The present invention relates to citrullinated peptide fragments of GRP78 for diagnosis of type 1 diabetes. Furthermore, the present invention relates to citrullinated GRP78 or fragments thereof for vaccination treatment against type 1 diabetes.

BACKGROUND OF THE INVENTION

Type 1 diabetes (T1D) is an autoimmune endocrine disease characterized by T-cell- mediated destruction of insulin-producing pancreatic beta-cells, causing insulin deficiency [Atkinson MA, Maclaren NK (1994) N Engl J Med 331 : 1428-1436; Coppieters KT, et al. (2012) J Exp Med 209 : 51-60] . Loss of central and peripheral tolerance towards beta-cell antigens (Ags) is proposed as the mechanism underlying T1D, but the beta-cells themselves participate in triggering and/or propagating the autoimmune attack, leading to a dialogue with infiltrating immune cells that may amplify the local inflammation (insulitis) in genetically predisposed individuals [Eizirik DL, et al. (2009) Nat Rev Endocrinol 5 : 219-226] . Insulin (or pro-insulin) is probably the primary autoAg in T1D [Daniel D, et al. (1995) Eur J Immunol 25 : 1056-1062; Lieberman SM, DiLorenzo TP (2003) Tissue Antigens 62: 359-377], but Ag spreading occurs as the autoimmune assault progresses, with autoantibodies and/or autoreactive T-cells appearing against several non-beta-cell- specific antigens, such as glutamic acid decarboxylase (GAD65) [Baekkeskov S, et al. (1990) Nature 347 : 151-156; Kaufman DL, et al. (1992) J Clin Invest 89 : 283- 292], islet Ag 2 [Kawasaki E, et al. (1996) Diabetes 45 : 1344-1349; Morran MP, et al. (2010) Endocrinology 151 : 2528-2537], heat shock protein 60 (HSP60) [Birk OS, et a/. (1996) J Autoimmun 9 : 159-166] and chromogranin A [Stadinski BD, et al. (2010) Nat Immunol 11 : 225-231] .

During insulitis, the local production of inflammatory mediators, such as interleukin-lbeta (IL-Ιβ), interferon-gamma (IFNy) and tumor necrosis factor- alpha (TNF-a) [Cnop M, et al. (2005) Diabetes 54 Suppl 2: S97-107], triggers beta-cell oxidative and endoplasmatic reticulum (ER) stress. These, and other signals, such as apoptosis, may lead to post-translational modifications (PTMs) of beta-cell proteins [Ortis F, et a/. (2010) Diabetes 59 : 358-374; D'Hertog W, et a/. (2007). Mol Cell Proteomics 6: 2180-2199; D'Hertog W, et al. (2010) J Proteome Res 9 : 5142-5152; McGinty JW, et a/. (2014) Diabetes 63 : 3033-3040] . In different autoimmune diseases, such as rheumatoid arthritis (RA), multiple sclerosis (MS), systemic lupus erythematosus (SLE) and celiac disease, such post-translationally modified proteins are known to behave as autoAgs [Bicker KL, Thompson PR (2013) Biopolymers 99: 155-163; Sollid LM, Jabri B (2011) Curr Opin Immunol 23: 732- 738], but until today evidence for a role of modified proteins in the pathogenesis of T1D is only starting to reveal [Dunne JL, et al. (2012) Diabetes 61: 1907-1914; Delong T, et al. (2012) Diabetes 61: 3239-3246; van Lummel M, et al. (2014) Diabetes 63: 237-247] .

Such PTMs of beta-cell autoAgs would provide a novel hypothesis to understand how autoreactive T-cells can escape thymic tolerization and cause destruction of beta-cells. In addition, tissue-specific PTMs would also provide an explanation on how a non-beta-cell-specific protein can become a beta-cell-specific target Ag. Next to this, a lack of tolerance to modified autoAgs can be caused by differences in Ag processing between the native and modified autoAgs, giving rise to different epitopes. Indeed, the recognition and cleavage by certain proteases can be influenced by the PTM of an amino acid residue which will influence the Ag peptides that are generated. Independently of this, a specific post-translationally modified epitope can engender differential binding to certain HLA-haplotypes, as compared to its native counterpart. This can lead to altered T-cell recognition, determining the strength of the immune response to modified peptides [Scally SW, et al. (2013) J Exp Med 210: 2569-2582] .

One kind of modification that has received much attention in regard to autoAg generation is citrullination, an enzymatic modification implying the conversion of arginine (Arg) into citrulline (Cit). This is most clear from studies in RA, but also from MS and SLE, where citrullination has been described to be involved in the generation of autoAgs. In RA, several citrullinated autoAgs have been identified, most of them being ubiquitously expressed proteins, such as filaggrin, vimentin, glucose-regulated protein 78 29.(GRP78), fibrinogen and type II collagen [Young BJ, et al. (1979) Br Med J 2:97-99; Shoda H, et al. (2011) Arthritis Res Ther 13: R191; Masson-Bessiere C, et al. (2001) J Immunol 166:4177-4184; Uysal H, et al. (2009). J Exp Med 206:449-462; Bang H, et al. (2007) Arthritis Rheum 56: 2503-2511; Schellekens GA, et al. (1998) J Clin Invest 101: 273-281] . Moreover, increased levels of anti-citrullinated protein antibodies (ACPAs) are detectable in synovial joint fluid from RA patients and diagnostic kits for prediction of RA have been developed based on the detection of ACPAs, making use of cyclic citrullinated peptides (CCPs) [Mimori T (2005). Intern Med Tokyo Jpn 44: 1122- 1126] . Similarly, in MS citrullinated myelin proteins have been suggested as autoAgs [Musse AA, Harauz G (2007) Int Rev Neurobiol 79 : 149-172] . Of interest, citrullinated peptide epitopes have been described to be better accommodated in the HLA-pocket of HLA-DR4 type individuals, providing a molecular basis for the genetic predisposition of HLA-DR4 individuals to RA [Scally SW, et al. (2013) J Exp Med 210: 2569-2582] .

Recently, first evidence for a role of citrullination in TID was reported by McGinty and colleagues, who showed that citrullinated GAD65 is recognized by CD4 ⁺ T cells from TID patients. This enhanced T-cell reactivity was due to a better binding of these modified GAD65 peptides to HLA-DR4 haplotypes [McGinty JW, et al. (2014) Diabetes 63 : 3033-3040] .

Our group has recently shown that the endoplasmic reticulum chaperone GRP78 is citrullinated specifically upon exposure of beta-cells to inflammatory stress. This is paralleled by translocation of GRP78 to the plasma membrane and eventually its secretion. Under these circumstances, a specific cross-talk between the beta-cell and the immune system is initiated, resulting in the generation of autoantibodies and induction of T-cell autoreactivity against citrullinated GRP78 in non-obese diabetic (NOD) mice [Rondas D, et al. (2015) Diabetes 64: 573-586] . Moreover, citrullination is catalyzed by a group of peptidylarginine deiminases (PADs) including PADI 1, 2, 3, 4 and 6 and we have strong data indicating that the gene encoding Padi2 is a susceptibility factor for TID development in NOD mice [Rondas D, et al. (2015) Diabetes 64: 573-586] .

Several documents are cited throughout the text of this specification. Each of the documents herein (including any manufacturer's specifications, instructions etc.) are hereby incorporated by reference; however, there is no admission that any document cited is indeed prior art of the present invention.

SUMMARY OF THE INVENTION

The present invention provides novel epitopes of post-translationally modified GRP78, which are identified as autoantigens in human TID and which are a potential antigen for use in therapeutic or prophylactic vaccines for the treatment of patients developing or being at risk of developing TID. The present invention also provides novel methods for diagnosis of TID.

The present invention is based on the surprising finding by the inventors that human islets of Langerhans, when ex vivo exposed to inflammatory cytokines, induce post-translational modification of GRP78, and that autoreactive CD4+ T-cells against citrullinated GRP78 epitopes are present in the circulation of T1D patients and in an islet infiltrate from a 22 year old female T1D patient. Finally, the inventors show that vaccination with citrullinated GRP78 in pre-diabetic NOD mice, delayed disease onset and decreased diabetes incidence.

These findings show that citrullinated GRP78 is an autoantigen in human T1D and put citrullinated GRP78 or citrullinated arginine containing fragments thereof forward as a potential target for therapeutic prevention or intervention strategy for T1D patients.

Further scope of applicability of the present invention will become apparent from the detailed description given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed.

Some embodiments of the invention are set forth in claim format directly below:

1. A GRP78 peptide between 9 and 30 amino acids, the peptide comprising a sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1),

VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3), wherein X is citrulline, for the prevention or treatment of type 1 diabetes.

