Background of the Invention Annual crop losses to plant-parasitic nematodes (soil-dwelling microscopic worms) are estimated to exceed 70 billion dollars world-wide. The soybean cyst nematode (SCN), Heterodera glycines, causes about one billion in annual soybean losses in the United States alone. Environmental restrictions in the use of toxic nematicides and limitations in available plant resistance schemes to nematodes have prompted an urgent need for alternative management strategies to reduce nematode- related damage in agriculture.

One way to control nematodes is by understanding and specifically interfering with the nematode's ability to locate and feed from plant roots. Like most plant- parasitic nematodes, infective juveniles of SCN migrate in the soil and use their neurosensory organs to follow chemical signals emanating from host roots that they will attack Chemoreceptor molecules have been identified in the model nematode, Caenorhabditis elegans, as described in S. Yu et al., Proc. Natl. Acad. Sci. USA 94, 3384-3387 (1997). However, essentially nothing is known about putative chemoreceptors in plant-parasitic nematodes. Accordingly, there is a continued need for more information about the chemoreceptors of plant-parasitic nematodes.

Summary of the Invention A first aspect of the present invention is an isolated DNA encoding a nematode guanylyl cyclase chemoreceptor selected from the group consisting of (a) isolated DNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 6; (b) isolated DNA that hybridizes to DNA of (a) above under stringent conditions and encodes a nematode guanylyl cyclase chemoreceptor; and (c) isolated DNA that differs from the DNA of (a) or (b) above due to the degeneracy of the genetic code, and encodes a nematode guanylyl cyclase chemoreceptor encoded by (a) or (b) above.

In one particular embodiment of the invention, the isolated DNA is selected from the group consisting of : (a) isolated DNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 6; (b) isolated DNA that hybridizes to DNA of (a) above under stringent conditions in which said isolated DNA does not hybridize to DNA having a nucleotide sequence of SEQ ID NO: 1, and encodes a nematode guanylyl cyclase chemoreceptor; and (c) isolated DNA that differs from the DNA of (a) or (b) above due to the degeneracy of the genetic code, and encodes a nematode guanylyl cyclase chemoreceptor encoded by (a) or (b) above.

In another particular embodiment of the invention, the isolated DNA is selected from the group consisting of : (a) isolated DNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and SEQ ID NO: 3; (b) isolated DNA that hybridizes to DNA of (a) above under stringent conditions and encodes a nematode guanylyl cyclase chemoreceptor; and (c) isolated DNA that differs from the DNA of (a) or (b) above due to the degeneracy of the genetic code, and encodes a nematode guanylyl cyclase chemoreceptor encoded by (a) or (b) above.

In another particular embodiment of the invention, the isolated DNA is selected from the group consisting of : (a) isolated DNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4; (b) isolated DNA that hybridizes to DNA of (a) above under stringent conditions and encodes a nematode guanylyl cyclase chemoreceptor; and (c) isolated DNA that differs from the DNA of (a) or (b) above due to the degeneracy of the genetic code, and encodes a nematode guanylyl cyclase chemoreceptor encoded by (a) or (b) above.

In still another particular embodiment of the invention, the isolated DNA is selected from the group consisting of : (a) isolated DNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 6; (b) isolated DNA that hybridizes to DNA of (a) above under stringent conditions and encodes a nematode guanylyl cyclase chemoreceptor; and (c) isolated DNA that differs from the DNA of (a) or (b) above due to the degeneracy of the genetic code, and encodes a nematode guanylyl cyclase chemoreceptor encoded by (a) or (b) above.

Preferably, the encoded nematode guanylyl cyclase chemoreceptor is selected from the group consisting of order Tylenchida and order Aphelenchida chemoreceptors.

A second aspect of the invention is an oligonucleotide that specifically binds to isolated DNA as described above is a further aspect of the invention. Such an oligonucleotide may comprise DNA or RNA, or may be a synthetic oligonucleotide.

A third aspect of the invention is an antisense oligonucleotide that specifically binds to an mRNA transcript of a DNA as described above, along with DNAs that encode such antisense oligonucleotides.

A fourth aspect of the invention double-stranded RNA that is complementary to a DNA as described above and interferes with the expression thereof in a cell that expresses the encoded protein.

A fifth aspect of the invention is an expression cassette comprising a DNA as described above and a heterologous promoter operatively associated therewith, along with cells that contain such expression cassettes and express the encoded nematode guanylyl cyclase chemoreceptor (e. g., yeast cells, plant cells, insect cells).

A sixth aspect of the invention is an isolated nematode guanylyl cyclase chemoreceptor protein encoded by a DNA as described above (a protein of the invention), along with proteins or peptides (e. g., antibodies) that specifically bind to such nematode guanylyl cyclase chemoreceptor proteins.

A seventh aspect of the present invention is a method of screening a compound for the ability to disrupt plant parasitic nematode feeding or chemotaxis, said method comprising: determining whether or not said compound selectively binds to a nematode guanylyl cyclase chemoreceptor protein encoded by a DNA as described above. The presence of such binding indicating said compound is useful in disrupting plant parasitic nematode feeding or chemotaxis.

