Primary cell are being used in transplantation settings. Most experience has been obtained with blood cells such as erythrocytes and blood platelets. Also bone marrow transplantations have been done for quite some time now. Where various cell types in the bone marrow transplant provide short term relief in the host, long term reconstitution of the blood system is achieved only by successful engraftment of hemopoietic stem cells of the donor bone marrow.

Since these initial transplantation successes many different cell types and even organs have been transplanted.

The present invention provides a novel type of cells suited for transplantation. Cells of the invention have favorable properties in among others wound healing, blood vessel stabilization and in dampening immune responses against the individuals own cells or transplanted foreign organs and cells.

In some aspects cells of the invention resemble mesenchymal stromal cells (MSCs). MSCs are immune modulatory and anti-fibrotic cells originally isolated from the bone marrow (bmMSCs) and are characterized by their spindle shaped morphology and ability to adhere to plastic. bmMSC are able to differentiate into fat, bone and cartilage and express the stromal markers CD73, CD90 and CD 105 while being negative for CD34 and CD45 (Pittenger, Mackay et al. 1999, Dominici, Le Blanc et al. 2006). In several experimental models of kidney disease (a.o. cisplatin, glycerol and ischemic injury) MSC treatment enhanced tissue repair and reduced fibroses (Morigi, Introna et al. 2008, Wang, He et al. 2013) In a transplantation model, MSC therapy could prolong graft survival and a T-reg dependent tolerance was observed (Casiraghi, Azzollini et al. 2008). These promising results let to the first clinical trials with bmMSCs in renal transplantation. Although the group sizes are small and the studies were mainly set up to show that MSC therapy is safe and feasible, the first results suggest an immunomodulatory effect of bmMSC therapy (Perico, Casiraghi et al. 2011, Tan, Wu et al. 2012, Perico, Casiraghi et al. 2013, Reinders, de Fijter et al. 2013).

Previously it has been shown that perivascular stromal cells from different solid organs express various markers among which there are NG2, PDGFR-β and

CD 146. These perivascular stromal cells exhibit MSC-like characteristics (Crisan, Yap et al. 2008). The perivascular location of these cells allows for close interaction with several cell types including endothelial cells, epithelial cells, resident macrophages and dendritic cells. Recruitment of inflammatory cells is possible and these cells are likely to have a role in tissue homeostasis (Rabelink and Little 2013).

MSC like cells can be isolated from murine kidneys (kCFU-F). Although these kCFU-F have a comparable stromal marker expression and trilineage

differentiation potential compared to bmMSCs, there is a distinct gene and protein expression profile (Pelekanos, Li et al. 2012) This suggests that although kCFU-F and bmMSCs may look similar at the surface, functionally there may be

differences. Li et al. showed that these cells are indeed different compared to bmMSCs as kidney MSC-like cells, in particular the HoxB7 positive fraction isolated from the collecting duct, were able to integrate into the collecting duct in neonatal mice while bmMSCs did not have this capacity (Li, Ariunbold et al. 2015).

In the present invention we show that human kidneys have perivascular stromal cells and that these cells can be isolated from the human kidney (kPSCs) and propagated in vitro. We further show that the propagated cells actively support kidney repair and that these cells are more potent than perivascular cells derived from other organs. Without being bound by theory it is believed that this is due to tissue specific imprinting. The present invention shows that kPSCs can be isolated and propagated in a clinical grade manner and in sufficient quantities for in vivo application. The invention therefore provides a cell source for cell therapy which compares well with the currently most studied stromal cell population for cell therapy, bmMSCs and even outperforms these cells in at least some aspects.

Human kPSCs of the present invention do not fulfill the ISSCT criteria for MSCs. They, for instance, do not differentiate into adipocytes. The cells of the invention exhibit a distinct mRNA expression profile and show tissue homeostatic capacities as they have immune modulatory functions, are able to stabilize endothelial cells and can enhance kidney epithelial repair. The human kPSCs of the invention are therefore a distinct cell population and are a promising new cell therapy candidate for kidney diseases and transplantation.

