Field of the Invention The present Invention relates to chimeric antigens (fusion proteins) for targeting antigen presenting cells and elicit an immune response. In particular, the invention describes compositions and methods that contain or use one or more fusion proteins that contain a pre-selected HBV antigen or an HCV antigen, and a xenotypic immunoglobulin fragment, wherein the fusion molecule is capable of binding toantigen presenting cells, especially dendritic cells and eliciting an immune response.

Background of the Invention Viral infectious diseases are major public healthcare issues. Human Hepatitis B virus (HBV) is a member of a family of DNA viruses that primarily infect the liver (Gust, 1986). Other members of this family are woodchuck hepatitis B virus (WHV) ((Summers, Smolec et al. 1978), ground squirrel hepatitis B virus (GSHV)1 duck hepatitis B virus (DHBV) (Mason, Seal et aL 1980) and heron hepatitis B virus ( HHBV) (Sprengel, Kaleta et al, 1988). These viruses share a common morphology and replication mechanisms, but are species specific for infectϊvity (Marion, 1988). HBV primarily infects liver cells and can cause acute and chronic liver disease resulting in cirrhosis and hepatocellular carcinoma. Infection occurs through blood and other body fluids. Approximately 90% of the individuals infected by HBV are able to clear the infection, while the remaining 10% become chronic carriers of the virus with a high probability of developing cirrhosis of the liver and hepatocellular carcinoma. The World Health Organization statistics show that more than 2 billion people have been infected by HBV and among these, 350 million are chronically infected by the virus (Beasley 1988) (Law JY 1993). Prophylactic vaccines based on HBV surface antigen (HBsAg) have been very effective in providing protective immunity against HBV infections. These vaccines have been developed from HbSAg purified from plasma of chronic HBV carriers, produced by recombinant DNA techniques as well as through the use of synthetic peptides (Please see U.S. Patents 4,599,230 and 4,599,231). These vaccines are highly effective in the prevention of infection, but are ineffective in eradicating established chronic infections. Although all hepadnaviruses have similar morphology and replication mechanism, they are fairly species specific consequently, infect only very closely related species. These viruses have a DNA genome ranging in size of 3.0-3.2 Kb1 with overlapping reading frames to encode several proteins. HBV genome encodes several proteins. Among these, the surface antigens: Large (S1/S2/S), Medium (S2/S) and Small (S) are proposed to be involved in the binding of the virus to the cellular receptors for uptake. The core protein (Core) forms capsids, which encapsidate the partially double stranded DNA genome. Polymerase/Reverse Transcriptase (Pol) protein is a multifunctional enzyme necessary for the replication of the virus. The X protein has been proposed to have many properties, including the activation of Src kinases (Ganem and Schneider, 2001). The present invention describes DNA sequences and amino acid compositions of the surface antigen proteins S1/S2, S1/S2/S as well as Core protein fusion proteins with a xenotypic monoclonal antibody (MAb) fragment. DHBV, another member of the hepadnaviral family, infects pekin ducks, are species specific, and have served as an animal model for studying the hepatitis B viruses. DHBV has a DNA genome and it codes for surface antigens PreS and PreS/S, Core protein (Core) and Polymerase/ Reverse Transcriptase. The present invention also describes DNA sequences and deduced amino acid sequences of fusion proteins of the PreS, PreS/S and Core proteins with a fragment of a xenotypic MAb. These fusion proteins can be used to elicit a broad immune response in chronic viral infections, thus as therapeutic vaccine. Hepatitis C virus (HCV) is a member of the flaviviridae family of RNA viruses. The route of infection is via blood and body fluids and over 50 % of the patients become chronic carriers of the virus. Persistent infection results in chronic active hepatitis that may lead to iiver cirrhosis and hepatocellular carcinoma (Saito et. al. 1990). Approximately 170 million people worldwide are chronic carriers of HCV (Wild & HaIi 2000). There is no prophylactic vaccine available at present. Current therapy is interferon a 2b and Ribavirin, either alone or as combination therapy. The significant side effects for interferon treatment and the development of mutant strains are major drawbacks to the current therapy. Moreover, interferon therapy is effective only in 30 to 40% of the patients. Therapeutic vaccines to enhance host immune system to eliminate chronic HCV infection will be a major advancement in the treatment of this disease. HCV genome is a positive sense single stranded RNA molecule of approximately 9.5Kb in length, this RNA, which contains both 5' and 31 untranslated regions, codes for a single polyprotein which is cleaved into individual proteins catalyzed by both viral and host proteases (Clarke, B. 1997). The structural proteins are Core, Envelope E1 & E2 and P7. The non-structural proteins are NS2, NS3, NS4A, NS4B, NSδA and NS5B. Core forms capsids. E1, E2 are envelope proteins, also called "Hypervariable Region" due to the high rate of mutations. NS3 is a serine protease, the target of several protease inhibitors as antivirals for HCV, NS5B is the RNA Polymerase enzyme. NS5A has recently been suggested to have a direct role in the replication of the virus in the host by counteracting the interferon response (Tan,S-L & Katze, M.G. 2001 ) which augments the immune function. When a healthy host (human or animal) encounters an antigen (such as proteins derived from a bacterium, virus and/or parasite), normally the host initiates an immune response. This immune response can be a humoral response and/or a cellular response. In the humoral response, antibodies are produced by B-cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. The antibody then neutralizes the antigen, e.g. on a virus, by binding specifically to antigens on its surface, marking it for destruction by phagocytotic cells and/or complement-mediated mechanisms. The cellular response is characterized by the selection and expansion of specific helper and cytotoxic T lymphocytes capable of directly eliminating the cells that contain the antigen. In many individuals, the immune system does not respond to certain antigens. When an antigen does not stimulate the production of a specific antibody and/or killer T cells* the immune system is unable to prevent the resultant disease. As a result, the infectious agent, e.g. virus, can establish a chronic infection and the host immune system becomes tolerant to the antigens produced by the virus. The mechanism by which the virus evades the host immune machinery is not clearly established. The best-known examples of chronic viral infections include Hepatitis B1 Hepatitis C, Human Immunodeficiency Virus and Herpes Simplex Virus. In chronic states of viral infections, the virus escapes the host immune system. Viral antigens are recognized as "self," and thus not recognized by the antigen presenting cells (APC). The lack of proper presentation of the appropriate viral antigen to the host immune system may be a contributing factor. The success in eliminating the virus will result from the manner in which the antigen is processed and presented by the APCs and the involvement of the regulatory and cytotoxic T cells. The major participant in this process is the dendritic cell (DC), which captures and processes antigens, expresses lymphocyte co-stimulatory molecules, migrates to lymphoid organs, and secretes cytokines to initiate immune responses. Dendritic cells also control the proliferation of B and T lymphocytes, which are the mediators of immunity (Steinmaπ et al 1999). The generation of a cytotoxic T cell (CTL) response is critical in the elimination of the virus infected cells and thus a cure of the infectioπ. APCs process the encountered antigens differently depending on the localization of the antigen (Steinman et al, 1999). Exogenous antigens are processed within the endosomes of the APC and the generated peptide fragments are presented on the surface of the cell complexed with Major Histocompatibility Complex (MHC) Class II. The presentation of this complex to CD4+ T cells stimulate the CD4+ T helper cells. As a result, cytokines secreted by the helper cells stimulate B cells to produce antibodies against the exogenous antigen (humoral response). Immunizations using antigens typically generate an antibody response through this endosomal antigen-processing pathway. On the other hand, intracellular antigens are processed in the proteasome and the resulting peptide fragments are presented as complexes with MHC Class I on the surface of APCs. Following binding of this complex to the co-receptor CD8 molecule, antigen presentation to CD8+ T cells occurs which result in cytotoxic T cell CTL immune response to remove the host cells that carry the antigen. n patients with chronic viral infections, since the virus is actively replicating, viral antigens will be produced within the host cell. Secreted antigens will be present in the circulation. As an example, in the case of chronic HBV carriers, virions, the HBV surface antigens and the core antigens can be detected in the blood. An effective therapeutic vaccine should be able to induce strong CTL responses against an intracellular antigen or an antigen delivered into the appropriate cellular compartment so as to activate the MHC Class I processing pathway. These findings would suggest that a therapeutic vaccine that can induce a strong CTL response should be processed through the proteasoma! pathway and presented via the MHC Class I (Larsson, Fonteneau et al., 2001). This can be achieved either by producing the antigen within the host cell, or it can be delivered to the appropriate cellular compartment so that it gets processed and presented so as to elicit a cellular response. Several approaches have been documented in the literature for the intracellular delivery of the antigen. Among these, viral vectors (Lorenz, Kantor et al. 1999)τ the use of cDNA-transfected ceIls(Donnelly et al 1997) as well as the expression of the antigen through injected cDNA vectors (Lai and Bennett 1998) ( US patent No. 5,589,466), have been documented. Delivery vehicles capable of carrying the antigens to the cytosolic compartment of the cell for MHC Class I pathway processing have also been used. The use of adjuvants to achieve the same goal has been described in detail by Hilgers et al. (1999). Another approach is the use of biodegradable microspheres in the cytoplasmic delivery of antigens (Newman, Kwon et al. 2000), exemplified by the generation of a Th1 immune response against ovalbumin peptide (Newman, Samuel et al. 1998; Newman, Kwon et al. 2000). It has also been shown that PLGA nanospheres are taken up by the most potent antigen presenting cells, dendritic cells (Newman, Elamanchili et al. 2002). Dendritic cells derived from blood monocytes, by virtue of their capability as professional antigen presenting cells, have been shown to have great potential as immune modulators which stimulate primary T cell response (Steinmaπ, lnaba et al. 1999), (Banchereau and Steϊnman 1998) . This unique property of the DCs to capture, process, present the antigen and stimulate πaϊve T cells has made them very important tools for therapeutic vaccine development (Laupeze, Fardel et al. 1999). Targeting of the antigen to the DCs is the crucial step in the antigen presentation and the presence of several receptors on the DCs for the Fc region of monoclonal antibodies have been exploited for this purpose (Regnault, Lankar et ai. 1999). Examples of this approach include ovarian cancer MAb-B43.13, Anti- PSA antibody as well as Anti-HBV antibody antigen complexes (Wen, Qu et al. 1999). Cancer immunotherapy using DCs loaded with tumor associated antigens have been shown to produce tumor-specific immune responses and anti-tumor activity (Campton, Ding et al. 2000; Fong and Engleman 2000). Promising results were obtained in clinical trials in vivo using tumor-antigen-pulsed DCs (Tarte and Klein 1999), These studies clearly demonstrate the efficacy of using DCs to generate immune responses against cancer antigens.

