conditionε, εuch aε extraction, precipitation, chromatography, affinity chromatography, electrophoreεiε, or the like.

The COMT protein DNA encoding sequences, obtained through the methods above, will provide sequenceε which, by definition, encode COMT protein and which may then be uεed to obtain COMT protein antisense RNA genetic sequenceε as the antisenεe RNA sequence will be that sequence found on the opposite, complementary strand of the strand tranεcribing the protein's mRNA. An expresεion vector may be constructed which contains a DNA sequence operably linked to a promoter wherein such DNA sequence expresses the COMT antisenεe RNA sequence. Transformation with this vector reεultε in a hoεt capable of expression of a COMT antisense RNA in the transformed cell.- Preferably such expression occurs in a regulated manner wherein it may be induced and/or repreεεed as desired. Most preferably, when expreεεed, antiεenεe COMT RNA interactε with an endogenous COMT DNA or RNA in a manner which inhibits or represseε tranεcription and/or tranεlation of the COMT protein gene and/or mRNA in a highly εpecific manner. Use of antisense RNA probes to block gene expression is discuεsed in Lichtenεtein, C, Nature 333:801-802 (1988).

The examples below are for illustrative purposeε only and are not deemed to limit the εcope of the invention.

EXAMPLES

Example 1: Purification of Rat Liver Soluble COMT

Step 1: Extraction

Frozen rat livers (typically 50 g) were homogenized twice in three volumes of 20 mM sodium phosphate, pH 7.2, containing 0.2 M PMSF. The homogenate was centrifuged at 10,000 x g for 25 min and the pellet discarded. The supernatant fraction was recentrifuged at 30,000 x g for 25 min. The collected supernatant fraction waε further ultracentrifuged at 100,000 x g for 1 hour and the pellet discarded.

Step 2: Acetate fractionation

The pH of the 100,000 x g supernatant fraction was adjusted to 5.1 with acetic acid. The mixture was kept at 0°C for 30 min and the formed precipitate removed by centrifugation at 15,000 x g for 20 min.

Step 3: Hydroxyapatite treatment

The acetate fractionated εupernatant fraction waε adjusted to pH 7.2, with 1 M sodium hydroxide and mixed with hydroxyapatite (2:1, v/v) . The mixture was shaken for 20 min and hydroxyapatite removed by centrifugation at 15,000 x g for 20 min.

Step 4: Ammonium εulfate precipitation

The proteins in the hydroxyapatite treated supernatant fraction were precipitated-with ammonium sulphate (65% saturation at 0°C). The precipitate was collected after

centrifugation at 30,000 x g for 20 min and dissolved in 20 mM sodium acetate, pH 4.8.

Step 5: Gel filtration

The disεolved ammonium εulfate precipitate was chromatographed on a BioGel P-100 column (2.5 x 90 cm) in 20 mM sodium acetate, pH 4.8. Those fractions containing COMT activity were pooled and concentrated by ultrafiltration in a Filtron Novacell NC10 cell.

Step 6: Cation-exchange chromatography

The ultrafiltrated concentrate was applied on a Mono S (HR 5/5, Pharmacia, Sweden) column equilibrated with 20 mM sodium acetate, pH 4.8. Chromatography was performed with a linear gradient of 1 M εodium chloride (0-50% B in 20 min) in the equilibration buffer. The COMT activity containing fraction was concentrated and changed to 20 mM triethanolamine acetate, pH 7.2, in a Filtron Novacell NC10 cell.

Step 7: Anion exchange chromatography

The COMT enzyme from the previous step was further purified on a Mono Q (HR 5/5, Pharmacia, Sweden) column using a linear gradient of 1 M sodium chloride (0-65% in 25 min) in 20 mM triethanolamine acetate, pH 7.2. Peaks were collected and eaεured for COMT activity (Figure 1).

Step 8. Reversed phase chromatography

The COMT containing fraction from anion exchange chromatography was subjected to reversed phase chromatography on a TSK TMS 250 Cl (0.46 x 3 cm) column. Chromatography waε performed by uεing a linear gradient of acetonitrile (0-100%

in 60 min) in 0.1% trifluoroacetic acid, and monitored at 218 nm (Figure 2) .

Step 9. Alkylation of Purified COMT

The COMT fractionε from reverεed phaεe chromatography (Step 8) were dried in a vacuum centrifuge and dissolved in 40 ml alkylation buffer (6 M guanidine hydrochloride, 0.5 M Tris-HCl, 2 mM EDTA, pH 7.5). Reduction was performed with 7 mmol dithiothreitol for 10 min followed by addition of 1 μl (9 umol) 4-vinylpyridine. Alkylation was stopped after 15 min by addition of. another 7 mmol of dithiothreitol. The alkylated protein was desalted on a TSK TMS 250 (0.46 x 3 cm) column, using a linear gradient of acetonitrile (20-50% B in 30 min) in 0.1% trifluoroacetic acid (Figure 10). The protein peakε were c-ollected and dried in a vacuum centrifuge.

Step 10. Trypsin Digestion and Separation of Tryptic Peptides

The protein purified from Step 9 was dissolved in 100 ml 0.1 M ammonium bicarbonate and treated with 4% TPCK-trypsin (Sigma) for 8 hourε. Reεulting peptideε were εeparated on a 0.46 x 15 cm Vydac 218 TPB5 column uεing a linear gradient of acetonitrile (0-60% or 90% in 60 min) in 0.1% trifluoroacetic acid. Elution was monitored at 218 nm and the individual peptides collected manually and dried (Figure 4).

Example 2

Purification of Human Placental S-COMT

a. Materialε and Methodε

All purification εteps, except RP-chromatography, were performed at +4°C and in the presence of 20 mM cysteine in the bufferε. The enzymatic activity waε meaεured as described (Nisεinen, E., et al., Anal. Biochem. 137:69-73 (1984)) and lU correspondε to 8.35 nmol O-methylated product formed in a min. at 37°C.

The protein amountε were meaεured according to Bradford, M. , Anal. Biochem. 72:248 (1976). The purification procedure waε essentially similar to that of the rat liver enzyme (Tilgmann, C, et al. , Febs Letterε 264:95-99 (1990)) but with small modificationε. 74 g of human placenta fresh or stored at -70°C waε used as the starting material for the purification. The acetic acid treatment of the 100,000 x g supernatant and the following centrifugation, were omitted. Gel filtration in the Bio-Gel P-100 was performed in 20 mM triethanolaminechloride, pH 7.2. The high performance cation exchange chromatography (Mono-S HR 5/5) waε alεo omitted.

Alkylation, deεalting and digeεtion with trypεin were done aε deεcribed in Example 1 and Tilgmann, C, et al., Febs. Letters 264:95-99 (1990)). The resulting peptides were separated by RP chromatography as deεcribed in Example 1 and the peptideε collected.

Amino acid εequence analyεiε waε performed on a gas/pulsed-liquid sequencer equipped with an on-line PTH-amino acid analyzer (Kalkkinen, N. , et al., J. Prot. Che . 7:242-243 (1988)).

Peptideε were degraded on glaεε fiber filter discs Whatman GF/C treated with 2 mg Polybrene using the Applied Biosystem degradation program 03RPTH.

For N-terminal analysis the protein electroblotted from the SDS-PAGE (Speicher, D.W., in: Techniques in Protein Chemistry, (Hugli, T.E., ed.), Academic Press, San Diego, CA (1989)) waε degraded on the PVDF blotting membrane.

SDS-PAGE was done according to Laemmli (Laemmli, U.K., Nature 227:680-685 (1970)).

Chro atofocusing was performed on a Mono-P HR 5/20 Pharmacia column as in Tilgmann, C, et al., Febs. Letters 264:95-99 (1990).