SUMMARY OF THE INVENTION

The invention provides a method for culturing human kidney cells comprising

a) providing a cell suspension of a human kidney or part thereof;

b) culturing cells of the suspension of step a) on a cell culture surface for

adherent cells;

c) producing a single cell suspension from cells that adhered to said cell

culture surface; d) collecting Chondroitin Sulfate Proteoglycan 4 (also known as NG2) positive cells from said single cells suspension and

e) culturing collected NG2 positive cells on the presence of a cell culture

surface for adherent cells.

The invention further provides a collection of kidney- derived cells obtainable by a method according to invention.

The invention also provides a collection of kidney- derived cells that exhibits multilineage differentiation capacity as exemplified by the formation of osteocytes and chondrocytes from a culture of 10e5 of said cells and the lack of formation of adipocytes from a culture of 10e5 of said cells.

The invention further provides a collection of kidney- derived cells that is positive for expression of cell surface marker CD73, CD90, CD 105, CD 146, NG2,

PDGFRbeta, or HLA-class I or a combination thereof and negative for CD31, CD34, CD45, or CD 133 or HLA-DR or a combination thereof.

Also provides a method for the treatment of an individual having or at risk of having kidney damage, the method comprising administering a collection of cells according to the invention to the individual in need thereof.

Further provided is a method for the treatment of an individual having or at risk of having an undesired immune response, the method comprising administering a collection of cells according to the invention to the individual in need thereof.

Further provides is a method for stabilizing a blood vessel comprising providing a system comprising or forming said blood vessel with a collection of cells according to the invention.

The invention also provides a collection of cells of the invention for use in the treatment of an individual having or at risk of having: kidney damage; an undesired immune response or a vascular disease, preferably a microvascular disease.

The invention further provides a medium conditioned by cultured perivascular stromal cells wherein the medium is obtained by preparing a suspension of a mammalian kidney or part thereof; culturing cells of the suspension in the presence of a cell culture surface for adherent cells; producing a single cell suspension from cells that adhered to the cell culture surface; collecting

Chondroitin Sulfate Proteoglycan 4 (CSPG4) positive cells from said single cells suspension and culturing collected CSPG4 positive cells in the presence of a cell culture surface for adherent cells and a medium and harvesting the medium of the culture to obtain the conditioned medium.

Also provided is a method of perfusion of an organ with a perfusion fluid wherein the perfusion fluid comprises medium that is conditioned by cultured perivascular stromal cells, wherein the organ is preferably a kidney, liver, pancreas, heart, or lung.

The invention further provides a method of improving donor organ quality ex vivo or epithelial repair of an organ ex vivo comprising perfusing the organ with perfusion fluid comprising medium that is conditioned by cultured perivascular stromal cells.

The invention further provides use of HGF for improving donor organ quality ex vivo or epithelial repair of an organ ex vivo.

DETAILED DESCRIPTION OF THE INVENTION

It is preferred that the kidney is a primate or a Sus scrofa domesticus or Sus domesticus (domestic pig) kidney. The primate is preferably a human. The term adult when used in the context of a human refers to an individual of 18 years of age or older. The cells of the invention can also be collected from kidneys of post-natal individuals. The cells are preferably obtained from human individuals that are at least 12 years of age, preferably at least 15, more preferably at least 18 years of age. Organs typically deteriorate in quality with increasing age. Cells can also be collected from older individuals, for instance older than 65, as long as the quality of the kidney is sufficient for transplantation.