Summary of the Invention The present invention pertains to compositions and methods for targeting and activating antigen presenting cells, one of the first steps in eliciting an immune response. The compositions of the present invention include a novel class of bifunctional molecules (hereinafter designated as "chimeric antigens") that include an immune response domain (IRD), for example a recombinant protein, linked to a target binding domain (TBD)1 for example, a xenotypic antibody fragment portion. More specifically, the chimeric antigens are molecules that couple viral antigens, such as Hepatitis B core and surface proteins, to a xenotypic Fc fragment, such as a murine immunoglobulin G fragment. The compositions and methods of the present invention are useful for targeting and activating antigen presenting cells. The present invention may be useful for inducing cellular and humoral host immune responses against any viral antigen associated with a chronic viral infection, including but not limited to Hepatitis B, Hepatitis C, Human Immunodeficiency Virus, Human Papilloma Virus (HPV)1 and Herpes Simplex Virus. The invention may also be applicable to all autologous antigens in diseases such as cancer and autoimmune disorders. The present invention relates to chronic infectious diseases, and in particular to chronic HBV infections. The presentation of HBV antigens to elicit a CTL response by the use of vaccine molecules designed to target the vaccines to DCs whereby the HBV-associated antigens treated as "self during the chronic infection will be recognized as "foreign" and the host's immune system will mount a CTL response to eliminate HBV-infected cells. At the same time the antibody response to the circulating HBV antigen will bind to the antigen and remove it from the circulation. Accordingly, the present invention is designed to produce vaccines that can induce a broad immune response (cellular or humoral) in patients who have chronic viral infections such as HBV. One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis B virus (HBV). In these embodiments of the invention, the nucleotide and deduced amino acid sequences for pre-selected HBV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells. One or more embodiments of the present invention include one or more chimeric antigens suitable for initiating an immune response against Hepatitis C virus (HCV). In these embodiments of the invention, the nucleotide and deduced amino acid sequences for pre-selected HCV antigens are linked to fragments of xenotypic antibodies. The resulting chimeric antigens are capable of targeting and activating antigen presenting cells, such as dendritic cells. The present invention also includes methods for cloning and producing fusion proteins in a heterologous expression system. In preferred embodiments of the invention, the cloning and production methods introduce unique post translational modifications including, but not limited to unique glycosylation on the expressed fusion proteins. In order to make the efficient presentation of the antigens, the inventors have developed a novel murine monoclonal antibody Fc fragment-antigen (viral antigenic protein/peptϊde) fusion protein. This molecule, by virtue of the Fc fragment is recognized at a higher efficiency by the antigen-presenting cells (dendritic cells) as xenotypic, and the viral antigen is processed and presented as complexes with Major Histocompatibility Complex (MHC) Class I. This processing and antigen presentation is expected to result in the upregulation of the response by cytotoxic T-lymphocytes, resulting in the elimination of virus-infected cell population. In addition, due to cross priming and antigen presentation by MHC Class Il molecules, humoral response also aids in the antibody response to the viral infection. The bifunctional nature of the molecule targets the chimeric antigen to the proper antigen-presenting cells (dendritic cells), making it a unique approach in the therapy of chronic infectious diseases by specifically targeting the antigen presenting cells with the most effective stoichiometry of antigen to antibody. This is useful in the development of therapeutic vaccines to cure chronic viral infections such as Hepatitis B, Hepatitis C7 Human Immunodeficiency Virus, Human Papilloma Virus and Herpes Simplex Virus, and may also be applicable to ail autologous antigens In diseases such as cancer and autoimmune disorders. The administration of these fusion proteins can elicit a broad immune response from the host, including both cellular and humoral responses, thus can be used as therapeutic vaccines to treat subjects that are immune tolerant to a particular antigen.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1a is a schematic diagram illustrating the structure of the chimeric antigen of the present invention as a monomer, wherein the chimeric antigen has two portions, namely a viral antigen and a xenotypic Fc fragment with the hinge region present. Figure 1b is a schematic diagram illustrating the structure of the chimeric antigen of Figure 1 a in its normal, assembled state as a dimer. Figure 2a is a schematic diagram illustrating the structure of a modified chimeric antigen as a monomer, wherein the chimeric antigen has two portions, namely a modified viral antigen portion which incorporates in the Complementarity Determining Regions (CDR) any viral antigen pr antigens, antigenic protein fragments or peptides, or any of these with glycosylate at specific sites, and a xenotypic binding agent, namely an Fc fragment with the hinge region present. Figure 2b is a schematic diagram illustrating the structure of the modified chimeric antigen of Figure 2a in its normal, assembled state as a dimer. The abbreviations "Ag1 ," "Ag2," and "Ag3" represent different viral antigenic peptides or proteins. Figure 3a is a schematic diagram illustrating the structure of a modified biotinylated viral protein and a fusion protein of a streptavidin-Fc fragment with the hinge region present. Figure 3b is a schematic diagram illustrating the structure of the modified chimeric antigen of Figure 3a in its normal, assembfed state as a dimer. Figure 4 is a schematic diagram illustrating a transposition event to form a bacmid. Figure 5 is a schematic embodiment of TBD of the present invention. The sequence of the open reading frame contains 5* ATG initiation codon, nucleotide sequences encoding 6xHis Tag, a spacer region encoding 0-20, preferably 7 amino acid peptide, a protease cleavage site (e,g, rTEV), a 24 amino acid linker peptide, a portion of CH1, the hinge region, CH2 ,CH3 and a peptide of 0-20, preferably 10, amino acids in length. Figure 6 shows the nucleotide (A) and amino acid (B) sequences of the open reading frame encoding the TBD of Figure 5. Figure 7 is a schematic embodiment of an exemplary chimeric antigen of the present invention (S1/S2-TBD), suitable for use with an insect cell expression system. The sequence of the open reading frame contains 5' ATG initiation codon, nucleotide sequences encoding 6xHis Tag, a spacer region encoding 0-20 amino acid, preferably 7 amino acid peptide, a protease cleavage site (e.g. rTEV), HBV S1/S2, a 7 amino acid [inker peptide, a portion of CH1, the hinge region, CH2 ,CH3 and a peptide of 0-20 , preferably 10, amino acids in length. Figure 8 shows the nucleotide (A) and deduced amino acid sequences (B) from the open reading frame of the chimeric antigen molecule (S1/S2-TBD) shown in Figure 7. Figure 9 shows the nucleotide (A) and deduced amino acid (B) sequences of the expressed HBV S1/S2 protein. Figure 10 is a schematic embodiment of an exemplary chimeric antigen of the present invention (HBV S1/S2/S-TBD), illustrating an exemplary IRD of the present invention. Figure 11 shows the nucleotide (A) and deduced amino acid (B) sequences of the chimeric antigen molecule of Figure 10. Figure 12 shows the nucleotide (A) and deduced amino acid (B) sequences of the expressed HBV S1/S2/S protein. Figure 13 is a schematic embodiment of an exemplary chimeric antigen of the present invention (HBV Core-TBD), illustrating an exemplary IRD of the present invention. Figure 14 shows the nucleotide (A) and deduced amino acid sequences (B) of the chimeric antigen molecule of Figure 13. Figure 15 shows the nucleotide (A) and deduced amino acid (B) sequences of the expressed HBV core protein. Figure 16 is a schematic embodiment of an exemplary chimeric antigen of the present invention (DHBV PreS-TBD), illustrating an exemplary IRD of the present invention. Figure 17 shows the nucleotide (A) and deduced amino acid sequences (B) of the chimeric antigen molecule of Figure 16. Figure 18 shows the nucleotide (A) and deduced amino acid (B) sequences of the expressed DHBV PreS protein. Figure 19 is a schematic embodiment of an exemplary chimeric antigen of the present invention (DHBV PreS/S-TBD), illustrating an exemplary IRD of the present invention. Figure 20 shows the nucleotide (A) and deduced amino acid sequences (B) of the chimeric antigen molecule of Figure 19. Figure 21 shows the nucleotide (A) and deduced amino acid sequences (B) of the expressed DHBV PreS/S protein. Figure 22 is a schematic embodiment of an exemplary chimeric antigen of the present invention (DHBV Core-TBD), illustrating an exemplary IRD of the present invention. Figure 23 shows the nucleotide (A) and deduced amino acid sequences (B) of the chimeric antigen molecule of Figure 22. Figure 24 shows the nucleotide (A) and deduced amino acid sequences (B) of the expressed DHBV core protein. Figure 25 shows that a chimeric antigen embodiment (Chemical Conjugate) of the invention can give an immune response -on presentation by dendritic cells. Figure 26 shows CDS3 levels, a marker of DC maturation, on treatment with a chimeric antigen of the present invention (S1/S2-TBD), as compared to the target binding domain (TBD) alone, orthe immune response domain (IRD) alone. Figure 27 shows the expression of MHC Class Il by dendritic cells after treatment with a chimeric antigen of the present invention (S1/S2-TBD), as compared to the target binding domain (TBD) alone, or the immune response domain (IRD) alone. Figure 28 shows that a cellular response is generated after contact with dendritic cells activated with a chimeric antigen of the present invention (S1/S2/TBD). Figure 29 shows T cell stimulation by a chimeric antigen embodiment, a chemical conjugate of the present invention. Figure 30 shows the time course of expression of antigen binding receptors on maturing dendritic cells. Figure 31 shows the time course of expression of various dendritic cells activation markers. Figure 32 shows the comparison of binding of HBV S1/S2-TBD, IgGI, and lgG2a to dendritic cells as a function of time. Figure 33 shows the comparison of HBV S1/S2-TBD, IgGI , and IgG2a binding to maturing dendritic cells on day 1. Figure 34 shows the comparison of HBV S1/S2-TBD, IgGI, and lgG2a binding to maturing dendritic cells on day 4. Figure 35 shows the comparison of the uptake of HBV S1/S2-TBD, IgGI , and lgG2a as a function of concentration. Figure 36 shows the correlation of HBV S1/S2-TBD binding to CD32 and CD206 expression on dendritic cells. Figure 37 shows that the binding of HBV S1/S2-TBD to the CD32 receptors on dendritic cells is abolished by mouse Fc-γ fragments. Figure 38 shows that glycosylation of S1/S2 antigen increases the uptake via the CD206 receptor. Figure 39 shows intracellular interferon-γ positive T cells after antigen presentation. Figure 40 shows secretion of iπterferαn-γ after antigen presentation. Figure 41 shows intracellular interferon-γ positive cells as a function of S1/S2-TBD concentration Figure 42 shows interferon-γ secretion by T cells as a function of S1/S2- TBD concentration. Figure 43 shows the effect of glycosylation on intracellular interferon-γ production in T cells. Figure 44 shows the effect of glycosylation on interferon-γ secretion by T cells. Figure 45 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV Core (1-191) in the plasmid pFast BacHTa-HCV Core (1-191). Figure 46 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV Core (1-191)-TBD in the plasmid pFast BacHTa-HCV Core-TBD. Figure 47 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV Core (1-177) in the plasmid pFastBacHTa-HCV-Core(1-177). Figure 48 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV Core (1-177)-TBD protein in the plasmid pFast BacHTa-HCV-core(1- 177)-TBD. Figure 49 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV IMS5A in the plasmid pFast BacHTa-HCV-NS5A. Figure 50 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV NS5A-TBD in the plasmid pFast BacHTa-HCV-NS5A-TBD Figure 51 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV E1 in the plasmid pFast BacHTa-HCV-E1. Figure 52 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV E1-TBD in the plasmid pFastBacHTa-HCV-E1-TBD. Figure 53 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV E2 in the plasmid pFastBacHTa-HCV-EZ Figure 54 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV E2-TBD in the plasmid pFastBacHTa-HCV-E2-TBD. Figure 55 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV E1/E2 in the plasmid pFast BacHTa-HCV-E1/E2. Figure 56 shows the nucleotide (A) and amino acid (B) sequences of the ORF of HCV E1/E2-TBD in the plasmid pFastBacHTa-HCV-E1/E2-TBD.

Detailed Description of the Invention A composition of the present invention includes a chimeric antigen comprising an immune response domain (IRD) and a target binding domain (TBD). In preferred embodiments of the invention, the protein portion is capabie of inducing humoral and/or T cell responses, and the target binding portion is capable of binding an antigen presenting cell, such as a dendritic cell. The chimeric antigen of the present invention may also include one or more of the following: a hinge region of an immunoglobulin, a CHIregion of an immunoglobulin, a peptide linker, a protease cleavage site, and a tag suitable for use with a purification protocol. A chimeric antigen of the present invention is capable of binding an antigen presenting cell and eliciting an immune response. In some embodiments of the invention, the IRD of the chimeric antigen includes one or more proteins selected from the group comprising: one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins. In yet another embodiment of the invention, IRD of the chimeric antigen includes 6-His-pepEide fused to one or more HBV proteins, one or more recombinant HBV proteins, one or more HCV proteins, or one or more recombinant HCV proteins. f n preferred embodiments of the invention, the target binding domain of the chimeric antigen is an antibody fragment xenotypic to the host. For example, if the host is a human, an exemplary xenotypic antibody fragment is an animal antibody fragment, such as from a mouse. In the preferred embodiments of the invention, the xenotypic antibody fragment comprises a murine Fc fragment. In the most preferred embodiments of the invention, the target binding domain comprises a xenotypic Fc fragment, a hinge region, a CH 1 region, and a peptide linker suitable for linking the target binding domain to the IRD. The present invention also comprises the use of linking molecules to join the IRD to the TBD. Exemplary linker molecules include leucine zippers, and biotin/avidin. The present invention also comprises methods of using the compositions of the present invention to bind and activate antigen presenting cells, such as dendritic cells. The present invention also comprises methods of using the compositions for the present invention to activate T cells. The present invention also comprises methods of making the chimeric antigens of the present invention. The present invention also comprises a method of delivering an antigen to an immune system cell, such as an antigen presenting cell. The present invention also comprises compositions and methods for activating a humoral and/or cellular immune response in an animal or human, said method comprising administering one or more chimeric antigens of the present invention. The chimeric antigen of the present invention is a fusion protein having two portions, namely an IRD containing an antigenic sequence (such as a viral antigen(s), and a TBD containing a xenotypic Fc fragment. The xenotypic murine Fc fragment with the hinge region present recruits the antigen-presenting cells, specifically dendritic cells, to take up the chimeric antigen. The binding region of the chimeric antigen thus targets antigen-presenting ceils specifically. The interna! machinery of the APC then processes the IRD to form an activated APC. The activated APC must then be capable of contacting and activating immαne response cells for generating humoral and cellular immune responses to clear infected cells. In a further embodiment, the chimeric antigen is a fusion protein having two portions, namely a modified viral antigen or antigens, antigenic protein fragments or peptides, or any of these with glycosylation at specific sites, and a xenotypic murine Fc fragment with the hinge region present. In yet another embodiment, the invention provides a further modified chimeric antigen, wherein the antigen is biotinylated and the Fc fragment is generated with streptavidin as a fusion protein to facilitate the production of a wide assortment of aπtigen-Fc conjugates In yet another embodiment, the invention provides an association between the antigen and the antibody Fc fragment through chemical conjugation.