Western blotting was performed according to (Tilgmann, C, et al., Febs. Letters 264:95-99 (1990)) and using Protoblot (Promega) detection. The antibody against rat liver enzyme waε used (Tilgmann, C, et al., Febs. Letters 264:95-99 (1990)).

b. Purification of S-COMT

To obtain pure human placental S-COMT for further characterization the purification procedure for the rat liver enzyme, εupra, waε used (Tilgmann, C, et al. , Febs. Letters 264:95-99 (1990)) with slight modifications. The purification was started by homogenization of the placental tissue followed by clarification of the homogenate by centrifugation. The S-COMT activity recovered into the supernatant fraction corresponded to 8 U/g placenta which is about l/4th of the COMT activity abtained from 1 g of rat liver. Much lower amounts of the human enzyme aε compared with the rat liver enzyme have alεo been reported (Burba,

J.V., Can. J. Physiol. Pharmacol. 57:213-216 (1979)). The specific COMT activity obtained in the placental supernatant fraction was 0.1 U/mg protein. The supernatant showed a strong immunoreactive band corresponding to a molecular weight of 26,000 daltonε in SDS-PAGE/Weεtern blotting by uεing specific antisera (Tiulgmann, C, et al. , Febε Letterε 264:95-99 (1990)) againεt the rat liver COMT. Thiε εuggeεtε structural homology of the placental enzyme to the rat liver COMT.

During the following purification steps it became obvious that the human enzyme iε leεε εtable than the rat liver enzyme. The inactivation could be prevented by adding cyεteine (20mM) to all of the εolutionε, which indicatioε that the obεerved inactivation moεt probably iε due to oxidation of the enzyme. Activation oε the enzyme by cyεteine haε alεo been obεerved by other inveεtigatorε (Ball, P., et al., Eur. J. Biochem. 26:560-569 (1972)).

The clarification εtepε of the homogenate were followed by hydroxyapatite treatment and ammonium εulfate precipitation, which reεulted in a 6.8 fold purification. 54% of the amount of COMT activity in the clarified homogenate waε recovered in the diεεolved ammonium sulfate precipitate. This iε εlightly leεε than the recovery of the rat liver enzyme after the correεponding εteps (Tilgmann, C, et al., Febs. Letters 264:95-99 (1990)). The placental enzyme was further purified by gel filtration, in which it eluted aε a εingle εymmetrical peak corresponding to a molecular weight of about 25,000. The observed molecular weight is considerably leεε than that by gel filtration for placental COMT previouεly reported 52,000 (Gugler, R. , et al., Biochim. Biophyε. Acta 220:10-21 (1970) and 49,000 (Darmenton, P., et al., Biochimie 58:1401-1403 (1976)). The enzymatically active fractionε pooled from the gel filtration step showed a εpecific activity of 14.2 U/mg corresponding to

a 237 fold purification. The COMt was further purified by high performance anion exchange chromatography in which the COMT active fraction correεponded to a εpecific activity of 145.2 U/mg and a 1452 fold purification. The pi of the placental S-COMT was determined by chromatofocuεing. .An aliquot of the COMT active Mono-Q fraction waε applied to Mono-P column from which the enzymatic activity eluted at pH 5.3. The obtained pi iε εlightly higher than that (pi 5.1) obtained for the rat liver enzyme (Tilgmann, C, et al., Febε. Letterε 264:95-99 (1990)). Because the COMT active Mono-Q fraction still contained εeveral impuritieε, the enzyme was further purified by RP-chromatography. Due to the denaturing conditionε, the enzymatic activity recovered in the fractionε waε conεiderably low (about 1/10 of the expected) but clearly detectable. Due to the low enzymatic activity, the elution position of the COMT was also verified by immunoblotting uεing the antiεerum previously mentioned. Both the placental and rat liver enzyme could be detected by using the rat liver COMT antiserum. However, a ten-fold amount of the placental enzyme as compared withe the rat liver enzyme had to be used for an identical immunoreactive staining indicating that these polypeptides are homologouε but not identical.

The placental COMT polypeptide migrated εlightly εlower, (corresponding to MW 26,000 daltons) in the SDS-PAGE than did the corresponding rat liver enzyme as detected by WEstern immunoblotting.

Unfortunately, the reversed phase fraction carrying the COMT polypeptide also still contained another polypeptide, which did not react with the rat liver COMT antibody in Western blotting.

To separate theεe two co ponentε for further primary structure analyεiε the εample waε alkylated and deεalted by

RP-chromatography (Tilgmann, C, et al., Febs. Letters 264:95-99 (1990)). By this meanε the two componentε (a and b) could be εeparated. Only the later eluting fraction (b) reacted in the Weεtern blotting with the rat liver anti-COMT. Because the identity of the other polypeptide still remained unclear, the alkylated polypeptideε were digeεted with trypsin and the peptides separated. Sequence analysiε of five peptideε from fraction (a) confirmed taht it waε not a form of the COMT enzyme. In a computer search among the existing databases, the obtained peptide sequence gave a 100% match to the known primary εtructure of the human sphingolipid activator protein 1 precursor (Dewji, N.N. , et al., Proc. Natl. Acad. Sci. USA 84:8652-8656 (1987)). The typtic peptides from the immunologically active alkylated fraction (b) were separated by RP-chromatography and all the indicated peptideε (1-X) subjected to sequence analyεiε. Compariεon of the obtained sequences (141 residueε, about 65% of the total polypeptide) with the known primary εtructure of the rat liver enzyme εhowε that the placental enzyme iε not identical but highly homologouε to the rat liver enzyme.

Thiε εtructural difference of the proteinε explainε also the different response in Western blotting. The N-terminuε of the rat liver S-COMT iε blocked. To analyze the N-terminal εequence of the placental COMT, the enzyme, either purified by RP-chromatography after alkylation or electroblotted onto a PVDF membrane (Speicher, D.W., in: Techniques in Protein Chemiεtry, (Hugli,T.E., ed. ) , Academic Press, San Diego, CA (1989)) after SDS-PAGE, was applied to a gas/pulsed field liquid εequencer. However, the reεultε obtained were negative, suggesting that the N-terminuε of the placental COMT enzyme iε alεo blocked.

The preεented data shows that human placenta contais a S-COMT enzyme very εimilar to the rat liver enzyme iε εize, pi and primary εtructure. The primary εtructure data given

in this paper was obtained from one trypctic digeεt of the alkylated polypeptide. The partial sequence data iε enough to indicate the cloεe realtion of the two enzymes.

Example 3

Cloning of COMT Enzyme from Rat Liver

a. Materialε

Restriction enzymes and T4-DNA ligaεe were purchaεed from New England Biolabε and the AMV reverεe tranεcriptaεe aε well aε the rabbit reticulocyte lysate from Promega Biotec. The radioactive nucleotides [fα- ³² P]dCPT, [γ- ³² P]dAPT and [α- ³⁵ S]dATP and the [ ¹⁴ Hjmethylated proteins were from Amerεham International. The L-[ ³⁵ S]methionine was from NEN DuPont and the RNA Ladder (0.24-9.5 kb) was from GIBCO BRL. Kodak X-Omat AR film was used for autoradiography.

b. Screening the Rat Liver cDNA and Genomic Libraries

A rat liver cDNA library (Clontech Laboratories Inc.) in λgtll was screened using E. coli Y1090 as a host. The immunoscreening method (Yong,.- R.A. et al. , Proc. Natl. Acad. Sci. 80:1194-1198 (1983)) was modified using the ProtoBlot Immunoscreening System (Prome,ga Biotec) and rat polyclonal antibody raised against highly purified rat liver COMT.