The foregoing and other objects and aspects of the present invention are explained in detail in the specification set forth below.

Brief Description of the Drawinss Figure 1 provides a comparison of the guanylyl cyclase (gcy) domains of HG- gcy-1, HG-gcy-2, and HG-gcy-3 to various other guanylyl cyclases and proteins.

Detailed Description of the Preferred Embodiments Amino acid sequences disclosed herein are presented in the amino to carboxy direction, from left to right. The amino and carboxy groups are not presented in the sequence. Nucleotide sequences are presented herein by single strand only, in the 5' to 3'direction, from left to right. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by three letter code, in accordance with 37 CFR §1. 822 and established usage.

The present invention may be carried out with plant parasitic, or plant feeding, nematodes. That is, chemoreceptors proteins of the present invention may be those of such nematodes, and isolated DNA may be isolated, directly or indirectly, from such nematodes. Examples of plant parasitic nematodes include, but are not limited to, cyst nematodes (Heteroderidae spp.), root knot nematodes (Meloidogyne spp.), lesion nematodes (Pratylenchus spp.), and reniform nematodes (Rotylenchulus spp.). In general, nematodes of the orders Tylenchida and Aphelenchida are preferred, particularly nematodes of the order Tylenchida. Nematodes of the Heteroderoidea superfamily are particularly preferred, the Heterodae family more preferred, and the genus Heterodera most preferred.

The production of cloned genes, recombinant DNA, vectors, transformed host cells, proteins and protein fragments by genetic engineering is discussed in greater detail below. It will be appreciated, however, that the techniques employed in carrying out the instant invention are well known. See, e. g., U. S. Patent No. 4,761,371 to Bell et al. at Col. 6 line 3 to Col. 9 line 65; U. S. Patent No. 4,877,729 to Clark et al. at Col. 4 line 38 to Col. 7 line 6; U. S. Patent No. 4,912,038 to Schilling at Col. 3 line 26 to Col. 14 line 12; and U. S. Patent No. 4,879,224 to Wallner at Col. 6 line 8 to Col.

8 line 59. (Applicant specifically intends that the disclosure of all patent references cited herein be incorporated herein in their entirety by reference).

1. Isolated nucleic acids.

Isolated DNA of the present invention can be of any species of origin, but is preferably isolated either directly or indirectly from plant parasitic nematodes as described above. Thus, polynucleotides that hybridize to DNA disclosed herein as SEQ ID NO : 1, SEQ ID NO: 3, SEQ ID NO: 4, and/or SEQ ID NO: 6 (or fragments or derivatives thereof which serve as hybridization probes as discussed below) and which code on expression for a protein of the present invention (e. g., a protein according to SEQ ID NO : 2), are also an aspect of the present invention.

Conditions which will permit other polynucleotides that code on expression for a protein of the present invention to hybridize to the aforesaid DNA can be determined in accordance with known techniques. For example, hybridization of such sequences may be carried out under conditions of reduced stringency, medium stringency or even stringent conditions (e. g., conditions represented by a wash stringency of 35-40% Formamide with 5x Denhardt's solution, 0.5% SDS and lx SSPE at 37°C ; conditions represented by a wash stringency of 40-45% Formamide with 5x Denhardt's solution, 0.5% SDS, and lx SSPE at 42°C ; and conditions represented by a wash stringency of 50% Formamide with 5x Denhardt's solution, 0.5% SDS and lx SSPE at 42°C, respectively) to the aforesaid DNA in a standard hybridization assay. See, e. g., J. Sambrook et al., Molecular Cloning, A Laboratory Manual (2d Ed. 1989) (Cold Spring Harbor Laboratory). In general, sequences which code for proteins of the present invention and which hybridize to the DNAs disclosed herein will be at least 60% homologous, 70% homologous, 80% homologous and even 90% homologous or more with SEQ ID NO : 1, SEQ ID NO : 3, SEQ ID NO: 4, or SEQ ID NO: 6, respectively.

As noted above, in one particular embodiment of the invention, the isolated DNA is selected from the group consisting of : (a) isolated DNA having a nucleotide sequence selected from the group consisting of SEQ ID NO: 4 and SEQ ID NO: 6; (b) isolated DNA that hybridizes to DNA of (a) above under stringent conditions in which said isolated DNA does not hybridize to DNA having a nucleotide sequence of SEQ ID NO: 1, and encodes a nematode guanylyl cyclase chemoreceptor; and (c) isolated DNA that differs from the DNA of (a) or (b) above due to the degeneracy of the genetic code, and encodes a nematode guanylyl cyclase chemoreceptor encoded by (a) or (b) above. In this embodiment, the stringency of the wash conditions is routinely determined by adjusting wash stringency upward until the stringency meets the test of excluding hybridization to a nucleotide sequence of SEQ ID NO: 1.