DEFINITIONS As used herein and in the claims, the terms and phrases set out below have the meanings which follow. "Antibody" refers to an immunoglobulin molecule produced by B lymphoid cells with a specific amino acid sequence evoked in humans or other animals by an antigen (immunogen). These molecules are characterized by reacting specifically with the antigen, each being defined in terms of the other. "Antibody response" or "humoral response" refers to a type of immune response in which antibodies are produced by B lymphoid cells and are secreted into the blood and/or lymph in response to an antigenic stimulus. In a properly functioning immune response, the antibody binds specifically to antigens on the surface of cells (e.g., a pathogen), marking the cell for destruction by phagocytotic cells and/or complement-mediated mechanisms. "Antigen" refers to any substance that, as a result of coming in contact with appropriate cells, induces a state of sensitivity and/or immune responsiveness and that reacts in a demonstrable way with antibodies and/or immune cells of the sensitized subject in vivo or in vitro. "Native antigen" refers to an antigen that the body does not recognize as foreign and which will, through the present invention, be recognized as foreign. "Antigen-presenting cell" refers to the accessory cells of antigen inductive events that function primarily by handling and presenting antigen to lymphocytes. The interaction of antigen presenting cells (APC) with antigens is an essential step in immune induction because it enables lymphocytes to encounter and recognize antigenic molecules and to become activated. Exemplary APCs include macrophages, Langerhans-dendritic cells, Follicular dendritic ceils, and B cells. "B-celP1 refers to a type of lymphocyte that produces immunoglobulins or antibodies that interact with antigens. "CH region" refers to the heavy chain constant domain of an antibody. "Cellular response" or "cellular host response" refers to a type of immune response mediated by specific helper and killer T cells capable of directly eliminating virally infected or cancerous cells. "Complex" or "antigen-antibody complex" refers to the product of the reaction between an antibody and an antigen. Complexes formed with polyvalent antigens tend to be insoluble in aqueous systems. "Cytotoxic T lymphocyte" is a specialized type of lymphocyte capable of destructing foreign cells and host cells infected with the infectious agents that produce viral antigens. "Epitope" refers to the simplest form of an antigenic determinant, on a complex antigen molecule; this is the specific portion of an antigen that is recognized by an immunoglobulin or T cell receptor. "Fusion protein" or "chimeric antigen" refers to a protein formed by expression of a hybrid gene made by combining two or more gene sequences. "Hinge region" refers to the portion of an antibody that connects the Fab fragment to the Fc fragment; the hinge region contains disulfide bonds that link the two heavy chains. "Host" refers to human or animal. "Immunity" or "immune response" refers to the ability of the body to resist or protect itself against infectious disease. "Immune Response Domain (IRD)" refers to the variously configured antigenic portion of a bifunctional molecule. The IRD comprises one or more antigens or one or more recombinant antigens. Viral antigens may include, but are not limited to, HBV PreS1/S2 HBV PreS1/S2/S, HBV Core, HBV Core ctm (c- terminal modified), HBV e-antigen, HBV Polymerase, HCV Core, HCV E1-E2, HCV EI 1 HCV E2, HCV NS3-εerine protease, HCV NSδA and NS4A, HIV GP120 and HSV Alkaline nuclease and HPV Antigens. "Lymphocyte" refers to a subset of nucleated cells found in lhe blood, which mediate specific immune responses. "Monoclonal antibody" or "MAb" refers to an antibody produced from a clone or genetically homogenous population of fused hybrid cells, i.e., a hybridorna cell. Hybrid cells are cloned to establish cell lines producing a specific monoclonal antibody that is chemically and immunologically homogenous, i.e., that recognizes only one type of antigen. "Peptide linkage" or "peptide bond" refers to two or more amino acids covalently joined by a substituted amide linkage between the alpha-amino group of one amino acid and the alpha-carboxyl group of another amino acid. "Protease cleavage site" refers to the site where proteolytic enzymes hydrolize (break) polypeptide chains. Exemplary proteases include rTEV, eπterokiπase and thrombin. "Tag" refers to marker or marker sequence used to isolate or purify a molecule containing the tag. An exemplary tag includes a 6x His tag. 1T cell" refers to a type of lymphocyte responsible for antigen-specific cellular interactions, and which mediates humoral and cellular immune responses. "Target Binding Domain (TBD)" refers to the region of a chimeric antigen comprising an immunoglobulin heavy chain constant region. In accordance with the present invention, the TBD is a portion capable of binding to an Fc receptor on an APC, particularly a dendritic cell, and is subsequently transported into the APC by receptor-mediated uptake. In accordance with the present invention, the presence of the Fc fragment augments the uptake of the chimeric antigen through the Fc receptor on antigen-presenting cells, specifically dendritic cells. By virtue of the specific uptake, the viral antigen is processed and presented as foreign; thus, an immune response is effectively elicited to the previously tolerant viral antigen. "Xenotypϊc" refers to originating from a different species other than the host. An embodiment of the present invention includes the use of recombinant antigens of HBV, HCV, or DHBV virus fused to a xenotypϊc antibody fragment by molecular biological techniques, production of the fusion proteins in baculovirus expression system and their use as therapeutic vaccines against chronic HBV and HCV infections. The present invention provides an efficient method to deliver a hitherto tolerated antigen to APCs in vivo so as to generate a broad immune response, a T∏1 response involving CTLs and a Th2 (antibody) response. The immunogenicity of the pre-selected viral antigen unrecognized by the host immune system is increased due to the presence of the xenotypic antibody fragment as well as by the presence of specific glycoεylation introduced in the insect cell expression system. The antigen-antibody fragment fusion protein, due to the presence of the antibody component, will bind to specific receptors present on various immune eel! types including dendritic cells, macrophages, B cells and granulocytes. The fusion proteins administered to either humans or animals will be taken up by the APCs1 especially DCs, will be hydrolysed to small peptides and presented on the cell surface, corπplexed with MHC Class 1 and/or MHC Class II, which can elicit a broad immune response and clear the viral infection, As used herein, the term 'Target Binding Domain (TBD)" refers to the region of a chimeric antigen comprising an immunoglobulin heavy chain constant region, which is a portion capable of binding to an Fc receptor on an APC. This DNA sequence is derived from mouse anti-HBVsAg MAb hybridoma 2C12 as cloned in pF astBac HTa expression vector, and expressed in High Five insect cell expression system (Invitrogen). The constant region of the heavy chain of the immunoglobulin molecule consists of part of CH1 , and Hinge-C H2-C H 3 from N- terminal to C-terminal. The constant region of the IgGI molecule for the practice of the present invention contains a linker peptide, part of CH1-hinge and the regions CH2 and CH3. The hinge region portion of the monomeric TBD can form disulphide bonds with a second TBD molecule. Figure 5 illustrates a schematic representation of the TBD molecule. The protein is expressed as an N-terrninal fusion protein with 6xHis tag, a seven amino acid spacer region, a seven amino acid rTEV protease cleavage site, 24 amino acid peptide linker, followed by a portion of the xenotypic (murine) MAb raised against HBV sAg (Hybridoma 2C12). TBD is a fragment of the constant chain of the IgGI IvIAb from 2C12 with the sequence of amino acids comprising the 7 or 24 amino acid peptide linker, five amino acids of the CH1 region, the hinge sequences, CH2 and CH3 region sequences (Figure 5), The TBD fragment defined herein forms the parent molecule for the generation of fusion proteins with antigens derived from viruses or other infectious agents. Figure 1b depicts the formation of dimeric TBD molecule formed via intermolecutar disulphide bonds. Figure 6 shows the nucleotide sequence of the Open Reading Frame (ORF) encoding the TBD protein and the deduced amino acid sequence as defined in Figure 5. Figure 7 shows a schematic representation of chimeric antigen vaccine molecule, as produced in the insect cell expression system. This molecule is a fusion protein of N-terminal 6xHis tag, rTEV protease cleavage site, HBV S1/S2 antigen, linker peptide (7 amino acid), a part of the CH1 as well as CH2 and CH3 domains of the mouse monoclonal antibody from 2C12, Purification and cleavage will result in the generation of HBV S1/S2-TBD molecule. Figure 8 shows the nucleotide and amino acid sequences of the chimeric antigen molecule- as expressed in insect cells and purified. Figure 9 shows the nucleotide and the deduced amino acid sequences of the expressed HBV S1/S2 protein. Figure 10 shows a schematic representation of the fusion protein of HBV S1/S2/S-TBD. Figure 11 shows the nucleotide and deduced amino acid sequences of the ORF of the fusion protein. Figure 12 shows the nucleotide and deduced amino acid sequences of the HBV S1/S2/S protein. Figure 13 illustrates the fusion protein of HBV core-TBD molecule as expressed in the insect cells. Figure 14 shows the nucleotide and amino acid sequences in the ORF of the fusion protein. Figure 15 shows the nucleotide and deduced amino acid sequences of the HBV Core protein. Another embodiment of the present invention involves the production and use of fusion proteins generated from Duck Hepatitis B Virus (DHBV) antigens and murine TBD, DHBV has been used as a very versatile animal model for the development of therapies for HBV, its human counterpart. DHBV genome encodes Surface antigen PreS/S, Core protein (Core), which form capsids and the polymerase enzyme that serves multiple functions. Figure 16 depicts a schematic representation of the fusion protein of DHBV PreS- TBD, as produced in High Five™ (Invitrogen) insect cell expression system. The nucleotide and deduced amino acid sequences of the ORF of the fusion protein as cloned in the plasmid pFastBac HTa is shown in Figure 17. The nucleotide and deduced amino acid sequences of the DHBV PreS protein shown in Figure18. Figure 19 shows schematically, another embodiment of the present invention viz.. DHBV PreS/S-TBD. The nucleotide and amino acid sequences are presented in figs, 20. The nucleotide and deduced amino acid sequences are presented in Figure 21. Figure 22 shows a schematic representation of the fusion protein of DHBV Core-TBD, Figure 23 shows the nucleotide and deduced amino acid sequences of the DHBV Core-TBD fusion protein. The nucleotide and deduced amino acid sequences of DHBV Core protein is shown in Figure 24. The present invention uses established recombinant DNA technology for producing the fusion proteins of pre-selected antigen(s) and the TBD that are necessary in the practice of the invention. Fusion protein constructs are generated at the DNA level incorporating specific restriction enzyme sites, which are exploited in incorporating the desired DNA fragment into expression vectors, and used to express the desired fusion proteins in a heterologous expression system. As used herein, the term "vector" denotes plasmids that are capable of carrying the complimentary DNA, which encode the desired protein(s). The plasmid vectors used in the present invention include, but not limited to, pFastBacHTa and the corresponding recombinant "BACMIDS" generated in DH10BAC E.Coli {Invitrogen). It is possible to mobilize the ORF of the desired proteins and produce other recombinant plasrnids for expression of the proteins in other systems, (bacterial or mammalian), in addition to the Baculovirus Expression System (Invitrogen), employed in the present invention. The term "expression" is used to mean the transcription of the DNA sequence into mRNA, the translation of the mRNA transcript into the fusion protein. This is achieved by the transposition of the gene of interest into the bacmids, tranfected into Sf9 insect cells and recombinant baculovirus produced. These are used to infect High Five insect ceils, which produce the protein of interest. All the recombinant proteins produced have an N-terminal 6xHis tag that is exploited in the purification of the proteins by using Ni-NTA Agarose or Ni-NTA superflow (Qiagen). The proteins also have an N-terminal rTEV protease cleavage site cloned in. The Ni-purified protein can be subjected to digestion with rTEV protease (Invitrogen), which also has an N-terminal βxHis tag. Following the protease digestion, the mixture can be loaded on to a Ni-NTA agarose column and the pure protein can be eluted out, while the δxHis tagged fragments will be bound to the column. This method of purification is standard procedure and one skilled in the art wouid be able to understand the methodology without further explanation. The proteins produced using the current invention can also be used as vaccines without the removal of the 6xHis tag. Cloning and expression of the DNA sequences which encode the viral antigen and the Fc fragment of the murine monoclonal antibody to generate the chimeric antigen can be achieved through two approaches. The first approach involves cloning the two proteins as a fusion protein, while the second approach involves incorporating specific "bio-iinkers" such as biotiπ or streptavidiπ in either of the molecules, purifying them separately and generating the chimeric antigen. A monoclonal antibody (2C12) is generated against the Hepatitis B virus surface antigen, and the hybridoma that produces this monoclonal antibody is used to isolate the total RNA for the murine immunoglobulin G. This total RNA is used to clone the murine Fc fragment. Specifically, the total RNA from a hybridoma cell that expresses murine IgG is isolated using Trizol™ reagent (Invitrogen/Gibco BRL, product catalog number 10551-018, 10298-016). The mRNA is purified from total RNA by affinity chromatography on an ofigo-dT column (Invitrogen/Gibco BRL, product catalog number 15939-010). A complementary DNA (cDNA) is produced using reverse transcriptase in a polymerase chain reaction. The oligonucleotide primers are designed to add unique restriction enzyme recognition sites to facilitate cloning. This cDNA is cloned into Bac-To-Bac™ bacuiovirus expression system (Invitrogen/Gibco BRL, product catalog number 15939-010). The bacuiovirus system is used because not only are large amounts of heterologous proteins produced, but also post-translational modifications, such as phosphorylation and glycosylatiαπ, of eukaryotic proteins occur within the infected insect cell. In this expression system, the cDNA can be cloned into vectors called pFastBac™ as illustrated schematically in Figure 4 (Invitrogen/Gibco BRL, product catalog number 15939-010). The advantage of the Bac-To-Bac™ system over other baculovirus systems involves the method of generating recombinant baculoviruses. In other systems, the protein of interest is cloned and then co- transfected with a wild-type baculovirus. Homologous recombination is required to generate recombinants; however, this method is very inefficient and requires laborious plaque purification and screening. In the Bac-To-Bac™ system, the generation of recombinants is based on site-specific transposition with the bacterial transposoπ Tn7. The gene of interest is cloned into p FastBac™, which has mini-Tn7 elements flanking the cloning sites. The plasrnid is transformed into Escherichia coli strain DH10BAC™ (Invitrogen/Gibco BRL, product catalog number 10361-012), which has a baculovirus shuttle plasmid (bacrnid) containing the attachment site of T∏7 within a LacZ gene. Transposition disrupts the Lac? gene so that only recombinants produce white colonies and are easily selected for. The advantage of using transposition in E. coli is that single colonies contain only recombinants so that plaque purification and screening are not required. The recombinant bacmids are transfected into insect cells to generate baculoviruses, which express recombinant proteins. The chimeric proteins are purified by Ni-NTA affinity chromatography using techniques known to those skilled in the art. The second approach involves incorporating specific "bio-linkers" such as biotin or streptavidin in either of the molecules, purifying them separately and generating the chimeric antigen. The viral antigens of interest are cloned into plasmids that control the expression of proteins by the bacteriophage T7 promoter. The recombinant plasmid is used to transform an E. coli strain, e.g. BL21(DE3) Codon Plus™ RIL cells (Stratageπe, product catalog number 230245), which has production of T7 RNA polymerase regulated by the lac repressor. The T7 RNA polymerase is highly specific for T7 promoters and is much more processive (~S fold faster) than the E. coli host's RNA polymerase. When production of T7 RNA polymerase is induced by isopropyl-β-D-thiogalactoside, the specificity and processivity of T7 RNA polymerase results in a high level of transcription of genes under control of the T7 promoter. In order to couple two proteins together, the high affinity binding between biotin and streptavidin is exploited, in E. coli, the BirA enzyme catalyzes the covaleπt linkage of biotin to a defined lysine residue in a specific recognition sequence. Antigens, which are thus biotinylated at a specific site, can be expressed and purified. The murine Fc fragment is expressed in the baculovirus system, as described above, as a fusion protein with streptavidin. These two proteins can be mixed to form a chimeric protein by biotin-streptavidin binding. Following cloning and expression, the chimeric antigen is then evaluated for its efficacy in generating an immune response. Evaluation involves presenting the chimeric antigen to dendritic cells ex vivo or in vivo. The dendritic cells are presented to T lymphocytes and evaluated for the production of interferon γ as a marker of T cell response. Specifically, in the ex vivo evaluation, naive dendritic cells are generated from peripheral blood mononuclear cells. Dendritic cells process and present antigen to T cells which cause their activation into effector cells, e.g. helper T cells or cytotoxic T lymphocytes. Activation of the T cells by the dendritic cells is then evaluated by measuring markers, e.g. interferon .γlevels, by a known procedure (Berlyn et al., 2001 ). In the case of the in vivo evaluation, the chimeric antigen is directly introduced parenterally in the host where available dendritic and other antigen presenting cells which have the capacity to interact with all antigens and process them accordingly. The following non-limiting examples provide further illustration of the invention.

Examples Example 1. Construction of murine TBD protein expression vector. The mouse IgGI DNA sequences encoding amino acids of CH1-Hinge- CH2-CH3 region was generated from mRNA isolated from the hybridoma (2C12) that produces MAb against HBV surface antigen (sAg). Total rnRNA was isolated using TRizol reagent (Gibco BRL cat. No. 15596-026) and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide -SRPQGGGS- at the 51 terminus, a unique Not I site at the 5' and a unique Hind III restriction site at the 3' end. The resulting cDNA contains (5' Not I)- linker sequence-CHI (VDKKI)-Hinge-CH2-CH3-(3' Hind III). Following digestion with the respective enzymes, the fragment is ligated with pFastBacHTa expression vector plasmid (Invitrogen) using the same restriction enzyme sites. The 5" primer used for PCR amplification was (Sense) 5' TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGTGCC CAGG (Seq. ID No. 1) and the 3" primer was (antisense) 5" ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG (Seq. ID No.2), which contained the Not I and Hind III sites, respectively. The following is the protocol used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods. Following the cloning of the gene of interest (eg. TBD) into the pFastBac- HTa donor plasmid, the production of recombinant proteins is based upon the Bac-to-Bac bacuiovirus expression system (Invitrogen). The next step is site- specific transposition of the cloned gene into a bacuiovirus shuttle vector (Bacmid). This is accomplished in a strain of E. coli called DHIOBac. The DHIOBac cells contain the bacmid, which confers kaπamycin resistance and a helper plasmid that encodes the transposase and confers resistance to tetracycline. The recombinant pFastBac-HTa plasmids with the gene of interest (TBD ) are used to transformed into DHIOBac cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DHIOBac cells is thawed on ice, the pFastBacHTa based plasmids are added and the mixture is incubated on ice for 30 minutes. The mixture is given a heat shock for 45 seconds at 42oC and then chilled on ice for 2 minutes. The mixture is then added to 900 μL of LB media and incubated for 4 hours at 37oC The transformed cells are serially diluted with LB to 10-1 and 10-2 and 100 μl of each dilution is plated on LB agar plates supplemented with 50μg/mI kaπamycin, 7 μg/ml gentamicin, 10μg/ml tetracycline, 100μg/ml X-gal, and 40μg/ml IPTG and incubated for at least 36 hours at 37oC. The gentamicin resistance is conferred by the pFastBac-HTa and the X-gal and IPTG are used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies are picked and inoculated into 2ml of LB supplemented with 50 μg/ml kanamyciπ, 7 μg/ml gentamicin and 10 μg/ml tetracycline and incubated overnight at 37oCr with shaking. A sterile loop is used to sample a small amount of the overnight culture and the sample is streaked onto a fresh LB agar plate supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG and incubated for at least 36 hours at 37oC to confirm a white phenotype. Recombinant bacmids were isolated by standard protocols (Maniatis), the DNA sample was dissolved in 40 μ! of TE (1OmM Tris-HCI pH 8, 1 mM EDTA) and used for transfections. In order to produce baculoviruses, the bacmid is transfected into Sf9 insect cells. Sf9 cells (9 x 105) were seeded into each well of a 6 well cell culture dish (35mm wells) in 2ml of SfθOOII (Invitrogen) and allowed to attach for at least 1 hour at 27oC. Transfections were carried out using CELLFectin Reagent (Invitrogen, Cat No. 10362-010) as per the protocols provided by the supplier of the Sf9 cells. Following transfection, the cells were incubated at 27oC for 72 hours. The medium containing baculovirus was collected and stored at 4oC in the dark. The efficiency of the tranfection is verified by checking for the production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest (TBD). The primers used are pFastBac 5' (sense) TAT TCCGGATTATTCATACCG (Seq. ID No.3) and pFastBac 3' (antiseπse) 5' CTCTACAAATGTGGTATGGC (Seq. ID No 4). Amplified products were on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6xHis tag monoclonal antibody (Clonetech) as the probe. Once production of baculovirus and the expression of protein have been confirmed, the virus is amplified to produce a concentrated stock of the baculovirus that carry the gene of interest (e.g. TBD). It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Invitrogen). The most appropriate concentration of the virus to infect High Five™ cells and the optimum time point for the production of the desired protein was established as well. Example 2. Construction of HBV Surface antigen S1/S2 and HBV S1/S2-TBD fusion protein expression vectors. The DNA encoding the HBV sAg fragment S1/S2 was generated from the piasmid pRSETB HBV S1/S2 template using PCR methodology. The primers used were; (sense) 5' GGATCTGT ACGACGATGACG (Seq. ID No. 5) and the 3' primer (antisense) 5' AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (Seq. ID No. 6) containing the restriction enzyme site Not I. The 5' end contained a unique Bam H I site derived from the parent piasmid that was used for ligations. Amplified DNA was digested with Bam H I/Not I and ligated with pFastBacHTa expression vector to generate the expression piasmid for HBV S1/S2 protein. The fragment was iigated with the piasmid pFastBacHTa -TBD (described in example 1) following the digestion with the respective enzymes. This produced the expression piasmid pFastBacHTa HBV S1/S2-TBD. This piasmid was used to produce recombinant baculovirus (described in example 1), which expressed the chimeric antigen-TBD fusion protein: 6xHis tag-rTEV protease cleavage site-HBVS1/S2-TBD (See Figures — 7-9).