2. The peptide for use in the prevention or treatment of type 1 diabetes according to statement 1, which comprises the sequence of VEKAKXALSSQHQA (SEQ ID No. 2).

3. The peptide for use in the prevention or treatment of type 1 diabetes according to statement 1, which consists of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3),

4. The peptide for use in the prevention or treatment of type 1 diabetes according to statement 1, which consists of VEKAKXALSSQHQA (SEQ ID No. 2).

5. The in vitro use of a GRP78 peptide fragment in a diagnostic test for assessing a subject's type 1 diabetes status or a subject's predisposition for developing type 1 diabetes, wherein said peptide has a length between 9 and 30 amino acids, and wherein said peptide comprises a sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2), EVTFEIDVNGILXVT (SEQ ID No. 3), TFEIDVNGILXVTAE (SEQ ID No. 4) and KEXIDTXNELESYAY (SEQ ID No. 5), wherein X is citrulline.

6. The use according to statement 5, wherein said peptide selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2), EVTFEIDVNGILXVT (SEQ ID No. 3), TFEIDVNGILXVTAE (SEQ ID No. 4) and KEXIDTXNELESYAY (SEQ ID No. 5), wherein X is citrulline.

7. The use according to statement 5, wherein said peptide comprises, or consists of, the sequence VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3).

8. In an vitro method according for assessing a subject's type 1 diabetes status or a subject's predisposition for developing type 1 diabetes comprising the steps of :

- isolating peripheral blood mononuclear cells (PBMCs) from said subject,

-contacting said cells with a GRP78 peptide fragment,

- evaluating a cytokine response of said PBMCs contacted with said GRP78 peptide fragment.

9. The method according to statement 8, wherein said cytokine response is an IFNy IL4, IL10 or IL17 response.

10. The method according to statement 8 or 9, comprising the step of determining the presence of autoreactive CD4+ T cells in PBMCs isolated from said subject by staining the CD4+ T cells in an ex-vivo tetramer assay with a tetramer consisting of MHC Class II molecules that present said peptide fragment.

11. A GRP78 peptide between 9 and 30 amino acids, wherein said peptide comprises an amino acid sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2), EVTFEIDVNGILXVT (SEQ ID No. 3), TFEIDVNGILXVTAE (SEQ ID No. 4) and KEXIDTXNELESYAY (SEQ ID No. 5), wherein X is citrulline.

12. The peptide according to statement 11, wherein said peptide is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2), EVTFEIDVNGILXVT (SEQ ID No. 3), TFEIDVNGILXVTAE (SEQ ID No. 4) and KEXIDTXNELESYAY (SEQ ID No. 5), wherein X is citrulline.

13. The peptide according to statement 11, wherein said peptide is VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3).

14. A pharmaceutical vaccine composition comprising of:

a pharmaceutical active amount of a peptide of between 9 and 30 amino acids, the peptide comprising a sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3), wherein X is citrulline.

15. The vaccine composition according to statement 14, wherein the peptide consists of the sequence VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3), wherein X is citrulline.

16. The vaccine composition according to statement 14, wherein the peptide comprises, or consist of, VEKAKXALSSQHQA (SEQ ID No. 2)

17. A method for preventing or treating type 1 diabetes in a subject, comprising the step of administering a peptide between 9 and 30 amino acids, the peptide comprising a sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3), wherein X is citrulline.

18. The method according to statement 17, wherein said peptide is VMXIINEPTAAAIAY (SEQ ID No. 1), VEKAKXALSSQHQA (SEQ ID No. 2) or EVTFEIDVNGILXVT (SEQ ID No. 3).

19. A peptide comprising at least 9 amino acids and not more than 30 amino acids, wherein said peptide has an amino acid sequence with at least 80% sequence identity to the amino acid sequence of a fragment of the protein GRP78 (SEQ ID No 7) that comprises any one of the arginines as present in GRP78 on the positions Arg-197, Arg-297, Arg-510, Arg-558, Arg-562 or Arg-17 and wherein at least one of said arginines present in said peptide is citrullinated.

20. The peptide according to statement 19, wherein said peptide is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2), EVTFEIDVNGILXVT (SEQ ID NO: 3), TFEIDVNGILXVTAE (SEQ ID NO: 4), KEXIDTXNELESYAY (SEQ ID NO: 5) and LLSAAXAEEEDKKE (SEQ ID NO: 6) and wherein X stands for citrullinated arginine.

21. The peptide according to statement 19, wherein said peptide is VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2) or EVTFEIDVNGILXVT (SEQ ID NO: 3).

22. The use of a peptide according to any one of statement 19 to 21 in a diagnostic test for assessing a subject's type 1 diabetes status or a subject's predisposition for developing type 1 diabetes.

23. The use according to statement 22, wherein said diagnostic test involves evaluating a cytokine response of CD4+ T cells isolated from said subject when exposed to any of said peptides. 24. The use according to statement 23, wherein said cytokine response is an IFNy, IL4, IL10 or IL17 response.

25. The use according to statement 22, wherein said diagnostic test involves evaluating the presence of autoreactive CD4+ T cells in PBMC isolated from said subject by staining the CD4+ T cells in an ex-vivo tetramer assay with a tetramer consisting of MHC Class II molecules that present said peptide fragment.

26. A citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof comprising at least 9 amino acids, wherein at least one of the arginines in said protein or said fragment thereof is citrullinated, for use in a vaccination treatment against type 1 diabetes, wherein said vaccination treatment comprises administering to a subject an active amount of said protein or said fragment thereof.

27. The citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof according to statement 26, wherein the at least one of the citrullinated arginines is located at any one of the positions Arg-197, Arg-297, Arg-510, Arg- 558, Arg-562 or Arg-17 as present in GRP78 (SEQ ID NO: 7).

28. The citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof according to statement 26 or 27, wherein all of the arginines at positions Arg-197, Arg-297, Arg-510, Arg-558, Arg-562 and Arg-17 as present in GRP78 (SEQ ID NO: 7), are citrullinated.

29. The citrullinated protein GRP78 according to statement 26, wherein all arginines in said GRP78 protein are citrullinated.

30. The citrullinated arginine containing fragment of protein GRP78 according to statement 26, wherein all arginines present in said fragment are citrullinated.

31. The citrullinated arginine containing fragment of protein GRP78 according to statements 26 or 27, wherein said fragment is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2), EVTFEIDVNGILXVT (SEQ ID NO: 3), TFEIDVNGILXVTAE (SEQ ID NO: 4), KEXIDTXNELESYAY (SEQ ID NO: 5) and LLSAAXAEEEDKKE (SEQ ID NO: 6) and wherein X stands for citrullinated arginine.

32. The fragment according to statement 31, wherein said fragment is VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2) or EVTFEIDVNGILXVT (SEQ ID NO: 3).

33. A pharmaceutical composition comprising an active amount of the citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof according to any one of the statements 26 to 32, for use in a vaccination treatment against type 1 diabetes, wherein said vaccination treatment comprises administering to a subject said pharmaceutical composition.

34. The pharmaceutical composition according to statement 33, wherein said citrullinated protein GRP78 is a GRP78 protein wherein all arginines are citrullinated.

35. The pharmaceutical composition according to statement 33, wherein said citrullinated arginine containing fragment is a fragment wherein all arginines are citrullinated. DETAILED DESCRIPTION OF THE INVENTION LEGENDS TO FIGURES

Figure 1. shows apoptosis levels in human islets after exposure to IL-Ιβ (50 U/ml), IFNy (1000 U/ml) and TNFa (1000 U/ml) during 24h (a) and 72h (b) (n = 8). Data is expressed as means ± s.e.m. and were analyzed by a paired t-test. ***p < 0.001 Figure 2. shows that human islets of Langerhans express 5 isoforms of GRP78 with different isoelectric point, indicated by detection on 2D-WB (pH 4-7).

Figure 3. shows GRP78 isoforms in control and cytokine-exposed (IL-Ιβ (50 U/ml), IFNy (1000 U/ml) and TNFa (1000 U/ml)) human islets, analyzed by 2D-DIGE (pH 4-7; n = 5). Two isoforms (II and 12) are indicated with arrows (a). The ratio between the volume of isoform 12/11 is shown (%) (b). The ratio of GRP78 12/11 is increased in cytokine-exposed islets from donor R130, R133 and R138, while decreased in islets from R135 and R136.

Figure 4. shows binding affinity of native (R) and citrullinated (X) GRP78 peptides for HLA Class-II DR4 (a) or DQ8 (b). Peptide sequences are shown in Table 4.