Further, polynucleotides that code for proteins of the present invention, or polynucleotides that hybridize to nucleotides having a sequence as given in SEQ ID NO : 1, SEQ ID NO : 3, SEQ ID NO: 4, and/or SEQ ID NO: 6, as described above, but which differ in codon sequence from the given coding sequence due to the degeneracy of the genetic code, are also an aspect of this invention. The degeneracy of the genetic code, which allows different nucleic acid sequences to code for the same protein or peptide, is well known in the literature. See, e. g., U. S. Patent No.

4,757,006 to Toole et al. at Col. 2, Table 1.

The invention also encompasses production of DNA sequences, or fragments thereof, which encode proteins of the invention, entirely by synthetic chemistry.

Where modeled after the natural protein or DNA, such sequences may be considered to have been indirectly isolated from the species carrying the naturally occurring nucleotide or protein. After production, the synthetic sequence may be inserted into any of the many available expression vectors and cell systems using reagents that are well known in the art.

In general, those skilled in the art will appreciate that minor deletions or substitutions may be made to the amino acid sequences of peptides of the present invention without unduly adversely affecting the activity thereof. Thus, peptides containing such deletions or substitutions are a further aspect of the present invention.

In peptides containing substitutions or replacements of amino acids, one or more amino acids of a peptide sequence may be replaced by one or more other amino acids wherein such replacement does not affect the function of that sequence. Such changes can be guided by known similarities between amino acids in physical features such as charge density, hydrophobicity/hydrophilicity, size and configuration, so that amino acids are substituted with other amino acids having essentially the same functional properties.

2. Oligonucleotides.

The term"oligonucleotide"refers to a nucleic acid sequence of at least about 6 nucleotides to about 60 nucleotides, preferably about 15 to 30 nucleotides, and more preferably about 20 to 25 nucleotides, which can be used in PCR amplification or a hybridization assay, or a microarray. As used herein, oligonucleotide includes "amplifiers","primers","oligomers", and"probes", as commonly defined in the art.

Knowledge of the nucleotide sequences disclosed herein can be used to generate hybridization probes which specifically bind to the DNA of the present invention or to mRNA produced by the transcription of such nucleotides to determine the presence of, amplify, or determine the overexpression of the proteins of the present invention. The oligonucleotides may also be used as active agents for the control of plant feeding nematodes as described above.

A label or detectable group may be conjugated to the oligonucleotide, if desired. A wide variety of labels and conjugation techniques are known by those skilled in the art and may be used in various nucleic acid and amino acid assays.

Means for producing labeled hybridization or PCR probes for detecting sequences related to proteins of the invention oligolabeling, nick translation, end-labeling or PCR amplification using a labeled nucleotide. Alternatively, the sequences encoding proteins of the invention, or any fragments thereof may be cloned into a vector for the production of an mRNA probe. Such vectors are known in the art, are commercially available, and may be used to synthesize RNA probes in vitro by addition of an appropriate RNA polymerase such as T7, T3, or SP6 and labeled nucleotides. These procedures may be conducted using a variety of commercially available kits (Pharmacia & Upjohn, (Kalamazoo, Mich.); Promega (Madison Wis.); and U. S.

Biochemical Corp., Cleveland, Ohio)). Suitable reporter molecules or labels, which may be used for ease of detection, include radionuclides, enzymes, fluorescent, chemiluminescent, or chromogenic agents as well as substrates, cofactors, inhibitors, magnetic particles, and the like.

Assays for detecting the nucleotides of the invention, or the extent of amplification thereof, typically involve, first, contacting the cells or extracts of the cells containing nucleic acids therefrom with an oligonucleotide that specifically binds to proteins of the invention under conditions that permit access of the oligonucleotide to intracellular material, and then detecting the presence or absence of binding of the oligonucleotide thereto. Any suitable assay format may be employed (see, e. g., U. S. Patent No. 4,358,535 to Falkow et al.; U. S. Patent No.

4,302,204 to Wahl et al.; 4,994,373 to Stavrianopoulos et al; 4,486,539 to Ranki et al.; 4,563,419 to Ranki et al.; and 4,868,104 to Kurn et al.) (the disclosures of which applicant specifically intends be incorporated herein by reference).

3. Expression vectors and transgenic cell lines.

A vector is a replicable DNA construct. Vectors are used herein either to amplify DNA encoding the proteins of the present invention or to express the proteins of the present invention. An expression vector is a replicable DNA construct in which a DNA sequence encoding the proteins of the present invention is operably linked to suitable control sequences capable of effecting the expression of proteins of the present invention in a suitable host. The need for such control sequences will vary depending upon the host selected and the transformation method chosen. Generally, control sequences include a transcriptional promoter, an optional operator sequence to control transcription, a sequence encoding suitable mRNA ribosomal binding sites, and sequences which control the termination of transcription and translation.

Amplification vectors do not require expression control domains. All that is needed is the ability to replicate in a host, usually conferred by an origin of replication, and a selection gene to facilitate recognition of transformants.