Cell suspensions of a kidney can suitably be obtained from transplant grade kidneys, preferably human transplant grade kidneys. The kidneys used for the present invention were obtained from transplant grade kidneys that were not used for surgical reasons. Transplant grade kidneys are kidneys from individuals with no known renal disease and which have been surgically harvested at a time point when ischemic damage is minimal. The cells of the invention can be obtained by flushing the kidney after surgery with a physiological salt solution that contains heparin. A cell suspension of kidney cells can be obtained by perfusion of the kidney with a collagenase or other protease that can digest extracellular matrix proteins. A DNAse is often added to reduce aggregation due to lysis of cells. It is preferred to use the perfusion solution described in the example section. Perfusion is preferably done via a renal artery cannula. Collected cells can be cultured directed or frozen for later use. It is preferred that perirenal fat and kidney capsule are removed prior to initiation of the perfusion with the enzyme solution(s). The kidney is preferably an intact kidney. Parts of the kidney can also be used. In such case it is preferred that the part contains the renal artery. A part preferably comprises one or more large arteries, one or more afferent arterioles, one or more efferent arterioles or a combination thereof.

The cells of step e) can be cultured in vitro for a number of passages. Cultures from freshly isolated cells typically exhibit a first crisis after initiation of the culture and a second crises when the cells remaining reach senescence. The first crisis particularly occurs when the culture conditions are not suited for the propagation of endothelial cells. This is for instance the case when the cells are cultured on a plastic surface. Endothelial cells do not easily adhere not such surfaces and do not noticeably grow thereon.. Cells collected in step d) are preferably subjected to further purification, for instance to remove endothelial cells and/or epithelial cells if needed, in such case the first crisis can be reduced or be absent entirely.

Epithelial cells are typically not NG2 positive. Cell suspensions are typically suspensions of single cells but may contain cell aggregates. Cell suspensions can contain debris such as cell debris or matrix material. A single cell suspension typically contains at least 90.% single cells (based on the number of single cells and the total number of single cells and aggregates containing more than 1 cell). Single cell suspensions are easily made by mild proteolytic treatment of adherent cells. In cell culture trypsin is usually used for such purposes. In harvesting the cells from organs typically other proteolytic enzymes are used (see elsewhere herein). The single cell suspension is preferred for use in purifying cells by means of cellular markers. Single cell suspensions are typically also made for routine culturing and passaging of the cell culture, but this is not critical.

The cell culture surface for adherent cells is typically a surface of a culture dish for adherent cells. Thus the culture surface is preferably a culture dish for adherent cell culture. Such dishes are typically made from plastic that is charged. Suitable dishes can also be made by coating a surface with a protein, typically gelatin, laminin, fibronectin or the like. The cell culture surface can also be a bead (or carrier) that is suitable for adherent cell growth. Such beads are typically referred to as microcarriers; a support matrix allowing for the growth of adherent cells in for instance biore actors. An adherent cell culture dish or cell culture surface can also be a dish that contains a carrier to which the cells can adhere. Suitable carriers are known in the art and include but are not limited to microcarriers.

Chondroitin Sulfate Proteoglycan 4 (CSPG4; also known as NG2) positive cells are preferably collected by incubating the cells with an antibody that binds to CSPG4 on the surface of CSPG4 expressing cells. The antibody preferably specifically binds CSPG4 in that it does not bind cells in the suspension that do not express CSPG4. The cells multiply during culture and are very suited for a number of different purposes as detailed elsewhere herein. The invention therefore provides a collection of kidney- derived cells obtainable by a method according to invention. The collection of kidney- derived cells exhibits multilineage differentiation capacity as exemplified by the formation of osteocytes and chondrocytes from a culture of 10e5 of said cells and the lack of formation of adipocytes from a culture of 10e5 of said cells. The inability to differentiate into adipocytes as indicated herein sets the collection of cells of the invention aside from mesenchymal stromal cells (MSC). A hallmark of MSC is that such cells can differentiate into the adipocyte lineage. The cells of the invention lack this ability from the onset of the culture. I.e. immediately upon conclusion of step e) of the method of the invention.