Figure 5. shows detection of autoreactivity against GRP78 peptides by a CD4+ T- cell clone, grown from islets of a T1D donor. IFNy was significantly more secreted in response to an HLA-matched EBV transformed B cell (DR3+, DR4+, DQ2+, DQ8+) pulsed with peptide 27, citrullinated at position 297, compared with the native peptide 28 (p=0,04). Representative experiments of three similar experiments are shown.

Figure 6. shows the result of ex-vivo tetramer assay for citrullinated GRP78 DR4 peptides. Positive tetramer-stainings are indicated by a black square for each donor separately (N=6) (a) and the average reaction against each peptide is shown as a percentage (b).

Figure 7. shows tetramer staining of the CD4+ T-cell clone raised against the citrullinated GRP78 peptide 31 and indicates preferential recognition of this citrullinated epitope (peptide 31; a) compared with the native arginine-containing epitope (peptide 32; b).

Figure 8. Part A shows diabetes incidence in NOD mice vaccinated at 3 weeks of age with in-vitro citrullinated (IVC) GRP78 (total protein, 50 μg) (N= 12) and native GRP78 (total protein, 50 μg) (N= 14) in incomplete Freud's adjuvant (IFA), I FA alone (N=9) and PBS alone (N= 12). *P<0.05, ***P<0.001.

Part B Diabetes incidence in NOD mice vaccinated at 3 weeks of age with a citrullinated GRP78 peptide (citrullinated peptide 27 (SEQ ID NO: 2); 50 μg; N= 15) and a native GRP78 peptide (SEQ ID No. 2R; 50 μg; N=5) in incomplete Freud's adjuvant (IFA), IFA alone (N = 15) and PBS alone (N= 10). *P<0.05, **P<0.01.

Figure 9. Shows gating strategy (a) and tetramer-labels (b) for T-cell staining after in-vitro stimulation with GRP78 peptides. The amount of double tetramer positive CD4+ PBMCs per 10 ⁶ was analyzed. Tetramer staining more than twice the background was considered positive. The positive control peptides B45 (citrullinated GAD65 peptide) and MP54 (influenza peptide) were included. More information about the GRP78 peptides is shown in Table 4.

Figure 10. shows frequency of tetramer+ CD4+ T-cells in PBMCs from healthy controls (n=8) and T1D patients (n= 15) with HLA-DRB1*0401, reactive against SEQ ID No. 1 and SEQ ID No. 3. Responses were investigated by ex-vivo tetramer assays against the native arginine (R) containing GRP78 epitopes (a and c) and citrullinated (X) GRP78 epitopes (b and d). Median is indicated. Statistical significance was investigated by Welch's T-test (*p<0.05).

Figure 11. Shows vaccination of NOD mice with citGRP78 peptide 27 (292-305X, SEQ ID NO: 2) protects against diabetes onset in NOD mice (n = 5). 3-week old NOD mice were injected with the indicated solutions and mice were followed up for diabetes development. Statistical significance was investigated by Mantal-Cox test ( ^* p<0.05).

Figure 12. shows the sequence of human GRP78 with indication of specific peptides with SEQ ID NO: 1 to 6.

Throughout the application, various peptides are represented by a number. These numbers refer to the numbers indicated in table 4. Peptides represented with the numbering as depicted in the sequence listing are preceded with "SEQ ID NO: ".

DETAILED DESCRIPTION

The following detailed description does not limit the invention. Instead, the scope of the invention is defined by the appended claims and equivalents thereof. Several documents are cited throughout the text of this specification. Each of the documents herein (including any manufacturer's specifications, instructions etc.) are hereby incorporated by reference; however, there is no admission that any document cited is indeed prior art of the present invention.

This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. Thus, the claims following the detailed description are hereby expressly incorporated into this detailed description, with each claim standing on its own as a separate embodiment of this invention.

Furthermore, while some embodiments described herein include some but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. For example, in the following claims, any of the claimed embodiments can be used in any combination. In the description provided herein, numerous specific details are set forth. However, it is understood that embodiments of the invention may be practiced without these specific details. In other instances, well-known methods, structures and techniques have not been shown in detail in order not to obscure an understanding of this description.

Other embodiments of the invention will be apparent to those skilled in the art from consideration of the specification and practice of the invention disclosed herein. It is intended that the specification and examples be considered as exemplary only. Each and every claim is incorporated into the specification as an embodiment of the present invention. Thus, the claims are part of the description and are a further description and are in addition to the preferred embodiments of the present invention. Each of the claims set out a particular embodiment of the invention. The scope of the applicability of the present invention will become apparent from the detailed description and drawings provided below. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the present invention, are given by way of illustration only since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

DEFINITIONS

Reference throughout this specification to "one embodiment" or "an embodiment" means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases "in one embodiment" or "in an embodiment" in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to one of ordinary skill in the art from this disclosure, in one or more embodiments.

Similarly it should be appreciated that in the description of exemplary embodiments of the invention, various features of the invention are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding the understanding of one or more of the various inventive aspects.

"GRP78" as used herein refers to GRP78 protein (also known as: immunoglobulin heavy chain binding protein (BiP); endoplasmic reticulum lumenal Ca(2+)-binding protein grp78; heat shock 70 kDa protein 5 (HSPA5); and heat shock 70 kD protein 5 (glucose-regulated protein, 78 kD)) which is a member of the HSP70 protein family that can be located on the cell surface (Wang et al., Antioxidants & Redox Signaling In Press (2009)) and is a key regulator of the unfolded protein response (UPR) (Ni and Lee, FEBS Lett 581(19) : 3641 (2007)). GRP78 was discovered as a cellular protein induced by glucose starvation (Lee, Cancer Res 67(8) :3496 (2007)). GRP78 is present in the endoplasmic reticulum as a major chaperone involved in many cellular processes, including protein folding and assembly, marking misfolded proteins for proteasome degradation, regulating Ca2+ homeostasis, and serving as a sensor for endoplasmic reticulum stress (Li and Lee, Curr Mol Med 6(1) :45 (2006)). Despite its main function as a cellular chaperone protein, recent studies reported the translocation of a fraction of GRP78 to the cell surface in a variety of cells (Davidson et al., Cancer Res 65(11) :4663 (2005); Misra et al., Cell Signal 16(8):929 (2004); Hardy et al., Biochem Pharmacol 75(4) : 891 (2008); Jindadamrongwech et a/., Arch Virol 149(5) :915 (2004); and Triantafilou et al., J Virol 76(2): 633 (2002)). The polypeptide sequence of GRP78 has been previously identified and described for several species including Homo sapiens, Pongo abelii, Pan troglodytes, Mus musculus, Rattus norvegicus, Cricetulus griseus, Bos Taurus, Canis lupus familiaris, and others. See, for example, the amino acid sequences described by the National Center for Biotechnology Information (NCBI) identified by the following accession and gene identification (GI) numbers: NP—

005338.1 (GI: 16507237); AAF13605.1 (GI :6470150); NP-005338.1 (GI : 16507237); P11021.2 (GI : 14916999); NP-001126927.1 (GI: 197101513); NP-001156906.1 (GI :254540168); AA065155.1 (GI :29164908); A27414 (GI :90188); AAI19954.1 (GI : 111308468); XP-537847.2 (GI :73968072), all of which are herein incorporated by reference. The corresponding nucleic acid cDNA, mRNA or genomic sequences have also been identified and described for the above species as described by NCBI and identified by the following accession and gene identification (GI) numbers: NM-005347.3 (GI : 194097371); M 19645.1 (GI : 183644); AF188611.1 (GI :6470149); AF216292.1 (GI :7229461); NM- 001133455.1 (GI : 197101512); XM-001146903.1 (GI : 114689310); NM- 001163434.1 (GI :254540167); NM-022310.3 (GI : 254540165); NM-013083.1 (GI : 25742762); M 17169.1 (GI : 191090); NM-001075148.1 (GI : 115495026); XM-

537847.2 (GI: 73968071), all of which are herein incorporated by reference.

The term "citrullination" or "deamination" as used herein refers to the conversion of the amino acid arginine in a protein into the amino acid citrulline (2- Amino-5-(carbamoylamino)pentanoic acid). Enzymes called peptidylarginine deiminases (PADs) replace the primary ketimine group (=NH) by a ketone group (=0). Citrullination controls the expression of genes, particularly in the developing embryo. The immune system often attacks citrullinated proteins, leading to autoimmune diseases such as rheumatoid arthritis and multiple sclerosis. Citrulline is not one of the 20 standard amino acids encoded by DNA in the genetic code. Instead, it is the result of a post-translational modification. Citrullination is distinct from the formation of the free amino acid citrulline as part of the urea cycle or as a byproduct of enzymes of the nitric oxide synthase family. Arginine is positively charged at a neutral pH, whereas citrulline is uncharged. This increases the hydrophobicity of the protein, leading to changes in protein folding. Therefore, citrullination can change the structure and function of proteins.