Vectors comprise plasmids, viruses (e. g., adenovirus, cytomegalovirus), phage, retroviruses and integratable DNA fragments (i. e., fragments integratable into the host genome by recombination). The vector replicates and functions independently of the host genome, or may, in some instances, integrate into the genome itself. Expression vectors should contain a promoter and RNA binding sites which are operably linked to the gene to be expressed and are operable in the host organism.

DNA regions are operably linked or operably associated when they are functionally related to each other. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence; a ribosome binding site is operably linked to a coding sequence if it is positioned so as to permit translation. Generally, operably linked means contiguous and, in the case of leader sequences, contiguous and in reading phase.

Transformed host cells are cells which have been transformed or transfected with vectors containing DNA coding for proteins of the present invention need not express protein.

Suitable host cells include prokaryotes, yeast cells, or higher eukaryotic organism cells. Prokaryote host cells include gram negative or gram positive organisms, for example Escherichia coli (E. coli) or Bacilli. Higher eukaryotic cells include established cell lines of mammalian origin as described below. Exemplary host cells are E. coli W3110 (ATCC 27,325), E. coli B, E. coli X1776 (ATCC 31,537), E. coli 294 (ATCC 31,446). A broad variety of suitable prokaryotic and microbial vectors are available. E. coli is typically transformed using pBR322. See Bolivar et al., Gene 2,95 (1977). Promoters most commonly used in recombinant microbial expression vectors include the beta-lactamase (penicillinase) and lactose promoter systems (Chang et al., Nature 275,615 (1978); and Goeddel et al., Nature 281,544 (1979), a tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res. 8,4057 (1980) and EPO App. Publ. No. 36,776) and the tac promoter (H. De Boer et al., Proc. Natl. Acad. Sci. USA 80,21 (1983). The promoter and Shine- Dalgarno sequence (for prokaryotic host expression) are operably linked to the DNA of the present invention, i. e., they are positioned so as to promote transcription of the messenger RNA from the DNA.

Expression vectors should contain a promoter which is recognized by the host organism. This generally means a promoter obtained from the intended host.

Promoters most commonly used in recombinant microbial expression vectors include the beta-lactamase (penicillinase) and lactose promoter systems (Chang et al., Nature 275,615 (1978); and Goeddel et al., Nature 281,544 (1979), a tryptophan (trp) promoter system (Goeddel et al., Nucleic Acids Res. 8,4057 (1980) and EPO App.

Publ. No. 36,776) and the tac promoter (H. De Boer et al., Proc. Natl. Acad. Sci. USA 80,21 (1983). While these are commonly used, other microbial promoters are suitable. Details concerning nucleotide sequences of many have been published, enabling a skilled worker to operably ligate them to DNA encoding the protein in plasmid or viral vectors (Siebenlist et al., Cell 20, 269 (1980). The promoter and Shine-Dalgarno sequence (for prokaryotic host expression) are operably linked to the DNA encoding the desired protein, i. e., they are positioned so as to promote transcription of the protein messenger RNA from the DNA.

Eukaryotic microbes such as yeast cultures may be transformed with suitable protein-encoding vectors. See e. g., U. S. Patent No. 4,745,057. Saccharomyces cerevisiae is the most commonly used among lower eukaryotic host microorganisms, although a number of other strains are commonly available. Yeast vectors may contain an origin of replication from the 2 micron yeast plasmid or anautonomously replicating sequence (ARS), a promoter, DNA encoding the desired protein, sequences for polyadenylation and transcription termination, and a selection gene. An exemplary plasmid is YRp7, (Stinchcomb et al., Nature 282,39 (1979); Kingsman et al., Gene 7,141 (1979); Tschemper et al., Gene 10, 157 (1980). This plasmid contains the trpl gene, which provides a selection marker for a mutant strain of yeast lacking the ability to grow in tryptophan, for example ATCC No. 44076 or PEP4-1 (Jones, Genetics 85,12 (1977). The presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.

Suitable promoting sequences in yeast vectors include the promoters for metallothionein, 3-phospho-glycerate kinase (Hitzeman et al., J. Biol. Chem. 255, 2073 (1980) or other glycolytic enzymes (Hess et al., J. Adv. Enzyme Reg. 7,149 (1968); and Holland et al., Biochemistry 17,4900 (1978), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase. Suitable vectors and promoters for use in yeast expression are further described in R. Hitzeman et al., EPO Publn. No. 73,657.

Cultures of cells derived from multicellular organisms are a desirable host for recombinant protein synthesis. In principal, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture, including insect cells.

Propagation of such cells in cell culture has become a routine procedure. See Tissue Culture, Academic Press, Kruse and Patterson, editors (1973). Examples of useful host cell lines are VERO and HeLa cells, Chinese hamster ovary (CHO) cell lines, and WI138, BHK, COS-7, CV, and MDCK cell lines. Expression vectors for such cells ordinarily include (if necessary) an origin of replication, a promoter located upstream from the gene to be expressed, along with a ribosome binding site, RNA splice site (if intron-containing genomic DNA is used), a polyadenylation site, and a transcriptional termination sequence.