Example 3. Construction of HBV Surface antigen S1/S2/S and HBV S1/S2/S-TBD fusion protein expression vectors. The DNA encoding the HBV sAg fragment S1/S2/S was generated from the piasmid pAlt HBV 991 (University of Alberta) template using PCR methodology. The 51 primer used for the PCR was (sense) 5' GATAAGGATCCTATGGGAGGTTGGTCATCAAAAC (Seq. ID No. 7), containing the restriction enzyme Nco I site. The PCR primer for 3' terminus was (antisense) 5' GTCATACTGCGGCCGCGAAATGTATACCCAGAGACAAAAG (Seq. ID No. 8), containing the restriction enzyme Not I site. Amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression piasmid for HBV S1/S2/S or the expression piasmid pFastBac HTa HBV S1/S2/S-TBD fusion protein (see Figures — 10-12). Example 4. Construction of HBV Core antigen and HBV Core-TBD fusion protein expression vectors. HEV produces the core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the core one secreted into circulation, also known as the "e" antigen and the capsid forming core protein. The present invention also relates to the generation of expression plasmids to produce the Core protein as well as the core antigen-TBD fusion protein, in insect cells. The cDNA encoding the HBV Core protein was generated from the plasmid pAltHBV991 template using PCR technique. The 5' primer used for the PCR was (sense) 51 TGCGCTACCATGGACATTGACCCTTATAAAG (Seq. ID No. 9) which contains the restriction enzyme Nco I site and the 31 primer used was (antisense) 5' TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (Seq. ID No. 10), containing the restriction enzyme Not I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBacHTa HBV Core-TBD fusion protein (see Figures 13- 15).

Example 5. Construction of DHBV Surface antigen fragment PreS and DHBV PreS-TBD fusion protein expression vectors. DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenially infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules that could be used as therapeutic vaccines in DHBV- infected ducks, thus providing a viable animal model for the feasibility studies for HBV therapeutic vaccines. The cDNA encoding DHBV PreS antigen was produced by PCR from a plasmid pFastBacHTaDHBV PreS/S (University of Alberta). The 5' primer used for the PCR was (sense) 5' TATTCCGGATTATTCATACCG (SEQ. ID No. 11). The unique restriction enzyme site EcoR I, resident on the parent plasmid was used for directional cloning. The 31 primer used was (antisense) 5' TGTCATTCTGCGGCCGCGTTTTCTTCTTCAAGGGGGGAGT (Seq. ID No. 12), containing the restriction enzyme Not I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoR I and Not I and the DNA fragment was purified on a 1% agarose gel, The fragment was ligated with the expression plasmid pFastBacHTa at the respective sites to produce pFastBacHTa DHBV PreS, which expressed the PreS antigen. The same fragment was also used to ligate with pFastBacHTa-TBD to generate the expression plasmid pFastBacHTa DHBV PreS-TBD. The production of baculovirus stocks from these plasmids and the expression of the PreS and PreS-TBD in High Five insect ceils were done as described in Example 1.

Example 6. Construction of DHBV Surface antigen fragment PreS/S and DHBV PreS/S-TBD fusion protein expression vectors. DHBV PreS/S DNA was produced by PCR methods using 51 primer (sense) 5' tattccggattattcataccg (Seq. ID No 11 ) and the 3] primer (antisense) 5' TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (Seq. ID No 13), containing restriction enzyme Not ! site. The unique restriction enzyme site Eco R I, resident on the parent plasmid pFastBacHTa PreS/S (University of Alberta) was used for directional cloning. This plasmid also was the template for generating the required cDNA by PCR. All other protocols forthe production of either the DHBV PreS/S or the fusion protein PreS/S-TBD are the same as described in the Example 5 above. Nucleotide and deduced amino acid sequences are shown in Figures 20 and 21,

Example 7. Construction of DHBV Core antigen and DHBV Core- TBD fusion protein expression vectors. The DNA coding for DHBV Core was generated by PCR using the following primers. The 5' terminus primer used was (sense) 5' TGCGCTACCATGGATATCAATGCTTCTAGAGCC (Seq. ID No.14), containing the restriction enzyme Nco I site. The 3' terminus primer used was (antisense) 5' TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (Seq. ID No. 15), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in the example 5 above. Example 3. Chemically cross-linked HBV sAg- Fc (murine) HBV sAg was cross-linked using the bifunctional cross-linking agent DMS1 a homobifuπctional imidoester which react with amino groups on the proteins. The unreacted components were removed by gel filtration. The conjugate was characterized with respect Lo the stoichiometry of sAg/Fc in the conjugate and the fraction containing sAg:Fc at 1 :1 ratio was chosen for antigen presentation assays using human monocyte-derived immature Dendritic cells (DCs). Immature DCs were cultured for four days with GM-CSF/JL4, incubated with the sAg-Fc conjugate and matured in the presence of TNFα/ IFNα. Autologous CD3+ T cells were added to the mature DCs. Following three rounds of exposure to the mature DCs, T cell stimulation was quantitated by measuring the production of intracellular IFNγ , using flow cytometry.

Materials: HBV sAg (US Biologicals; Cat # H 1910-27) Mouse Polyclonal IgG Fc fragment (Harlaπ Sera-Lab Ltd., Cat# PP-19-01) DMS (Dimethyl subeήmidate. 2HCI) (Pierce Cat # 20700) Cross- linking Buffer O.1 M HEPES pH 8.7 Stop Buffer 0.1 M TrisHCI pH 7.8 Elution Buffer: Phosphate Buffered Saline (PBS) pH 8.3 Sephadex G 75 (Pharmacia)

Methods: Solutions of sAg (100 μg) and Mouse Fc fragment (100 μg), were dialyzed against the cross linking buffer overnight at 4 0C. The protein solutions were mixed together, DMS reagent was added immediately to a final concentration of 10 mM, and the mixture was incubated at room temperature for 1 Hr. The reaction was stopped by the addition of 0.1 M TrisHCI pH 7.8. The reaction mixture was loaded on a Sephadex G 75 column (0.7x12 cm), and fractions were eluted using elution buffer. 0.5 ml fractions were collected and the fractions containing sAg/Fc at a molar ratio of 1 ;1 , as estimated by Elisa using the respective antibodies were pooled and used for Antigen Presentation Assays. Results: The levels of intracellular IFNγ produced in T cells In the presence of conjugate was substantially higher than the sAg or the Fc fragment alone. The results are presented in Figure 25,

Example 9. Chimeric Antigens of Hepatitis C virus (HCV) Hepatitis C virus (HCV) is a member of the flaviviridae family of RNA viruses. Route of infection is via blood and body fluids and over 50 % of the patients become chronic carriers of the virus. Persistent infection results in chronic active hepatitis, which may lead to liver cirrhosis and hepatocellular carcinoma (Salto et. al. 1990). Approximately 170 million people worldwide are chronic carriers of HCV (Wild & Hall 2000). There is no prophylactic vaccine available at present. Current therapy is Interferon α 2b and Ribavirin, either alone or as combination therapy. The significant side effects for interferon treatment and the development of mutant strains are major drawbacks to the current therapy. Moreover, interferon therapy is effective only in 20% of the patients. Therapeutic vaccines to enhance host immune system to eliminate chronic HCV infection will be a major advancement in the treatment of this disease.

Replication of HCV: HCV genome is a positive sense single stranded RNA molecule of approximately 9.5Kb in length. This RNA which contains both 5' and 3' untranslated regions codes for a single polyprotein, which is cleaved into individual proteins, catalyzed by both viral and host proteases (Clarke, B. (1997) J,Gen. Virol. 78: 2397-2410). The structural proteins are Core, Envelope E1 & E2 and P7. The non-structural proteins are NS2, NS3, NS4A, NS4B, NS5A and NS5B. Core forms capsids. E1 , E2 are envelope proteins, also called "Hypervariable Region" due to the high rate of mutations, NS3 is a Serine Protease, the target of several protease inhibitors as aπtivirals for HCV. NS5B is the RNA Polymerase enzyme. NS5A has recently been suggested to have a direct role in the replication of the virus in the host by counteracting the interferon response Taπ,S-L & Katze, M.G. (2001) which augments the immune function.

Chimeric HCV antigens:

HCV Cσre (1~191)-TBD: This protein has been cloned using the pFastBac HTa vector and the baculovirus system and expressed in Sf-9 and High Five insect cells, similar to the HBV fusion proteins. This was done as follows. The DNA encoding the HCV core fragment was generated from the plasmid pCV-H77c (NIH) template using PCR methodology. The primers used were: (sense) 5'CGGAATTCATGAGCACGAATCCTAAAC (Seq. ID No.16), containing the restriction enzyme site Eco Rl and the 3' primer (antiseπse) 51 ΘGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (Seq. ID No.17), containing the restriction enzyme site Spe !. Amplified DNA was digested with Eco Rl/Spe I and the fragment was ligated with the plasmid pFastBacHTa -TBD (described in Example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HCV core-TBD. This plasmid was used to produce recombinant baculovirus (described in example 1 ), which expressed the chimeric antigen (HCVCore(1-19I)-TBD) fusion protein. 6xHis tag-rTEV protease cleavage site-HCV core-TBD,

HCV Core protein: Amplified DNA was digested with Eco Rl/Spe I and ligated with plasmid pFastBacHTa expression vector to generate the expression plasmid for HCV core protein. This protein is expressed with N4ermϊnal 6xHis tag and rTEV protease cleavage site.

Example 10. Cloning, Expression and Purification of Recombinant proteins using the Baculovirus Expression System. Baculovirus Expresssion System is commercially available from Iπvitrogen and the procedures used were as described in the company protocols. The gene of interest is cloned into pFastBac-HTa donor plasmid and the production of recombinant proteins is based upon the Baoto-Bac baculovirus expression system (invitrogen). In the next step, the pFastBac-HTa donor plasmid containing the gene of interest is used in a site-specific transposition in order to transfer the cloned gene into a baculovirus shuttle vector (bacmid). This is accomplished in E. coli strain DHIOBac. The DHIOBac cells contain the bacmid, which confers kanamyciπ resistance and a helper plasmid, which encodes the transposase and confers resistance to tetracycline- The recombinant pFastBac-HTa plasrnids with the gene of interest are transformed into DH 10Bac cells for the transposition to generate recombinant bacmids. A 100 μl aliquot of competent DHIOBac cells is thawed on ice, the pFastBac-HTa based plasmids are added and the mixture is incubated on ice for 30 minutes. The mixture is given a heat shock for 45 seconds at 42 oC and then chilled on ice for 2 minutes. The mixture is then added to 900 μl_ of LB media and incubated for 4 hours at 37 oC. The transformed cells are serially diluted with LB to 10-1 and 10-2 and 100 μl of each dilution is plated on Luria broth (LB) agar plates (supplemented with 50 μg/ml kanamycin, 7 μg/ml geπtamicin, 10 μg/ml tetracycline, 100μg/m) X-gal, and 40μg/ml IPTG) and incubated for at least 36 hours at 37 oC. The gentamicin resistance is conferred by the pFastBac-HTa and the X-gal and IPTG are used to differentiate between white colonies (recombinant bacmids) from blue colonies (non recombinant). The white colonies are picked and inoculated into 2ml of LB (supplemented with 50 μg/ml kanamycin, 7 μg/m) gentamicin and 10 μg/ml tetracycline) and incubated overnight at 37 oC, with shaking. A sterile loop is used to sample a small amount of the overnight culture and the sample is streaked onto a fresh LB agar plate (supplemented with 50 μg/ml kanamycin, 7 μg/ml gentamicin, 10 μg/ml tetracycline, 100 μg/ml X-gal, and 40 μg/ml IPTG) and incubated for at least 36 hours at 37oC to confirm a white phenotype. Recombinant bacmids were isolated by standard protocols (Sambrook and Russell, 2001), the DNA sample was dissolved in 40 μl of TE (1OmM Tris-HCI pH 8, 1 πriM EDTA) and used for transfections. In order to produce baculoviruses, the bacmid is transfected into Sf9 insect cells. Sf9 cells (9 x 105) were seeded into each well of a 6 well cell culture dish (35mm wells) in 2m! of SfmθOOl! and allowed to attach for at least 1 hour at 27 oC. Transfections were carried out using CELLFectiπ Reagent (Invitrαgeπ, Cat. No. 10362-010) as per the protocols provided by the supplier. Following traπsfection, the cells were incubated at 27 oC for 72 hours. The medium containing baculovirus was collected and stored at 4 oC in the dark. The efficiency of the transfection was verified by checking for production of baculoviral DNA. The isolated baculovirus DNA is subjected to PCR to screen for the inserted gene of interest. The primers used are pFastBac 5' (sense) TAT TCCGGATTATTCATACCG (Seq. ID No.3) and pFastBac 3' (antisense) 51 CTCTACAAATGTGGTATGGC (Seq. ID No 4). Amplified products were separated on an agarose gel (0.8%). The expression of the heterologous protein in the cells was verified by SDS polyacrylamide gel electrophoresis (SDS-PAGE) and Western blots using the 6xHis tag monoclonal antibody (Clontech) as the probe. Once production of baculovirus and the expression of protein have been confirmed, the virus stock is amplified to produce a concentrated stock of the baculovirus that carry the gene of interest. It is standard practice in the art to amplify the baculovirus at least two times, and in all protocols described herein this standard practice was adhered to. After the second round of amplification, the concentration of the generated baculovirus was quantified using a plaque assay according to the protocols described by the manufacturer of the kit (Iπvilrogen). The most appropriate concentration of the virus to infect High Five cells and the optimum time point for the production of the desired protein was also established.

Example 11. Expression of the recombinant proteins Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3 x 105 cells/mL and incubated at 27.5 0C with shaking at 138 rpm until the cell density reached 2-3 x 106 cells/mL. Standardized amounts of the respective recombinant bacuiovirus was added to the cells. The incubation temperature was 27.5 0C and the appropriate infection period was standardized for individual protein expression. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4 0C and used forthe purification of the recombinant proteins. Unused portions of cells were snap frozen in liquid nitrogen and stored at -70 0C, Example 12. Purification of proteins For purification under denaturing conditions, the cells were lysed in a buffer containing 6 M Guanidinium-HCI in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCI, 10 mM Imidazole, pH 8.0 (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 70 to 80 watts, and was mixed at room temperature for 1 hour. The lysate was ceπtrifuged at 10,000 x g for 10 min to remove unbroken cells and cell debris. The supernatant was loaded on to a Ni-NTA agarose (Qiagen) bead column (1 x 5 cm/100 ml_ cell iysate), pre-equilibrated with lysis buffer. Following loading, the column was washed with 20 column volumes of 6 M guanidiπium-HCI in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCI1 40 mM Imidazole, pH 8.0 (wash buffer 1), followed by washes with 20 column volumes of S M urea in 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCI1 40 mM imidazole, pH 8.0 (wash buffer 2). The bound protein was eluted with a buffer containing 8 M urea, 100 mM NaH2PO4, 10 mM Tris, 300 mM NaCI, 250 mM imidazole, pH 8 (Elution Buffer). The fractions containing the protein was pooled and dialyzed against PBS, (Overnight, 4°C).