A λ Charon 4A rat genomic library (Clontech Laboratorieε was screened with the filter hybridization method of Benton et al. (Benton, W.D. et al., Science 196:180-182 (1977)) using Hybond-N filters (Amersham international). ³² P-labeled (Multiprimer DNA labeling kit., Amersham International) 209 bp fragment from the COMT cDNA clone digested with EcoRI and Pstl restriction enzymes waε used as a probe. A positive clone was purified by three successive platings and

reεcreeningε. DNA from thiε clone waε iεolated and further analyzed by Southern hybridizationε (Maniatis, T. et al. , Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982)) with four different probes (EcoRI/Pstl 209 bp, Bglll/Xhol 450 bp, Smal/Smal 500 bp and Accl/Accl 630 bp fragments) covering different regions of the COMT cDNA sequence (Figure 5).

c. Nucleotide Sequence Analysiε

The inεertε from the cDNA and genomic clones were subcloned for sequence determination in the EcoRI restriction enzyme site of the pGem-7zf(+)-vector (Promega Biotec). Sequencing was accomplished uεing the dideoxy-nucleotide chain-termination method (Sanger, F. et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977)) with the modified T7 DNA polymeraεe (Tabor, S. et al., Proc. Natl. Acad. Sci. 84:4767-4771 (1987)) and the Sequenaεe kit (United Stateε Biochemical). Reactionε were made on double-stranded DNA preparations (Holmeε and Quigley, Anal. Biochem. 114:193-197 (1981)) and the conditionε were derived from the manufacturer'ε recommendationε (Wang, Biotechniqueε 6:843-845 (1988)). Reactionε were analyzed by electrophoreεiε on 8% and 6% linear gelε containing 50% w/v urea.

SP6 and T7 promoter primerε (Promega Biotec) were uεed for sequencing the endε of the cDNA clone. In addition, nine oligonucleotide primers were syntheεized with the DNA Synthesizer 381A (Applied Biosyεtems) according to the obtained amino acid or DNA sequence.

DNA sequence editing and analysis of functional protein domains were performed using the PC Gene computer software ( IntelliGenetics Inc./Genofit SA, Switzerland). The εearch for sequence ho ologieε waε done in both protein (SwiεεProt Release 11.0, June 1989; National Biomedical Research

Foundation Protein Releaεe 20.0, March 1989) and DNA (EMBL Release 18.0, February 1989) data bankε.

d. Amino Acid Sequencing

The COMT enzyme waε purified from rat liver with a reverse phase purification method as described below. The material from the last purification εtep was alkylated with 4-vinylpyridine (Friedman, M, et al. , J. Biol. Chem. 245:3868-3871 (1970); Fullmer, C.S., Anal. Biochem. 142:336-339 (1984)), desalted on a 0.46 x 3 cm TSK TMS 250 (Cl) reversed phase column and treated with 4% w/w TPCK-trypsin in 0.1 M ammonium bicarbonate for 8 hours. Tryptic peptideε were separated on a 0.46 x 10 cm Vydac 218TPB5 column using a linear gradient of acetonitrile (0-60% in 60 min) in 0.1% trifluoroacetic acid. Chromatography was monitored at 218 nm and the peptides collected into Eppendorf tubes and dried. For the sequence analyεiε the peptideε were dissolved in 30 μl of 20% trifluoroacetic acid before loading on a Polybrene treated (2 mg/30 μl H20) glasε fiberfilter (Whatman GF/C). Edman degradationε were carried out in a gaε-pulεed liquid phase sequencer (Kalkkinen, N. et al., J. Prot. Chem. 7:242-243 (1988)) equipped with an on-line phenylthiohydantoin amino acid analyzer (correεponding to the Applied Biosystems 120A.) . Sequencing was performed uεing the Applied Bioεystems 03RPTH program.

e. RNA and DNA Analysis

Total RNA waε isolated from rat liver by the guanidium thiocyanate method (Chirgwin, J.J. et al. , Biochemistry 18:5294-5299 (1979)) and purified with cesium chloride centrifugation (Gliεin, V. et al., Bioche iεtry 13:2633-2637 (1974)). Polyadenylated mRNA was prepared from total RNA by HybondTM-mAP (Amersham) . The electrophoresis of the isolated RNAs was done through formaldehyde containing gels. The RNAs

were blotted to Hybond-N membraneε (Amersham International) and the Northern hybridization was done using the 32P labeled rat liver COMT cDNA 209 bp fragment digested with EcoRI and Pstl restriction enzymes as a probe (Maniatis, T., et al., Molecular Cloning. A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY (1982)).

Rat cell lines, XC (ATCC CCL 165), and L6J1 (Ringerts, N.R., et al., Exp. Cell Reε. 113:233-246 (1978), obtained from Dr. Wahrmann) were grown in minimal eεsential medium and 10% foetal calf serum (GIBCO BRL). Isolated DNA from these cells were digested with EcoRI or Hindlll restriction enzymes. 20 μg of each digested DNA was electrophoresed on a 0.8% agarose gel and transferred to a Hybond-N nylon membrane (Amersham International). Hybridization of the membrane was done uεing the 209 bp EcoRI/Pεtl fragment from COMT cDNA aε a probe.

f. In vitro Tranεlation and Immunoprecipitation

2 μg of rat liver polyadenylated mRNA waε translated in vitro using micrococcal nuclease treated reticulocyte lyεate from Promega Biotec. The tranεlation reactions were incubated for 60 min at +30°C in the presence of L-[ ³⁵ S]methionine. For immunoprecipitation, the lysates (50 μl ) were diluted with 400 ml of NET buffer (1% NP-40, 400 mM NaCl, 50 mM Triε-HCl pH 8.0, 5 mM EDTA) containing 10 μg/ml Aprotinin (Boehringer-Mannhei ) and 0.2% NaDodS04. Preimmune- or anti-COMT polyclonal rabbit serum was added with Protein A-Sepharose (Pharmacia-LKB) . The samples were mixed for 2 hours at +22°C and subjected to NaDodS04/polyacrylamide gel electrophoresiε (Laemmli, U.K., Nature 227:680-685 (1970)). After electrophoresiε the gel waε impregnated with PPO, dried and fluorographed.

g. Primer-Extenεion Analyεiε of the 5' End of COMT mRNA

The initiation εiteε of the rat liver COMT mRNA transcripts were mapped by extending the labeled oligonucleotide primers in the presence of total rat liver mRNA with reverse transcriptase as described in (Maniatis, T, et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition, 1988).

h. Results

When a rat liver cDNA library waε εcreened with a polyclonal antibody raiεed againεt the purified rat liver COMT polypeptide, positive plaques were obtained at a frequency of 0.02%. After plaque purifications, DNAε iεolated from the poεitive cloneε were characterized by digeεtion with EcoRI reεtriction enzyme. The εizeε of the inεertε were determined by agarose gel electrophoreεiε and the largeεt insert subcloned for sequence determination.

The first rat liver COMT cDNA which was identified in thiε manner and iεolated was 1349 bp long and contained an 622 bp long open reading frame (ORF) and an 727 bp 3' untranslated region (Figures 6 and 7). A comparison of the amino acid sequence derived from the ORF nucleotide sequence to the 14 tryptic peptide sequences of the purified COMT protein showed that they are identical (Table 1).

Table 1. Results from the direct micro-sequence analysis in a gas/pulsed liquid sequencer from rat liver S-COMT. Peptide numbers refer to the corresponding ones in Fig. 3. Position in sequence refers to the peptide location in the deduced amino acid εequence.

