CatD is the major lysosomal aspartic protease with a pH optimum between pH 2.8 and pH 4.0 (Barrett. 1977). Although there are many hints as to the in vivo function of CatD, direct evidence is presently not available. CatD is thought to be involved in intracellular catabolic proteolysis, end-processing, secretion and activation of enzymes and hormones (Opgenorth T. J. et al. 1992), and antigen processing and extracellular proteolysis (Barrett. 1977). Furthermore, it may play a role in leukocyte mobilization (Leto G. et al. 1992), and T-cell cytotoxic activity (Grusby M. J. et al. 1990). It has also been suggested that CatD stimulates DNA synthesis and cell proliferation in regenerating tissue (Morioka M. et al. 1984), and participates in pathological processes such as inflammation (Barrett. 1977).

CatD is induced by estrogens in human breast cancer cell lines (Westley B. et al.

1980) and is produced in excess in cancer cells both in vitro and in vivo, where its concentration in the primary tumour is correlated with increased risk of metastases (Rochefort H. et al. 1990).

CatD is expressed in all tissues examined but the level of expression varies. These differences, which are most likely due to different transcription rates, are controlled by a combination of constitutive and proximal promoters. The steroid hormones, vitamin D and estrogen have been shown to induce human CatD expression (Redecker B. et al. 1989). Steroid receptors increase the initiation of transcription of specific genes by interacting with the transcriptional machinery at the promoter level (Beato M. 1989). In eukaryotes, gene expression is controlled by both proximal and distal elements, generally located in the 5'upstream region of the gene. Many class 11 gene promoters contain a TATA box, which binds the transcription factor IID and defines the transcription initiation site;

genes with these promoters have been called facultative or regulated genes. In contrast, promoters of housekeeping genes, such as those coding for lysosomal enzymes, lack a recognisable TATA box but contain multiple GC boxes acting as putative binding sites for the transcription factor Spl (Blake M. C. et al. 1990).

Estrogens stimulate transcription of the CatD gene by means of estrogen- responsive sequences located in the proximal region of the promoter (Cavailles V. et al. 1991).

The role of estrogen on the intracellular regulation of procathepsin D, a 52- kDa protein, and CatD (a 34-kDa protein) has been extensively investigated. 17p- Estradiol (E2) significantly increases CatD gene transcription and intracellular protein formation, and within 24 hrs after hormone treatment, the extracellular levels of the 52-and 34-kDa proteins are also significantly increased. E2 induces the expression of the CatD gene in ER-responsive breast cancer cells by interacting with the transcriptional machinery at the promoter level. In the absence of E2, the CatD gene transcription is initiated at multiple transcription start sites I-V; however, E2 exclusively initiates transcription at the TATA-dependent transcription start site I on the CatD promoter (Cavailles V. et al. 1993). The promoter region of CatD does not contain a classical palindromic estrogen- responsive elements (ERE) but contains several GC-rich boxes which can bind to the transcription factor Sp1 (Cavailles V. et al. 1993). Sp-1-dependent activation of transcription is TATA box-dependent (Smale S. T. et al. 1990). The mechanism of estrogen activation of the c-myc oncogene also involves similar interactions between the ER half-site and the Sp1 element on the c-myc downstream promoter (Dubik D. et al. 1992).

Biochemical methods have demonstrated that some ocular tissues such as retinal pigment epithelium (RPE), iris and ciliary body, choroid, and corneal endothelium have a high activity of CatD (Hara S. et al. 1986; Hayasaka S. et al.

1975). The highest activity of CatD in ocular tissues has been identified in RPE (Hayasaka S. et al. 1975b; Hayasaka S. et al. 1975b). The RPE is a single multifunctional cell layer of the eye. It is situated beneath the photoreceptor outer segments (POS) and due to its tight junctions, it constitutes part of the blood

retinal barrier. It is responsible for the movement of ions and water from apical to basal direction, the absorption of stray light, phagocytosis and lysosomal digestion of POS, and is a major player in the visual cycle of rhodopsin (Bok D. 1993; Bok D. 1985). Of these RPE functions, the processing of POS and the RPE visual cycle are discussed below.

Phagocytic properties: The RPE is responsible for the removal of the ever regenerating POS, the lysosomal digestion of phagosomes and the recycling of digestion products.

Following the displacement from the proximal to distal end of the outer segments, the intermittently shed POS are phagocytosed by the RPE (Young R. W. et al.

1969; Bosch E. et al. 1993). The phagocytosed POS form phagosomes within the RPE cells which induce a lysosomal response resulting in the digestion of the POS. The RPE layer consists of non-renewable cells and with time the continuous phagocytosis and digestion of POS causes the accumulation of an autofluorescent debris, called lipofuscin, in the aging RPE (Feeney L. 1987). It has been proposed by several investigators that abnormal amount of lipofuscin compromises RPE function, and macular photoreceptors die as a secondary response to an aged, incompetent RPE (Bressler N. M. et al. 1994).

Visual cycle: The visual cycle is the movement of vitamin A (retinol) between the photoreceptors and the RPE cells (Bridges C. D. B. 1976). The visual pigment in the rod and cone outer segments (ROS and COS) is 11-cis retinaldehyde. As a results of photon-triggered isomerisation 11-cis-retinaldehyde is converted to all- trans retinaldehyde, which is then reduced to all-trans retinol. The all-trans retinol is then transported to the RPE cells to be regenerated into 11-cis retinaldehyde. In addition to the POS-derived all-trans retinol, RPE also receives all-trans retinol from the blood. All-trans retinol is a lipid soluble molecule therefore to increase solubility and stability the plasma retinol binds to a retinol binding protein (RBP) secreted by the liver (Heller J. et al. 1976). The precise process of the uptake and release of retinol from RBP remains to be elucidated. Once in the RPE, the all-

trans retinol is initially converted by a retinoid isomerase to 11-cis retinol and by an oxidoreductase (retinol dehydrogenase, RDH) into 11-cis retinaldehyde. The 11- cis retinaldehyde then delivered from the apical membrane of the RPE cells, through the extracellular matrix into the photoreceptors (Saari J. C. et al. 1994).

However, 11-cis retinol can also be converted into 11-cis retinyl ester and stored.

During these processes, retinol or its derivatives bind to several transport and binding proteins.

Recent progress in molecular biological techniques has had a major effect on our understanding of the development, diagnosis and treatment of diseases. Of these new techniques gene therapy, which is the deliberate transfer of DNA for therapeutic purposes, has been the centre of attention in recent years.

To date, most of the approved gene therapy protocols target cancer, cystic fibrosis, HIV infections, and a variety of metabolic diseases and diseases of the central nervous system. The application of gene therapy for ocular diseases has been somewhat slower and the majority of the work has been targeting genetically inherited diseases such as retinitis pigmentosa in animal models only so far.

It is an object of the present invention to overcome, or at least alleviate, one or more of the difficulties or deficiencies associated with the prior art.

In one aspect, the present invention provides an isolated regulatory element capable of targeting CatD-expressing cells, preferably cells expressing a high level of CatD.

By"targeting CatD-expressing cells"is meant that the regulatory element preferentially causes expression of a transgene to which it is operationally linked in CatD expressing cells.

The regulatory element is preferentially operational in cells expressing a high level of catD. Although a vector including the regulatory element, e. g. a recombinant virus, may be able to enter other cells non-specifically, transgene expression in these cells will be substantially dormant. Only cells which express

CatD and preferably a high level of CatD produce factors ncessary to activate the regulatory element.

The term"isolated"means that the material is removed from its original environment (e. g., the natural environment if it is naturally occurring). For example, a naturally occurring polynucleotide present in a living animal is not isolated, but the same polynucleotide separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

By"cells expressing a high level of CatD activity"is meant cells expressing between approximately 0.04 and 10 units CatD enzymatic activity/mg protein, preferably cells expressing between approximately 0.1 and 5 units CatD enzymatic activity/mg protein, more preferably cells expressing between approximately 0.5 and 0.9 units CatD enzymatic activity/mg protein.

Cells with less than approximately 0.04 units CatD activity/mg protein are considered to be low CatD producers. While the regulatory element of the present invention is capable of targeting these cells, only the constitutive part of the regulatory element would be active producing low levels of transgenes, as the cells lack the relevant factors necessary for the activation of the estrogen or retinoic acid responsive elements of the CatD regulatory element.

The regulatory element may be a nucleic acid molecule, including DNA, cDNA, genomic DNA and RNA eg. mRNA.

Preferably the regulatory element is a promoter, more preferably a CatD promoter, even more preferably a CatD promoter from retinal pigment epithelium (RPE), preferably human RPE.

Even more preferably the regulatory element includes the nucleotide sequence

GGCCGCGCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATC CGGCCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACC CTCTCCGACCC (SEQ ID NO: 1) or a functionally active variant, such as an analogue, derivative, mutant or fragment thereof.