The terms "protein", "peptide" or "polypeptide" as used herein refer to a polymer of amino acid residues, including D-amino acids, typically L-amino acids, and to derivatives, variants and synthetic analogues of the same, encompassing native peptides (including synthetically synthesized or recombinant peptides), modified proteins or peptides and peptidomimetics (typically, synthetically synthesized peptides and peptide analogues). Thus, these terms apply to amino acid polymers in which one or more amino acid residues is a synthetic non-naturally occurring amino acid, such as a chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. A protein or peptide of the present invention may also be produced by recombinant expression in prokaryotic and eukaryotic engineered cells other than plant cells, such as bacteria, fungi, or animal cells. Suitable expression systems are known to those skilled in the art. By "recombinant ( polypeptide" is meant a (poly)peptide made using recombinant techniques, i.e., through the expression of a recombinant or synthetic polynucleotide. Suitable expression protocols and strategies are known to the skilled person and can be retrieved e.g. from Sambrook, 2001. When the polypeptide is recombinantiy produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the peptide preparation.

The term "peptide" or "protein" as used herein also refers to modified peptides or proteins wherein the modifications render the protein or peptides even more stable e.g. while in a body. Such modifications include, but are not limited to N-terminus modification, C-terminus modification, peptide bond modification, including, but not limited to, CH2-NH, CH2-S, CH2-S=0, 0=C-NH, CH2-0, CH2-CH2, S=C-NH, CH =CH or CF=CH, backbone modifications, cyclisation (including by coupling the C- terminus to the N-terminus of the peptide or by Cys-Cys disulphide linkages) and residue modification. Other modified proteins or peptides include proteins or peptides comprising D-amino acids, retro modified peptides, in verso modified peptides, retro-inverso modified peptides or cyclic peptides. Methods for preparing peptidomimetic compounds are well known in the art and are specified, for example, in Quantitative Drug Design, C.A. Ramsden Gd., Chapter 17.2, F. Choplin Pergamon Press ( 1992).

The term "derivative(s) of a peptide or protein" or "derivative" as used herein refers to proteins, peptides or polypeptides which, compared to the amino acid of a protein or peptide according to this invention, may comprise: (i) substitutions, deletions or additions of naturally and non-naturally occurring amino acid residues (including D-amino acids); (ii) amino acid residues that are substituted by corresponding naturally or non-naturally altered amino acids; (iii) naturally occurring altered, (such as glycosylated, acylated, myristoylated or phosphorylated amino acids) or non-naturaiiy occurring amino acid residues (such as biotinylated amino acids, or amino acids modified after CNBr treatment); ( iv) proteins or peptides carrying post-transiationai modifications. A derivative may also be a retro, inverso or retro-inverso modified form of any of the proteins or peptides according to this invention. A derivative may also comprise one or more non-amino acid substituents compared to the amino acid from which it is derived, for example a reporter molecule or other ligand, covalently or non-covalently bound to the amino acid such as, for example, a reporter molecule which is bound to facilitate its detection . Preferably, amino acid substitutions comprise conservative amino acid substitutions. One or more amino acid residues may be introduced into a predetermined site in said peptide of the present invention. Insertions can comprise amino-terminal and/or carboxy-terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Examples of amino- or carboxy- terminal fusion proteins or peptides include the binding domain or activation domain of a transcriptional activator as used in the yeast two-hybrid system, phage coat proteins, (histidine)6-tag, glutathione S-transferase-tag, protein A, maltose- binding protein, di hydro folate reductase, Tag* 00 epitope, c-myc epitope, FLAG®- epitope, lacZ, CMP (calmodulin-binding peptide), HA epitope, protein C epitope and VSV epitope.

The term "non-natural amino acid" refers to a non-coded, non proteinogenic amino acid, or a post-translationally modified variant thereof that is not naturally encoded or found in the genetic code of any organisms. In particular, the term refers to an amino acid that is not one of the 20 common amino acids or pyrrolysine, selenocysteine or N-formylmethionine, or post-translationally modified variants thereof.

The term "sequence identity" as used herein refers to the extent that sequences are identical on an amino acid-by-amino acid basis over a window of comparison. Sequence identity is generally determined by aligning the residues of the two sequences to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of identical residues, although the amino acids in each sequence must nonetheless remain in their proper order. Thus, a "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical amino acid residue (e.g ., Ala, Pro, Ser, Thr, Gly, Val, Leu, He, Phe, Tyr, Trp, Lys, Arg, His, Asp, Glu, Asn, Gin, Cys and Met or a non-naturally altered amino acid) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. Preferably, sequence identity between two amino acid sequences is determined by comparing said sequences using the Blastp program, available at http://blast.ncbi. nlm.nih.gov/Blast.cgi. Preferably, the default values for all BLAST 2 search parameters are used, including in the case of Blastp : matrix = BLOSUM62; open gap penalty = 11, extension gap penalty = 1, gap x-dropoff = 5 0, expect = 10, wordsize = 3, and filter on. "Similarity" refers to the percentage number of amino acids that are identical or constitute conservative substitutions.

As used herein, the terms "treatment", "treating," and the like, refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.

"Treatment", as used herein, covers any treatment of a disease in a subject, particularly in a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, e.g., causing regression of the disease, e.g., to completely or partially remove symptoms of the disease.

The term "subject" or "patient" refers to any human, animal, or mammal,

"prevention" and "diagnosis" can be performed on any subject, but is typically performed on subjects with an increased risk in developing diabetes type 1. Such persons typically have a family history of Type 1 Diabetes or are positive for 2 autoantibodies (amongst pro-INS, I-A2, GAD65 and ZnT8)

"Treatment" encompasses an improvement of disease type of diabetes 1. Indicators of treatment are for example restoration of immune tolerance, prevention or delay in loss of beta-cell function and improved C-peptide secretion.

Particular and preferred aspects of the invention are set out in the accompanying independent and dependent claims. Features from the dependent claims may be combined with features of the independent claims and with features of other dependent claims as appropriate and not merely as explicitly set out in the claims. Thus, the claims following the detailed description are hereby expressly incorporated into this detailed description, with each claim standing on its own as a separate embodiment of this invention.

In a first object the present inventions presents a peptide comprising at least 9 amino acids and not more than 30 amino acids (also herein referred to as "peptide of the present invention"), wherein said peptide has an amino acid sequence with at least 80%, more preferably at least 90%, more preferably at least 95%, 97%, 99% or 100% sequence identity to the amino acid sequence of a fragment of the protein GRP78 (SEQ ID No 7) that comprises any one of the arginines as present in GRP78 on the positions Arg-197, Arg-297, Arg-510, Arg-558, Arg-562 or Arg-17 and wherein at least one of said arginines present in said peptide is citrullinated.

Preferably, said peptide consists of 9 to 30 amino acids. More preferably, a peptide of the present invention consists of 9 to 20 amino acids. More preferably, a peptide of the present invention consists of 9 to 15 amino acids. More preferably, a peptide of the present invention comprises at least 9 amino acids, for instance at least 9, 10, 11, 12, 13, 14 or at least 15 amino acids. It is further preferred that a peptide of the present invention does not comprise more than 30 amino acids, for instance not more than 15, 17, 20, 22, 24, 26, 28 or 30 amino acids. More preferably, said peptide consists of 9, 10, 14 or 15 amino acids. Typically the peptide is a fragment of GRP78. In certain embodiment, the sequence at the N and/C terminal sequence of the epitope may be modified to increase for example half-life time of the peptide, to improve solubility, to remove protease recognition sites, or other factors which influence the formulation or pharmaceutical efficacy of a peptide.