Peptide sequence

Cys-Thr-Gln-Lys (SEQ ID NO. 1)

Het-Ala-Arg

Tyr-Val-Gln-Gln-Asn-Ala-Lys (SEQ ID NO.2)

No result

No result

Val-Val-Asp-Gly-Leu-Glu-Lys (SEQ ID NO.3}

Leu-Leu-Gln-Pro-Gly-Alβ-Arg (SEQ ID NO.4)

Ala-Ile-Tyr-Gln-Gly-Pro-Ser-Ser-Pro-Asp-Lys (SEQ ID NO.5)

Cys-Gly-Leu-Leu-Arg (SEQ ID NO.6)

Glu-Trp-Ala-Het-Asn-Val-Gly-Asp-Ala-Lys (SEQ ID NO.7)

Ser-Ser-Tyr-Leu-Glu-Tyr-Met-Lys (SEQ ID NO.8)

Gly-Gln-Ile-Met-Asp-Ala-Val-Ile-Arg (SEQ ID NO.9)

Gly-Ser-Ser-Ser-Phe-Glu-Cys-Thr-His-Tyr-Ser-Ser

(SEQ ID NO. 10)

Tyr-Leu-Pro-Asp-Thr-Leu-Leu-Leu-Glu-Lys ((SEQ ID NO. 11)

Tyr-Val-Gln-Gln-Asn-Ata-Lys-Pro-Gly-Λsp-

Pro-Gln-Ser-Val-Leu-Glu-Ala-Ile-Asp-Thr-

Tyr-Cys-Thr-Gln-Lys (SEQ ID NO. 12)

Val-Thr-Ile-Leu-Asn-Gly-Ala-Ser-Gln-Λsp-

Leu-Ile-Pro-Gln-Leu-Lys (SEQ ID NO. 13)

No result

No result

Glu-Tyr-Ser-Pro-Ser-Leu-Val-Leu-Glu-Leu-

Gly-Ala-Tyr-Cys-Gly-Tyr-Ser-Ala-Val-Arg (SEQ ID NO. 14)

Lys-Lys-Tyr-Asp-Val-Asp-Thr-Leu-Asp-Met-

Val-Phe-Leu-Asp-His-Trp-Lys (SEQ ID NO. 15)

Lys-Tyr-Asp-Val-Asp-Thr-Leu-Asp-Het-Val-

Phe-Leu-Asp-His-Trp-Lys (SEQ ID NO. 16)

Tyr-Λsp-Val-Λsp-Thr-Leu-Λsp-Het-Val-Phe-

Leu-Asp-His-Trp-Lys (SEQ ID NO. 17)

Lys-Gly-Thr-Val-Leu-Leu-Ala-Λsp-Asn-Val-

Ile-Vat-Pro-Gly-Thr-Pro-Λsp-Phe-Leu-Λla-

Tyr-Val (SEQ ID NO. 18)

Gly-Thr-Val-Leu-Leu (SEQ ID NO. 19) Leu-Leu-Thr-Met-Glu-Het-Λsn-Pro-Λsp-Tyr-

Ala-Ala-Ile-Thr-Gln-Gln-Met-Leu-Asn-Phe-

Ala-Gly-Leu-Gln-Asp-Lys (SEQ ID NO.20)

However, from the amino acid sequence of the peptide 3 it waε determined that the 5' end of thiε cDNA clone did not contain the complete COMT sequence. Therefore, to determine the total ORF sequence the rat COMT gene was isolated.

To isolated the COMT gene, a rat genomic library was screened with a ³² P labeled DNA-probe derived from the cDNA coding sequence. One positive clone was found from 0.5 x 10 ⁶ plaques. The digestion of this clone with EcoRI restriction enzyme gave three fragments (8.0 kb, 6.8 kb and 0.7 kb) of which only the largest, 8.0 kb fragment, gave a signal in Southern hybridization with the COMT cDNA probes. Thiε 8.0 kb fragment waε uεed for εubcloning and" εequencing.

The sequencing of the COMT genomic clone revealed a 41 bp extension to the cDNA ORF starting with a ^' putative translation initiation codon (Figure 7). The sequence at this site (ATCATGG) resembles- closely the optimum consensus sequence (ACCATGG) for translation initiation by eukaryotic ribosomes (Kozak, M. , Cell 44:283-292 (1986)). That thiε ATG iε actually uεed for translation initiation is further supported by the tryptic peptide sequenceε. No tryptic peptides corresponding to the sequence upstream of this start codon were detected (Figure 4).

The complete COMT ORF region was 663 bp long. The molecular weight of rat liver COMT predicted from the sequence (24747 daltons) corresponded well to the size of the purified rat liver COMT enzyme. This molecular weight is somewhat higher than those previouεly reported (23000 daltonε) for the rat S-COMT (Grossman, M.H. et al., J. Neurochem. 44:421-432 (1985); Heydorn, W.E. et al. , Neurochem. Int. 8:581-586 (1986)). Primary εequence analysis of the polypeptide derived from the cDNA did not reveal any regionε characteristic of integral membrane protein. This protein has no hydrophobic εignal εequence, membrane εpanning

domainε or N-glycoεylation εiteε. Thuε, the protein purification method uεed and the expreεεion library εcreening with the polyclonal antibody againεt COMT revealed only a S-COMT form of the enzyme.

The 3' end of the cDNA haε no conεenεuε polyadenylation εignalε. The verification of the 3' sequence using the genomic clone reveals a discrepancy between the two sequences. Examining the genomic sequence corresponding to the 3' end of the cDNA, one posεible polyadenylation signal (ATTAAA) can be found (Figure 7). Thiε εequence haε been found in 12% of eukaryotic mRNAε (Wickenε, M. et al. , Science 226:1045-1051 (1984)).

Homology εearcheε of the COMT nucleotide or amino acid sequences in protein or DNA data banks did not reveal any significant similarity to any known sequence.

i. RNA Analysiε and in vitro Tranεlation

The COMT εpecific tranεcriptε were analyzed by iεolating polyadenylated mRNA from rat liver and hybridizing the RNA blotε with the ³² P labeled COMT cDNA probe. Aε εhown in Figure 8, COMT mRNA iε reεolved in formaldehyde containing agaroεe gel aε a 1.8-2.0 kb band.

Primer extenεion of rat liver mRNA εuggeεted that there iε one major tranεcript 5' end of 450 nucleotideε upεtream from the tranεlation initiation codon (Figure 9). Baεed on thiε, the deduced length of 1.8 kb COMT tranεcript correspondε to the mRNA length obεerved in RNA blotε. In addition, primer extenεion revealed two minor 5' endε for COMT tranεcriptε in rat liver.

The in vivo tranεlation of rat liver mRNA in rabbit reticulocyte lyεate produced a 24-25 kDa polypeptide which

could be precipitated with the anti-COMT antiserum. This polypeptide most likely representε the product of the major 1.8 kb COMT mRNA in rat liver. No immunoprecipitated material with larger molecular weight waε detected from the in vitro lyεateε. Thiε reεult iε in accordance with the in vitro translation of immunopurified rat liver polysomal mRNA by Grossman et al. (Grossman, M.H., et al., J. Neurochem. 44:421-432 (1985)). Their data showed that 1-2 kb COMT mRNA stimulated only the synthesis of a 23 kDa protein which they asεumed to repreεent the εoluble form of COMT enzyme.

The localization of COMT expression in different rat tisεueε waε inveεtigated by Northern and dot hybridization on total and polyA containing RNA. High amounts of 1.8-2.0 kb COMT mRNA was found in liver. Lower amounts of transcripts could be detected in all other tisεueε εtudied. Intereεtingly, there is heterogeneity in the size of COMT mRNA from different εourceε. Primer extension and nuclease protection assays showed that different 5' ends of the transcriptε accounted for the heterogeneity in mRNA εize in different tissues.

The distribution of COMT enzyme in rat tissues, in particular in brain, was studied by immunohiεtochemiεtry uεing the εpecific polyclonal antiserum raised against the purified COMT enzyme and εynthetic peptideε. Specific εtaining of both neuronε and glial cells was found.