By"functionally active"is meant that the variant is capable of targeting CatD-expressing cells. Such variants include naturally occurring allelic variants and non-naturally occurring variants. Additions, deletions, substitutions and derivatizations of one or more of the nucleotides are contemplated so long as the modifications do not result in loss of activity of the regulatory element. Preferably the variant has at least approximately 80% identity to the relevant part of the above sequence, more preferably at least approximately 90% identity, most preferably at least approximately 95% identity. Such variants include, for example, those having nucleic acid changes which result in conservative amino acid substitutions of one or more residues in the corresponding amino acid sequence.

Such variants also include nucleic acid sequences which are antisense to the above sequence.

In a particularly preferred embodiment of this aspect of the invention, the regulatory element includes a nucleotide sequence selected from the group consisting of: GGCCGCGCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATC CGGCCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACC CTCTCCGACCC (SEQID No: 1)

GGCGCGAGCGGCGGGAACTGTAGGCGCGGCAGGCGCACCACCACCCCCCC CCCGCCCGGGCGCTGTGCGCGTGCGCCGAGGTTGCCCCGCCCAGGCCAGG CCCCGCTCCGCCCCGCCCCGCGCACGCCGGCCGCGCCCACGTGACCGGTC CGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCCAACTGCGGCGTCATCC CGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCC (SEQ ID No: 2) GGCCGGGACAGGGGTCACCCCGCGGGGCCCTCCAGGGTGGGCCGCCCCA CGACCCCGGGCCGGCCGAAACGGGAATCCTCCAGACCCCAGAAGCTGGGC CGGGCTGACCCCGCGGGCGCGAGCGGCGGGAACTGTAGGCGCGGCAGGC GCACCACCACCCCCCCCCCGCCCGGGCGCTGTGCGCGTGCGCCGAGGTTG CCCCGCCCAGGCCAGGCCCCGCTCCGCCCCGCCCCGCGCACGCCGGCCGC GCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCC CAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCC GACCC No:ID 3) ATGTGAAAGGAATGTATTTTAGGGTGGAATACTTTGCCTGCCTTCGGGCCTG CTGTCTGCCACGTGAGGCTGTGCCAGTGTGAGGCTGGAATTTGGGATCTGG AGGCTAGAGCCATCGGTGAGGCCTGAGTCTCTAAGCACAGCGCCCAGAGGG CGGAGCGGGTCCGACCCCCTTTGCGGCAGGGCCTGAGCTGGTTTTCCAGGT TTCTCTGGAAGCCCTGTAGAGGAGCGGAGGGTCCATTCGGTGGGCTGGGGA CTTTGAATTTAACCTTGGTTTGCAAGAGGCTTCCAGAGAGGATGTCTGGGAG CGTCTCGGAGGGGGACGAGGGGGCGCCGGGAGGAGCAGGTGCAGGAGCC CACGGCGCAGCGCCCCGCGCAGGCCTGGACGCGGGGACGGCCGCGGCGG CCGGGACAGGGGTCACCCCGCGGGGCCCTCCAGGGTGGGCCGCCCCACGA CCCCGGGCCGGCCGAAACGGGAATCCTCCAGACCCCAGAAGCTGGGCCGG GCTGACCCCGCGGGCGCGAGCGGCGGGAACTGTAGGCGCGGCAGGCGCA CCACCACCCCCCCCCCGCCCGGGCGCTGTGCGCGTGCGCCGAGGTTGCCC CGCCCAGGCCAGGCCCCGCTCCGCCCCGCCCCGCGCACGCCGGCCGCGC CCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCCAA CTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGAC CC GGCCGCCGCCGC (SEQ ID No. 4) or a functionally active variant such as an analogue, derivative, mutant or

fragment, thereof.

The regulatory element may include other fragments of the sequences shown in Figures 13 (SEQ ID No. 5) and 14 (SEQ ID Nos: 6 and 7), produced by restriction enzyme cuts such as BstY, promoter 154-835, Msil, promoter 328-835 or SfiL, promoter 460-835. These may provide further specificity to RPE cells.

Specificity to RPE cells may be further increased by the elimination of the estrogen responsive elements totally (480-728 bp; see Fig 13) or partially, E1 480- 495 bp, non consensus ERE, 564-585 bp, ER/SP1 635-669 bp, CD/L 688-712 bp, MLPE-EPE, 714-728 bp in any combination with the promoter regions listed above.

In addition, elimination of the initiation site (752-786 bp; see Fig 13) which is responsible for non retinoic acid mediated expression may increase specificity, particularly eliminating the expression of transgenes in a constitutive manner in cells expressing low levels of CatD.

Preferably the CatD expressing cells are eye cells, more preferably human eye cells. However, it will be understood by those skilled in the art that the invention may be applied to target cells outside the eye and in species other than humans. Most preferably the target cells in the eye include the RPE cells, iris epithelium, ciliary bodies. Another group of cells which are known to express high levels of CatD are cancer cells.

In a second aspect of the present invention there is provided a vector capable of targeting CatD expressing cells, preferably cells expressing a high level of CatD, said vector including a regulatory element according to the present invention.

Said vector may further include a transgene capable of expression in said CatD-expressing cells.

The invention not only enables the specific targeting of CatD-expressing

cells but, in contrast to the widely used viral promoters (RSV, CMV, MLP), it enables the internal CatD regulatory elements to control the expression of the transgene.

The regulatory element may be a nucleic acid molecule, including DNA, cDNA, genomic DNA and RNA eg. mRNA.

Preferably the regulatory element is a promoter, more preferably a CatD promoter, even more preferably a CatD promoter from retinal pigment epithelium (RPE), preferably human RPE.

Even more preferably the regulatory element includes the nucleotide sequence GGCCGCGCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATC CGGCCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACC CTCTCCGACCC (SEQ ID NO: 1) or a functionally active variant, such as an analogue, derivative, mutant or fragment thereof.

In a particularly preferred embodiment of this aspect of the invention, the regulatory element includes a nucleotide sequence selected from the group consisting of: GGCCGCGCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATC CGGCCCCAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACC CTCTCCGACCC (SEQ ID No: 1)

GGCGCGAGCGGCGGGAACTGTAGGCGCGGCAGGCGCACCACCACCCCCCC CCCGCCCGGGCGCTGTGCGCGTGCGCCGAGGTTGCCCCGCCCAGGCCAGG CCCCGCTCCGCCCCGCCCCGCGCACGCCGGCCGCGCCCACGTGACCGGTC CGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCCAACTGCGGCGTCATCC CGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGACCC (SEQ ID No: 2) GGCCGGGACAGGGGTCACCCCGCGGGGCCCTCCAGGGTGGGCCGCCCCA CGACCCCGGGCCGGCCGAAACGGGAATCCTCCAGACCCCAGAAGCTGGGC CGGGCTGACCCCGCGGGCGCGAGCGGCGGGAACTGTAGGCGCGGCAGGC GCACCACCACCCCCCCCCCGCCCGGGCGCTGTGCGCGTGCGCCGAGGTTG CCCCGCCCAGGCCAGGCCCCGCTCCGCCCCGCCCCGCGCACGCCGGCCGC GCCCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCC CAACTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCC GACCC (SEQ ID No: 3) ATGTGAAAGGAATGTATTTTAGGGTGGAATACTTTGCCTGCCTTCGGGCCTG CTGTCTGCCACGTGAGGCTGTGCCAGTGTGAGGCTGGAATTTGGGATCTGG AGGCTAGAGCCATCGGTGAGGCCTGAGTCTCTAAGCACAGCGCCCAGAGGG CGGAGCGGGTCCGACCCCCTTTGCGGCAGGGCCTGAGCTGGTTTTCCAGGT TTCTCTGGAAGCCCTGTAGAGGAGCGGAGGGTCCATTCGGTGGGCTGGGGA <BR> CTTTGAATTTAACCTTGGTTTGCAAGAGGCTTCCAGAGAGGATGTCTGGGAG CGTCTCGGAGGGGGACGAGGGGGCGCCGGGAGGAGCAGGTGCAGGAGCC CACGGCGCAGCGCCCCGCGCAGGCCTGGACGCGGGGACGGCCGCGGCGG CCGGGACAGGGGTCACCCCGCGGGGCCCTCCAGGGTGGGCCGCCCCACGA CCCCGGGCCGGCCGAAACGGGAATCCTCCAGACCCCAGAAGCTGGGCCGG GCTGACCCCGCGGGCGCGAGCGGCGGGAACTGTAGGCGCGGCAGGCGCA CCACCACCCCCCCCCCGCCCGGGCGCTGTGCGCGTGCGCCGAGGTTGCCC CGCCCAGGCCAGGCCCCGCTCCGCCCCGCCCCGCGCACGCCGGCCGCGC CCACGTGACCGGTCCGGGTGCAAACACGCGGGTCAGCTGATCCGGCCCCAA CTGCGGCGTCATCCCGGCTATAAGCGCACGGCCTCGGCGACCCTCTCCGAC CC GGCCGCCGCCGC (SEQ ID No. 4) or a functionally active variant such as an analogue, derivative, mutant or

fragment, thereof.