The transcriptional and translational control sequences in expression vectors to be used in transforming vertebrate cells are often provided by viral sources. For example, commonly used promoters are derived from polyoma, Adenovirus 2, and Simian Virus 40 (SV40). See, e. g., U. S. Patent No. 4,599,308. The early and late promoters are useful because both are obtained easily from the virus as a fragment which also contains the SV40 viral origin of replication. See Fiers et al., Nature 273, 113 (1978). Further, the protein promoter, control and/or signal sequences, may also be used, provided such control sequences are compatible with the host cell chosen.

An origin of replication may be provided either by construction of the vector to include an exogenous origin, such as may be derived from SV40 or other viral source (e. g. Polyoma, Adenovirus, VSV, or BPV), or may be provided by the host cell chromosomal replication mechanism. If the vector is integrated into the host cell chromosome, the latter may be sufficient.

Host cells such as insect cells (e. g., cultured Spodoptera frugiperda cells) and expression vectors such as the baculorivus expression vector (e. g., vectors derived from Autographa californica MNPV, Trichoplusia ni MNPV, Rachiplusia ou MNPV, or Galleria ou MNPV) may be employed to make proteins useful in carrying out the present invention, as described in U. S. Patents Nos. 4,745,051 and 4,879,236 to Smith et al. In general, a baculovirus expression vector comprises a baculovirus genome containing the gene to be expressed inserted into the polyhedrin gene at a position ranging from the polyhedrin transcriptional start signal to the ATG start site and under the transcriptional control of a baculovirus polyhedrin promoter.

In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, sequences encoding proteins of the invention may be ligated into an adenovirus transcription/translation complex consisting of the late promoter and tripartite leader sequence. Insertion in a non-essential E1 or E3 region of the viral genome may be used to obtain a viable virus which is capable of expressing proteins of the invention in infected host cells (Logan, J. and Shenk, T. (1984) Proc. Natl. Acad. Sci. 81: 3655- 3659). In addition, transcription enhancers, such as the Rous sarcoma virus (RSV) enhancer, may be used to increase expression in mammalian host cells.

Rather than using vectors which contain viral origins of replication, one can transform mammalian cells by the method of cotransformation with a selectable marker and the chimeric protein DNA. An example of a suitable selectable marker is dihydrofolate reductase (DHFR) or thymidine kinase. See U. S. Pat. No. 4,399,216.

Such markers are proteins, generally enzymes, that enable the identification of transformant cells, i. e., cells which are competent to take up exogenous DNA.

Generally, identification is by survival or transformants in culture medium that is toxic, or from which the cells cannot obtain critical nutrition without having taken up the marker protein.

4. Antibodies and other binding proteins and peptides.

As used herein, the term"antibody"refers to intact molecules as well as fragments thereof, such as Fa, F (ab') 2, and Fc, which are capable of binding the epitopic determinant. Antibodies that bind proteins of the invention can be prepared using intact proteins or fragments containing small peptides of interest as the immunizing antigen. The polypeptide or oligopeptide used to immunize an animal can be derived from the translation of RNA or synthesized chemically and can be conjugated to a carrier protein, if desired. Commonly used carriers that are chemically coupled to peptides include bovine serum albumin and thyroglobulin, keyhole limpet hemocyanin. The coupled peptide is then used to immunize the animal (e. g., a mouse, a rat, or a rabbit) from which antibodies or spleen cells are collected.

Antibodies that specifically bind to the proteins of the present invention (i. e., antibodies which bind to a single antigenic site or epitope on the proteins) are useful for a variety of diagnostic purposes.

Antibodies to proteins of the invention may be generated using methods that are well known in the art. Such antibodies may include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, Fab fragments, and fragments produced by a Fab expression library. Neutralizing antibodies, (i. e., those which inhibit dimer formation) are especially preferred for therapeutic use.

For the production of antibodies, various hosts including goats, rabbits, rats, mice, humans, and others, may be immunized by injection with a protein of the invention or any fragment or oligopeptide thereof which has immunogenic properties.

Depending on the host species, various adjuvants may be used to increase immunological response. Such adjuvants include, but are not limited to, Freund's, mineral gels such as aluminum hydroxide, and surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Among adjuvants used in humans, BCG (bacilli Calmette-Guerin) and Corynebacterium parvum are especially preferable.

Monoclonal antibodies to proteins of the invention may be prepared using any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique, the human B-cell hybridoma technique, and the EBV-hybridoma technique (Kohler, G. et al. (1975) Nature 256: 495-497; Kozbor, D. et al. (1985) J. Immunol. Methods 81: 31- 42; Cote, R. J. et al. (1983) Proc. Natl. Acad. Sci. 80: 2026-2030; Cole, S. P. et al.

(1984) Mol. Cell Biol. 62: 109-120).

Antibodies may also be produced by inducing in vivo production in the lymphocyte population or by screening immunoglobulin libraries or panels of highly specific binding reagents as disclosed in the literature (Orlandi, R. et al. (1989) Proc.