Preferably, the peptide of the present invention has an amino acid sequence with such sequence identity to a fragment of GRP78 (SEQ ID NO: 7) that comprises one of the arginines as present in GRP78 on positions Arg-197, Arg-297, Arg-510, Arg- 558, Arg-562 or Arg-17, wherein said arginine is citrullinated in said peptide. More preferably, said peptide of the present invention has an amino acid sequence with such sequence identity to a fragment of GRP78 (SEQ ID NO: 7) that comprises one of the arginines as present in GRP78 on positions Arg-197, Arg-297 or Arg-510, wherein said arginine is citrullinated in said peptide. More preferably, said peptide of the present invention has an amino acid sequence with such sequence identity to a fragment of GRP78 (SEQ ID NO: 7) that comprises the arginine as present in GRP78 on position Arg-297, wherein said arginine is citrullinated in said peptide. In a preferred embodiment of the present invention, said peptide comprises an amino acid sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2), EVTFEIDVNGILXVT (SEQ ID NO: 3), TFEIDVNGILXVTAE (SEQ ID NO: 4), KEXIDTXNELESYAY (SEQ ID NO: 5) and LLSAAXAEEEDKKE (SEQ ID NO: 6) and wherein X stands for citrullinated arginine. Preferably, said peptide comprises an amino acid sequence selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2) or EVTFEIDVNGILXVT (SEQ ID NO: 3). More preferably, said peptide comprises the amino acid sequence VEKAKXALSSQHQA (SEQ ID NO: 2).

Preferably, said peptide is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2), EVTFEIDVNGILXVT (SEQ ID NO: 3), TFEIDVNGILXVTAE (SEQ ID NO: 4), KEXIDTXNELESYAY (SEQ ID NO: 5) and LLSAAXAEEEDKKE (SEQ ID NO: 6) and wherein X stands for citrullinated arginine. Preferably, said peptide is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2) or EVTFEIDVNGILXVT (SEQ ID NO: 3). More preferably, said peptide is VEKAKXALSSQHQA (SEQ ID NO: 2).

Typically, the peptides of the present invention as described herein are used in a diagnostic test for assessing a subject's type 1 diabetes status or a subject's predisposition for developing type 1 diabetes. Preferably, said subject is a human being.

In a preferred embodiment of the present invention, said diagnostic test involves evaluating a cytokine response of CD4+ T cells isolated from said subject when exposed to any of said peptides of the present invention. Typically, said cytokine response can be, but is not limited to, a IFNy, IL4, IL10 or IL17 response. Preferably, said cytokine response is a IFNy, IL4, IL10 or IL17 response. Preferably, said subject is a human being.

In another preferred embodiment of the present invention, said diagnostic test involves evaluating the presence of autoreactive CD4+ T cells in PBMC isolated from said subject by staining the CD4+ T cells in an ex-vivo tetramer assay with a tetramer consisting of MHC Class II molecules that present said peptide. Preferably, said subject is a human being.

In a second object the present invention presents a citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof comprising at least 9 amino acids, wherein at least one of the arginines in said protein or said fragment thereof is citrullinated, for use in a vaccination treatment against type 1 diabetes, wherein said vaccination treatment comprises administering to a subject an active amount of said citrullinated GRP78 or said fragment thereof. Preferably, said subject is a human being.

The second object also relates to such use of citrullinated proteins having at least 80%, more preferably at least 90%, more preferably at least 95%, 97%, 99% or 100% sequence identity to GRP78 (SEQ ID NO: 7) and to citrullinated peptides having at least 80%, more preferably at least 90%, more preferably at least 95%, 97%, 99% or 100% sequence identity to fragments of GRP78, wherein said fragments comprise at least 9 amino acids.

In a preferred embodiment of the present invention, said citrullinated protein GRP78 or said citrullinated arginine containing fragment thereof for use in a vaccination treatment against type 1 diabetes, is a GRP78 protein or fragment thereof wherein the at least one of the citrullinated arginines is located at any one of the positions Arg-197, Arg-297, Arg-510, Arg-558, Arg-562 or Arg-17 as present in GRP78 (SEQ ID NO: 7). Preferably, said citrullinated protein GRP78 or said citrullinated arginine containing fragment thereof is a GRP78 protein or fragment thereof, wherein the at least one of the citrullinated arginines is located at positions Arg-197, Arg-297 or Arg-510 as present in GRP78 (SEQ ID NO: 7). Preferably, said citrullinated protein GRP78 or said citrullinated arginine containing fragment thereof is a GRP78 protein or fragment thereof, wherein the at least one citrullinated arginine is located at position Arg-297 as present in GRP78 (SEQ ID NO: 7). Preferably, said vaccination treatment comprises administering to a subject an active amount of said citrullinated GRP78 or said fragment thereof. Preferably, said subject is a human being.

Preferably, said citrullinated arginine containing fragment of protein GRP78 for use in a vaccination treatment against type 1 diabetes, is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2), EVTFEIDVNGILXVT (SEQ ID NO: 3), TFEIDVNGILXVTAE (SEQ ID NO: 4), KEXIDTXNELESYAY (SEQ ID NO: 5) and LLSAAXAEEEDKKE (SEQ ID NO: 6) and wherein X stands for citrullinated arginine. More preferably, said citrullinated arginine containing fragment of protein GRP78 for use in a vaccination treatment against type 1 diabetes, is VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2) or EVTFEIDVNGILXVT (SEQ ID NO: 3). Even more preferably, said citrullinated arginine containing fragment of protein GRP78 for use in a vaccination treatment against type 1 diabetes, is VEKAKXALSSQHQA (SEQ ID NO: 2).

In another preferred embodiment of the present invention, the citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof for use in a vaccination treatment against type 1 diabetes, is a GRP78 protein or fragment thereof, wherein all of the arginines at positions Arg-197, Arg-297, Arg-510, Arg- 558, Arg-562 and Arg-17 as present in GRP78 (SEQ ID NO: 7) are citrullinated. Preferably, said vaccination treatment comprises administering to a subject an active amount of said citrullinated GRP78 or said fragment thereof. Preferably, said subject is a human being.

In another preferred embodiment of the present invention, the citrullinated protein GRP78 for use in a vaccination treatment against type 1 diabetes is a GRP78 protein wherein all arginines are citrullinated. Preferably, said vaccination treatment comprises administering to a subject an active amount of said citrullinated GRP78. Preferably, said subject is a human being.

In another preferred embodiment of the present invention, said citrullinated arginine containing fragment of said citrullinated protein GRP78 for use in a vaccination treatment against type 1 diabetes is a GRP78 fragment wherein all arginines are citrullinated. Preferably, said vaccination treatment comprises administering to a subject an active amount of said citrullinated arginine containing fragment of said citrullinated protein GRP78. Preferably, said subject is a human being.

In a third object the present invention presents a pharmaceutical composition comprising an active amount of the citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof comprising at least 9 amino acids, wherein at least one of the arginines in said protein or said fragment thereof is citrullinated, for use in a vaccination treatment against type 1 diabetes, wherein said vaccination treatment comprises administering to a subject said pharmaceutical composition. Preferably, said subject is a human being.

In a preferred embodiment of the present invention, said pharmaceutical composition comprises an active amount of said citrullinated protein GRP78 or a citrullinated arginine containing fragment thereof, for use in a vaccination treatment against type 1 diabetes, wherein the at least one of the citrullinated arginines is located at any one of the positions Arg-197, Arg-297, Arg-510, Arg- 558, Arg-562 or Arg-17 as present in GRP78 (SEQ ID NO: 7). Preferably, said citrullinated protein GRP78 or said citrullinated arginine containing fragment thereof, is a GRP78 protein or fragment thereof, wherein the at least one of the citrullinated arginines is located at positions Arg-197, Arg-297 or Arg-510 as present in GRP78 (SEQ ID NO: 7). Preferably, said citrullinated protein GRP78 or said citrullinated arginine containing fragment thereof, is a GRP78 protein or fragment thereof, wherein the at least one citrullinated arginine is located at position Arg-297 as present in GRP78 (SEQ ID NO: 7). More preferably, said citrullinated protein GRP78 or said citrullinated arginine containing fragment thereof, is a GRP78 protein or fragment thereof, wherein all of the arginines at positions Arg-197, Arg-297, Arg-510, Arg-558, Arg-562 and Arg-17 as present in GRP78 (SEQ ID NO: 7) are citrullinated. Preferably, said vaccination treatment against type 1 diabetes comprises administering to a subject said pharmaceutical composition. Preferably, said subject is a human being.

Preferably, said pharmaceutical composition comprises an active amount of said citrullinated arginine containing fragment of protein GRP78 for use in a vaccination treatment against type 1 diabetes, wherein said citrullinated arginine containing fragment of protein GRP78 is selected from the group consisting of VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2), EVTFEIDVNGILXVT (SEQ ID NO: 3), TFEIDVNGILXVTAE (SEQ ID NO: 4), KEXIDTXNELESYAY (SEQ ID NO: 5) and LLSAAXAEEEDKKE (SEQ ID NO: 6) and wherein X stands for citrullinated arginine. More preferably, said citrullinated arginine containing fragment of protein GRP78 is VMXIINEPTAAAIAY (SEQ ID NO: 1), VEKAKXALSSQHQA (SEQ ID NO: 2) or EVTFEIDVNGILXVT (SEQ ID NO: 3). Even more preferably, said citrullinated arginine containing fragment of protein GRP78 is VEKAKXALSSQHQA (SEQ ID NO: 2).