The regulatory element may include other fragments of the sequences shown in Figures 13 (SEQ ID No. 5) and 14 (SEQ ID Nos: 6 and 7), produced by restriction enzyme cuts such as BstY, promoter 154-835, Msil, promoter 328-835 or SfL, promoter 460-835. These may provide further specificity to RPE cells.

Specificity to RPE cells may be further increased by the elimination of the estrogen responsive elements totally (480-728 bp; see Fig 13) or partially, E1 480- 495 bp, non consensus ERE, 564-585 bp, ER/SP1 635-669 bp, CD/L 688-712 bp, MLPE-EPE, 714-728 bp in any combination with the promoter regions listed above.

In addition, elimination of the initiation site (752-786 bp; see Fig 13) which is responsible for non retinoic acid mediated expression may increase specificity, particularly eliminating the expression of transgenes in a constitutive manner in cells expressing low levels of CatD.

Preferably the CatD expressing cells are eye cells, more preferably human eye cells. However, it will be understood by those skilled in the art that the invention may be applied to target cells outside the eye and in species other than humans. Most preferably the target cells in the eye include the RPE cells, iris epithelium, ciliary bodies. Another group of cells which are known to express high levels of CatD are cancer cells.

The transgene may be DNA and/or RNA and/or a nucleotide sequence which is in antisense orientation to the target sequence. The transgene or the target sequence may be a nucleic acid sequence which is implicated in the causation exarbation of a pathological condition. The transgene may code for a genomic DNA or cDNA sequence. The antisense transgene may be a DNA sequence targeting genomic DNA, cDNA or mRNA. The transgene may code for a protein or RNA sequence depending the target condition and whether down or upregulation of gene expression is required. Preferably the target gene is expressed in the RPE, however the invention is not limited to such genes. More

preferably the target gene is selected from the group consisting of RPE 65, CatD, cathepsin S, CRALBP, vascular endothelial growth factor (VEGF) and Fibroblast growth factor (FGF). The transgenes of non RPE origin may include reporter genes such as lacZ and green fluorescent protein (GFP), and genes specifically expressed in other cell types within the eye such as opsin. The transgene may also include start codons (ATG) and a variety of stop codons and introns. In addition to containing DNA sequences in sense orientation coding for the appropriate protein, the transgene may be in antisense orientation coding for an RNA capable of inhibiting protein translation from the mRNA sequence.

The vector may be of any suitable type and may be viral or non-viral. The vector may be a recombinant virus. The vector may be an expression vector.

Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e. g., derivatives of SV40; bacterial plasmids; transgenic animal plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

The vector may further include a nucleic acid sequence which mediates the delivery and production of the transgene. Thus, the vector may include the regulatory element of the present invention, with or without a spacer, the transgene with or without 3'untranslated regions and/or viral polyA signals.

In a preferred aspect, the vector or backbone may be a plasmid, for example a mammalian expression vector such as pCDNA2, pGEM etc., a bicistronic expression vector such as pIRES1 neo, or a recombinant virus such as adenovirus, adenoassociated virus, retrovirus, sendai virus, lentivirus, etc.

The vector backbones, in addition to the regulatory element and the transgene or transgenes, may include further elements necessary for transgene expression in different combinations, for example origin of replication (ori), multiple cloning sites, spacer sequences, polyadenilation signals (eg SV40), enhancers, synthetic introns (eg IVS), antibiotic resistance genes (eg Neo) and other marker

genes. The vector may also contain a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

The regulatory element of the present invention may also be used with other full promoters or partial promoter elements.

In addition, the vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells.

More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.

The constructs comprise a vector backbone, such as a plasmid or viral vector backbone, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises a transgene.

Those skilled in the art will appreciate that the various components of the vector are operatively linked, so as to result in expression of said transgene.

In a further aspect of the present invention there is provided a host cell including, eg. genetically engineered with, a vector of the present invention.

The host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation. (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).

Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in

conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying genes. The culture conditions, such as temperature, pH and the like, will be apparent to the person skilled in the art.

In a further aspect of the present invention there is provided a pharmaceutical composition for the prophylaxis or treatment of a pathological condition, said composition including a regulatory element and/or a vector according to the present invention and a pharmaceutically acceptable excipient, diluent or carrier therefor.

In a further aspect of the present invention there is provided a method for prophylaxis or treatment of a pathological condition in a subject in need thereof, said method including administering to said subject an effective amount of a regulatory element and/or a vector according to the present invention.

In a still further aspect of the present invention there is provided use of a regulatory element and/or a vector according to the present invention for preparation of a medicament for the prophylaxis or treatment of a pathological condition.

The pathological condition may be a pathological condition of the eye, such as an eye disease, preferably an eye disease in which up or down regulation of gene expression can be beneficial. For example, the pathological condition may be any disease where a genetic failure or acquired abnormality in the RPE cells have clinical consequences such as subretinal neovascularisation, Early Childhood Retinal Degeneration and Age Related Macular Degeneration.

It should be understood that prophylaxis or treatment of said pathological condition includes amelioration of said condition. It should also be understood that said method of treatment may be a method of gene therapy.

By"an effective amount"is meant a therapeutically or prophylactically effective amount. Such amounts can be readily determined by an appropriately skilled person, taking into account the condition to be treated, the route of

administration and other relevant factors. Such a person will readily be able to determine a suitable dose, mode and frequency of administration.

The subject to be treated is preferably a human, although the methods of the present invention may also be used to treat other mammals such as cats, dogs, horses, sheep, pigs and cattle.

The regulatory element and/or vector of the present invention may be administered via any suitable route. In general, it may be administered by routes including the topical, oral, rectal, parenteral (eg. intravenous, subcutaneous or intramuscular), nasal and inhalation routes.

The pharmaceutical composition may be in any suitable form, including but not limited to capsules, cachets, tablets, aerosols, powder granules, micronised particles, solutions, emulsions and as a bolus etc.

In addition, the active ingredient may be incorporated into biodegradable polymers allowing for sustained release, the polymers being implanted in the vicinity of where delivery is desired. The biodegradable polymers and their use are described in detail in Brem et al., J Neurosurg.. 74: 441-446 (1991).

A person skilled in the art will be able by reference to standard texts, such as Remington's Pharmaceutical Sciences 17th edition, to determine how the formulations are to be made and how these may be administered.

Such formulation techniques include the step of bringing into association the active ingredient and the pharmaceutically acceptable carrier (s), diluent (s) or excipient (s). In general, the formulations are prepared uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

The present invention will now be more fully described with reference to the accompanying Examples and drawings. It should be understood, however, that the description following is illustrative only and should not be taken in any way as

a restriction on the generality of the invention described above.

In the Figures Figure 1: Histopathology human sample retinas following picro-Mallory staining. (A) A typical morphology of an intact retina (sample 12). (B) Demonstration of a typical hyalinised drusen in sample 10. (C) Soft granular drusen in sample 11. (D) Demonstration of the subretinal neovascular membrane (CNV) in sample 13.

Figure 2: (A) Histopathology of a typical human ciliary body and iris following picro-Mallory staining (sample 2). (B-D) Immunohistochemistry of normal human eyes following CatD staining. (B) left panel: CatD immunohistochemistry of a normal human retina (sample 6); right panel: control mouse anti-human IgG monoclonal antibody immunoreactivity of the same sample. The neural retina and the RPE layer are partially detached from the choroid. Strong CatD related immunohistochemical signal present in the RPE layer (arrow) and a signal of medium intensity in the ganglion cell layer (small arrow). (C) CatD immunoreactivity in the pigmented epithelium of the ciliary body (sample 2) and (D) in the anterior dilator epithelium of the iris (sample 6) Figure 3: CatD immunoreactivity in the retinal pigment epithelial layer of representative samples. (A) RPE CatD immunoreactivity in normal, Gp1, young retina (sample 1) and (B) in a normal, Gp1, old retina (sample 5). (C) Typical RPE immunoreactivity around a hyalinised drusen in Gp2 samples (sample 9). (D) RPE CatD immunoreactivity around soft granular drusen in a Gp3 (sample 11). (E) Immunoreactivity around a drusen in a sample with geographic atrophy (sample 12). (F) CatD immunoreactivity in a sample with subretinal neovascularisation (sample 13), arrow pointing to RPE cells. Note no staining of fibrovascular tissue.

Figure 4: CatD immunoreactivity in the retinal pigment epithelial layer of sample 12 at posterior (A) and at anterior (B) locations.

Figure 5: Tissue distribution of RPE CatD expression. A top: An

autoradiograph of Northern blot I containing lane 1: RPE, lane 2: D407, lane 3: MCF7 and lane 4: HepG2 cell total RNA. A, bottom: Expression of GAPDH housekeeping gene on the same blot. B. An autoradiograph of Northern blot 11, the commercial human MTN, containing mRNA from heart (lane 1), brain (lane 2), placenta (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6), kidney (lane 7) and pancreas (lane 8). Both blots were probed with RPECatD.