Examples 13-16. Use of Chimeric Antigens to Enhance Antigen Presentation by Human PBMC-derived Dendritic Cells and to Elicit an Immune Response in T Lymphocytes

Example 13. Human PBMC Monocyte Isolation and Differentiation to DCs Peripheral blood mononuclear cells (PBMC) were obtained from Ficoll/Histopaque (Sigma) treatment of a leukapheresis cell preparation. Monocytes were separated from the PBMC population by negative selection using a monocyte isolation kit (Dyna!) (Berlyn er a!. 2001), The monocytes were greater than 95% pure as assessed by antibody analysis and flow cytometry (CD3-, CD19-, CD16-, CD11a+, CD14+). Monocytes were washed twice with AIM V media containing L-glutamine, streptomycin sulfate (50 μg/mL) and ge∏tamicin sulfate (10 μg/mL) with 1% donor matched sera. Next, the monocytes were cultured in AIM V media containing 2.5% donor matched sera and the cytokines GM-CSF and lL-4 (1000 U/mL) to differentiate the cells toward the dendritic cell (DC) lineage. The cells were incubated in 12-well tissue culture plates at 37 oC under a 7% CO2 atmosphere. The DCs were used for APAs and ligand binding and uptake studies. The monocyte-derived DCs (mDC) were harvested on days 1 through 4. The cells were subsequently washed once with AIM V media with 0.1% BSA (Sigma), and twice with Dulbecco's phosphate buffered saline (l∏vitrogen) with 0.1% (w/v) BSA (PBSB). The mDC were used in 4 0C labeling or binding assays or in 370C binding/uptake assays.

Example 14. Human Dendritic Cell T cell Stimulation Assay Antigen presentation assays were performed using human PBMC-derived dendritic ceils according to established protocols (Berlyn, Schultes et al., 2001 ). Monocytes were generated from leukapheresis samples from healthy donors (described above) and were depleted of lineage cells by incubation with anti-CD3, CD19, and CD16 antibodies. This was followed by incubation with magnetic bead conjugated anti-mouse IgG and separation on a magnet (Dynal). Negatively selected cells were approximately 95% pure monocytes as characterized by flow cytometry using a broad CD marker panel. Next, monocytes were incubated with IL-4 and GM-CSF (R&D Systems) for 4 days in AIM V media + 2.5% matched human serum to generate immature DC. Again, an aliquot of the cells was stained with a broad CD marker pane) to ensure purity and identity of the cells. The cells were harvested and loaded with antigens for 2-8 hours at 37 0C, and matured with IFN-α and TNF-α for 3 days. Dendritic cell were checked again using flow cytometry for an array of CD markers to ensure that cells had undergone proper maturation. Mature DCs were washed thoroughly and added to T cells that were generated from the same monocytes as the DCs by means of negative selection using a magnetic T cell isolation kit (Dynal). T cells and DCs were incubated for 7 days and re-stimuiated with loaded and matured DCs that were prepared as described above. An aliquot of the cells was taken 16 hours later and prepared for intracellular cytokine staining (Day 15), while the remaining cells were incubated for another 7 days. The latter cells were stimulated with another batch of loaded and matured DCs and prepared for intracellular cytokine staining on Day 22. For intracellular cytokine staining, cells were incubated with Brefeldin A (Golgi Plug, R&D Systems) 2 hours after DC addition and incubated for another 16 hours. Cells were stained with anti-CD3-FITC and anti-CDS-Cy-Chrome for 30 minutes, washed, fixed, perrneabilized, and stained with anti-lFN-γ-PE for 30 minutes on ice. The cells were washed and analyzed by flow cytometry (FACSCalibur, Becton Dickinson). After the third DC loading and presentation, a batch of the T cells was incubated for three days and the supernatant was used for measuring the level of secreted IFN~γ by ELISA (Pharmingen Opt EIAtM). A protocol summary forthe APA is presented in schematic form. DsyO Manoijtes __ w Lcerfrrj ,. . ^ GWCSF+IL4 INFβ÷TNSx Oay7 [∏TW-JeCC M=-ueCC \ fteatttfetaTceils

Day7 DC-2 4<%s 3D-ys Dey14 \ BsiauhA 18hbus Nb∏ostes ►Using -— ► TCeils ► TraSte GMCSFflL4 UvFti+TN^ f \ IFNγ (IrfiaceilJar)

Day14 ^ Day23 003 4d^ιs 3«^s Da/-∏ TOais IVbnβytes ^ lxectng -— — y IR^ (SeαdEd) £3WCSFt!L4

Example 15. Expression of Foγ Receptors and CD206 on Maturing DC There are several receptors on the APCs that bind and take up antigens. The abundance of these receptors on maturing DCs was evaluated using fluorescent labeled receptor-specific antibodies. FACS analysis was used to estimate percentage of specific positive cells in the total population of DCs and as a function of relative mean fluorescent intensity (MFI) (Figure 30). The expression of CD64 decreased with time in culture and at day 4 was almost negligible. In contrast, CD32, and to a lesser extent CD16, were expressed after 4 days of DC culture. On day 0 of culture, there was essentially no CD206 expression, but on culture with lL-4 and GM-CSF1 the expression of CD206 was induced and at day 4 was expressed at very high levels. Thus at day 4, the day that antigen was loaded in the antigen presentation assays, the DCs possessed at least two potential receptors for the binding of chimeric antigens: CD32 and CD206. In addition, as shown in Figure 31 , they had the full complement of the co-stimulatory molecules. The expression of HLA-DR (Class II) and HLA-ABC (Class I) also increased with time in culture. Co-stimulatory molecules CD86 (B7.2) and CD80 (B7.1) were expressed at high levels throughout the period of the assay (Figure 31). These results indicate that the monocyte-derived DCs were differentiating towards mature DCs and were capable of antigen presentation to T cells. The cells were used to evaluate the binding and uptake of the chimeric antigens in comparison to relevant antibodies.

Example 16. Phβnotypic Analysis, Binding and Uptake Assay For the pheπotypic analysis and binding assay, all procedures using incubations were performed at 40C1 buffer solutions were also held at 4 0C. The binding of antigens, chimeric antigens or antibodies was determined by incubating the cells with various concentrations of the agents for 60 minutes in phosphate buffered saline, 0.1% BSA (PBSB). For phenotypic analysis, cells were incubated with the various conjugated MAbs at the concentrations recommended by the manufacturer for 20 minutes. Incubations were performed with 1 χ 105 cells/well in 96-well v-bottom plates in a volume of 25 μL. Subsequently, the cells were washed twice with PBSB. Before conjugated MAb labeling, the cells were resuspended in PBS with 2% (w/v) paraformaldehyde (PF)1 and for the binding studies, the cells were treated with F(ab')2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB for 20 minutes. The cells were washed twice with PBSB and either resuspended in PBSB with 2% PF and acquired by FACS or in PBSB and incubated with PE-conjugated CD32 or CD206 specific MAb for 20 minutes before washing twice with PBSB. To determine the extent of uptake of chimeric antigens (e.g. HBV S1/S2- TBD) compared with IgGI and !gG2a, cells were incubated with various concentrations of the antigen, IgG! {2C12, the parent MAb from which TBD was produced) and lgΘ2a (G155-178) for 1 hour at 370C in AIM V media with 0.1 % BSA. Cells were washed twice in PBSB and fixed with PBS with 2% PF overnight at 4 0C. Subsequently, the cells were washed twice in PBSB and permeablϊzed with PBS containing 0.1% (w/v) saponin (Sigma) for 40 minutes at 200C. The cells were washed twice with PBSB and incubated with F(ab')2 goat anti-mouse Alexa-488 (10 μg/mL) in PBSB with 0.1% (w/v) saponin for 20 minutes at 40C. After washing twice in PBSB, the cells were resuspended in PBSB. A variant of this assay involved treating the cells as above with chimeric antigen, IgG1 , or lgG2a for 10 minutes followed by the addition of F(ab')2 goat anti-mouse Alexa-488 (10 μg/mL) for 50 minutes. Subsequently the cells were washed and resuspended in PBS with 2% PF. This procedure relied on the ability of the anti- mouse Alexa-488 Ab to directly bind the S1/S2-TBD, IgGI or lgG2a molecules. Cells were acquired by a Becton Dickinson (BD) FACScan fitted with CellQuest™ acquisition and analysis software (BD). A gate was made on the viable cell population as determined by the FSC and SSC scatter profile and ≥10,000 events were acquired. To determine the percentage of positive cells, a gate was set based on negative control treated cells (isotype control labeled or cells labeled with F(ab')2 goat anti-mouse Alexa-488 alone). The percent of specific positive cells was calculated as: (% positive cells test sample - % positive cells control) * 100 100 - % positive cells of control

The relative mean fluorescent intensity (MFI) was determined as the MFI of the test sample - MFI of the control sample.

Example 17. Construction of pFastBacHTa-TBD, TBD protein expression vector. The mouse IgGI DNA sequences encoding amino acids of CH1-Hinge- CH2-CH3 region was generated form mRNA isolated from the hybridoma (2C12), which produces MAb against HBV surface antigen (sAg). Total mRNA was isolated using TRizo! reagent (Gibco BRU cat. No. 15596-026) and the cDNA of the TBD was generated by RT-PCR using Superscript First-strand Synthesis (Invitrogen Cat. No. 11904-018). The PCR primers contained linker sequences encoding the linker peptide -SRPQGGGS- at lhe 5' terminus, a unique Not I site at the 5' and a unique Hind III restriction site at the 3' end. The resulting cDNA contains (51 Not I )-liπker sequence-CHI (VDKKI)-CH2-CH3-(3] Hind 111). Following digestion with the respective enzymes, the fragment is ligated with pFastBacHTa expression vector plasmid (lπvilrogen) using the same restriction enzyme sites to generate- pFastBacHTa-TBD. The 5! primer used for PCR amplification was (Sense) 5' TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGTGCC CAGG (Seq. ID No. 1) and the 3' primer was (aπtisense) 51 ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG (Seq. ID No 2), which contained the Not I and Hind III sites, respectively. The following is the protocol used for directional cloning. The generated fragment was digested with the respective enzymes, purified on agarose gel and cloned into the vector plasmid. The DNA sequence and the correctness of the ORF were verified by standard sequencing methods. Nucleotide sequence of the ORF of TBD in the plasmid pFASTBacHTa-TBD and the deduced amino acid sequences of the expressed TBD protein from the ORF is shown in Figure 6 (a and b).

Example 18.Expression and purification of TBD Protein, Recombinant bacmids of standardized multiplicity of infection (MOl) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3 x 105 celis/mL and incubated at 27.5 0C with shaking at 138 rpm until the cell density reached 2-3 x 106 cells/mL Recombinant baculovirus was added to the cells. For the expression of TBD the MOI used was 10 pfu/cell. The incubation at 27.50C was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4 0C and used for the purification of the recombinant proteins. TBD protein was expressed in Express Five Insect cells, purified using Ni- NTA affinity chromatography.

Example 19. Construction of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Chimeric Fusion Protein Plasmids The DNA encoding the HBV sAg fragment S1/S2 was generated from the plaεmici pRSETB HBV S1/S2 template using PCR methodology. The primers used were: (sense) 5' GGATCTGTACGACGATGACG (Seq. ID No. 5) and the 3' primer (antjsense) 5' AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (Seq. ID No. 6) containing the restriction enzyme site Not I. The 5' end contained a unique Bam H I site derived from the parent plasmid, which was used for ligations. Amplified DNA was digested with Bam H I/Not I and ligated with pFastBacHTa expression vector to generate the expression plasmid for HBV S1/S2 protein. The fragment was ligated with the plasmid pFastBacHTa -TBD (described in Example 1) following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HBV S1/S2-TBD. This plasmid was used to produce recombinant baculovirus (described in example 10), which expressed the chimeric antigen-TBD fusion protein: 6xHis tag-rTEV protease cleavage site- HBVS1/S2-TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV S1/S2 are shown in Figure 9 (a and b). Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV S1/S2-TBD are shown in Figure S (a and b).

Example 20. Expression and purification of HBV Surface Antigen S1/S2 and HBV S1/S2-TBD Chimeric Fusion Proteins. Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3 x 105 cells/mL and incubated at 27.50C with shaking at 138 rpm until the cell density reached 2-3 x 106 cells/mL Recombinant baculovirus was added to the cells. For the expression of the fusion protein HBV S1/S2-TBD, the MOI was 1 pfu/cell and for S1/S2, 2 pfu/cell were used. The incubation at 27.5 0C was continued for 48 hrs. The cells were harvested by centrifugation at 2,500 rpm for 10 minutes at 4 βC and used for the purification of the recombinant proteins. HBV S1/S2 protein, TBD proteinas well as HBV S1/S2-TBD fusion protein were expressed in High Five™ Insect cells, and subjected to purification using Ni- NTA, as described below. Expression of S1/S2-TBD was performed in High five cells (Trichoplusia πi BTl- Tn-5B1-4) grown in Express Five SFM media. The High Five™ cells were grown in a shaker culture at 27.5 oC unti! the cell density reached 2.5 x 106 cells/ml. Usually, a 250 ml culture is prepared. The culture was infected With CS12 baculovirus at a multiplicity of infection (MOI) of 1pfu/cell and incubated at 27.5oC for 48hrs with shaking. Infected cells are harvested by centrifugation at 4000 x g on a JA-10 (Beckman) rotor for 10 minutes. The cells are stored at -70 oC until purification is performed. For purification, 40 ml of ice-cold lysis buffer (6M guanidine hydrochloride, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCi, 10 mM imidazole, pH 8.0) was added to a frozen cell pellet. The cells are sonicated on ice for 5 pulses at 1 minute per pulse at 78-81 W and stirred at room temperature for 1hour. The lysate is clarified by centrifugation at 25000 x g on a JA-25.50 rotor (Beckman) for 30 min.. Purification was performed on Ni-NTA superflow. A 1.5 X 12 cm column is packed with 3 mi of Ni-NTA superflow and equilibrated with 10 column voiumes of lysis buffer. The clarified lysate is loaded onto the column. First, the column is washed with lysis buffer until the OD280 < 0.01. Next, the column is washed with 6 M guanidine hydrochloride, 0.1M NaH2PO4, 1OmM Tris, 50OmM NaCl, 4OmIVl imidazole, pH 8.0 until the OD2S0 < 0.01. Then the column is washed with 8 M urea, 0.1 M NaH2PO4, 10 mM Tris, 500 mM NaCI, 40 mM imidazole, pH 8.0 until the OD280 < 0.01. Elution is performed with 8 M urea, 0.1M NaH2PO4, 10 mM Tris, 500 mM NaCI, 250 mM imidazole, pH 8.0 and 0.5 ml fractions were collected. The fractions were analyzed by OD280 for protein. HBV S1/S2 and TBD protein fractions were dialyzed against .10 mM sodium phosphate, 0.3 M sodium chloride, pH 8.0. S1/S2-TBD was dialyzed against 8 M urea, 0.1 M NaH2PO4, 10 mM Tris, pH 8.0 with 3 changes and was subjected to further purification as follows. A 1 ml bed of DEAE Sepharose fastflow was equilibrated with 8 M urea, 0.1 M NaH2PO4, 10 mM Tris, pH 8.0. The dialyzed S1/S2-TBD was added to the DEAE Sepharose fast flow and mixed together for 2 hours at room temperature. The mixture was centrifuged at 2500 rpm for 2 min and the supernatant was collected. Purified S1/S2-TBD was subjected to refolding. DEAE purified S1/S2-TBD was reduced by adding 10 mM DTT and incubating for 30min at room temperature. The reduced S1/S2-TBD was dialyzed against 4 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCI7 pH 8,0 at 4 oC for at least 6hrs. The buffer was changed to 2 M urea, 0.1 M lMaH2PO4, 10 mM Tris, 150 mM NaGI, pH 8.0 and dialysis is continued at 4 oC. After al least 6 hrs, the dialysis buffer is changed to 1 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCI, 200 mM L- arginine, 0.5 mM GSSG, pH 8.0 and dialysis was continued at4oC overnight. Following this, the buffer was changed to 0.5 M urea, 0.1 M NaH2PO4, 10 mM Tris, 150 mM NaCl, 200 mM L-arginine, 0.5 mM GSSG1 pH 8.0 and dialysis is continued at 4oC overnight. Finally, the sample was dialyzed against 10 mM NaH2PO4, 150 mM NaCI, pH 8.0 at 4 oC for at least 6 hrs. The last step was repeated 2 more times.