. DNA Analysis

The rat gene for COMT was cloned ,from a genomic 1 Charon 4A DNA library uεing the liver cDNA aε a probe. The gene waε found to have four exons. Southern blotting of genomic DNAs digested with several different restriction enzymes indicated that there is only one single gene in rat, mouse and hamster for COMT. The hybridization data further suggested that the

COMT gene iε well conεerved in rodentε. Thuε, the different formε of the COMT enzyme are not products of separate genes but rather the result from alternative procesεing of transcripts and/or from some posttranslational modificationε of the COMT polypeptide.

Example 4

A human placental cDNA library (Clontech Laboratorieε Inc. CA, USA) iε bacteriophage λ gtll was screened using εynthetic oligonucleotideε (Lathe, R. , J. Mol. Biol. 183:1.12 (1985)). The two oligonucleotideε used

(5'TGCAAGCTTGCGCTGCTCCTTTGTGTCACCC 3' [SEQ ID NO. 21] and 5'GARTGGGCYATGATYGTSGGCGA 3' [SEQ ID NO. 22] where R = A or G; Y = C or T; and S = C or G were designed from the amino acid εequence obtained from direct εequencing of tryptic peptideε of purified human placental COMT enzyme and from the previouεly known rat COMT cDNA εequence. COMT-poεitive cloneε were εubcloned into pGEM-7zf(+)-vector (Promega, WI, USA) prior to εequencing by the dideoxynucleotide chain termination method (Sanger, F., et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977); Tabor, S., et al. , Proc. Natl. Acad. Sci. USA 84:4767-4771 (1987)). DNA εequence editing, analyεiε of functional protein domainε and homology compariεonε to rat COMT sequenceε were performed using the PC Gene computer software (Intelligenetics Inc./Genofit SA, Switzerland) . The search for sequence homologies was done in protein (SwisεProt) and DNA (EMBL) data bankε.

For production of RNA by in vitro tranεcription (Melton, D.A., et al., Nucl. Acidε Res. 12:7035-7056 (1984)) two of the placenta cDNA clones (pHPC3 and pHPC7) were subcloned into pGEM-3 vector (Promega). Capped RNA waε εyntheεised from linearized templates uεing T7 RNA polymeraεe (Nielsen, D.A., et al., Nucl. Acidε Res. 14:5936 (1988)). DNA

templates were removed by RNase free DNaεe I enzyme and the RNA productε were purified by phenol extraction and ethanol percipitation. The integrity of the RNA preparationε was analysed in agarose gelε. Approximately 0.5 to 2 μg of RNA waε tranεlated in vitro with rabbit reticuloεyte lysate (Promega) in 25 or 50 μl reactions as detailed by Promega. Immunoprecipitation using the polyclonal antiserum raised against the purified rat liver enzyme (Tilgmann, C, et al., FEBS Lett. 364:95-99 (1990)) was performed as described. Dog pancreas microsomal membranes and (3-lactamase control mRNA were purchased from Promega. The incubation were for one hour at 30°C. To pellet the microsomal membraneε, translation lysates were dissolved into 2.25 ml 10 mM Tris-HCl, pH 8.0, ImM MgCl ₂ , 0.4 mM phenylmethylsulphonyl- fluoride (PMSF). An equal volume of 0.5 M sucrose in 40 mM Tris-HCl, 2 mM MgCl ₂ , 0.4 mM PMSF was added and the mixtures were centrifuged at 100,000 g for one hour in a Sorvall AH 650 rotor at 4°C. The pellets were diεεolved into gel εample buffer and the proteins in the supernatant fractions were precipitated by adding 5 volumes of -20°C acetone, and collected by centrifugation for 10 minutes at 10,000 g and 4°C. The ³⁵ S-labelled protein productε were analyzed by SDS-polyacrylamide gels (10% polyacrylamide, Laemmli, U.K., Nature 227:680-685 (1970)) followed by autoradiography.

Southern and Northern blot analysis

Chromosomal DNA was iεolated from four different continuouε human cell ineε (Chang human liver cellε, ATCC CCL13; human embyonic intestine 407 cellε, ATCC CCL6; HeLa cervix carcinoma cells, ATCC CCL2; K562 chronic myelogenouε leukemia cells, ATCC CCL243) and, for comparison, from one monkey (Vero, African green monkey kidney cells, ATCC CCL81) and one canine (D-17, primary oεteogenic sarcoma cells, ATCC CCL183) cell line as described (Maniatis et al., Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory,

Cold Spring Harbor, New York (1982)). DNAε were digeεted with reεtriction enzymeε Hind III and Eco RI and 20 μg of DNA was analysed in a 0.8% neutral agarose gel, blotted onto nylon filter (Hybond-N, Amersham Intermational, England) and hybridized at 65°C with a ³² P-labelled 505 bp Eco RI-Kpn I fragment from the pHPC22 cDNA clone. Poly A containing RNA was iεolated from human placenta and rat liver aε deεcribed. 5 μg of the polyadenylated RNAε were analysed in 1% agarose - 2.2 M formaldehyde gelε and blotted onto Hybond-N filterε. The RNA filterε were hybridized with the same probe as the DNA filters at 42°C as described by Thomas (Thomaε, P.S., Proc. Natl. Acad. Sci. USA 77:5201-5205 (1980)). Commercial RNA-ladder (GIBCO/BRL, NY, USA) waε uεed aε a molecular weight marker.

cDNA cloning and sequencing

A human placental cDNA library in λ gtll waε εcreened with COMT specific synthetic oligonucleotides. Four poεitive cloneε of variable lengthε (pHPC3, pHPC7, pHPC14 and pHPC22 Figure 10) were found among 40,000 plaqueε. The DNA εequenceε (Figure 11) of the cloneε revealed, that they contained overlapping εequenceε, wiht a 663 bp ORF to be found in all cloneε. The ORF εtartε with an ATG tranεlation initiation codon, potentially coding for a 221 amino acid long polypeptide with a predicted molecular maεε of 24.4 kDA. Compariεon of the ORF εequences with the amino acid εequenceε of purified human placenta S-COMT and with the known rat COMT sequences, confirmed that the ORF coded for human COMT polypeptide.

In the clones pHPC3 and 22 the ATG codon in the 663 ORF iε the first one in the sequence. Cloneε pHPC7 and 14 contained about 220 nucleotideε (nt) upεtrea from the εtart of the 663 nucleotide ORF (Figure 10), having another ATG codon in the εame reading frame. Thiε ATG potentially

initiateε a 50 amino acid extenεion to teh 221 amino acid polypeptide. The predicted molecular mass of this protein is 30.0 kDA. This polypeptide would contain a highly hydrophobic peptide in its amino terminus, as εeen in the hydropathy plot (Figure 12). Comparison of the four cDNA sequences revealed that there were two baεe changeε at nucleotide positions 258 (C to T) and 544 (G to A) in clone pHPVl4. The 3' ends of the clones consist of partially overlapping sequenceε containing putative noncoding εequenceε downεtream from the COMT ORF (Figure 10). The cloneε pHPC3 and 22, wiht the longeεt 3' hon'coding εequences, have a possible polyadenylation signal AATTAA 265 nucleotides from the translation termination codon TGA of the COMT ORF. In the clone pHPC3 there i~ε a poly A εtretch 21 nucleotides from the polyadenylation signal (Figure 11 B). The clone pHPC22 haε only two A:ε at thiε position, followed by an undetermined sequence of about 1 kb. At the 3' noncoding sequence of the clone pHPC3 there is a change of CC to GG 14 bp downstream from the translation εtop codon.