In another preferred embodiment of the present invention, said pharmaceutical composition comprises an active amount of said citrullinated protein GRP78, wherein all arginines are citrullinated, for use in a vaccination treatment against type 1 diabetes, wherein said vaccination treatment comprises administering to a subject said pharmaceutical composition. Preferably, said subject is a human being. In another preferred embodiment of the present invention, said pharmaceutical composition comprises an active amount of said citrullinated arginine containing fragment of said citrullinated protein GRP78, wherein all arginines are citrullinated, for use in a vaccination treatment against type 1 diabetes, wherein said vaccination treatment comprises administering to a subject said pharmaceutical composition. Preferably, said subject is a human being.

Typically, methods of administering said protein, or said fragment thereof, or said pharmaceutical composition comprising said protein or said fragment thereof, for use in a vaccination treatment against type 1 diabetes to said subject, include but are not limited to oral, subcutaneous, intramuscular, intranasal, intraperatoneal, intradermal, or topical (including buccal and sublingual) administration. Preferably, said subject is a human being.

EXAMPLES MATERIAL & METHODS

Human islet isolation. Islets from 8 human healthy donors (characteristics listed in Table 1), used for apoptosis and 2D-DIGE experiments, were isolated by the Alberta Diabetes Institute Islet Core [Lyon J, et al. (2016) Endocrinology 157 : 560- 569], with ethical approval from the University of Alberta Human Research Ethics Board (Pro00013094; Pro00001754). For T-cell outgrow, islets from 9 donors with established TID and 7 donors without diabetes were obtained from Network of Pancreatic Organ Donors with Diabetes (nPOD), National Disease Research Interchange (NDRI) and Integrated Islet Distribution Program (IIDP) (characteristics listed in Table 2 and 3, respectively). All institutions have current Internal Review Board approval for these studies.

Table 1. Characteristics of human donors from islets that were collected for cytokine exposure

Body mass index (BMI); Hemoglobine Al C (HbAlc). Samples used for analysis of apoptosis and 2 dimensional difference gel electrophoresis (2D-DIGE) are indicated (+)■

Treatment of islets. Islets were exposed to a combination of human Interleukin-1 beta (IL-Ιβ) (50 U/ml; R&D systems), mouse Tumor necrosis factor alpha (TNFa) (1000 U/ml; R&D systems) and human Interferon gamma (IFNy) (1000 U/ml; Preprotech) during 24 or 72 hours. Cell death assay. Islets were incubated for 15 min with propidium iodide (PI, 20 μς/ηηί, Invitrogen) and Hoechst H0342 (4 μς/ηηί, Invitrogen) at 37°C. At least 15 cultured islets in each experimental condition were evaluated by two researchers, one of them unaware of the sample identity after imaging by a Zeiss COLIBRI fast LED microscope.

2D-DIGE. Samples of 40 μg protein lysate, obtained from approximately 2000 hand-picked islets were separated on IPG strips in pH-range 4-7 (24cm, GE Healthcare). 2D-DIGE procedure and analysis (with DeCyder 7.2.1.72 software) was performed as described previously [D'Hertog W, al (2007). Mol Cell Proteomics 6: 2180-2199] . IPG strips were rehydrated overnight in rehydration buffer (7 M urea, 2 M thiourea, 4% CHAPS, 0.5% IPG buffer, 0.05% OrangeG, and 1% DTT). The first dimension separation according to isoelectric point was performed on an Ettan IPGphorll manifold (GE Healthcare). Before the second dimension separation according to molecular weight, strips were equilibrated in equilibration buffer (6 M urea, 30% (v/v) glycerol, 2% (w/v) SDS, and 50 mM Tris-HCI, pH 8.8) containing 1% (w/v) DTT in the first step and 4% (w/v) iodoacetamide and 0.02% bromophenol blue in the second step. Equilibrated strips were placed on top of 12.5% SDS-polyacrylamide gel and separated on an Ettan DaltSix system (GE Healthcare). Differences in protein expression, investigated by 2D-DIGE, were analyzed by the DeCyder software (version 7.2.1.72) and a p-value of equal or less than 0.05 was considered significant. Identification of GRP78 spots was done by matching with 2D-gels used for spot picking and mass spectrometry analysis, as well as by 2D-western blotting.

2D-western blotting. 2D-gels were blotted onto a PVDF membrane (Hybond-ECL; GE Healthcare), and probed with anti-GRP78 antibody (Santa Cruz). Western blots were incubated with the Western lightning™ Plus-ECL detection system (PerkinElmer, Zaventem, Belgium) and analyzed with the ImageQuant LAS 500 system (GE Healthcare, Diegem, Belgium).

In-silico peptide prediction. To predict epitopes we adapted the in silico approach outlined in our published work (James et a/. JI 2009; James et a/. A&R 2010; James et al. A&R 2014). An array of binding coefficients (Cp) was developed for DRB1*04: 01 and DRB1*03 : 02 based on observed and published binding data for conventional amino acids and citrulline within pockets 1, 4, 6, 7 or 9. Peptide binding affinities were then calculated based on the following formula :

RBA=Cpl xCp4xCp6xCp7xCp9

In this formula, each Cp refers to the observed or estimated binding coefficient for a given amino acid. To predict RBA values for peptides, Cp values were taken from the table using lookup procedure by scanning across every possible binding register and taking the highest observed RBA value for the sequence. To predict RBA values for entire GRP78 proteins, Cp values were tabulated for every possible binding register.

Peptide-MHC affinity assays. Peptide binding to HLA-DRB1*0401 was measured by incubating increasing concentrations of peptides in competition with 0.02 μηηοΙ/L biotinylated HA306-318 in wells coated with DRB1*0401 or DQB1*0302 protein. After washing, residual biotin-HA306-318 was detected using europium-conjugated streptavidin (PerkinElmer) and quantified using a Victor2 D time-resolved fluorometer (PerkinElmer). Relative binding was calculated based on EC50 values.

MHC Class-II protein and tetramer reagents. Recombinant HLA- DRB1*04: 01 was purified from insect cell culture supernatants by affinity chromatography and dialyzed against phosphate buffer, pH 6.0. To prepare tetramers, DRB1*0401 was biotinylated in vitro and subsequently incubated with 0.2 mg/mL of peptide at 37°C for 72 h in the presence of 0.2% n-octyl-p-D-glucopyranoside (Sigma-Aldrich) and 1 mmol/L Pefabloc SC. Monomers were conjugated into tetramers using RPE streptavidin (Invitrogen) at a molar ratio of 8 : 1.

CD4 T-Cell Isolation, in Vitro Stimulation, and Tetramer Staining. Peripheral blood mononuclear cells (PBMC) were isolated and expanded in vitro as described previously [Yang J, et al. (2008) J Autoimmun 31 : 30-41; Yang J, et al. (2013) Immunology 138: 269-279] . Briefly, 2.5 x 10 ⁶ CD4 cells were stimulated in a 48 well plate with 6 μΜ of citrullinated GRP78 peptides (peptide 25, 31, 33 and 39; Table 4).