Example 21. Binding of Chimeric Antigens to Maturing DCs The extent of binding of S1/S2-TBD relative to murine IgG1 and lgG2a to maturating DC was compared as a function of time. DCs were isolated at various days of ex vivo culture (from day 1 to day 4) and treated with S1/S2-TBD (10 μg/mL) or with murine IgG1 (clone 2C12) or lgG2a (clone G155-178, 90 μg/mL) for 1 hour at 4 0C. Subsequently, binding was detected with a F(ab')2 anti- mouse IgG conjugated to Alexa 488 as described in Example 16. These experiments clearly demonstrated that S1/S2-TBD bound with high efficiency to the maturing DC.

Example 22. A High Proportion of Maturing DCs Bind Chimeric Antigen S1/S2-TBD A large proportion of maturing DCs bind S1/S2-TBD.The binding of S1/S2- TBD in comparison to murine IgG2a and IgGI was measured. DCs were isolated at day 1 and day 4, and were treated with S1/S2-TBD (10 μg/mL), murine IgGI (clone 2C12), or lgG2a (clone G155-178, 90 μg/ml) for 1 hour at 4 0C. Subsequently, binding was detected with a F(ab')2 anti-mouse IgG conjugated to Alexa 488. The binding of S1/S2-TBD relative to IgGI and lgG2a on DC after 1 and 4 days of culture is shown in Figures 33 and 34. S1/S2-TBD binding was clearly much greater than the binding of either IgGI or lgG2a with more S1/S2- TBD binding evident on day 1 than day 4. Thus, these experiments demonstrated that a large proportion of maturing DCs bind S1/S2-TBD. The proportion of DCs that bind S1/S2-TBD was much greater than either lgG2a or IgGL Furthermore, the degree of binding of S1/S2-TBD was several orders of magnitude greater than that of the immunoglobulins. Example 23. Chimeric Antigen S1/S2-TBD is Internalized by DCs with High Efficiency The uptake of S1/S2-TBD in comparison to murine IgGI and lgG2a was measured as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37 0C for 1 hour and the results are shown in Figure 35. There was a linear increase in the uptake of S1/S2-TBD with concentration. IgGI was internalized at a much lower level and there was very little uptake of lgG2a. Therefore, the chimeric antigen S1/S2-TBD is internalized by the DCs more efficiently than immunoglobulins.

Example 24. Correlation of CD32/CD206 Expression and S1/S2- TBD Binding to Maturing DCs There is a direct correlation between the expression of CD32/CD206 receptors and S1/S2-TBD binding to maturing DCs. Since it was known that murine IgGI binds efficiently to CD32, it was expected that S1/S2-TBD, which contains the murine Fc component of IgGI 1 would also bind CD32, Furthermore, S1/S2-TBD by virtue of its high mannose glycosylation would also be expected to bind to DCs through the CD206 receptor. The dot plots in Figure 36 show S1/S2-TBD binding (10 μg/mL) and CD32 expression as well as S1/S2-TBD binding and CD206 expression. There was a direct correlation between the extent of S1/S2-TBD binding and the degree of CD32 expression, which was relatively heterogeneous, i.e., there was a broad degree of expression. These results demonstrate that S1/S2-TBD binds to CD32, and that the greater the expression of CD32, the greater was the degree of binding of the chimeric antigen S1/S2-TBD. The dot plot of S1/S2-TBD binding and CD206 expression shows that the vast majority of cells expressing CD206 also bound S1/S2-TBD. A small percentage of the cell population was CD206 negative and was consequently negative for S1/S2-TBD binding. Therefore both CD32 and CD206 receptors are involved in the binding of the S1/S2-TBD. Example 25. The Binding and Uptake of S1/S2-TBD is Primarily Via CD32, but CD206 is Involved to a Lesser Extent The uptake of S1/S2-TBD in comparison to murine IgG1 and lgG2a was estimated as a function of concentration on day 4 of DC maturation. The uptake was quantified at 37 0C for 1 hour in the presence and absence of inhibitors of CD32 and CD206 and the results are shown in Figure 37. There was a progressive increase in the binding of the chimeric antigen with its concentration. MAb against mouse Fcγ fragment abolished this binding, whereas mannan, an inhibitor of CD206 receptor binding, had only marginal effect. Therefore, CD32 appears to be the primary receptor involved in the binding and uptake of the chimeric antigen.

Example 26. HBV S1/S2 Antigen Produced in Insect Cells Bind to DCs through CD206 Receptors. The insect cell pathway of protein glycosyiation is different from that of mammalian cells in that proteins synthesized in insect cells undergo giycosylatioπ that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altman, Staudacher, et al 1999), HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylatioπ) and in High Five™ insect cells (high mannose glycosylation). These antigens were compared for their binding to DCs. Glycosylated protein showed better binding and uptake by DCs (Figure 38). Example 27. Ghimeric Antigen S1/S2-TBD Elicited T Cell Responses as Measured by IFNγ Production. The T cell response was greater with S1/S2-TBD treatment than with either of its two components measured individually. DCs were loaded with S1/S2 antigen, TBD, or S1/S2-TBD and presented to T cells in an APA as described in Example 14. T cell stimulation was evaluated by measuring intracellular and secreted IFNγ levels. The results are presented in Figures 39 and 40. The chimeric antigen S1/S2-TBD induced the production of higher IFNγ levels compared to either the IRD or the TBD domain of the molecule when tested alone, at equivalent concentrations. It should be pointed out that 5 μg dose of S1/S2- TBD contains roughly 2.5 μg each of the components.

Example 28. IFN.yProduction Following S1/S2-TBD Antigen Presentation by DCs IFN y production and secretion by CD3+ T cells increased in a concentration dependent manner following S1/S2-TBD antigen presentation by DCs. Purified S1/S2-TBD was used in APAs using human PBMC-derived DCs, and the secreted and intracellular IFNγ levels were measured in T cells following three rounds of antigen presentation. Figure 41 presents intracellular levels and Figure 42 shows the secreted levels. The results are the mean of three estimates. Various concentrations of S1/S2-TBD were tested for the T cell response. The effect of S1/S2-TBD was greater than the tetanus toxoid treatment at similar concentrations. At concentrations lower than 5 μg/mL, the vaccine elicited a concentration dependent increase in lhe production and secretion of IFNγ. The positive response at low concentrations would be beneficial with respect to the dose necessary for vaccination and the cost of manufacturing of the vaccine.

Example 29. Glycosylation of HBV S1/S2 Antigen Imparts Immunogenicϊty to the Antigen and Generates Higher T Cell Responses Glycosylation of HBV S1/S2 elicits increased immunogenicity and T Cell responses. The insect cell pathway of protein glycosylation is different from that of mammaiian cells in that proteins synthesized in insect cells undergo glycosylation that results in high mannose content and a lack of terminal sialic acid residues in the secreted protein (Altrna∏, Staudacher, et al 1999). HBV S1/S2, the antigen component of the chimeric antigen was expressed in both E. coli (no glycosylation) and in High Five insect cells (high mannose glycosylation). These antigens were compared for T cell responses when presented by DCs. Both intracellular and secreted IFNγ levels were measured and the results are presented in Figures 43 and 44. Example 30. Construction of HBV Core antigen and HBV Core- TBD fusion protein expression vectors. HBV produces the core proteins (Core) to encapsidate the replicating genome of the virus. There are two forms of the core one secreted into circulation, also known as the "e" antigen and the capsid forming core protein. The present invention also relates to the generation of expression plasmids to produce the core protein as well as the core antigeπ-TBD fusion protein, in insect cells. The DNA encoding the HBV Core protein was generated from the plasmid pAltHBV991 template using PCR technique. The 5' primer used for the PCR was (sense) 5" TGCGCTACCATGGACATTGACCCTTATAAAG (Seq. ID No. 9) that contains the restriction enzyme Nco I site and the 3' primer used was (antisense) 5' TGTCATTCTGCGGCCΘCGAACATTGAGATTCCCGAGATTGAG (Seq. ID No. 10), containing the restriction enzyme Not I site. The PCR-amplified DNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HBV Core protein or the expression plasmid pFastBacHTa HBV Core-TBD fusion protein. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV core are shown in Figure 15 (a and b). Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HBV Core-TBD are shown in Figure 14 (a and b).

Example 31. Construction of DHBV Surface antigen PreS/S and DHBV PreS/S-TBD fusion protein expression vectors. DHBV has served as a powerful animal model in the development of antiviral therapy for HBV. Pekin ducks, congenially infected with DHBV have been used to study the mechanism of replication of the virus and for the screening of antiviral compounds. The present invention also describes the chimeric DHBV antigen-TBD molecules, which could be used as therapeutic vaccines in DHBV- infected ducks, thus providing a viable animal model for the feasibility studies for HBV therapeutic vaccines. DNA encoding DHBV PreS/S was produced by PCR methods from template plasmid pFastBacHTa PreS/S (University of Alberta) using 5' primer (sense) 5' tattccggattattcataccg (Seq. ID No 11) and the 31 primer (antisense) 5' TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (Seq. ID No 13), containing restriction enzyme Not I site. The unique restriction enzyme site Eco R I, resident on the parent plasmid pFastBacHTa PreS/S was used for directional cloning. Figure 19 shows, schematically DHBV PreS/S-TBD nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV PreS/S are shown in Figure 21 (a and b). Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV PreS/S-TBD are shown in Figure 20.

Example 32. Construction of DHBV Core antigen and DHBV Core-TBD Fusion Protein Vector Plasmids and Expression of Chimeric Antigens. The cDNA coding for DHBV Core was generated by PCR using the following primers. The 5' terminus primer used was (sense) 5' TGCGCTACCATGGATATCAATGCTTCTAGAGCC (Seq. ID No.14), containing the restriction enzyme Nco I site. The 3' terminus primer used was (antisense) 5' TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (Seq. ID No. 15), containing the restriction enzyme Not I site. All other protocols for the production of either the DHBV Core or the fusion protein DHBV Core-TBD are the same as described in previous examples. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV Core are shown in Figure 24 (a and b, respectively). Figure 22 shows a schematic representation of DHBV core-TBD chimeric antigens. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa DHBV Core-TBD are shown in Figure 23 (a and b, respectively). The proteins were expressed using the baculovirus expression system in High Five™ insect ceils. They were purified by Ni-NTA affinity chromatography followed by CM Sepharose ion exchange chromatography.

Example 33. Construction of pFastBacHTa HCV Core(1-191) Antigen and the Chimeric Antigen pFastBacHTa HCV Core(1- 191)-TBD Fusion Protein Vector Plasmids. The DNA encoding the HGV core was generated from the plasrnid pCV- H77C template (University of Alberta) using PCR methodology. The primers used were: (sense) 5' CGGAATTCATGAGCACGAATCCTAAAC (Sequence ID No, 16) containing the unique restriction enzyme site Eco Rl and the 3' primer (antisense) 5' GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (Sequence ID No. 17) containing the unique restriction enzyme site Spe I. Amplified DNA was digested with EcoR l/Spe I and tigated with pFastBacHTa expression vector digested with the same two enzymes. The expression plasmid for HCV core protein was generated with this method. The fragment was ligated with the plasmid pFastBacHTa following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HCV Core. This plasmid was used for the transposition in DHIOBac and the recombinant Bacmids used for Sf9 insect cell transfections. The resulting baculovirus carrying the gene of interest was optimized for MOI and the time for efficient protein expression. The generation of recombinant expression plasmid pFastBacHTa-HCV Core-TBD was achieved through similar protocols. The PCR-ampϋfied DNA was digested with EcoR i/Spe I and the purified fragment was ligated with the plasmid pFastBacHTa-TBD following the digestion with the respective enzymes. This produced the expression plasmid pFastBacHTa HCV Core-TBD, This plasmid was used to produce recombinant baculovirus, which expressed the chimeric antigen-TBD fusion protein: 6xHis tag-rTEV protease cleavage site-HCV Core- TBD. Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HCV Core(1-191) are shown in Figure 45 (a and b). Nucleotide and deduced amino acid sequences from the ORFs of plasmid pFastBacHTa HCV Core(1-191 )-TBD are shown in Figure 46 (a and b).

Example 34. Expression and purification of HCV Core(1-191) Antigen and HCV Core(1-191)-TBD Chimeric Fusion Protein Recombinant bacmids of standardized multiplicity of infection (MOI) were used to infect High Five insect cells. For suspension cultures, cells were seeded at a density of 3 x 105 cells/mL and incubated at 27.5 0C with shaking at 138 rprn until the cell density reached 2-3 x 106 cells/mL Recombinant baculovirus was added to the cells. For HCV core, infections of High Five cells were performed at an MOl=I pfufcell. Cells in suspension were grown to mid-log phase and infected with the recombinant baculovirus at this MOI. These infected cultures were incubated for 48 hours then the cells were harvested. For HCV core-TBD, infections of High Five cells were done at an MOI of 1 pfu/cell and for 72 hours.

Purification of proteins The purification of HCV Core and HCV core-TBD was done under denaturing conditions as follows. The cells were lysed in a buffer containing 6 M Guanidinium HCI, 0.1 M Na2HPO4, 0.01 M Tris-HCI, pH 8.0, 0.01 M Imidazole, (lysis buffer). The suspension was sonicated on ice with 5 pulses of 1 minute per pulse at a power setting of 60 watts, and was mixed at room temperature for 1 hour. The lysate was ceπtrifuged at 10,000 x g for 10 min to remove unbroken cells and cell debris. The supernatant was mixed for 1 hr with Ni-NTA agarose (Qiagen) beads (5 mL/100 ml_ cell lysate), pre-equiljbrated with lysis buffer. Following the mixing step, the beads were loaded on to a column and was washed with a minimum 20 column volumes of 8M Urea, , 0.1 M Na2HPO4, 0.01 M Tris-HCI pH 8.0 0.02 M Imidazole (wash buffer), until the OD280 was <0.01 , The bound protein was eluted in a buffer containing 8M Urea, 0.1 M Na2HPO4, 0.01 M Tris-HCI pH 8f 250 rnM imidazole. HCV core antigen and the fusion protein HCV Core-TBD fusion protein Were expressed in Express Five Insect cells, and purified; coomassie blue-stained HCV core was run on a 12% polyacrylamide gel. Core-TBD was purified and a Western blot using 6-His monoclonal antibody.