Figure 6: An autoradiograph of an RNase protection assay demonstrating CatD RNase protected fragments of: lane 1: transfer RNA, lane 2: MCF7 cells, lane 3: RPE cells. The two major TSS are indicated with arrows.

Figure 7: An autoradiograph of an RNase protection assay comparing the intensity of CatD RNase protected fragments of rod outer segment (ROS) challenged and unchallenged RPE cells. Top: Lane 1 RPE cells, lane 2: RPE cells challenged with ROS, and lane 3: tRNA. Bottom: GAPDH RNase protected fragments of the same samples.

Figure 8:. Northern blot analysis of CatD expression in rod outer segment challenged and unchallenged RPE cells. A: Ethidium bromide staining of total RNA loaded. Lane 1: RPE cells, lane 2: rod outer segment (ROS) challenged RPE cells. B: Northern blot analysis of panel A. Lane 1: RPE cells, lane2: ROS challenged RPE cells.

Figure 9: Outline of the CatD promoter region showing five TSS. The two major TSS identified in MCF7 and RPE cells are indicated by black lines and the TATA box with an arrow.

Figure 10: Electroretinograms (ERGs) obtained from representative rats at 4 and 10 days post-injection with vehicle and AdRSVnIslacZ. A. Typical ERG traces recorded from the left and right eye of a rat at 4 days after subretinal injection of vehicle into the right eye. B. Typical ERG traces recorded from the left and right eye of a rat at 4 and 10 days after subretinal delivery of AdRSVnIslacZ into the right eye.

Figure 11: LacZ activity in non-pigmented (a-d) and pigmented (e-f) rat eyes following subretinal injection of AdRSVnIslacZ (a-d) or AdCMVIacZ (e-f) at 7 days post-injection. (a) Gross morphology of an eye after X-gal staining (X4.5), (b) Wholemount preparation of the eye in panel a, showing that the LacZ-positive cells were confined to a circular area within the bleb created (X10), (c) Re- composed computer image of the whole mount preparation in panel b, captured by a BioRad MRC-1000 confocal microscope for quantification of the cells expressing lacZ (X5). Inset: higher magnification of image showing nuclear staining of retinal pigment epithelial (RPE) cells transduced with AdRSVnIslacZ (X50), (d) A light micrograph of the retina, demonstrating that the lacZ activity was localised to the RPE cells (arrows) (X200, counterstained with hematoxylin). (e) Whole mount preparation of a pigmented eye, showing the presence of lacZ- positive cells in a circular area near the posterior part of the eye. (X10). (f) Histological finding indicated that the lacZ activity in the pigmented eye was also localised to the RPE cells (arrows). (X100, counterstained with neutral red) Figure 12: Fluorescent micrographs of RPE cells 48 hours post-transfection with pEGFP-CatDf.

A. ARPE19 (x 40), B. Long Evans RPE (x 40) and C. D407 (x 10) Figure 13: Nucleotide sequence of CatD promoter region. The cloning boundaries in pCatD-gfp are indicated by bent arrows. USF and SP1 binding sites are represented by forward and backward arrows, respectively. The estrogen and RA responsive regions are represented by lines above and below the sequence, respectively.

Figure 14: Alignment of nucleotide sequence of the human Cathepsin D promoter region between MCF-7 cells and leukocytes and diagram summary of relative regulatory elements. The transcribed sequences are shown in upper case.

The transcriptional site and the initiating codon are indicated by"I, II, III, VI, V"and "*"above the sequence, respectively. Sp1 binding sites (<<<) and Ap-2 binding sites (>>>) in the direct and reverse orientations, respectively, are labelled under the sequence. Imperfect palindromes containing > 10 nucleotides including TGA or TCA motifs are underlined or uplined. TATA and CCAAC boxes are labelled in

blocks. RA-responsive region is indicated in blocks. E1-4 or ERE represent estrogen-responsive elements.

Figure 15: Structure of Cathepsin D promoter region and EGFP recombinants.

E1-3 and ERE indicate estrogen-responsive elements; RA indicates retinoic acid- responsive region; Sp1, MLPE (the adenovuris major late promoter element) and AP2 are general regulatory elements. Arrowhead shows TATA box; I-V indicate CatD transcription sites and +1 represents the coding region. The Constructs are shown below, with the corresponding Cathepsin D promoter fragments; EGFP (enhancer green fluorescent protein) in pEGFP-1 N is used for a reporter gene in the constructs.

Figure 16: Diagram of the construct preparation of the CatD promoter region and pEGFP-1 N.

EXAMPLE 1 Sample collection There were 13 eyes from 13 patients aged 5 to 95 years. All but one patient had been examined clinically by one of us (SHS) from 1967 to 1984 as part of a long term clinicopathological study (Sarks S. H. 1980; Sarks S. H. 1976).

Examination included best corrected visual acuity, funduscopy and fundus photography of 11 patients using the 30° field Zeiss fundus camera. The clinicopathological study of patients 5 and 6 have been reported previously (Sarks S. H. 1980; Sarks S. H. 1976).

The eyes were obtained on average 3-4 hours after death, except the eye of a 5 year old child which was obtained at autopsy. Before enucleation intravitreal injection of Lillie's buffered formalin through the pars plana was performed. Following enucleation the eyes were fixed in Lillie's buffered formalin for a minimum of 24 hours at room temperature. The eyes were opened in the horizontal plane and examined macroscopically. The position on the sclera corresponding to the macula was localised by observing the tip of a fine probe during transillumination, and the spot marked with concentrated Harris's

haematoxylin solution. The inferior section was made using a 10 mm corneal trephine from within the eye. Specimens were sequentially dehydrated up to 70 % alcohol, then placed in 90 %, 95 % and 100 % alcohol under evacuation for a period of 4 hours each. The eyes were double embedded in paraffin wax, and serial sections (6 Rm) cut through the optic disc and macula, using the marked spot on the sclera as a guide. Every tenth section was stained by the picro-Mallory method and adjacent sections from each sample were placed on 3- aminopropyltriethoxysilane (APES) (Sigma Chemical Co., St Louis, Miss, USA) coated glass slides.

The eyes were divided into groups according to the appearance of BLD (Sarks S. H. 1976). Briefly, eyes with no BLD (Gp1) or those in which it was present in a patchy distribution (Gp2) were considered normal. ARM was diagnosed when BLD formed a diffuse layer beneath the RPE (Gp3 and 4). The end stages of ARM are called AMD. The two types of AMD geographic atropy (GA) and choroidal neovascularisation (CNV), were represented as Gp5 and Gp6, respectively Bleaching The sections were deparaffinised with xylene, and rehydrated through graded alcohol's to distilled water. All subsequent incubation steps were carried out at room temperature. Sections were immersed in Tris buffered saline (TBS) (pH 7.2) for 5 minutes before being bleached to remove melanin. Bleaching was carried out at various stages, prior to and after incubation with normal horse serum, primary antibody, secondary antibody and chromagen to determine the effect of bleaching on CatD immunoreactvity. Procedure which did not result in a signal decrease was applied for the study. The optimal bleaching procedure was performed as follows. Sections were incubated in 0.25 % Potassium Permanganate for 45 minutes followed by 1 % Oxalic Acid for 5 minutes. After three 5-minute washes in TBS, the sections were processed for immunohistochemistry as usual.

Monoclonal CatD Antibody staining Sections were blocked with 10 % normal horse serum for 30 minutes and then subjected to a further three 5-minute washes. A monoclonal mouse anti- human CatD (Calbiochem-Novabiochem Corporation, San Diego, California, USA) was applied to the sections at a concentration of 5 wg/ml for 1 hour. A monoclonal mouse anti-human IgG was used at the same concentration on control sections.

After washing, sections were incubated for 1 hour with horse anti-mouse IgG conjugated to alkaline phosphatase, (Vector Laboratories Incorporated, Burlingame, California, USA) at a dilution of 1/250. After a further three 5-minute washes, immunodetection was carried out by incubating the sections in SIGMA FAS7TM Fast Red TR/Naphthol AS-MX (Sigma Chemical Company, St Louis, Missouri, USA) for 20 minutes, resulting in a red/pink deposit. A light counterstain was applied by immersing the sections in Meyer's Haemotoxylin for 5 seconds followed by 10 minutes in tap water. Finally, sections were mounted for bright field light microscopy using a glycerol based mounting medium.

Results Of the 13 human eyes studied (Table I) the majority had good morphology (Fig. 1A) and no other changes than patchy artefact detachment of the neural retina was observed.