Table 4. Sequences of native and citrullinated GRP78 peptides, which were in-silico predicted to interact with HLA Class-II DR4 and DQ8. SEQ SEQ

ID ID

Citrullinated peptide NO: Native peptide NO:

Nr Sequence Nr Sequence

Class-II 8 9 DR4 13 AAMLLLLSAAXAEE 14 AAMLLLLSAARAEE

15 YSCVGVFKNGXVEII 10 16 YSCVGVFKNGRVEII 11

17 GNXITPSYVAFTPEG 12 18 GNRITPSYVAFTPEG 13

19 YVAFTPEGEXLIGDA 14 20 YVAFTPEGERLIGDA 15

21 XLIGXTWNDPSVQQ 16 22 RLIGRTWNDPSVQQ 17

23 VPAYFNDAQXQATKD 18 24 VPAYFNDAQRQATKD 19

25 VMXIINEPTAAAIAY 1 26 VMRIINEPTAAAIAY 20

27 VEKAKXALSSQHQA 2 28 VEKAKRALSSQHQA 21

29 TKLIPXNTVVPTKKS 22 30 TKLIPRNTVVPTKKS 23

31 EVTFEIDVNGILXVT 3 32 EVTFEIDVNGILRVT 24

33 TFEIDVNGILXVTAE 4 34 TFEIDVNGILRVTAE 25

35 KITITNDQNXLTPE 26 36 KITITNDQNRLTPE 27

37 KLKEXIDTXNELE 28 38 KLKERIDTRNELE 29

39 KEXIDTXNELESYAY 5 40 KERIDTRNELESYAY 30

Class-II

DQ8 41 LLSAAXAEEEDKKE 6 42 LLSAARAEEEDKKE 31

43 TPSYVAFTPEGEXLI 32 44 TPSYVAFTPEGERLI 33

45 PEGEXLIGDAAKNQL 34 46 PEGERLIGDAAKNQL 35

47 IAGLNVMXIINEPTA 36 48 IAGLNVMRIINEPTA 37

49 AAIAYGLDKXEGEK 38 50 AAIAYGLDKREGEK 39

51 LSSQHQAXIEIESFY 40 52 LSSQHQARIEIESFY 41

53 DFSETLTXAKFEELN 42 54 DFSETLTRAKFEELN 43

55 AKFEELNMDLFXST 44 56 AKFEELNMDLFRST 45

57 ELNMDLFXSTMKPVQ 46 58 ELNMDLFRSTMKPVQ 47

59 YEGEXPLTKDNHLLG 48 60 YEGERPLTKDNHLLG 49

61 IPPAPXGVPQIEVTF 50 62 IPPAPRGVPQIEVTF 51

63 IDVNGILXVTAEDKG 52 64 IDVNGILRVTAEDKG 53

65 VNGILXVTAEDKGTG 54 66 VNGILRVTAEDKGTG 55

67 NDQNXLTPEEIEXMV 56 68 NDQNRLTPEEIERMV 57

69 EEIEXMVNDAEKFA 58 70 EEIERMVNDAEKFA 59

71 IEXMVNDAEKFAEE 60 72 IERMVNDAEKFAEE 61

After 14 d of in-vitro stimulation, tetramer staining for the GRP78 epitopes (75 min at 37°C), encoded by pairs of labels, was performed. Tetramer staining for MP54 (influenza peptide) and B45 (citrullinated GAD65 peptide [McGinty JW, et al. (2014) Diabetes 63 : 3033-3040]) were included as positive control peptides (Figure 9). Analysis was performed by FACSCalibur (BD Biosciences) using FlowJo software (TreeStar Inc.)- Positivity was defined as the presence of a distinct population of CD4 bright cells at a percentage more than twofold above background (staining of cells from the unstimulated well, set to 0.1% for most experiments). Gating strategy and tetramer-labels are provided in Figure 9. Information about the donors is show in Table 5.

Table 5. Human PBMC donor characteristics.

The presence of T1D predisposing HLA types is indicated (+/+ homozygous positive; +/- heterozygous positive; -/- negative; nd: not determined).

GRP78-Specific CD4+ T-Cell Cloning. Single tetramer-positive T cells were cloned and expanded as previously described, by single-cell sorting using FACS Aria (BD Biosciences) and expansion in 96-well plates in the presence of l x lO ⁵ irradiated PBMC from an unrelated donor, 2 μg/mL phytohemagglutinin (Remel Inc.), adding T-cell media and IL-2 starting on day 10 [Yang J, et al. (2008) J Autoimmun 3 : 30- 41] . Antigen specificity was confirmed by tetramer staining.

T-cell clone generation from T1D islet infiltrates. Islet-infiltrating T cells were directly grown from or sorted by FACS from islets isolated from 9 tissue donors with established T1D and 7 donors without diabetes. CD4+ and CD8+ T cell lines and clones were assayed for reactivity with native and citrullinated GRP78 peptides by release of IFNy. Mice. Nonobese diabetic (NOD) mice have been inbred in our animal facility since 1989 and are kept under semibarrier conditions. For all experiments, female mice were used. All animal manipulations were in compliance with the principles of laboratory care and approved by the Institutional Animal Ethics Committee of KU Leuven.

GRP78 cloning, expression, purification and in vitro citrullination. To express recombinant mouse GRP78-His6, full length mouse GRP78 cDNA was amplified by PCR using the forward and reverse infusion primers TATCGAAGGTCGTCATATGATGAAGTTCACTGTGGTGGC [SEQ ID NO: 62] and GTTAGCAG CCG G ATCCTTAC A ACTC ATCTTTTTCTG ATGTATCC [SEQ ID NO: 63] and Platinum® Pfx DNA polymerase (Invitrogen). After confirmation of the cDNA sequence, the full length GRP78 PCR-fragment was cloned into Ndel and BamHI sites in pET16 (Novagen) using In-fusion® (Clontech), following the manufacturer's protocol. Endotoxins were removed using a Detoxi-Gel Endotoxin removing column (Thermo Scientific) and purity of recombinant GRP78 was verified by SDS-PAGE and Coomassie Blue staining. For in vitro citrullination of recombinant mouse GRP78, 2 U of rabbit PADI2 (Sigma-Aldrich) were added to 1 mg of protein and incubated for 2 h at 50 °C in citrullination buffer (0.1 M Tris-HCI, pH 7.4; 10 mM CaCI2 and 5 mM DTT).

Vaccination of NOD mice. Female NOD mice were subcutaneously injected in the inguinal region with 50μg of in-vitro citrullinated (IVC) or native GRP78, emulsified 1 : 1 in incomplete Freund's adjuvant (IFA). Littermate controls received PBS/IFA or PBS alone. The mice were followed up for diabetes development until 26 weeks of age and were considered diabetic when hyperglycemia was above 200 mg/dL during two consecutive days.

PBMC donors. Peripheral blood mononuclear cells (PBMC) from HLA-DRB1*0401 positive donors were isolated from heparinized blood samples using Lymphoprep™ and frozen in AIM-V medium (Gibco) containing 10% DMSO as described in Mallone R, et al. (2011) Clin Exp Immunol. 163(l) : 33-49] .

Ex-vivo tetramer assay. Samples were independently analyzed in parallel at the Benaroya Research Institute (Seattle, USA) and the lab for Clinical and Experimental Endocrinology at KU Leuven (Leuven, Belgium). PBMCs (30 xlO ⁶ ) were after thawing incubated with tetramers presenting the citrullinated GRP78 peptides 25 (195-209X, SEQ ID NO: 1) and 31 (498-512X, SEQ ID NO: 3) during 2h at room temperature. This was followed by enrichment of tetramer-bound cells with anti-PE and anti-APC microbeads (Miltenyi Biotec) as described in Day CL, et al. (2003) J Clin Invest 112(6) : 831-42.

Pre-enriched and enriched fractions were stained for CD4, CD45RA and CD19 and analysed by FACSCalibur (BD Biosciences) at the Benaroya research institute and Fortessa (BD Biosciences) at the KU Leuven. Data analysis was performed using FlowJo software (TreeStar Inc.).

Vaccination of NOD mice with GRP78 peptides. To evaluate the potential of citGRP78 in vivo as an autoantigen in NOD mice, pre-diabetic female NOD mice (3 week-old) were injected subcutaneously (s.c.) with 50 μg of citGRP78 peptide 27 (292-305X, SEQ ID NO: 2) emulsified 1 : 1 in IFA. Control NOD mice were injected in the same way with PBS emulsified in IFA. For this, total mouse GRP78 protein was cloned in the pET16 vector and purified after transformation in pLysS bacteria, and in vitro citrullinated using rabbit PADI2 enzyme and contaminating endotoxins were removed. Mice were followed up for diabetes development (glucosuria and hyperglycemia) till 20-25 weeks of age and were considered diabetic when blood glucose levels were more than 250 mg/dl on 2 consecutive days.

RESULTS

EXAMPLE 1 - GRP78 is post-translationally modified in human islets of Langerhans upon inflammatory stress.