The composition of the culture medium for the cells of the invention is not very critical although some media perform better (yield a higher division rate; or higher number of cells) than others. Suitable media are normal AMEM or DMEM supplemented with 10% normal human serum or 5% human platelet lysates. For the differentiation tests the following media are recommended:

■ Adipogenic: hMSC Adipogenic Differentiation BulletKit™ Medium (Lonza) provides both an induction medium and a maintenance medium guaranteed to induce adipogenic differentiation of human bone marrow derived mesenchymal stem cells into mature, functionally active adipocytes; Each bottle of the hMSC Adipogenic Differentiation BulletKit™ Medium contains enough induction medium and maintenance medium to fully differentiate approximately 3 million human bone marrow derived mesenchymal stem cells [approximately 15 wells in a 6-well plate format] into mature, functionally active adipocytes. Chondrogenic: hMSC Chondrogenic Differentiation BulletKit™ Medium

(Lonza), with the addition of TGF-B3 (provides a differentiation medium appropriate to induce chondrogenic differentiation of human adipose derived mesenchymal stem cells into mature, functionally active chondrocytes; Each bottle of the hMSC Chondrogenic Differentiation BulletKit™ Medium, with the addition of TGF-B3 (sold separately), contains enough differentiation medium to fully differentiate approximately 12.5 million human adipose derived mesenchymal stem cells [approximately 25 micropellets] into mature, functionally active chondrocytes).

■ Osteogenic: hMSC Osteogenic Differentiation BulletKit™ Medium (Lonza) provides a differentiation medium appropriate to induce osteogenic

differentiation of human adipose derived mesenchymal stem cells into mature, functionally active osteoblasts; Each bottle of the hMSC Osteogenic

Differentiation BulletKit™ Medium contains enough differentiation medium to fully differentiate approximately 200,000 human adipose derived mesenchymal stem cells [approximately 20 wells in a 24-well plate format] into mature, functionally active osteoblasts. A collection of kidney- derived cells of the invention is positive for expression of cell surface marker CD73, CD90, CD 105, CD 146, NG2, PDGFRbeta, or HLA-class I or a combination thereof and negative for CD31, CD34, CD45, CD 133 or HLA-DR or a combination thereof.

Chondroitin Sulfate Proteoglycan 4 or CSPG4 is also known under a number of aliases such as MSK16; Melanoma-Associated Chondroitin Sulfate Proteoglycan; NG2; Chondroitin Sulfate Proteoglycan 4 (Melanoma-Associated); HMW-MAA; chondroitin Sulfate Proteoglycan NG2; MEL-CSPG; Melanoma Chondroitin Sulfate Proteoglycan; EC 2.7.8; MCSP; EC 3.6.3; MCSPG. External IDs; HGNC: 24661

Entrez Gene: 14642; Ensembl: ENSG000001735467; OMIM: 6011725; UniProtKB: Q6UVK13. The human gene is located on human chromosome 15 at position q24.2.

The invention further provides a method for the treatment of an individual having or at risk of having kidney damage. The method comprises administering a collection of cells according to the invention to the individual in need thereof. An individual with kidney damage has an Estimated Glomerular Filtration Rate (eGFR)<60; proteinuria >0,3 g/L or a combination thereof. The individual at risk is at risk of developing these values. The invention further provides a method for the treatment of an individual having a kidney biopsy inflammation, fibrosis, vascular damage, glomerular damage, tubular damage the method comprising

administering a collection of cells according to the invention to the individual in need thereof Further provided is a method for the treatment of an individual having or at risk of having an undesired immune response, the method comprising administering a collection of cells according to the invention to the individual in need thereof. In a preferred embodiment the undesired immune response is an auto-immune disease or a host versus graft disease. The auto-immune disease preferably affects renal function. The graft in the host versus graft disease is preferably a kidney or a fraction thereof. The fraction is preferably a cell fraction.

The invention further provides a method for the treatment of an individual having a vascular disease, preferably a microvascular disease comprising administering a collection of cells according to the invention to the individual in need thereof. In a preferred embodiment the vascular disease is a renal vascular disease, preferably a renal microvascular disease. Further provides is a method for stabilizing a blood vessel comprising providing a system comprising or forming said blood vessel with a collection of cells according to the invention. Suitable systems are in vivo conditions preferably in a kidney. The invention also provides a collection of cells of the invention for use in the treatment of an individual having or at risk of having: kidney damage; an undesired immune response, an unstable blood vessel or (micro)vascular disease. A collection of cells of the invention that is used in transplantation settings preferably comprises at least 10e5 cells/kg body weight, more preferably at least 2,5xl0e5, more preferably at least 10e6 and in a particularly preferred embodiment l-2xl0e6 cells/kg body weight.