TABLEI - Clinical and pathological details of 13 study eyes<BR> Patient Age Health V.A. Clinical and Pathological Features<BR> 1 5 Fallot's tetralogy N Not seen clinically. Normal macular on<BR> 2 43 Paraplegia 20/20 Normal<BR> 3 61 Alcoholism 20/20 Normal<BR> 4 64 Carcinoma lung 20/20 Senile tigroid fundus, thin choroid<BR> 5 67 Carcinoma lung 20/30 Normal (cataract)<BR> 6 76 Hypertension Myocardial infarction 20/20 <10 SHD<BR> 7 66 Hypertension 20/20 <10 SHD<BR> 8 74 Carcinoma lung 20/20 <20 SHD<BR> 9 64 Cerebral palsy 20/20 Many SHD most <125 µm diam.<BR> <P>10 65 Alcoholism Blind Clusters of SHD <125 µm diam. (glaucc<BR> 11 94 Bronchopneumonia 20/30 Many SHD + soft distinct (granular) dr@<BR> diam. outside macula<BR> 12 71 Myocardial infarction 20/110 Drusen-related GA<BR> Hard hyalinised drusen nasal to disc<BR> 13 85 Cerebrovascular accident 20/400 Hard hyalinised drusen nasal to disc.<BR> <P>Soft membranous drusen. CNVM surrc<BR> SHD = small hard (hyalinised) drusen, usually <63 µm<BR> GA = geographic atrophy of RPE<BR> CNVM = choroidal neovascular membrane<BR> BLD = basal laminar deposit as peer Groups 1-6 (see materials and methods)

Eyes 6 and 7, had up to 20 small hard drusen of the hyalinised variety within the inner macular. In the second group (Gp2) BLD was present only occasionally over drusen thus these eyes were considered normal. Eyes 9 and 10 had masses of hard drusen (Fig. 1B) mostly within the inner macula, the largest drusen were 125 um diameter. Small clumps of BLD were found over the surface of the largest drusen in both eyes. Eye 11 from a 94-year-old patient presented soft distinct drusen (Fig. 1C) derived from clusters of small hard drusen outside the macula in the region of the arcades. There was no BLD over the drusen.

However at the macula BLD formed a thin continuous layer and a few hard drusen were present but there were no pigmentary changes. The patient who donated eye 12 was followed for 14 years, vision falling from 20/20 to 20/110 from drusen related GA at the age of 71. Patient 13 presented with hard and soft distinct drusen. He was followed for 6 years, vision falling from 20/30 to 20/400 as a results of CNV (Fig. 1D). The morphology of the pigmented epithelium of the ciliary body which formed a single layer and the iris was also sufficiently preserved (Fig. 2A).

To be able to visualise and interpret the immunohistochemical staining results in cell layers with high content of melanin bleaching was performed. When bleaching preceded the incubation of the sample with normal hoarse serum it was effective and did not influence CatD related signal. There was no CatD related immunohistochemical signal detected when bleaching followed incubation with the primary or secondary antibody or with the chromagen. There was no significant difference in the intensity of CatD related signal in unbleached and bleached samples (data not shown). Following bleaching a strong CatD related signal was revealed in the RPE (Fig. 2B, large arrow), pigmented epithelium of the ciliary body (Fig. 2C) and in the anterior iris epithelium (Fig. 2D). In the neural retina there was a medium intensity CatD related signal present in the ganglion cells (Fig. 2B arrow) and occasionally in Muller, smooth muscle and fibroblast cells of the choroid (data not shown). The RPE layer demonstrated the strongest signal in all samples examined (Fig. 2B large arrow). There was no age or disease related change in signal intensity in the ciliary body, the iris epithelium or in the ganglion cells.

There was no difference in the intensity distribution or localisation of RPE CatD related immunoreactivity in young and old normal eyes (Fig. 4A and B) or between the peripheral and central retina of human eyes (data not shown). CatD immunoreactivity in the neural retina or choroid did not change with age or disease stage. RPE cells retained the strongest signal. RPE cells demonstrated a high level, perhaps increased, CatD immunoreactivity around hyalinised drusen (Fig. 4C). The presence of BLD or soft drusen did not affect CatD signal intensity (Fig. 4D). RPE related CatD immunoreactivity remained high around the hyalinised drusen outside the area of atrophy (Fig. 4E) and CNV (data not shown) and in the location of the neovascular membrane (Fig. 4F arrow). There was no CatD immunoreactivity either in drusen or in the neovascular membrane of the CNV sample. There was no CatD immunoreactivity either in drusen or in the neovascular membrane of the CNV sample. RPE CatD immunoreactivity remained strong at all geographical positions. There was no difference in signal intensity between sections derived from the anterior and posterior retina (Fig. 4) EXAMPLE 2 MATERIALS AND METHODS The CatD cDNA clone A cDNA library prepared from cultured human RPE cells challenged with bovine ROS was constructed in the vector LambdaGEM-4. To obtain full length clones the library was screened with the Hind III fragment of a CatD clone (M13/CatD), corresponding to the first 1571 bp of the human CatD mRNA. The library was screened by plaque lifts on Zeta-Probe GT membrane (Bio-Rad Laboratories, Hercules, CA, USA). The membranes were prehybridized and hybridized in 0.25 M Na2HP04 pH 7.2,7 % SDS at 45°C for 5 minutes and 4-24 hours respectively. The membranes were washed twice in 20 mM Na2HPO4 pH 7.2,5 % SDS for 30 minutes then twice in 20 mM Na2HP04 pH 7.2,1 % SDS also for 30 minutes each. The washes were performed at 50°C and raised to 55°C when higher stringency was required.

The resulting clones in LambdaGEM-4 were converted to plasmid form, pGEM-1, by digestion with Spe I and re-ligation. The plasmid DNA was extracted and purified with Midi Qiagen-100 columns following the manufacturer's instructions (Qiagen, Hilden, Germany) and analyzed by Southern blot hybridization using conditions described above. Plasmids were sequenced in both directions using automated sequencing. The reactions were performed using a PRISM Ready Reaction DyeDeoxy Terminator Cycle Sequencing Kit and analyzed on an Applied Model 373A Automated Sequencer (Perkin-Elmer Applied Biosystems, Foster City, CA, USA).

Rapid amplification of the 5'cDNA end (5'RACE) To obtain the missing 5'end of the clones isolated from the library, 5' RACE was performed with the Marathon cDNA Amplification Kit following the manufacturer's protocol (Clontech Laboratories, Palo Alto, CA, USA). A CatD- specific primer spanning part of the coding region +349-+368 was used to prime the reverse transcriptase reaction. The cDNA was synthesized from RNA extracted from the same cells used to construct the cDNA library and amplified using PCR with a kit primer complementary to the 5'adaptor and a CatD-specific primer spanning a part of the coding region +325-+347. Synthetic oligonucleotides (primers) were synthesized by Bresatec Pty. Ltd. (Thebarton, SA, Australia). The 5'RACE product was purified on agarose, and sequenced in both directions as described above.

Sequencing analysis IBI Pustell Sequence Analysis Software (International Biotechnologies, New Haven, CT, USA) and the Blastn program were used for sequence comparison of the CatD clone and 5'RACE product with known CatD cDNA sequence on GenBank.

Northern blot analysis: Northern Blot I was prepared using 10 ug of total RNA, which was extracted from different cell lines of human origin namely, low passage human RPE cells,

HepG2 cells (a human hepatocellular line), MCF7 cells (a human breast cancer cell line), and D407 cells (an immortal human RPE cell line). The HepG2 and MCF7 cells were obtained from the American Type Culture Collection (ATCC, Rockville, USA) and maintained as recommended. Primary RPE cell cultures from human donor tissue were established as previously described. The total RNA was electrophoresed, transferred to Zeta-probe GT membrane then hybridized. A commercial human multiple tissue northern (Clontech Laboratories, Palo Alto, CA, USA), Northern Blot II, contained 2 ug of polyA+ RNA from human heart, brain, placenta, lung, liver, skeletal muscle, kidney and pancreas was purchased. Both Northern blots I and 11 were probed with the CatD cDNA insert isolated from the RPE cDNA library and the purified 5'RACE product labelled with a-32P-dCTP (Du Pont, Boston, MA, USA) by nick translation (Promega Corporation, Madison, Wl, USA). Equal loading of total RNA was demonstrated in Northern Blot I by probing with a radiolabeled insert of rat glyceraldehyde-3- phosphate dehydrogenaze (GAPDH). Rat GAPDH cDNA is 89 % homologous to human GAPDH cDNA, which is sufficient to hybridize with the transcripts from the human derived cell lines.

Cultured human RPE cells were left unchallenged or were challenged with 107 bovine ROS per ml in culture for 24 hours as previously described, then harvested for RNA extraction and 4 ug of total RNA of each sample was loaded on the gel. Equal loading was demonstrated using ethidium bromide staining. The Northern blot was probed with a radiolabeled insert purified from a full-length CatD clone (M 13/CatD).