Exposure of human islets of Langerhans to a combination of the pro-inflammatory cytokines IL-Ιβ (50 U/ml), IFNy (1000 U/ml) and TNFa (1000 U/ml) significantly induced cell death after 72h (14,8%) compared with control islets (6,5%) (p<0,001, n=8), whereas no increased cell-death was observed after 24h treatment (Figure 1). In addition, proteome analysis by 2D-DIGE after 72h cytokine-exposure revealed that 224 proteins spots out of 7489 (p<0.05; N=5) were differentially expressed. In this study we mainly focused on the expression of the endoplasmic reticulum chaperon GRP78. In human islets, 5 isoforms of GRP78 that differ in isoelectric point, but not in molecular weight, were detected (Figure 2). Two of these GRP78 isoforms were significantly upregulated upon cytokine exposure (Figure 3) (Isoform II : 1.5 fold upregulated, p=0.041; Isoform 12 : 1.64 fold upregulated, p=0.030). Interestingly, in addition to this, a shift in relative abundance between the most abundant GRP78 isoform in control islets (II) and the isoform with lower isoelectric point (12) was observed in three out of five donors after cytokine exposure (Figure 2). As such, in islets from donors R130, R133 and R138, a relative increase of GRP78 isoform 2 was observed (Figure 3), indicating that inflammatory cytokines can induce PTM of GRP78 in human islets, extending our previous findings in mouse islets and INS-IE cells, where we showed that this modification resulting in a more acidic GRP78 isoform, was caused by citrullination of Arg-residue 510 [Rondas D, et al. (2015) Diabetes 64: 573-586] .

EXAMPLE 2 - Citruiiinated GRP78 peptides can be presented in TID predisposing HLA molecules

Based on the findings in human islets that were exposed to inflammatory stress, a panel of native and citruiiinated peptides was designed, covering the full length GRP78 sequence. For this, we made use of in-house developed software allowing in-silico prediction of peptide-sequences that have high affinity for the TID susceptibility HLA types, namely HLA Class-II DR4 and DQ8 (Table 4). This indicated a variable in-vitro binding of these peptides to the respective HLA molecules (Figure 4a). Regarding Class-II DR4 binding, the strongest relative binding was observed for peptides 25-26. However peptides 31, 33 and 39 were also selected for further investigation, since for these epitopes, exclusively the citruiiinated peptides could be presented in HLA DR4 molecules. Binding affinity for HLA Class-II DQ8 GRP78 peptides was weaker when citruiiinated for most of the peptide pairs analyzed, except for peptide pair 41-42 (Figure 4b).

EXAMPLE 3 - CD4+ T-cells recognizing a citruiiinated GRP78 epitope are detected in a lymphocytic islet-outgrowth from a TID patient.

The relevance of citruiiinated GRP78 as auto-antigen in TID was in a first approach investigated by detecting reactive CD4+ T-cells in islets of Langerhans from TID patients. To study the islet-infiltrating T-cell repertoire in TID patients, hand-picked human islets from 9 TID donors (Table 2) and 7 healthy control donors (Table 3) were cultured in favor of T-cell growth. This lead to the generation of a large number of T-cell clones (236). CD4+ T cell clones were detected in 8 out of 9 donors with TID (p=0.02 as compared to the islets from the healthy control donors). One of these CD4+ T-cell lines, isolated from a 22 year-old female TID donor who had diabetes for 6 years, recognized GRP78 peptide 27, where arginine was converted to citrulline at position 297. A significant increase in IFNy secretion was detected (p=0.04) while the native peptide of this epitope (peptide 28) did not activate the CD4+ T-cell clone. This finding showed the importance of citruiiination in human T1D patients for breaking of immune tolerance against this citrullinated GRP78 epitope (Figure 5). Table 2: characterization of T1D donors from islets that were collected for lymphocytic outgrowth.

Summary of demographics, disease duration, other diagnoses, HLA, autoantibodies, insulin, cellular infiltrate, numbers of islet-infiltrating T cells detected, sorted and grown, and T cell autoreactivities detected for islets isolated from donors with T1D. * Numbers of CD4/CD8 T cell lines grown from individual cultured, hand-picked islets.

ND- Not done. Table 3. Characteristics of healthy donors from islets that were collected for lymphocytic outgrowth.

Demographics, HLA, autoantibodies, insulin, cellular infiltrate, and lack of islet infiltrating T cells detected, sorted and grown from islets detected for non-TID donors.

*Islet source- NDRI, National Disease Research Interchange

**Islet source- IIDP, Integrated Islet Distribution Program

#Islet source- Prodo Labs. EXAMPLE 4 - CD4+ T-cells recognizing GRP78 epitopes are detected in the circulation of TID patients.

Next, the presence of CD4+ T-cells, reactive against citrullinated GRP78 epitopes in peripheral blood, was investigated by ex-vivo tetramer assays to explore their potential as biomarker as well as their relevance in disease development in TID. Based on the results of the in vitro binding assays (see above under 2), we selected the citrullinated peptides 25, 31, 33 and 39 for evaluating reactivity of HLA-Class II DR4 in six healthy controls and six TID patients (Table 5). For all four peptides, a positive reaction was observed in TID patients and/or healthy subjects (Figure 6a). Interestingly, one epitope (peptide 31, sequence EVTFEIDVNGILXVT), citrullinated at position 510, was detected exclusively in PBMCs of three out of six TID patients and not in healthy subjects (0/6) (Figure 6). Furthermore, a T-cell clone against this citrullinated GRP78 peptide 31 could be generated and preferential recognition of the citrullinated GRP78 epitope by this clone was confirmed, since 79.6% of the T-cells bound to peptide 31 versus only 10.4% to the native GRP78 peptide 32 (Figure 7). These findings show that CD4+ T-cells reactive against citrullinated epitopes are present in the circulation of humans, with a high prevalence for GRP78 epitope 31 in TID patients. Interestingly, this is the same citrullinated peptide epitope against which autoreactive T-cells were shown to be present in new-onset diabetic NOD mice [Rondas D, et al. (2015) Diabetes 64: 573-586] .

EXAMPLE 5 - Vaccination of 3-week old NOD mice with citrullinated GRP78 protects against diabetes onset.

Although it is unlikely that citrullinated GRP78 is a primary auto-antigen in TID, but rather plays a role in amplification of the autoimmune disease process, we aimed to evaluate if injection of in-vitro citrullinated (IVC) GRP78 can delay or protect against diabetes development.

Following up on previous findings which indicated that NOD mice show auto reactivity against citrullinated GRP78 [Rondas D, et al. (2015) Diabetes 64: 573- 586], 3-week old female NOD mice were vaccinated by subcutaneous injection with 50 full length GRP78 protein (N= 14) or 50 \Jtg IVC GRP78 (N = 12), emulsified 1 : 1 in IFA, or with PBS/IFA or PBS alone as control groups. Follow-up of diabetes incidence until the age of 26 weeks, revealed that NOD mice vaccinated with IVC GRP78 showed a significantly lower diabetes incidence, with 8.33% of mice being diabetic at 26 weeks of age, compared to 55.56% in PBS/IFA controls (p< 0.05) and to 83.33% in PBS controls (p<0.001) (Figure 8). Also of note, is that onset was later in mice vaccinated with IVC GRP78, as compared to PBS/IFA or PBS injected mice. No significant protection was observed for mice vaccinated with native GRP78 (35.71% diabetic). Although further evaluation of the mechanism of protection is needed (and at present ongoing), these results put citrullinated GRP78 forward as a promising therapy for TID patients.

EXAMPLE 6 - CD4+ T-cells recognizing the citrullinated GRP78 epitope 195- 209X (SEQ ID NO: 1, peptide 25) are detected in the circulation of TID patients

The presence of CD4+ T-cells in peripheral blood of HLA-DRB1*0401 healthy controls (n = 12, average age 32.9 ± 10.5 years) and TID patients (n = 13, average age 30.4 ± 8.7 years and 3.57 ± 1.4 years of TID diagnosis) was investigated by ex-vivo tetramer assays.

Reactivity was tested against the citrullinated GRP78 peptides 25 (195-209X, SEQ ID NO: 1) and 31 (498-512X, SEQ ID NO: 3) that had binding affinity for HLA- DRB1*0401 molecules and showed preliminary evidence to be recognized as autoantigen by in-vitro tetramer assays (Figure 4a). Two independent analyses were performed in parallel at the Benaroya research institute (Seattle, USA) and at KU Leuven (Leuven, Belgium). The results from both Institutes showed significantly higher T-cell frequencies against peptide 25 (195-209X) in TID patients compared to healthy controls (p<0.05) (Figure 10 a-b). In addition, a clear trend was also observed for the frequency of CD4+ T-cells recognizing peptide 31 (498-512X) (Figure 10 c-d). EXAMPLE 7 - Vaccination of NOD mice with citGRP78 peptide 27 (SEQ ID NO: 2, 292-305X) protects against diabetes development.

Vaccination of 3 week-old NOD mice with the citrullinated GRP78 peptide 27 (292- 305X), against which CD4+ T-cells were detected in islets from a TID patient (Figure 5), significantly protected against the development of diabetes at 21 weeks of age (0% diabetic, n= 5) compared to PBS injected mice (p<0.05) (80% diabetic, n= 5) and IFA injected mice (p<0.05) (60% diabetic, n=5) (Figure 11).