Example 35. Construction of pFastBacHTa HCV Core (1-177) antigen and pFastBacHTa HCV Core (1-177)-TBD fusion protein piasmid vectors The DNA coding for HCV core (1-177) was generated by PCR using the following primers. The 5' terminus primer used was (sense) 5OGGAATTCATGAGCACGAATCCTAAAC(Sequence ID No,18), containing the restriction enzyme EcoR I site. The 31 terminus primer used was (antisense) 51 ggactagtccgaagatagagaaagagc (Sequence ID N.19 ), containing the restriction enzyme Spe I site. Following digestion with the two enzymes, the DNA fragment was ligated with plasmid pFastBacHTa to generate pFastBacHTaHCV (Core 1- 177} and with pFastBacHTa-TBD to generate the expression plasmid pFastBacHTaHCV Core (1-177)-TBD. All other protocols forthe production of either the HCV core (1-177) antigen or the chimeric antigen fusion protein HCV core (1-177)-TBD are similar to those as described in Example 19, Nucleotide sequence and the deduced amino acid sequence of 6xHis- rTEVprotease site-HCV Core (1-177) are shown in Figure 47 (a and b). Nucleotide sequence and the deduced amino acid sequence of 6xHis-rTEVprotease site- HCV Core(1-177)-TBD are shown in Figure 48 (a and b).

Example 36. Construction of pFastBacHTa HCV NS5A antigen and pFastBacHTa HCV NS5A-TBD fusion protein expression vector PIasmids The DNA encoding the HCV NS5A fragment was generated from the plasmid pCV-H77C(University of Alberta) template using PCR methodology. The 5' primer used form the PCR was (sense) 5'CCGGAATTCTCCGGTTCCTGGCTAAGG(Sequence ID No.20 ) containing the restriction enzyme EcoR I site. The PCR primer for 3! terminus was (antisense) 5'GGACTAGTCCGCACACGACATCTTCCGT (Sequence ID No.21) containing the restriction enzyme Spe I site. Amplified DNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate either the expression plasmid for HCV NS5A or it was ligated with the expression plasmid pFastBacHTa -TBD to generate the expression plasmid pFastBacHTa HCV NS5A-TBD fusion protein. Nucleotide sequence and the deduced amino acid sequence of 6xHis- rTEVprotease site-HCV NS5A are shown in Figure 49 (a and b). Nucleotide sequence and the deduced amino acid sequence of 6-Hϊs-rTEVprotease site-HCV NS5A-TBD are shown in Figure 50 (a and b).

Example 37. Construction of pFastBacHTa HCV E1 antigen and pFastBacHTa HCV E1-TBD fusion protein expression vectors Plasmid pFastBacHTa HCV E1 and pFastBacHTa HCV E1-TBD which are used to express HCV envelope protein E1 and the respective chimeric antigen E 1-TBQ fusion protein were generated as follows Tile DNKSi1eøcoc&ng Sje E-1 protein was generatedirom-theplasmfd p"CV-H77C template using PGR technique. The 5' primer used for the PCR was (sense) 5'CCGGAATTCTACCAAGTGCGCAATTCCT (Sequence !D No.22) which contains the restriction enzyme EcoR I site and the 3' primer used was (antise∏se) 5'GGACTAGTCCTTCCGCGTCGACGCCGGCAAAT (Sequence ID No.23), containing the restriction enzyme Spe I site. The PCR-amplified cDNA was digested with the respective enzymes and ligated with pFastBacHTa expression vector to generate the expression plasmid pFastBacHTa HCV E1 for the expression of HCV E1 protein. The digested DNA fragment was ligated with pFastBacHTa -TBD to generate the plasmid pFastBacHTa HCV E1-TBD which was used to express HCV E-TBD fusion protein. Figure 51 (a and b) show lhe nucleotide and the deduced amino acid sequences of 6xHis-rTEVprotease site-HCV E1 in the open reading frame of the expression plasmid. Figure 52 (a and b) show nucleotide and the deduced amino acid sequences of 6-His-rTEVprotease site-HCV E1-TBD chimeric antigen fusion protein.

Example 38, Construction of pFastBacHTa HOV E2 antigen and pFastBacHTa HCV E2-TBD fusion protein expression vectors The DNA encoding HCV E2 antigen was produced by PCR from a plasmid pCV-H77C. The 51 primer used for the PCR was (sense) 5' GCGGAATTCACCCACGTCACCGGGGGAAATGC (Sequence ID No.24) containing a unique restriction enzyme site EcoR I that is used for directional cloning. The 31 primer used was (antisense) 5' GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (Sequence ID No.25) containing the restriction enzyme Spe I site. Following PCR amplification, the fragment was digested with the restriction enzymes EcoR I and Spe I an the DNA fragment was purified and ligated with the expression plasmid pFastBacHTa at the respective sites to produce pFastBacHTa HCV E2, which expressed the E2 antigen. The same fragment was also used to ligate with pFastBacHTa-TBD to generate the expression plasmid pFastBacHTa HCV E2-TBD, which expressed the chimeric antigen fusion protein HCV E2-TBD. The production of bacuiovirus stocks from these plasmids and the expression of the E2 and E2-TBD in High Five insect cells were done as described in previous examples. Figure 53 (a and b) show the nucleotide and the deduced amino acid sequences of 6xHis-rTEVρrotease site-HCV E2 in the open reading frame of the expression plasmid. Figure 54 (a and b) show nucleotide and the deduced amino acid sequences of 6xHis-rTEVprotease site-HCV E2-TBD chimeric antigen fusion protein.

Example 39. Construction of pFastBacHTa HCV E1/E2 antigen and pFastBacHTa HCV E1/E2-TBD fusion protein expression vectors DNA encoding HCV E1/E2 was produced by PCR methods from the plasmid pCV-H77C using 5' primer (sense) 5' CCGGAATTCTACCAAGTGCGCAATTCCT (Sequence ID No.26 ) containing the restriction enzyme site EcoR I and the 31 primer (antisense) 5' GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (Sequence ID No.78) containing the restriction enzyme site Spe I. Restriction enzyme-digested DNA fragment was cloned into the respective sites of either pFastBacHTa to generate pFastBacHTaHCV E1/E2 or pFastBacHTa-TBD to generate pFastBacHTa HCV E1/E2-TBD. All other protocols for the production of either the E1/E2 antigen or the fusion protein E1/E2-TBD are the same as described in the example above. Figure 55 (a and b) show the nucleotide and the deduced amino acid sequences of 6xHis-rTEVprotease site-HCV E1/E2 in the open reading frame of the expression plasmid. Figure 56 (a and b) show nucleotide and the deduced amino acid sequences of 6xHis-rTEVprotease site-HCV E1/E2-TBD chimeric antigen fusion protein.

Conclusions from Examples 1-39 1. A new class of Chimeric Antigens is designed in order to incorporate antigen and antibody components in the molecule. 2. Antigen components can be derived from infectious agents or cancer antigen, 3. Antibody components are xenotypic, of murine origin, in the case of human chimeric antigens. 4. Chimeric antigen fusion proteins, TBD and the respective antigens have been produced by recombinant techniques. 5. Chimeric antigen fusion proteins, TBD and the respective antigens have been produced (expressed) in a heterologous expression system (Insect cells). 6. By virtue of the expression in insect cells, the proteins have high maπnose glycosylation. 7. Chimeric antigens include fusion proteins from HBV surface antigens (S1/S2), HBV Core and TBD, derived from the murine MAb 2C12. 8. Chimeric antigens include fusion proteins of DHBV surface antigens PreS, PreS/S, Core and TBD. 9. The following antigens from HCV have been cloned and expressed in insect cell expression systems. HCV Core (1-191), HCV core (1-177), HCV NS5A, HCV E1 , HCV E2, HCV E1/E2. 10. Chimeric antigen fusion proteins of HCV include HCV Core (1-191), HCV core (1-177), HCV NS5A, HCV E1, HCV E2, HCV E1/E2 and TBD. 11. Chimeric antigen fusion protein HCV Core (1-191 )-TBD and HCV Core (1- 191) have been expressed and purified. 12. Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD and HBV surface antigen S1/S2 has been purified. 13. The fusion protein binds to antigen presenting cells (Human PBMC-derived DCs) and are taken up by the DCs. 14. Binding and uptake is via Fey receptors CD 32 and possibly through CD 64. 15. Binding and uptake can occur via CD 206, the Mannose Macrophage receptor. 16. High mannose Glycosylation augments the binding and uptake of the antigens via CD206. 17. Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD enhances the antigen presentation by professional antigen presenting cells (DCs). 18.DCs loaded with the Chimeric antigen fusion protein HBV surface antigen S1/S2-TBD, on presentation to T cells elicit an immune response. 19.The immune response can be measured as an increase in intracellular and secreted IFNγ.

Example 40. Chimeric antigen Hepatitis B Therapeutic Vaccine The primary goal in antiviral therapy is the complete elimination of the infectious virus. In the case of chronic hepatitis B, this will result in the eradication of hepatitis B viremia, the arrest of progressive liver injury, normalization of liver transaminase activity, resolution of hepatic inflammation, elimination of HBV cccDNA reservoir, and improve the quality of life of the patient. Two forms of antiviral therapies are currently in use for the treatment of chronic hepatitis B infections. First, antiviral compounds, particularly nucleoside analogues, which are DNA chain terminators, suppress the viral replication resulting in a decrease in HBV DNA and HBV antigens. The effectiveness of the antiviral compound depends on the level of immune help from the host. The second therapy involves the use of immune modulators, such as interferons (e.g., IFNα2-b), to stimulate the immune system into mounting a generalized humoral and cellular response against the viral infection. The most widely used antiviral nucleoside agent is lamivudine, a cytosine analogue that acts as a chain terminator and inhibits HBV replication. The drug is well tolerated and has marked virus-suppressive activity in the majority of patients; complete clearance of the virus occurs If the patient has elevated levels of liver inflammatory enzymes. This suggests that a strong involvement of the host immune system is needed to clear the HBV infection. While lamis/udine suppresses HBV replication in HBV carriers, replication recurs if therapy is stopped. The emergence of resistant mutants also is a possibility. Interferons are biologic response modifiers that have a variety of therapeutic activities, including antiviral, immunomodulatory, and antiproliferative effects. They enhance T cell helper activity, cause maturation of B lymphocytes, inhibit T cell suppressors, and enhance HLA type I expression. While interferons have only mild to moderate virus-suppressive activities, they induce a generalized, non-specific but clinically important immune response in receptive individuals. The indications for interferon therapy are specific: patients must be HBeAg- positive, have detectable HBV DNA in the serum, and have a serum ALT level double the upper limit of normal. When these patients are treated with a standard course of interferon-alpha therapy (30-35 MU interferon/week for 16-26 weeks), the response rate is 40-50%. A response is defined as loss of HBeAg, development of anti-HBe, loss of HBV DNA (by non-PCR assays), and normalization of ALT. A sustained response encompasses the foregoing outcomes plus generating effective immune responses. The responses are usually durable, are associated with improvement in liver histology, and produce a better long-term outcome, e.g., with fewer patients progressing to cirrhosis and/or hepatocellular carcinoma. For most chronic hepatitis B patients, monotherapy with a standard 16 week course of interferon-alpha or a one year course of lamivudine is effective in only 30-40% of patients. It is reasonable to assume that combining the antiviral effect of one drug with a second agent promoting immune modulation may improve the response rate beyond that seen with either agent alone. However, in order to produce more effective and specific immune responses against chronic hepatitis B infections than are currently achievable with current biological response modifiers, an agent that induces highly specific cellular immune responses directed against cells harboring the viruses, viral antigens or cccDNA must be employed. Such an agent is the Chimeric antigens described in the present invention. Chimeric antigens have been shown to induce specific anti-HBV S1/S2 cytotoxic T-cell functions ex vivo, to induce anti-HBV S1/S2 humoral responses in mice, and reduce the viral load in ducks infected with the hepatitis B duck virus (DHBV). The use of a chimeric antigen in combination with nucleoside analogue(s) may prove to be highly efficacious in inducing sustained responses in the treatment of patients suffering from chronic hepatitis B. The mechanisms of action of the two agents used in combination may produce synergistic effects in treatment of hepatitis B patients in that (a) the nucleoside analogue would reduce the number of hepatitis B virons circulating in the blood and hence reduce the antigenic load that the immune system must eliminate, and (b) the Chimeric antigen has the potential to induce highly specific cellular immune responses that would eliminate cells which harbor HBV, HBV antigens and cccDNA. Furthermore, the immune mechanism of action of the chimeric antigen may also minimize the toxicity of nucleoside analogues by permitting lower doses of the drug to be administered over a shorter period of time. A reduction in the length of time to achieve a sustained response may reduce the chances of development of drug- resistant viral mutants normally induced by nucleoside analogue antiviral agents when used alone in long term therapy. The use of the chimeric antigen in combination with a nucleoside analogue in the LreaLment of patients suffering from chronic hepatitis B is a preferred combination for the treatment of chronic HBV infections. The chimeric antigens and a nucleoside analogue are expected to work synergistically to produce an effective clinical response in hepatitis B patients. Since nucleoside analogues effectively reduce the number of hepatitis B viruses circulating in the blood, the antigenic load with which the immune system must cope is thus reduced but not completely eliminated. The chimeric antigen hepatitis B vaccine has the potential to induce a highly specific cellular immune response that would remove the cells that harbor replicating hepatitis B viruses that are shed into the circulation; the cytotoxic immune response would thus further reduce the circulating viral load. Furthermore, the use of the combination therapy of chimeric antigen therapeutic vaccine and a nucleoside analogue would minimize the toxicity of the nucleoside analogue by permitting a lower dose of the drug to be administered over a shorter period of time. A reduction in the length of time to achieve a clinical response reduces the chances of development of drug-resistant viral mutants that are normally induced by antiviral agents (such as lamivudine) when used alone in long term therapy. In brief, combination therapy with the hepatitis B chimeric antigen (eg.S1/S2-TBD) and a nucleoside analogue in the treatment of hepatitis B has the potential to effect a complete cure of chronic HBV infection. The goals of treatment of chronic hepatitis C include eradication of the HCV infection, improvement or normalization of liver histology, prevention of progression of the viral liver infection to cirrhosis and hepatocellular carcinoma, extension of patient survival, improvement of the quality of life, and a reduction in the size of the infectious pool of hepatitis C virus patients in order to reduce the wide spread transmission of the disease. Two forms of treatment of chronic hepatitis C are currently in use: pegylated interferon alpha used alone and conventional or pegylated interferon alpha used in combination with ribavirin. Ribavirin is a purine nucleoside analogue that as monotherapy has little effect on HCV viremia, despite the fact that it significantly reduces serum ALT levels in some patients. While the exact nature of the synergism of ribavirin and interferon has not been elucidated, the efficacy of the combination exceeds that of either agent used alone. While the mechanism of action of ribavirin in hepatitis C infection is not understood, a number of mechanisms have been proposed including: (a) the enhancement of host T cell-mediated immunity against viral infection through switching the T-cell phenotype from type 2 to type 1 ; (b) the inhibition of the host enzyme inosine monophosphate dehydrogenase (IMPDH); (c) the direct inhibition of HCV, including NS5B-encoded RNA-dependent RNA polymerase (RdRp); and (d) its action as an RNA mutagen that drives a rapidly mutating RNA virus over the threshold to "error catastrophe." Interferons are biologic response modifiers that have a variety of therapeutic activities including antiviral, immunomodulatory, and antiproliferative effects. They enhance T-cell helper activity, cause maturation of B lymphocytes, inhibit T-cell suppressors, and enhance HLA type I expression. While interferons have only mild to moderate virus-suppressive activities, they induce a generalized, non-specific but clinically important immune response in receptive individuals that reduces viral levels. The treatment options for previously untreated patients with hepatitis C include pegylated interferon monotherapy and a combination of conventional or pegylated interferon with ribavirin. The overall sustained response rate (SR) of ribavirin combined with conventional interferon-alpha 2b therapy for 48 weeks is about 40%. The SR for patients infected with genotype 2 or 3 patients is about 60%, whereas the SR is about 30% for patients infected with genotype 1. However, the combination is associated with significantly more side effects than conventional interferon alone. Up 20% of patients receiving the combination required a reduction of dose or discontinuation of therapy because of the side effects. Nevertheless, the combination represents a significant improvement in the treatment of chronic hepatitis C and has become the current standard of care. Conventional interferoπ-alpha is rapidly cleared from the circulation by the kidneys. During the first 12 hours after interferon administration, interferon-alpha causes the viral levels to decrease significantly, but after that time, the viral levels begin to increase because of low blood levels of interferon. Sustained viral suppression can be achieved by the administration of pegylated interferon, which is administered only once a week and produces constant blood levels of interferon for 7 days. Thus, there is no need for daily dosing that is required with conventional interferon. The overall SR in previously untreated chronic hepatitis C patients who received pegylated Interferon for48 weeks was about 39%, which is comparable to the previously reported SR with combined conventional interferon and ribavirin combination (Rebetron), In studies comparing combined pegylated interferon and ribavirin to the Rebetron combination, the pegylated interferon and ribavirin combinations appeared to be more effective, especially in patients infected with genotype 1. With the latter genotype, the sustained response rate (SR) was about 45% for the pegylated interferon and ribavirin combination compared with about 35% for the Rebetron combination. As expected, the overall response rates in genotype 2 or 3 patients for each of these treatment groups were better than those obtained with genotype 1 patients (SR 60% to 80%). In a trial comparing Rebetron with varying doses of PEG-lπtron and ribavirin, the patients were predominately male Caucasians, more frequently infected with HCV genotype 1 , and had a mean age of 44 years. The best- sustained virologic response of 54% was obtained with PEG-lntron plus ribavirin given for 48 weeks. Patients with HCV genotype 1 had an SR of about 40%, while patients with HCV genotypes 2 and 3 after 48 weeks of therapy had the best sustained virologic response rate of approximately 80%, regardless of whether lhey received Rebetron or PEG-lntron and ribavirin. Adverse events in the PEG- Introπ plus ribavirin group that were more than 10% more frequent than in the standard interferon and ribavirin group included fever, nausea, and injection site reaction. Twelve percent of patients on PEG-lntron plus ribavirin required dose modifications due to an adverse event, while 34% had dose modifications due to a lab abnormality. In another large, multinational, multicenter trial of Pegasys plus ribavirin, the three arms of the study were Pegasys plus placebo, standard interferon alfa- 2b plus ribavirin (Rebetron), and Pegasys plus ribavirin, which were all given for 48 weeks. There were 1 ,149 predominantly male patients in the trial with an average age of about 40; 12% to 15% of patients had cirrhosis and approximately two-thirds had infection with HCV genotype 1. The overall sustained virologic response with Pegasys plus ribavirin was 56% compared to 30% in the Pegasys plus placebo group, and 45% in the standard interferon alfa-2b plus ribavirin (Rebetron) group. Patients with HCV genotype 1 had a 46% SR with Pegasys plus ribavirin, while patients with genotypes 2 and 3 had a 76% SR. Fever, myalgia, rigors, and depression were relatively less frequent with Pegasys plus ribavirin compared to standard interferon alfa-2b plus ribavirin (Rebetron). In the Pegasys plus ribavirin group, the rate of discontinuation of therapy due to an adverse event was 7% and due to a lab abnormality was 3%. Despite vigorous treatment with the current standard combination therapy of interferoπ-alpha and ribavirin, there are still a large proportion of patients with chronic HCV who do not respond. In order to produce an improved sustained response rate in the treatment of chronic hepatitis C infection, an agent that induces highly specific cellular immune responses directed against cells harboring the hepatitis C viruses must be employed. Such an agent is the chimeric antigen hepatitis C vaccine. There is no prophylactic vaccine available to prevent new HCV infections. The attempts to develop preventative vaccines using the envelope proteins of HCV have been unsuccessful due to the high rate of mutation of the virus. Chimeric antigens described in the present invention incorporating immunological attributes of HBV antigen and xenotypic monoclonal antibody have been shown to elicit a strong humoral response against viral antigen in animal models. Chimeric antigens described in the present invention incorporating HCV antigens and xenotypic monoclonal antibody fragment could be used for prophylaxis. The current therapy for chronic HCV infection involves the use of the combination of a nucleoside analogue ribavirin along with interferon. This treatment is not effective against all of the HCV subtypes and there have considerable adverse side effects with the use of interferon. A combination of an HCV antiviral such as ribavirin along with the HCV chimeric antigens described herein will be able to produce antigen-specific cellular as well as humoral immune response and thus clear HCV infection in chronically infected patients. This will be an improvement from the general immune response produced by interferon and the present invention will have a reduced or no adverse side effect profile.