RNase protection assay A clone containing 5'-prime upstream sequences of CatD was obtained, and the region containing the transcriptional start sites (TSS) was sub-cloned into pGEM-3Zf (Promega Corporation, Madison, Wl, USA). The resulting clone spanned the sequence numbered 702-1002 of genomic CatD sequence, HMCATD1 (GenBank &num M63134). This 301 bp insert corresponded to the upstream region of CatD spanning from-178 bb relative to the ATG, included exon 1, to within the first intron. The RNA probes were synthesized using the

Riboprobe System (Promega Corporation, Madison, Wl, USA) incorporating a-32P- CTP (Du Pont, Boston, MA, USA). Rat GAPDH was used as a control to demonstrate equal RNA amounts in all samples. The CatD and GAPDH probes were purified from unincorporated radioactive nucleotides using Chromaspin DEPC-30 and DEPC-400 columns respectively (Clontech Laboratories, Palo Alto, CA, USA). Total RNA was extracted from MCF7 cells, cultured human RPE cells that were either unchallenged or challenged with bovine ROS for 24 hours. An equal amount of yeast tRNA was used as a negative control to identify any self- protected fragments from the probes. The assay was performed with 10 ug total RNA for each sample using a commercial RNase Protection kit (Boehringer Mannheim, Mannheim, Germany). The protected RNA products were analyzed on a 7M urea/8 % polyacrylamide gel. Radioactive pGEM-3Zf dideoxy reaction products were run in parallel as a size marker (Omnibase DNA cycle sequencing system, Promega Corporation). Single stranded DNA (sequencing products) run approximately 10 % slower than single-stranded RNA (RNA protected products) and this was taken into account when identifying the TSS.

RESULTS Isolation and sequence analysis of RPE cell CatD cDNA Following low stringency screening 12 clones were isolated and of these all 6 which were selected for further characterization by Southern blot hybridization demonstrated strong signals (data not shown). Altogether 4 clones of varying length were partially sequenced and all of them had high homology to CatD. One of these clones (RPECatDE) contained an 1885 bp long insert and sequence analysis showed that it spanned position +115 to +1987 of CatD downstream from the start codon (ATG) (Faust P. L. et al. 1985). Except for a deletion of three thymidines at position +1393 to +1395 relative to the start codon, the 1885 bp long RPECatDE, was identical to the kidney CatD cDNA sequence, HMCTHD, <BR> <BR> <BR> (GenBankTM &num M11233) (Faust P. L. et al. 1985). The thymidine deletion was in the 3'-untranslated region and was likely to have occurred during the cloning process as this deletion was not in another partial CatD clone previously isolated from this

RPE cDNA library (Caveney D. et al. 1995).

The extreme 5'end and start codon missing from RPECatDE was subsequently isolated using 5'RACE. The RACE fragment (RPECatDF) that was approximately 400 bp long (data not shown) overlapped with RPECatDE and contained the missing 5'region which includes the start codon. The sequence of RPECatDF contained the adaptor primer sequence and CatD sequence corresponding to the beginning of the start codon at position +1 to the end of the primer used to generate the product which is at position +347. No sequence upstream of the start codon was isolated. There were no differences between the RPECatDF and the relevant kidney CatD cDNA sequence.

The full length RPE CatD and the kidney CatD cDNA sequence (GenBankTM &num M11233) (Faust P. L. et al. 1985) differ slightly from other CatD sequences previously reported. RPECatD and kidney CatD cDNA sequences differed from MCF7 CatD cDNA sequence by 5 mutations at single base-pair sites, 4 of these are silent mutations and therefore are likely to be polymorphisms.

The CatD cDNA sequence from estrogen responsive breast cancer cells, ZR-75 contains 1 silent mutation and 1 bp deletion compared to the kidney (Westley B. R. et al. 1987) and RPECatD sequences. Furthermore a human CatD cDNA clone from fibroblasts is identical to the kidney cDNA sequence except for a transition (A-G) at position +1306 and an extra 17 bp at the 5'end (Conner G. E. et al.

1989). Considering that several rounds of low stringency screenings with different probes all isolated clones identical to CatD it can be concluded that the main aspartic protease present in RPE cells is CatD Tissue distribution of CatD Northern blot analysis: Having established that the major aspartic protease present in RPE cells was CatD the relative levels of CatD expression in cell lines and tissues was investigated. The mRNA expression of CatD transcripts was monitored by the appearance of a signal at 2.2 kb, on Northern blots I and 11. CatD expression was detected in RPE cells, D407, MCF7 and HepG2 cell lines at varying intensities.

The expression of CatD was the strongest in RPE cells (Figure 5A, lane 1) followed by an intense signal in MCF7 cells (Figure 5A, lane 3). MCF7 cells, in agreement with previous reports, demonstrated elevated levels of CatD mRNA expression. CatD was moderately expressed in the HepG2 cells (Figure 5A, lane 4) and very weakly in the D407 cells (Figure 5A, lane 2). The human tissue blot demonstrated the ubiquitous expression of CatD (Figure 5). The strongest CatD expression was found in heart, lung, liver and skeletal muscle tissue samples (Figure 5B, lanes 1,4,5 and 6, respectively).

Identification of RPECatD Transcription Start Sites The TSS utilized by the RPE cells were investigated by a RNase protection assay. The RNase protection patterns of RPE cells (Figure 6, lane 3) showed two TSS which were approximately 90 and 131 nucleotide long and corresponded to-20 and-72 TSS (Cavailles V. et al. 1993) utilized by MCF7 cells (Figure 6, lane 2). The use of the same two TSS sites was shown in the RPE cell cultures from two different donors (data not shown) suggesting that these TSS sites are exclusively responsible for the expression of CatD in RPE cells.

Studies of ROS challenge on TSS activation and mRNA expression in RPE cells To investigate if phagocytosis of ROS initiates the use of additional TSS or upregulates any of the previously identified TSS sites an RNase protection assay was conducted on ROS challenged and unchallenged RPE cultures. Human RPE cells that had been challenged with ROS demonstrated no difference in the number of active TSS. The TSS found in challenged RPE cells (Figure 7 lane 2) were identical to those found in unchallenged RPE cells (Figure 6, lane 3 and Figure 7, lane 1). There was no increase in the signal intensity of TSS when RPE cells were challenged with ROS (Figure 7, lanes 1 and 2). Furthermore, Northern blot analysis of ROS unchallenged and challenged RPE cells did not show significant difference in the intensity of CatD mRNA expression (Figure 8). These results demonstrated that, in cultured RPE cells, the use of the two TSS was independent of ROS challenge and that ROS challenge did not initiate factors

inducing additional CatD expression.

In summary it was established that in RPE cells there are two transcription sites for CatD transcription (Fig. 9, site V). One of them is a constitutive responsible for CatD expression. In addition, it was demonstrated that the high level of CatD expression in RPE cells is the intrinsic nature of these cells and that it is linked to a TATA box-controlled TSS (Fig. 9 site 1). This TSS has previously been described as an estrogen regulated TSS.

EXAMPLE 3 Materials and Methods Propagation and purification of recombinant adenovirus The replication deficient adenovirus carrying the Rous sarcoma virus (RSV) long terminal repeat (LTR)-controlled E. coli LacZ reporter gene with a simian virus 40 nuclear localisation sequence (AdRSVnIslacZ) for b-galactosidase (b-gal).

AdRSVIacZ was used to infect 40 160cm2 tissue flasks of 293 cells. The infected cells were harvested and the resulting adenovirus purified on cesium chloride density gradients, dialysed against phosphate buffered saline (PBS), resuspended to a final concentration of 10% glycerol and stored at-70°C. The virus was titred by limiting dilution and also by spectrophotometry. The replication deficient adenovirus carrying the human cytomegalovirus (CMV) promoter-controlled E. coli lacZ reporter gene (AdCMVIacZ) was a gift from Dr. Karpati and the titre of this virus was 1x1012 pfu/ml.

Delivery of virus into the subretinal space Six-to eight-week old pigmented rats (RCS rdy p+) and non-pigmented rats (RCS rdy) were anaesthesised by intramuscular injection with a mixture of ketamine (50mg/kg body weight) and xylazine (8mg/kg body weight). The pupils were dilated with 2.5% phenylephrine (Chauvin Pharmaceutical Ltd., Romford, England) and 1 % tropicamide (Alcon, Belgium). The conjunctiva behind the limbus was cut to expose the sclera. A shelving puncture of the sclera was made

with a 30 gauge needle. A 32 gauge needle attached to a 5 ml Hamilton syringe was inserted through the puncture tangentially towards the posterior part of the eye and the advancement of the needle was observed under an operating microscope. Two microlitres of AdRSVnislacZ, or AdCMVIacZ (each containing 7 x 108 pfu of the virus) or vehicle (PBS containing 10% glycerol) were delivered into the subretinal space. The retina was closely observed at the penetrating site under an indirect ophthalmoscope. The conjunctiva was then replaced and an antibiotic solution (gentamicin) was applied on the eye at the site of the wound.

Successful delivery into the subretinal space was confirmed by the appearance of a partial detachment of the retina or bleb using the indirect ophthalmoscope. Only eyes with blebs were used for this study. The corneas were kept moist with Celluvisc (Allergan) until the rats recovered from the anaesthesia. The injected eyes were observed using indirect ophthalmoscopy to assess any signs of injury or infection at 3 and 7 days post-injection. All procedures used adhered to the Australian Code of Practice for the Care and Use of Animal for Scientific Purposes (Australian Health and Medical Research Council).