Natl. Acad. Sci. 86: 3833-3837; Winter, G. et al. (1991) Nature 349: 293-299).

Antibody fragments which contain specific binding sites for proteins of the invention may also be generated. For example, such fragments include, but are not limited to, the F (ab') 2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F (ab') 2 fragments. Alternatively, Fab expression libraries may be constructed to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity (Huse, W. D. et al. (1989) Science 254: 1275-1281).

Various immunoassays may be used for screening to identify antibodies having the desired specificity. Numerous protocols for competitive binding or immunoradiometric assays using either polyclonal or monoclonal antibodies with established specificities are well known in the art. Such immunoassays typically involve the measurement of complex formation between a protein of the invention and its specific antibody.

Antibodies may be conjugated to a solid support suitable for a diagnostic assay (e. g., beads, plates, slides or wells formed from materials such as latex or polystyrene) in accordance with known techniques, such as precipitation. Antibodies may likewise be conjugated to detectable groups such as radiolabels (e. g., 35S, 1251, 13lI), enzyme labels (e. g., horseradish peroxidase, alkaline phosphatase), and fluorescent labels (e. g., fluorescein) in accordance with known techniques.

Kits for determining if a sample contains proteins of the present invention will include at least one reagent specific for detecting the presence or absence of the protein. Diagnostic kits for carrying out antibody assays may be produced in a number of ways. In one embodiment, the diagnostic kit comprises (a) an antibody which binds proteins of the present invention conjugated to a solid support and (b) a second antibody which binds proteins of the present invention conjugated to a detectable group. The reagents may also include ancillary agents such as buffering agents and protein stabilizing agents, e. g., polysaccharides and the like. The diagnostic kit may further include, where necessary, other members of the signal- producing system of which system the detectable group is a member (e. g., enzyme substrates), agents for reducing background interference in a test, control reagents, apparatus for conducting a test, and the like. A second embodiment of a test kit comprises (a) an antibody as above, and (b) a specific binding partner for the antibody conjugated to a detectable group. Ancillary agents as described above may likewise be included. The test kit may be packaged in any suitable manner, typically with all elements in a single container along with a sheet of printed instructions for carrying out the test.

Binding proteins or peptides other than antibodies, and binding compounds other than proteins or peptides, can be identified by screening combinatorial libraries of such compounds with the screening assays described below.

5. Screening assays.

As noted above, the present invention provides methods of screening a compound for the ability to disrupt plant parasitic nematode feeding and/or chemotaxis. The methods comprise determining whether or not that compound selectively binds to a nematode guanylyl cyclase chemoreceptor protein encoded by a DNA as described herein. The presence of such binding indicates the compound is useful in disrupting plant parasitic nematode feeding and/or chemotaxis. The determining step may be carried out in vitro with a cell membrane preparation containing the proteins produced from recombinant cells as described above, or even in a membrane-free preparation. Alternatively, the determining step may be carried out in vivo in a cell culture comprising cells that express the protein, in accordance with known techniques.

The compound screened may be a member of a combinatorial library, which generally are comprised of non-oligomers, oligomers, or combinations thereof. Non- oligomer combinatorial libraries include a wide variety of organic molecules, such as heterocyclics, aromatics, alicyclics, aliphatics and combinations thereof, comprising steroids, antibiotics, enzyme inhibitors, ligands, hormones, drugs, alkaloids, opioids, terpenes, porphyrins, toxins, catalysts, as well as combinations thereof.

Oligomer combinatorial libraries include oligopeptides, oligonucleotides, oligosaccharides, polylipids, polyesters, polyamides, polyurethanes, polyureas, polyethers, and poly (phosphorus derivatives), e. g. phosphates, phosphonates, phosphoramides, phosphonamides, phosphites, phosphinamides, etc., poly (sulfur derivatives) e. g., sulfones, sulfonates, sulfites, sulfonamides, sulfenamides, etc., where for the phosphorous and sulfur derivatives the indicated heteroatom for the most part will be bonded to C, H, N, O or S, and combinations thereof.

When the compound to be screened is a member of a combinatorial library, the screening step may be incorporated into a high throughput screening procedure in accordance with known techniques. In this case, the members of the combinatorial library may be immobilized on solid supports, which solid supports may be separate from one another (e. g., particles or beads) as described in U. S. Patent No. 5,656,324 to Still et al., or may be discrete regions on a surface portion of a unitary substrate.

Such"chip-type"or"pin-type"solid supports are known. See, e. g., U. S. Patent No.

5,288,514 to Ellman (pin-based support); U. S. Patent No. 5,510,270 to Fodor et al.

(chip-based support). In addition, the screening step may be carried out with any other suitable combinatorial library technique, including but not limited to phage display. See, e. g., U. S. Patent No. 5,812,047 to Garrard et al.; U. S. Patent No.

5,223,409 to Ladner et al.; U. S. Patent No. 5,498,538 to Kay & Fowlkes U. S. Patent No. 4,953,002 to Dulbecco.