Comparison of rat and human COMT εequenceε

Comparison of the 221 amino acid polypeptides derived from the cDNA cloneε of rat liver and human placenta εhowed an overall homology of 80% (Figure 13). Like in rat, the human 221 amino acid COMT protein probably repreεents the soluble form of the enzyme (S-COMT) lacking the putative N-glycosylation siteε and hydrophobic membrane anchoring amino acid domainε (Figures 12 and 13). 45 amino acids are different in rat and human S-COMT (Figure 12). Most amino acid differences occur int the aminoterminal half of the 221 amino acid protein (29 amino acid changes between amino acidε 11-116) and in the carboxy terminal end (7 amino acid changeε between amino acidε 195-221). The four cyεtein reεidueε found in the rat COMT sequence are conserved in the human protein, but in addition, human COMT haε three more cyεteinε.

Consequently the hydropathy profiles (Figure 12) of the predicted rat and human S-COMT polypeptides were highly similar.

Comparison of the 50 amino acid aminoterminal extensions existing in the placenta cDNA clones pHPC7 and 14, with the respective rat sequence derived from the genomic clone also showes a high homology. Seven amino acidε (amino acidε 3 to 8 and amino acid 21) found in the human εequence are lacking in rat. The stretch of hydrophobic amino acids in the aminoterminal part iε particularly well conεerved.

At preεent it iε not known whether any of the conεerved regionε in COMT repreεent active εiteε of the enzyme. Compariεonε of human COMT εequences with the known DNA and protein sequenceε in data bankε did not give any direct homologieε.

In vitro tranεcription and tranεlation

To analyze the protein coding potentional of the mRNAs corresponding to the human placenta cDNAs, RNA waε εyntheεised in vitro by using bacteriophage T7 RNA polymerase. Two cDNAs having 63 nucleotideε (pHPC3) or 222 nucleotideε (pHPC7) upεtream from the putative initiating ATG of the εoluble COMT enzyme, were uεed for RNA εynthesis and subsequent in vitro translationε. As shown in Figure 14, the εhorter contruct produceε one 26 dDa protein, whereaε the longer conεtruct yielded one major 30 kDa and a trace amount of a 26 kDa protein. The two productε were detected in similar proportions upon the usage of different preparateε and translation lysateε. Both the 26 and 30 kDa proteinε could be precipitated with the COMT-specific antiεerum from the in vitro lyεateε.. To teεt whether the hydrophobic aminoterminuε in the 30 kDa protein funtionε aε a εignal peptide, microεomal membraneε were added onto the

reticulocyte lysate during translation reactions. No indication of the shortening of the 30 kDa product was seen, whereas the control protein, beta lactamase, waε proteolytically proceεεed by the membraneε (Figure 15). Sedimentation experimentε further indicatied that the 30 kDa protein waε quantitatively aεεociated with dog microsomal membranes in the lysate, thus behaving., in this respect, like β-lactamase used aε the signal peptide procesεing control (Figure 15). On the other hand, no 26 kDa S-COMT was associated with the membranes (Figure 15).

DNA and RNA anal siε

COMT εequenceε in human chromoεomal DNA were analyεed by uεing the 505 bp Eco RI - Kpn I fragment from the pHPC22 cDNA clone aε a probe in Southern blotting experimentε. Aε εhown in Figure 16, only one COMT εpecific restriction fragment was detected in Hind III and Eco RI digests of human cell line DNAs. This result indicates that man most likely has only one COMT gene, thus resembling the situation in rat. Also monkey and canine cells seem to contain one gene for COMT (Figure 16). Analysis of COMT specific transcriptε by Northern blotting εhows that- human placenta contains an approximately 1.5 kb long transcript for COMT, which is about 0.3 kb shorter than the corresponding mRNA in rat liver (Figure 17) .

DISCUSSION

High amounts of COMT enzyme occur in human placenta, where it has an important function to inactivate circulating catecholamines (Saarikoski, S., Acta Phyεiol. Scand. (Suppl. ) 42:5 (1982)). A cytoplaεmic COMT polypeptide haε been purified from human placenta, correεponding to the εoluble form of the enzyme (S-COMT; Gugler, R. , et al., Biochim.

Biophyε. Acta 220:10.21 (1970)). Whether the membrane-bound COMT (MB-COMT) activity found in other tiεsueε, exists in placenta, has not been defined so far.

Synthetic oligonucleotideε, deεigned on the baεis of known amino acid sequence from the human placental COMT aε well aε on the baεis of the rat COMT sequence were used to isolate cDNA clones from human placenta. The four positive cloneε contained a 663 nucleotide long ORF. Evidence that the deduced 221 amino acid polypeptide from a 663 ORF repreεentε the S-COMT in rat haε been preεented. The purified COMT protein from human placenta haε an apparent molecular weight of 26 kDa, which iε somewhat bigger than the predicted protein masε on the baεiε of the εequence of the 663 nucleotide ORF in the placental cloneε. The hydropathy profile εuggeεtε that thiε protein iε a cytoplaεmic protein, lacking putative membrane εpanning domainε. Thuε it iε likely that the deduced 221 amino acid protein repreεentε the human S-COMT form.

Two of the cDNA clones (pHPC3 and 22) contain only the ORF for S-COMT, whereas the clones pHPC7 and 14 have 222 and 216 nt:s long upεtream extenεionε. Theεe extenεion εequenceε contain a 150 nucleotide ORF in the εame reading fram aε S-COMT sequence, having an ATG codon 50 amino acids from the S-COMT initiation site. Thiε peptide εequence haε a remarkably high content of hydrophobic amino acidε in itε aminoterminal part reεembling eukaryotic εignal peptideε (Walter and Lingappa, 1986). The exiεtence of a εimilar and highly conεerved εequence in the rat genomic clone further suggests a functional role for this peptide.

Comparison of the human and rat COMT sequenceε reveals that there are several highly conserved regionε in the deduced polypeptideε, among which the hydrophobic aminoterminal domainε and the four cyεtein reεidueε are of

particular interest. Structural studies of rat liver COMT have suggeεted that a diεulphide bridge exists between cystein residues 33 and 191 in the active enzyme (Tilgmann, C, et al., FEBS Lett. 264:95-99 (1990)). At present the functional significance of disulphide bridges for the human COMT enzyme is not known. Site-directed mutagenesis experiments are needed to localize the amino acid residueε and polypeptide regionε required for enzymatic activity in COMT.

In vitro transcrip'tion-translation experiments showed, that both the shorter and longer cDNAs coded for immunoreactive COMT polypeptides. The εhort conεtruct produced only a 26 kDa protein, which in polyacrylamide gelε comigrateε with the purified human placental S-COMT. The longer construct yielded predominantly a 30 kDa protein, compatibile with the initiation of translation from the first AUG. This AUG has a rather favourable sequence context AAGAUGC for initiation, wheτeas the AUG for the S-COMT has less favourable context CTCAUGG (Kozak, M., Cell 44:283-292 (1986)). Low amount of a 26 DA product, seen in the in vitro lyεateε εtimulated by the longer conεtruct, may indicate translation initiation from thiε internal AUG. If true, thiε situation is εimilar to that εeen in εeveral bifunctional yeast and mammalian mRNAs (Kozak, M. , Cell 47:481-483 (1986); Kozak, M., J. Cell Biol. 108:229-241 (1989)). This would imply, that different COMT polypeptides could be synthesised from one mRNA species. In favor of this hypothesis, in vitro expression of the corresponding rat COMT construct yields about equal amounts of 24 kDa and 28 kDa COMT polypeptides. In rat the initiation context of the second AUG is relatively stronger than that of the firεt initiation AUG.