Electroretinography (ERG) The eyes of RCS rdy rats injected subretinally with the AdRSVnIslacZ and vehicle were assessed using ERG. Following anaesthesising the rat and dilation of the pupil as described above, the rat was placed in a stereotaxic frame. The corneas were kept moist with Celluvisc. The animals used for ERG analysis were then allowed to dark adapt for 30 min before recording of scotopic flash electroretinograms. A platinum wire loop was placed on each cornea to act as the recording electrode and a reference electrode was connected to each other.

Ground electrodes were attached to the animal's back. A xenon strobe light placed 0.5m in front of the animal presented the flash stimulus at 0.25 Hz. Eight consecutive responses were amplified and averaged using a MacLab/2e bioamplifier/data recorder running"Scope"software (ADlnstruments). The peak amplitudes of the a-and b-waves of the electroretinogram were determined at days 4 and 10 post-injection. The a-wave amplitude was measured from the baseline to the peak of the a-wave response and the b-wave amplitude was measured from the trough of the a-wave to the peak of the b-wave. A Paired T-

test was used to compare the a-and b-wave amplitudes of the treated eye with the control eye for each animal. A mean value standard error of the mean was calculated from the 4 treated eyes and the 4 control eyes in each group.

X-gal staining Rat eyes injected with AdRSVnislacZ, AdCMVIacZ or vehicle and uninjected eyes were enucleated at 7 and 28 days post-injection. A slit was made in the cornea of each eye before they were fixed in 2% paraformaldehyde for 1 h at 4°C followed by three 30 min washes in PBS. The fixed-eyes were incubated overnight at room temperature in 1 mg/ml 5-bromo-4-chloro-3-indolyl-b-D- galactopyranoside (X-gal) solution containing 5 mM potassium ferrocyanide, 5 mM potassium ferricyanide, 2 mM MgCl2 in PBS before being processed for whole mount preparation and paraffin embedding.

Wholemount preparation After enucleation and X-gal staining of the eyes as described earlier, the anterior chamber and lenses were removed. Four to five radial incisions were made at the peripheral part to enable the eye cup to be flattened, sclera side down, onto a silanated glass slide. The neural retina was then gently peeled off and the remaining tissue coverslipped. In krypton laser-treated eyes, the whole mount was prepared in a similar manner but the neural retina was not removed.

Image capture and analysis Quantitation of cells expressing LacZ was performed using image capture and analysis. Images of the cell layer in the wholemount preparation were recorded using the transmission detector of a BioRad MRC-1000 confocal microscope attached to a Nikon Diaphot 300 inverted microscope. The microscope was equipped with an electronic stage programmed to collect images with an overlap of 10 pixels. The image size was 512 x 512 pixels or 312 x 312 mm (pixel size 0.6 mm2). A 20 x OlanApo lens with a numerical aperture of 0.75 (Nikon) was used. The zoom was adjusted to 1.5 and all three lines of the Krypton/Argon laser (488,568 and 647 nm) were used for illumination. Movement

of the stage was controlled using a macro under BioRads macro programming language (MPL) programme. The focus was adjusted manually.

Images were analysed using the public domain NIH image programme developed at the National Institute of Health (USA) and available on the internet at http://rsb. info. gov/nih. image. A macro which has two major functions, i) to keep a count of all positive cells and ii) to clearly mark counted cells was used so that artefacts, due to either omission or double counting could be avoided. Montages of images were prepared using a combination of NIH image and Canvas 5.0 (Deneba software) and printed on an Epson 600 ink jet printer with a resolution of 720 dpi.

Histology and immunohistochemistry After staining of the eyes with X-gal, the anterior segments and lenses were removed and the resulting eye cups were placed in 70% ethanol for at least 2 h before being processed for paraffin embedding. Paraffin sections of 5-mm thickness were prepared. For laser-photocoagulated eyes, sections with laser lesions were collected. The expression and distribution of lacZ activity were examined by light microscopy after the sections were deparaffinised and then counterstained with hematoxylin, hematoxylin and eosin or neutral red.

Results Evaluation of subretinal injection on retinal function To determine the effect of subretinal delivery of AdRSVnIsIacZ or vehicle on retinal function, electroretinography (ERG) was used to clinically evaluate any changes in the responsiveness of the retina to light at 4 and 10 days post- injection. The subretinal injection of vehicle alone had no significant effect upon a- or b-wave amplitude of the scotopic flash elecroretinogram recorded at 4 and 10 days post-injection (Table II) demonstrating that the procedure itself did not cause significant retinal damage. Fig. 10a shows typical ERG traces recorded from the left and right eyes of a rat at 4 days after subretinal injection of vehicle into the right eye.

TABLE li: Measurement of a-and b-wave amplitude of the scotopic flash electroretinogram at 4 and 10 days after subretinal injection a-wave amplitude b-wave amplitude (µv) (µv) aControl vehicle aControl vehicle Day4 386 5014 ns 15815 1553 ns Day 10 43 t 14 42 11 ns 191 43 195 37 ns aControl AdRSVnislacZ aControl AdRSVnislacZ Day 4 79 t 12 50 10 ns 245 243 105 16 P<0.05 82~952~18ns283~14151~47nsDay10 a contralateral eye of the same animal analysed ns: not significant Typical ERG traces, recorded following the subretinal injection of AdRSVnIslacZ, are shown in Fig. 10. It can be seen in Table II that the ERG a- wave amplitude was suppressed on day 4 and day 10 following subretinal injection but these results were not statistically different from the mean a-wave amplitudes obtained from the contralateral control eyes (p>0.05). However, a subretinal injection of AdRSVnIslacZ caused a significant suppression of the scotopic ERG (b-wave). At four days post-injection, the mean b-wave amplitude was 105~16µV compared with the contralateral control value of 245+23RV (n=4, p<0.05). A slight recovery in the b-wave amplitude to 15147 (iV was seen on day 10. This value was not significantly different from the mean b-wave recorded from the contralateral control eyes (p>0.05) (see Table II), suggesting that the drop in the b-wave amplitude was transient.

LacZ expression in AdRSVnIsIacZ injected eyes The expression of lacZ after subretinal delivery of recombinant adenoviruses was evaluated in the RCS rdy (non-pigmented) and RCS rdy p+ (pigmented) rats. Gross inspection of the eye cups after histochemical staining with X-gal demonstrated the presence of lacZ activity, seen as a blue precipitate,

in all AdRSVnIslacZ-injected eyes of RCS rdy (n=8) and RCS rdy p+ rats (n=5) sampled at 7 days post-injection. LacZ positive-cells were predominantly confined to the posterior part of the eye (Fig. 11). Control uninjected eyes and eyes injected with vehicle did not have any lacZ activity.

From light microscopical examination of the whole mount preparations, the lacZ-positive RPE cells were confined to the subretinal space which was in contact with the injected virus (Fig. 11). Gross examination showed that the lacZ-positive cells were present, at most, in a quarter of the whole retinal area in RCS rdy rat eyes injected with AdRSVnIslacZ. (Fig. 11). The nuclear localisation of the blue precipitate was clearly visible under high magnification (Fig. 11 inset). From histological examination of paraffin-embedded sections, lacZ activity was predominantly present in the RPE cells (Figs. 19, arrows). However, transduced cells were occasionally observed in the photoreceptor, inner nuclear and ganglion cell layers (data not shown). In the eyes of RCS rdy p+ rats (n=5), a similar observation was made on gross examination of whole eyes, whole mount preparations and histological examination. However, the area comprising of lacZ- positive cells in the pigmented rat eyes were smaller than in non-pigmented RCS rdy eyes. In spite of the presence of dense pigmentation in these eyes, the blue precipitate was clearly visible (data not shown). In the control eyes, uninjected or injected with vehicle alone, lacZ expression was not detected microscopically.

At 14 days post-injection of AdRSVnIslacZ, gross inspection of the eye cup of RCS rdy rats (n=6) and also light microscopic examination of whole mounts and paraffin-embedded sections all showed that lacZ activity was still detectable.

However, the lacZ-positive cells covered a smaller area of the eye cup. No lacZ expression was detected at 21 days post-injection. For the RCS rdy p+ rats (n=6), only two eyes had a few lacZ-positive cells at 14 days post-injection. Except for the presence of infiltrating cells at the injection site of some of the RCS rdy and RCS rdy p+ eyes sampled at 7 days post-injection, the presence of AdRSVnIslacZ did not appear to have an effect on the morphology or histology of the eye and the animals were feeding and moving normally.

LacZ expression in AdCMVIacZ-injected eyes In the eyes of RCS rdy and RCS rdy p+ rats injected with AdCMVIacZ, strong lacZ expression was detected at 7 and 14 days post-injection. From light microscopic examination of whole mount preparations, lacZ-positive cells were present in an area covering approximately a quarter of the eyes of RCS rdy rats (n=4) and RCS rdy p+ rats (n=4) (Fig. 11). Histological examination of paraffin- embedded sections revealed the presence of lacZ expression predominantly in RPE cells in the subretinal space (Fig. 11 arrows). There were also a few lacZ- positive cells present in the photoreceptor and inner nuclear layers. Except for the presence of some infiltrating cells at the site of injection, the histology was normal.