One of the principal assays to determine efficacy of potential inhibitors of chemosensory receptors will be to transform plant cells and tissues with genes encoding chemosensory inhibitor molecules (like those mentioned in this application, preferably peptides) and test their effect on nematode chemotaxis. Expression of cassettes producing encoded inhibitory molecules that may be retained, or preferably designed to be exuded from plant tissues (i. e. roots), may be under the control of constitutive promoters such as CaMV 35S, RolA-D, nopaline synthase, gamma-TIP, T-cyt, and TR2', or inducible promoters such as those derived from expressed plant genes like TobRB7, cdc2At, and wunl (H. Atkinson et al., in The Physiology and Biochemistry of Free-Living and Plant-Parasitic Nematodes, pp. 382-413 (ed. RN Perry, DJ Wright, 1998); G. Gheysen et al., in Cellular and Molecular Aspects of Plant-Nematode Interactions, pp. 120-132 (ed. C Fenoll, FMW Grundler, SA Ohl, 1997); A. Goverse et al., Physiol. Mol. Plant Pathol. 52: 275-284 (1998)).

Transformation of plant cells and tissues may be conducted using Agrobacterium tumefascians, Agrobacterium rhizogenes, or biolistic approaches (Atkinson et al., 1998). Transformation of plant roots via A. rhizogenes is preferable for screening purposes since these systems work in many plant species and have been demonstrated to produce a reproducible and scorable plant-nematode interaction (D. Cai et al., Science 275,832-834 (1997); M. Savka et al., Phytopathology 80,503-508 (1990)). A variety of agar and soil-based assays may be utilized to assess the effect of transgenic expression of chemosensory inhibitors in plants on nematode chemotactic ability (C.

Bargmann and 1. Mori. Chemotaxis and thermotaxis. Pp. 717-737 In Riddle, D. L., T.

Blumenthal, B. J. Meyer, and J. R. Priess, eds., C. elegans 11, (Cold Spring Harbor Laboratory Press, NY 1997)).

6. Antisense oligonucleotides and double-stranded RNA.

Antisense oligonucleotides. The term"antisense", as used herein, refers to any composition containing nucleotide sequences which are complementary to a specific DNA or RNA sequence. The term"antisense strand"is used in reference to a nucleic acid strand that is complementary to the"sense"strand. Antisense molecules include peptide nucleic acids and may be produced by any method including synthesis or transcription. Once introduced into a cell, the complementary nucleotides combine with natural sequences produced by the cell to form duplexes and block either transcription or translation. The designation"negative"is sometimes used in reference to the antisense strand, and"positive"is sometimes used in reference to the sense strand.

Antisense oligonucleotides and nucleic acids that express the same may be made in accordance with conventional techniques. See, e. g., U. S. Patent No.

5,023,243 to Tullis; U. S. Patent No. 5,149,797 to Pederson et al. The length of the antisense oligonucleotide (i. e., the number of nucleotides therein) is not critical so long as it binds selectively to the intended location, and can be determined in accordance with routine procedures. In general, the antisense oligonucleotide will be from 8,10 or 12 nucleotides in length up to 20,30, or 50 nucleotides in length. Such antisense oligonucleotides may be oligonucleotides wherein at least one, or all, or the internucleotide bridging phosphate residues are modified phosphates, such as methyl phosphonates, methyl phosphonothioates, phosphoromorpholidates, phosphoro- piperazidates and phosphoramidates. For example, every other one of the internucleotide bridging phosphate residues may be modified as described. In another non-limiting example, such antisense oligonucleotides are oligonucleotides wherein at least one, or all, of the nucleotides contain a 2'loweralkyl moiety (e. g., Cl-C4, linear or branched, saturated or unsaturated alkyl, such as methyl, ethyl, ethenyl, propyl, 1-propenyl, 2-propenyl, and isopropyl). For example, every other one of the nucleotides may be modified as described. See also P. Furdon et al., Nucleic Acids Res. 17,9193-9204 (1989); S. Agrawal et al., Proc. Natl. Acad. Sci.

USA 87,1401-1405 (1990); C. Baker et al., Nucleic Acids Res. 18,3537-3543 (1990); B. Sproat et al., Nucleic Acids Res. 17,3373-3386 (1989); R. Walder and J.

Walder, Proc. Natl. Acad. Sci. USA 85, 5011-5015 (1988).

Antisense oligonucleotides may be used as biological control agents per se, or DNA encoding such antisense oligonucleotides may be provided in an expression cassette which is capable of infecting a host nematode and transforming cells of the same, which expression cassette may in turn be used as a biological control agent.

RNA interference (RNAi). RNAi is a methodology to directly inhibit gene activity that is both powerful and efficient is the double-stranded (ds) RNA-mediated interference (RNAi) of gene expression as demonstrated in C. elegans (A. Fire et al., Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans, Nature 391,806-11 (1998); L. Timmons and A. Fire, Specific interference by ingested dsRNA. Nature 395,854 (1998)). In this methodology, dsRNA complementary to a gene-of-interest (in this case, a DNA as described above) is administered to (e. g., injected into or ingested by) the target nematode. As a consequence, activity of the gene-of-interest is transiently abolished in the treated animal. Thus such agents are useful in the control of nematodes as described above.