Description of Artificial Sequence: Seq. ID No. 1 : TBD amplification Primer 5' 5' TGTCATTCTGCGGCCGCAAGGCGGCGGATCCGTGGACAAGAAAATTGT GCCCAGG (sense) Type: DNA Length: 55 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.2 : TBD amplification primer 3' 5' ACGAATCAAGCTTTGCAGCCCAGGAGAGTGGGAGAG(antisense) Type: DNA Length: 36 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.3: pFastBac 5' Sequencing primer 5' TATTCCGGATTATTCATACCG (sense) Type: DNA Length: 21 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.4 :pFastBac 3' sequencing primer 5'CTCTACAAATGTGGTATGGC (antisense) Type: DNA Length: 20 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 5 : HBV S1/S2 5' PCR amplification primer 5' GGATCTGTACGACGATGACG (sense) Type: DNA Length: 20 Nature; Artificial sequence

Description of Artificial Sequence; Seq. ID No.6 : HBV S1/S2 3' PCR amplification primer 5J AGTCATTCTGCGGCCGCGAGTTCGTCACAGGGTCCCCGG (antisense) Type: DNA Length:39 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 7: HBV S1/S2/S 51 PCR Amplification Primer 5' GATAAGGATCCTATGGGAGGTTGGTCATCAAAAC (sense) Type: DNA Length; 34 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 8; HBV S1/S2/S 3' PCR Amplification Primer 51 GTCATACTGCGGCCGCGAAATGTATACCCAGAGACAAAAG (antisense) Type: DNA Length: 40 Nature; Artificial sequence Description of Artificial Sequence: Seq. ID No, 9: HBV Core 5' PCR Amplification Primer 5' TGCGCTACCATGGACATTGACCCTTATAAAG (sense) Type: DNA Length: 31 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 10: HBV Core 31 PCR Amplification Primer 5' TGTCATTCTGCGGCCGCGAACATTGAGATTCCCGAGATTGAG (antisense) Type: DNA Length: 42 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 11: DHBV PreS/S and PreS PCR 51 Amplification Primer 5' tattccggattattcataccg (sense) Type: DNA Length: 21 Nature: Artificial sequence

Description of Artificial Sequence: Seq, ID No. 12 : DHBV PreS PCR 3" Amplification Primer 5' TGTCATTCTGCGGCCGCGTTTTCTTCTTCAAGGGGGGAGT (aπtisense) Type: DNA Length: 40 Nature; Artificial sequence

Description of Artificial Sequence: Seq. ID No. 13 : DHBV PreS/S PCR 3' Amplification Primer 5' TGTCATTCAGCGGCCGCGAACTCTTGTAAAAAAGAGCAGA (antisense) Type: DNA Length: 40 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 14: DHBV Core PCR 5" Amplification Primer 5' TGCGCTACCATGGATATCAATGCTTCTAGAGCC (sense) Type: DNA Length: 33 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 15 DHBV Core PCR 3' Amplification Primer 5' TGTCATTCTGCGGCCGCGATTTCCTAGGCGAGGGAGATCTATG (aπtisense) Type: DNA Length: 43 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.16: HCV Core(1-191) PCR 5' Amplification Primer 51 CGGAATTCATGAGCACGAATCCTAAAC (sense) Type: DNA Length: 27 Nature; Artificial sequence

Description of Artificial Sequence: Seq. ID No.17 : HCV Core(1-191) PCR 3" Amplification Primer 5' GGACTAGTCCGGCTGAAGCGGGCACAGTCAGGCAAGAG (a∏tisense) Type: DNA Length: 38 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.18 : HCV Core (1-177) PCR 5' Amplification Primer 5' CGGAATTCATGAGCACGAATCCTAAAC (sense) Type: DNA Length: 27 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No. 19 : PCR HCV Core (1-177) 3' Amplification Primer 5' ggactagtccgaagatagagaaagagc (antisense) Type; DNA Length: 27 Nature: Artificial sequence Description of Artificial Sequence: Seq. ID No.20 : HCV NS5A antigen PCR 5' Amplification Primer 5' CCGGAATTCTCCGGTTCCTGGCTAAGG (sense) Type: DNA Length; 27 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.21 : HCV NS5A antigen PCR 3' Amplification Primer 5' GGACTAGTCCGCACACGACATCTTCCGT (antisense) Type: DNA Length: 28 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.22 : HCV E1 antigen PCR 5* Amplification Primer 51 CCGGAATTCTACCAAGTGCGCAATTCCT (sense) Type: DNA Length: 28 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No,23 : HCV E1 antigen PCR 31 Amplification Primer 5: GGACTAGTCCTTCCGCGTCGACGCCGGCAAAT (antisense) Type1 DNA Length: 32 Nature: Artificial sequence

Description of Artificial Sequence: Seq. ID No.24: HCV E2 antigen PCR 5' Amplification Primer 5' GCGGAATTCACCCACGTCACCGGGGGAAATGC (sense) Type: DNA Length: 32 Nature: Artificial sequence Description of Artificial Sequence: Seq, ID No.25 : HCV E2 antigen PCR 3' Amplification Primer 5' GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (aπtisense) Type: DNA Length: 35 Nature: Artificial sequence

Description of Artificial Sequence: Seq. iD No.26 : HCV E1/E2 antigen PCR 5' Amplification Primer 51 CCGGAATTCTACCAAGTGCGCAATTCCT (sense) Type: DNA Length: 28 Nature: Artificial sequence

Description of Artificial Sequence; Seq. ID No.27 ; HCV E1/E2 antigen PCR 3' Amplification Primer 5' GGACTAGTCCAGCCGCCTCCGCTTGGGATATGAGT (sense) Type: DNA Length: 35 Nature: Artificial sequence

REFERENCES

Ba∏chereau, J. and R. M. Steinman (1998). "Dendritic cells and the control of immunity.1' Nature 392(6673): 245-52.

Beasley, R. P. (1988). "Hepatitis B virus. The major etiology of hepatocellular carcinoma." Cancer 61 (10): 1942-56,

Campton, K-, W. Ding, et al, (2000). "Tumor antigen presentation by dermal antigen-presenting cells." J Invest Dermatol 115(1): 57-61. Clarke, B. (1997). "Molecular virology of hepatitis C virus." J Gen Virol 78(10): 2397-410.

Donnelly, J. J., J- B. Ulmer, et al. (1997). "DNA vaccines." Annu Rev Immunol 15: 617^8.

Fong, L. and E. 6. Engleman (2000). "Dendritic cells in cancer immunotherapy," Annu Rev Immunol 18: 245-73.

Hilgerε, L. A., G. Lejeu∏e, et al. (1999). "Sulfolipo-cyclodextrin in squalane-in- water as a novel and safe vaccine adjuvant." Vaccine 17(3): 219-28.

Lai, W. C. and M. Bennett (1998). "DNA vaccines." Crit Rev Immunol 18(5): 449- 84.

Larsson, M., J. F. Fonteneau, et al. (2001). "Dendritic cells resurrect antigens from dead cells." Trends Immunol 22(3): 141-8.

Laupeze, B,, O. Fardel, et al. (1999). "Differential expression of major histocompatibility complex class Ia1 Ib, and Il molecules on monocytes-derived dendritic and macrophagic cells." Hum Immunol 60(7): 591-7.

Lorenz, M. G., J. A. Kantor, et al. (1999). "Antkumor immunity elicited by a recombinant vaccinia virus expressing CD70 (CD27L)." Hum Gene Ther 10(7): 1095-103.

Mason, W. S., G. Seal, et al. (1980). "Virus of Pekin ducks with structural and biological relatedness to human hepatitis B virus." J Virol 36(3): 829-36.

Newman, K. D., P. Elamanchili, et al. (2002). "Uptake of poly(D,L-!actic-co-glycolic acid) microspheres by antigen-presenting cells in vivo." J Biomed Mater Res 60(3): 480-6. Newman, K. D., G. S. Kwo∏, et al. (2000). "Cytoplasmic delivery of a macromolecular fluorescent probe by po!y(d, l-lactic-co-glycolic acid) microspheres." J Biomed Mater Res 50(4): 591-7.

Newman, K. D., J. Samuel, et al. (1998). "Ovalbumin peptide encapsulated in poly{d,l lactic-co-glycolic acid) microspheres is capable of inducing a T helper type 1 immune response." J Control Release 54{1): 49-59.

Regπauit, A., D. Lankar, et al. (1999). "Fcgamma receplor-mediated induction of dendritic cell maturation and major histocompatibility complex class l-restricted antigen presentation after immune complex internalization." J Exp Med 189(2): 371-80.

Saito, I., T. Miyamura, et al. (1990). "Hepatitis C virus infection is associated with the development of hepatocellular carcinoma." Proc Natl Acad Sci USA 87(17): 6547-9.

Sprengel, R., E. F. Kaleta, et al. (1988). "Isolation and characterization of a hepatitis B virus endemic in herons." J Virol 62(10): 3832-9.

Steinman, R. M., K. Inaba, et al. (1999). "Antigen capture, processing, and presentation by dendritic celis; recent cell biological studies." Hum Immunol 60(7): 562-7,

Summers, J.r J. M. Smolec, et al. (1978). "A virus similar to human hepatitis B virus associated with hepatitis and hepatoma in woodchucks." Proc Natl Acad Sci U S A 75(9): 4533-7.

Tan, S. L. and M. G. Katze (2001). "How hepatitis C virus counteracts the interferon response: the jury is still out on NS5A." Virology 284(1): 1-12.

Tarte, K. and B. Klein (1999). "Dendritic cell-based vaccine: a promising approach for cancer immunotherapy." Leukemia 13(5): 653-63. Wen, Y. M., D. Qu, et al. (1999). "Antigen-antibody complex as therapeutic vaccine for viral hepatitis B." lnt Rev Immunol 18(3): 251-8. AILman, F., Staudacher, E., Wilson, I.B.H and Marz, L (1999) Insect Cells as Hosts for the Expression of Recombinant Glycoproteins. Glycocoπjugate Journal 16: 109-123.

Wild, C. P. and A. J. Hall (2000). "Primary prevention of hepatocellular carcinoma in developing countries." Mutat Res 462(2-3): 381-93.

Berlyn, KA, et al., Clin. Immunol., 101 (3):276-2S3 (2001).

Sambrook, J and Russell, D.W (2001) in Molecular Cloning , A Laboratory Manual. Cold Spring Harbor Press.

M Lagget, M Rizzetto, Current pharmacotherapy for the treatment of chronic hepatitis B. Expert Opinion on Pharmacotherapy, 2003, vol. 4, no. 10, pp. 1821 - 1827