The putative 30 kDa COMT protein has a signal sequence-like, highly hydrophobic, amino terminuε. Thuε one possibility would be, that this COMT form corresponds to the

MB-COMT described in literature. Our in vitro experiments showed that the 30 kDa polypeptide associates with microsomal membranes, but iε not cleaved by signal peptidase. If the hydrophobic amino terminuε functionε as a signal peptide in MB-COMT, it might also function as an anchor εequence mediating the membrane binding of MB-COMT. The placenta cDNA cloneε have 3' noncoding εequenceε of variable lengthε. There iε no overall homology between human and rat 3' noncoding εequenceε. The only putative polyadenylation signal AATTAA can be found in the pHPC3 and 22 sequenceε (Wickenε, M. , et al., Science 226:1045-1051 (1984)). This sequence and 22ntε downεtream from it, are well conεerved alεo in the rat COMT sequence. The approximately 1 kb in the 3' end of the clone pHPC22, as well aε the other sequence differences between the cDNA cloneε, may be cloning artifacts. The final determination of the structure of the 3' end of COMT mRNAs needε more direct analyεiε of mRNAs and genomic sequenceε. If the AAUUAA codon iε functional, the 3' noncoding region in hyman COMT tranεcript iε about 440 nt:ε εhorter than that found in rat COMT tranεcriptε. This difference would partly explain the size difference between human placenta and rat liver COMT mRNAs revealed by the RNA blots.

On the basiε of the preεent data a model for expreεεion of different COMT formε cannot be preεented. Aεεuming the exiεtence of one gene for COMT, aε the Southern blotting experimentε strongly suggeεt, the trancriptε for S- and MB-COMT can be produced by the uεe of alternative promoterε or εplicing. Thiε could create mRNAε which have differenceε in their 5' endε, poεεibly in the εequencε coding for the hydrophobic peptide. Thiε poεεibility predictε different trancripts for the two COMT enzymeε, and the longer and εhorter cDNA cloneε, described here, could reflect this situation. Another mechanism, εuggeεted on the baεis of in vitro translation experiments, iε the alternative use of two initiation codons from the εame mRNA. In this case the cDNAs

from placenta would εimply represent incomplete copies of the COMT mRNA. The Northern blotting of placenta RNAε doeε not have enough resolution to resolve between these alternatives. Analysis of comt polypeptides and mRNAs from different tiεsueε or cell lineε, aε well aε expreεεion of COMT conεtructs in mammalian cells, are needed to evaluate the relevance of the in vitro experiments and to reveal the details of COMT expression.

Example 5

Expression of Recombinant Rat COMT

For expresεion in mammalian cellε, the rat COMT sequence in Figure 7 consiεting of 27 or 52 bp of 5' noncoding region, the 663 bp coding region and 489 bp of 3' noncoding region waε inεerted into an Epstein-Barr virus-derived expresεion vector. In thiε vector the tranεcription of rCOMT DNA iε under the control of human cytomegaloviruε enhancer and SV-40 viruε promoter. The expreεsion constructε were tranεfected into εeveral mammalian cell lineε. Transient COMT-activity was observed in human HeLa, K562 and hamster CH0-K1 cells. In εtable cell lineε high amountε of COMT-εpecific mRNA waε detected by RNA-blotting. Immunoprecipitation from the 35S-methionine labelled cell cloneε with the COMT-εpecific antiεerum detected a 24.5 kDa rCOMT protein.

To produce rCOMT in prokaryoteε, the COMT coding sequence can be cloned uεing εtandard techniques into E. coli expresεion vectorε which are known in the art (Maniatis, T. et al., Molecular Cloning (A Laboratory Manual), Cold Spring Harbor Laboratory, second edition, 1988).

The cloning and expresεion of active COMT allowε the production of the large quantities of COMT enzyme which are needed for the analysis of protein structure in the deεign of

εpecific inhibitorε. Further, the cell lineε which express rCOMT can now be used in the biological and pharmacological studies of the enzyme. The recombinantly-produced COMT protein sequenceε can be used in the analysiε of the functionally important regions in the COMT polypeptide by recombinant techniqueε εuch aε in vitro mutageneεiε εo as to allow the deεign of highly εpecific inhibitorε of COMT activity which have utility in the treatment of diseaseε wherein it iε deεired to control COMT'ε enzymatic activity.

Example 6

Identification of COMT Inhibitorε

COMT protein, purified by the methodε above, iε utilized for the identification of COMT inhibitorε. For the inhibitor εtudieε, COMT protein may be purified from native COMT εourceε (Exampleε 1 and 2) or from a hoεt that produceε recombinant COMT (Examples 3 and 4). COMT fragments that retain a desired biological or enzymatic COMT activity againεt which it iε desired to design an inhibitor may also be used. Such fragments may be prepared using any appropriate protease, εuch aε, for example, εubitiliεin, trypεin, proteinaεe K, pepεin, papain, ficin, elaεtaεe, bromelain, theromylεin, Staph. aureuε proteaεe V-8, pyroglutamate aminopeptidaεe, leucine aminopeptidaεe, endoproteinaεe Lyε-C, Glu-C or ARg-C, chymotrypεin A ₄ , carboxypeptidase A, B, P, or Y, or amino acid arylamidase, using techniqueε known in the art. Proteolytic fragmentε may be separated from each other and recovered for further analyεiε according to the methodε provided in Exampleε 1 and

2 for the εeparation and recovery of COMT peptideε.

To identify an inhibitor of COMT, the deεired COMT (purified native or recombinant or active fragmentε thereof) is incubated in a standard COMT asεay mixture aε above

(Nissinen, E. et al. , Anal. Biochem. 137:69-73 (1984), or any assay mixture capable of detecting the desired COMT acitivity and inhibition thereof, and COMT activity levels meaεured. Similar assay samples, but with increasing concentrations of the compound being teεted for COMT inhibitory ability are alεo analyzed. A compound that iε a COMT inhibitor iε a compound that decreaεeε COMT activity in the preεence of the compound. Such decreaεeε may result in a decrease in the V _max of COMT or in an increase in the K _m of a COMT subεtrate. Compounds that inhibit COMT activity at physiological concentrations of COMT subεtrateε are eεpecially deεired.

While this invention has been described in detail and with reference to εpecific embodimentε thereof, it will be apparent to one skilled in the art that various changes and modificationε could be made therein without departing from the εpirit and εcope thereof.

SEQUENCE LISTING

(1) GENERAL INFORMATION: Ulmanen, Ismo

Salminen, Marjo Lundstrδm, Kenneth Kalkkinen, Nisse Tilgmann, Carola Sδderlund, Hanε Jalanko, Anu

(i) APPLICANT: Orion-yhtyma Oy

(ii) TITLE OF INVENTION: CATECHOL-0-METHYLTRANSFERASE, POLYPETIDE SEQUENCES AND DNA MOLECULE CODING THEREFOR

(iii) NUMBER OF SEQUENCES: 28

(iv) CORRESPONDENCE ADDRESS:

Orion Corporation ORION PHARMACEUTICA Patent Department P.O.Box 65 02101 ESPOO FINLAND

(v) COMPUTER READABLE FORM: <>

(A) MEDIUM TYPE: <>

(B) COMPUTER: <>

(C) OPERATING SYSTEM: <>

(D) SOFTWARE: <>

(vi) CURRENT APPLICATION DATA: <>

(A) APPLICATION NUMBER: to be determined

(B) FILING DATE: filed herewith

(C) CLASSIFICATION: to be determined

(ix) TELECOMMUNICATION INFORMATION (A) TELEPHONE: +358-0-4293056

(2) INFORMATION FOR SEQ ID NO:l:

(i)' SEQUENCE CHARACTERISTICS:

(A) LENGTH: 4 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

Cys Thr Gin Lys

1

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

Tyr Val Gin Gin Asn Ala Lys 1 5

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 aMino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear ^" A

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3;

Val Val Asp Gly Leu Glu Lys 1 5

(2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

Leu Leu Gin Pro Gly Ala Arg 1 5

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 11 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

Ala lie Tyr Gin Gly Pro Ser Ser Pro Asp Lys 1 5 10

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS: ^'

(A) LENGTH: 5 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE _. TYPE: peptide

( i) SEQUENCE DESCRIPTION: SEQ ID NO:6:

Cys Gly Leu Leu Arg 1 5

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7;

Glu Trp Ala Met Asn Val Gly Asp Ala Lys 1 5 10

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 8 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

Ser Ser Tyr Leu Glu Tyr Met Lys 1 5

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

Gly Gin lie Met Asp Ala Val lie Arg 1 5 10

(2) INFORMATION FOR SEQ ID NO:10:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 12 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

Gly Ser Ser Ser Phe Glu Cys Thr His Tyr Ser Ser 1 5 10

(2) INFORMATION FOR SEQ ID NO:11:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 10 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

Tyr Leu Pro Asp Thr Leu Leu Leu Glu Lys 1 5 10

(2) INFORMATION FOR SEQ ID NO:12:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 25 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

( i) SEQUENCE DESCRIPTION: SEQ ID NO:12:

Tyr Val Gin Gin Asn Ala Lys Pro Gly Asp Pro Gin Ser 1 5 10

Val Leu Glu Ala lie Asp Thr Tyr Cys Thr Gin Lys 15 20 25

(2) INFORMATION FOR SEQ ID NO:13:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

Val Thr lie Leu Asn Gly Ala Ser Gin Asp Leu lie Pro 1 5 10

Gin Leu Lys 15

(2) INFORMATION FOR SEp ID NO:14:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(Xi) SEQUENCE DESCRIPTION: _, SEQ ID NO:14:

Glu Tyr Ser Pro Ser Leu Val Leu Glu Leu Gly Ala Tyr 1 5 10

Cys Gly Tyr Ser Ala Val ^" - Arg 15 20

(2) INFORMATION FOR SEQ ID NO:15:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

Lys Lys Tyr Asp Val Asp Thr Leu Asp Met Val Phe Leu 1 . 5 10

Asp His Trp Lys 15

(2) INFORMATION FOR SEQ ID NO:16:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

Lys Tyr Asp Val Asp Thr Leu Asp Met Val Phe Leu Asp 1 5 10

His Trp Lys 15

(2) INFORMATION FOR SEQ ID NO:17:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 15 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

Tyr Asp Val Asp Thr Leu Asp Met Val Phe Leu Asp His 1 5 10

Trp Lys 15

/

(2) INFORMATION FOR SEQ ID NO:18:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 22 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPEϊ peptide (xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

Lys Gly Thr Val Leu Leu Ala Asp Asn Val lie Val Pro 1 5 10

Gly Thr Pro Asp Phe Leu Ala Tyr Val 15 20

(2) INFORMATION FOR SEQ ID NO:19:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 5 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

Gly Thr Val Leu Leu 1 5

(2) INFORMATION FOR SEQ ID NO:20:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 26 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

Leu Leu Thr Met Glu Met Asn Pro Asp Tyr Ala Ala lie 1 5 10

Thr Gin Gin Met Leu Asn Phe Ala Gly Leu Gin Asp Lys 15 20 25

(2) INFORMATION FOR SEQ ID NO:21:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 31 base pairs

(B) TYPE: nucleic acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

( i) SEQUENCE DESCRIPTION: SEQ ID NO:21: TGCAAGCTTG CGCTGCTCCT TTGTGTCACC C 31

(2) INFORMATION FOR SEQ ID NO:22:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 23 base pairs

(B) TYPE: nucleic acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22: GARTGGGCYA TGATYGTSGG CGA 23

(2) INFORMATION FOR SEQ ID NO:23:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 225

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:23:

Met Gly Asp Thr Lys Glu Gin Arg lie Leu Arg Tyr Val 1 5 10

Gin Gin Asn Ala Lys Pro Gly Asp Pro Gin Ser Val Leu 15 20 25

(2) INFORMATION FOR SEQ ID NO:24:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1591 base pairs

(B) TYPE: nucleic acid

(C) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (xi) SEQUENCE DESCRIPTION: SEQ ID NO:24:

(2) INFORMATION FOR SEQ ID NO:25:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 1105 base pairs

(B) TYPE: nucleic acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE:' DNA

Met Pro Glu Ala Pro Pro Leu Leu Leu Ala Ala Val Leu 1 5 10

Leu Gly Leu Val Leu Leu Val Val Leu Leu Leu Leu Leu 15 20 25

Arg His Trp Gly Trp Gly Leu Cys Leu He Gly Trp Asn 30 35

Glu Phe He Leu Gin Pro He His Asn Leu Leu Met Gly 40 45 50

Asp Thr Lys Glu Gin Arg He Leu Asn His Val Leu Gin nn 55 60 65

His Ala Glu Pro Gly Asn Ala Gin Ser Val Leu Glu Ala

70 75

He Asp Thr Tyr Cys Glu Gin Lys Glu Trp Ala Met Asn 80 85 90

Val Gly Asp Lys Lys Gly Lys He Val Asp Ala Val He 95 100

Gin Glu His Gin Pro Ser Val Leu Leu Glu Leu Gly Ala 105 110 115

Tyr Cys Gly Tyr Ser Ala Val Arg Met Ala Arg 120 125

Leu Leu Ser Pro Gly Ala Arg Leu He Thr He Glu He 130 135 140

Asn Pro Asp Cys Ala Ala He Thr Gin Arg Met Val Asp 145 150

Phe Ala Gly Val Lys Asp Lys Val Thr Leu Val Val Gly 155 160 165

Ala Ser Gin Asp He He Pro Gin Leu Lys Lys Lys Tyr 170 175 180

Asp Val Asp Thr Leu Asp Met Val Phe Leu Asp His Trp

185 190

Lys Asp Arg Tyr Leu Pro Asp Thr Leu Leu Leu Glu Glu 195 200 205

Cys Gly Leu Leu Arg Lys Gly Thr Val Leu Leu Ala Asp 210 215

Asn Val He Cys Pro Glγ Ala Pro A≤p Phe Leu Ala His 220 225 230

Val Arg Gly Ser Ser Cys Phe Glu Cys Thr His Tyr Gin 235 240 245

Ser Phe Leu Glu Tyr Arg Glu Val Val Asp Gly Leu Glu

250 255

Lys Ala He Tyr Lys Gly Pro Gly Ser Glu Ala Gly Pro 260 265 270

(2) INFORMATION FOR SEQ ID NO:27:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 374 base pairs

(B) TYPE: nucleic acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: DNA

( i) SEQUENCE DESCRIPTION: SEQ ID NO:27:

AGGGAGGTGG TGGACGGCCT GGAGAAGGCC ATCTACAAGG 40

CCCAGGCAGC AAGCAGGGCC CTGACTGCCC CCCCGGGGCC 80

CCTCTCGGGC TCTCTCACCC AGCCTGGTAC TGAAGGTGCC 120

AGACGTGCTC CTGCTGACCT TGTGCGGCTC CGGGCTGTGT 160

CCTAAATGCA AAGCACACCT CGGCCGAGGC CTCCGCCCTG 200

ACATGCTAAC CTCTCTGAAC TGCAACACTG GATTGTTCTT 240

TTTTAAGACT CAATCATGAC TTCTTTACTA ACACTGGCTA 280

GCTATATTAT CTTATATACT AATATCATGT TTTAAAAATA 320

TAAAATAGAA ATTAAGAATC TAATATTTAG ATATAAAAAA 360

AAAAACCCGA ATTC 374

(2) INFORMATION FOR SEQ ID NO:28:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 amino acids

(B) TYPE: amino acid

(C) TOPOLOGY: linear

(ii) MOLECULE TYPE: peptide

(Xi) SEQUENCE DESCRIPTION: SEQ ID NO:28:

Arg Glu Val Val Asp Gly Leu Glu Lys Ala 1 5 10

He Tyr Lys Gly Pro Gly Ser Glu Ala Gly Pro

15 20