LacZ activity was still detectable at 28 days, the last sampling time point, in both RCS rdy (n=3) and RCS rdy p+ rats (n=3) but there was a decrease in the area covered by lacZ-positive cells.

There were less lacZ-positive cells in the pigmented eyes at the same sampling time when compared to non-pigmented eyes. Also, unlike the crisp nuclear staining with X-gal following AdRSVnIsIacZ injection (Fig. 11 and d), the lacZ activity resulting from AdCMVIacZ injection was present in the cytoplasm of RPE cells and the blue precipitate appeared diffused throughout the cytoplasm (Fig. 11 f).

Quantification of lacZ expression in the RPE layer To demonstrate the reproducibility of subretinal recombinant adenovirus- mediated gene delivery into the rat eye, RCS rdy rat eyes were injected with AdRSVnIslacZ. The nuclear localisation of the transgene gave a clear definition of the transduced cells (Fig. 11 inset) and the resultant whole mount retinal images were suitable for quantification. RCS rdy rats eyes (n=8) injected with AdRSVnIslacZ were enucleated at 7 days post-injection and the variability in transduction of RPE cells following subretinal delivery of the virus was assessed by image capture and analysis (Fig. 11). The number of lacZ-positive cells in the eight eyes sampled were 7140,6338,4269,3885,3698,3370,3138, and 2381, respectively with a mean and standard deviation of 4277+1632.

EXAMPLE 4 Regulatory elements were placed upstream of the green fluorescent protein (gfp) gene within a eucaryotic expression plasmid. This allows us to examine the CatD promoter activity in different cell types, including retinal pigment epithelial (RPE) cells, and under different culture conditions by measuring the relative levels of green fluorescence in the cells. One of the CatD promoter fragments used contained all of the most studied oestrogen responsive regions and the one identified retinoic acid responsive region.

MATERIALS AND METHODS Plasmid construction: The plasmid pEGFP-N1 (Clontech) contains the gfp gene driven by the CMV promoter. In addition, this plasmid contains a multiple cloning site immediately upstream of the gfp gene and it also contains the neomycin resistance gene (neor) for antibiotic selection if required. The CMV promoter was removed from pEGFP-N1 by restriction enzyme digestion with Asel and Nhel or other appropriate restriction enzymes. The cut plasmid was then blunt ended and relegated to yield a gfp plasmid containing no promoter, pEGFP-NP.

A 773 bp fragment of the human CatD promoter (-770bp to-3bp relative to the ATG start codon) was excised from a plasmid containing the CatD gene with the restriction enzyme Nlalll. The resulting fragment was blunt ended with T4 DNA polymerase in order to remove the 3'overhang containing the CatD gene start codon. <BR> <BR> <BR> <BR> <BR> <BR> <P> Similarly, three other fragments of the human CatD promoter were prepared (see Figure 15). <BR> <BR> <BR> <BR> <BR> <BR> pEGFP-NP was linearised eg. with the blunt ended restriction enzyme EcoICR1 which cut within the MCS. Each of the CatD promoter fragments

was cloned into this site (see Figure 16). Clones were obtained with the CatD promoter fragments in the correct forward orientation (pEGFP-CatDf) and in the backward orientation (pEGFP-CatDb).

Cell lines: A range of human, rat and murine cell lines were tested for their ability to express gfp when using the CatD promoter. We chose cells that are well characterised in their CatD expression status as well as some less well studied cells. The cells tested are listed below: LE Long Evans rat RPE cells (primary culture) ARPE19 human RPE cell line D407 a human RPE cell line that only expresses immature CatD by Western blot analysis.

NB41 murine neuroblastoma cell line C2C12 mouse muscle myoblast cell line HeLa human cervical carcinoma cell line MDA-MB-231 human breast adenocarcinoma MDA-MB-468 human breast adenocarcinoma ZR-75-1 human breast carcinoma that expresses oestrogen receptors MCF7 oestrogen responsive human breast adenocarcinoma cell line that expresses high levels of CatD.

293 human embryonic kidney cell line Transient transfections: All cells were transfected with the non-liposomal reagent, FuGENE (Roche). Cells were grown until 60-80% confluent in 6 well or 12 well plates. The transfection was carried out according to the manufacturer's instructions in Dulbeco's Modified Eagle medium in 5% fetal bovine serum (Life Technologies).

In addition to pEGFP-CatDf, cells were also transfected with pEGFP-N1 as a positive transfection control and pEGFP-NP or pEGFP-CatDb as a negative control. 48 to 72 hours post-transfection, cells were visualised by fluorescent

microscopy for GFP protein expression.

Results: These transfections were to establish if CatD promoter driven expression of GFP could be detected in RPE cells. The photographs clearly show that the three RPE cell lines tested express GFP protein driven by the CatD promoter. There was a variety of GFP expression intensity observed in cell lines other than RPE with the highest levels expressed in cancer cells.

Finally, it is to be understood that various alterations, modifications and/or additions may be made without departing from the spirit of the present invention as outlined herein.

It will also be understood that the term"comprises" (or its grammatical variants) as used in this specification is equivalent to the term"includes"and should not be taken as excluding the presence of other elements or features.

REFERENCES <BR> <BR> <BR> <BR> <BR> <BR> Barrett A. J. 1977 ; Proteinases in Mammalian cells and tissues. North- Holland, Amsterdam: p. 209-48. <BR> <BR> <BR> <P>Beato M. 1989 ; Cell 56 : 335-44.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Blake M. C., Jambou R. C., Swick A. G., et al. 1990 ; Mol Cell Biol 10 : 6632-41.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Bok D. 1985 ; Invest Ophthalmol Vis Sci 26 : 1659-94.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Bok D. 1993 ; Journal of Cell Science 17 : 189-95.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Bosch E., Horwitz J., Bok D. 1993 ; J Histochem Cytochem 41 : 253-63.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Bressler N. M., Silva J. C., Bressler S. B., et al. 1994 ; Retina 14 : 130-42.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Bridges C. D. B. 1976 ; Exp Eye Res 22 : 435-55.

Cavailles V., Augereau P., Rochefort H. 1991 ; Biochem Biophys Res Commun 174: 816-24. <BR> <BR> <BR> <BR> <BR> <BR> <P> Cavailles V., Augereau P., Rochefort H. 1993 ; Proc Natl Acad Sci USA 90: 203-7. <BR> <BR> <BR> <BR> <BR> <BR> <P> Caveney D., Rakoczy P., Constable I. 1995 ; Aust N Z J Ophthalmol 23 : 139- 44. <BR> <BR> <BR> <BR> <BR> <BR> <P> Conner G. E., Udey J. A., Pinto C., et al. 1989 ; Biochemistry 28 : 3530-3.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P> Dubik D., Shiu R. P. C. 1992 ; Oncogene 7 : 1587-94.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P> Faust P. L., Kornfeld S., Chirgwin J. M. 1985 ; Proc Natl Acad Sci USA 82: 4910-4. <BR> <BR> <BR> <BR> <BR> <BR> <P> Feeney L. 1987 ; Invest Ophthalmol Vis Sci 17 : 583-600.<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <P>Grusby M. J., Mitchell S. C., Glimcher L. H. 1990 ; Nucleic Acids Res 18 : 4008<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> Hara S., Hayasaka S., Mizuno K. 1986 ; Graefe's Arch Clin Exp Ophthalmol 224: 384 <BR> <BR> <BR> Hayasaka S., Hara S., Mizuno K. 1975a ; Exp Eye Res 21 : 307<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> Hayasaka S., Hara S., Mizuno K. 1975b ; Invest Ophthalmol Vis Sci 14 : 617<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> J.,BokD.1976;AmJOphthalmol81:93-7.#Heller <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> G.,GebbiaN.,RausaL.,etal.1992;AnticancerRes12:235-40.#Leto <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> M.,TerayamaH.1984;ExpCellRes151:273-6.#Morioka <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> T.J.,Wu-WongJ.R.,ShiosakiK.1992;FASEBJ6:2653-9.#Opgenorth <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> B.,HorstM.,HasilikA.1989;BiochemJ262:843-7.#Redecker <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> H.,CaponyF.,GarciaM.1990;CancerMetastasisRev9:321-31.#Rochef ort <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> J.C.,BredbergD.L.,NoyN.1994;Biochemistry33:3106-12.#Saari

Sarks S. H. 1976; Br J Ophthalmol 60: 324-41.

Sarks S. H. 1980; Aust J Ophthalmol 8: 117-30.

Smale S. T., Schmidt M. C., Berk A. J., et al. 1990; Proc Natl Acad Sci USA 87: 4509-13.

Westley B., Rochefort H. 1980; Cell 20: 353-62.

# Westley B. R., May F. E. B. 1987; Nucleic Acids Res 15: 3773-86.

Young R. W., Bok D. 1969; J Cell Biol 42: 392-403.