Two distinct advantages provided by RNAi analyses include; the dsRNA does not have to be injected into the nematode germ line to exert inhibitory effects in tissues distal to the injection site (i. e. RNAi does not require successful transformation) ; and the inhibitory effects of injected dsRNA can be realized in one or more subsequent nematode generations derived from the treated parent. RNAi designed to knock-out gene function in nematodes can be assayed directly for its effects on chemosensory behavior. It also will be important to monitor the effects RNAi by mRNA in situ hybridization and/or antibody probes to the target gene product to confirm inhibition. The dsRNA is, in general, from 8,10 or 12 nucleotides in length up to 20,30, or 50 nucleotides in length, each strand (although the strands do not have to be identical in length).

7. Control of plant parasitic nematodes.

The present invention provides a variety of means for controlling plant parasitic nematodes, as described above.

Nematodes may be administered an expression cassette that contains and expresses a DNA as described thereof, or a fragment thereof of a length sufficient to induce silencing (e. g., at least partial silencing) of expression of the guanylyl cyclase chemoreceptor in the nematode, and thereby disrupt feeding or chemotaxis of the nematode.

Nematodes may be administered an antisense oligonucleotide as described above, either per se or through a vector that expresses the antisense oligonucleotide, in an amount sufficient to disrupt feeding or chemotaxis of the nematode.

Nematodes may be administered an oligonucleotide as described above (such as an RNAi oligonucleotide as described above) in an amount sufficient to disrupt feeding or chemotaxis of the nematode.

Nematodes may be administered a protein or peptide (e. g., an antibody) that specifically binds to the guanylyl cyclase chemoreceptor proteins disclosed hereinabove, in an amount sufficient to disrupt the feeding or chemotaxis of the nematode. Such proteins and peptides, including antibodies, are readily produced in the manner described above.

Administration of the active compounds described above may be by any suitable means, such as by spraying crops or plants with the active agents described above, by treating soil with the active agents described above, etc. The active agents may be combined with a suitable agricultural carrier, including aqueous carriers, nonaqueous carriers, emulsions, dry powders, etc., which may optionally include stickers, adjuvants and the like, all in accordance with standard techniques, with the active agent being included in any suitable amount (e. g., from. 001 to 99 percent by weight of the total composition).

The present invention is explained in greater detail in the following non- limiting Examples.

EXAMPLE 1 Identification of HG-gcy-1 The soybean cyst nematode (SCN), Heterodera glycines guanylyl cyclase-1 (HG-gcy-1) coding sequence was first located by the instant inventors about 1 kb upstream of ß-1, 4-endoglucanase-1 precursor during a study of the organization of ß- 1,4-endoglucanase gene family in the soybean cyst nematode. The full-length chemosensory guanylyl cyclase gene HG-gcy-1 was generated by further Lambda genomic clone mapping, oligo (dT) cDNA library screening and 5'RACE. A partial cDNA clone of Hg-gcy-1 was obtained by screening a SCN cDNA library and the partial HG-gcy-1 cDNA sequence was released in GenBank on November 9,1998 (GenBank accession number AF095746). The HG-gcy-1 full-length cDNA sequence (3762 bp) (SEQ ID NO: 1) was released in GenBank on March 5,1999 with an accession number (AF095746).

By comparing the HG-gcy-1 genomic sequence (SEQ ID NO: 3) and cDNA sequence, 24 introns were identified in HG-gcy-1 gene. The predicted protein of HG- gcy-1 (SEQ ID NO: 2) had strong homology to a family of guanylyl cyclase chemoreceptors reported in the nematode Caenorhabditis elegans. We have recently localized transcripts of HG-gcy-1 in SCN chemosensory cells by mRNA in situ hybridization (data not reported).

EXAMPLE 2 Identification of HG-gey-2 and HG-gcy-3 A DNA DIG labeled probe was synthesized based on the guanylyl cyclase catalytic domain sequence. The primers used to synthesize the probe was cycleExp3 and cycleExp4. The cycleExp3 primer sequence is: AGCGGATCCCGTCCGCGCATGGACATTGTG (SEQ ID NO: 8).

The cycleExp4 prime sequence is: CCGCTCGAGCGTTGCGGCACTCGCATTTCT (SEQ ID NO: 9) The thus synthesized DNA probe was used to screen the SCN oligo (dT) cDNA library with both hybridization and washing temperature at 65°C. This endeavor lead to the identification of two additional guanylyl cyclase genes, namely HG-gcy-2 (3499 bps) (SEQ ID NO: 4) (the protein fragment being given as SEQ ID NO: 5) and HG-gcy-3 (3007 bps) (SEQ ID NO: 6) (the protein fragment being given as SEQ ID NO: 7). These sequences may be elongated in accordance with known techniques to provide the full length sequences thereof.

The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.