A collection of cells of the invention can be administered in various ways. In a preferred embodiment the cells are administered intravenously, intra-renally, via the renal artery or underneath the kidney capsule. "Cells of the invention" refers to a kidney-derived cell population that can be obtained using a method for culturing kidney cells as described herein. A collection of the invention comprises cells of the invention.

"Differentiation" is the process by which an unspecialized ("uncommitted") or less specialized cell acquires the features of a specialized cell, such as a kidney cell, for example. A "differentiated or differentiation-induced cell" is one that has taken on a more specialized ("committed") position within the lineage of a cell. The term "committed," when applied to the process of differentiation, refers to a cell that has proceeded in the differentiation pathway to a point where, under normal circumstances, it will continue to differentiate into a specific cell type or subset of cell types, and cannot, under normal circumstances, differentiate into a different cell type or revert to a less differentiated cell type.

As used herein, the "lineage" of a cell defines the heredity of the cell, i.e., which cells it came from and what cells it can give rise to. The lineage of a cell places the cell within a hereditary scheme of development and differentiation. A "lineage- specific marker" refers to a characteristic specifically associated with the phenotype of cells of a lineage of interest and can be used to assess the

differentiation of an uncommitted cell to the lineage of interest. Osteocytes, chondrocytes and adipocytes are different mesoderm derived cell types with distinct molecular and morphological phenotypes. Osteocytes are involved in bone restructuring, chondrocytes are involved in cartilage formation and adipocytes are fat cells. Cell of the invention as used herein are mammalian kidney- derived cells that can give rise to cells such as osteocytes or can give rise to one or more types of tissue, for example, renal tissue. The cells of the invention can also produce cells of similar differentiation potential as itself (i.e. it can self-renew) under the appropriate culture conditions. The term proliferation is sometimes also used to refer to the generation of two or more daughter cells that are essentially similar in function as the mother cell they originate from. The isolated or purified mammalian kidney- derived cell population of the invention is stable and capable of expansion in cell culture. The mammalian kidney- derived cell population has been identified phenotypically as cells that are positive for expression of at least one of CD73, CD90, CD105, CD146, NG2, PDGFRbeta, or HLA-class I or a combination thereof and negative for CD31, CD34, CD45, CD133 or HLA-DR or a combination thereof. The cells of the invention express HoxDIO, HoxDl l or a combination thereof. In a preferred embodiment the cells express HoxDl l. HoxDIO or homeobox D10 is also known under various other names, i.e. Homeobox Protein Hox-4E; HOX4D; HOX4E; HOX4; Hox-4.4; Homeo Box D10; Homeo Box 4D; Homeobox Protein Hox-4D and Homeobox Protein Hox-D10. External Ids are: HGNC: 51331; Entrez Gene: 32362; Ensembl: ENSG000001287107; OMIM:

1429845 and UniProtKB: P283583.

HoxDl l or Homeobox Dl l is also known under various other names, i.e. Homeobox Protein Hox-4F; HOX4F; Homeo Box 4F; HOX4; Homeobox Protein Hox-Dl l; Homeo Box Dl l; or Hox-4.6, Mouse, Homolog Of. External Ids are: HGNC: 51341; Entrez Gene: 32372; Ensembl: ENSG000001287137; OMIM: 1429865; UniProtKB: P312773.

Collections of cells or cells of the invention that express HoxDIO, HoxDl l or a combination thereof preferably express more HoxDIO, HoxDl l or a combination thereof than bmMCS of the same species and under otherwise similar conditions. In a preferred embodiment it is HoxDll that is expressed more.

Cultures, and collections of cells of the invention are so-called primary cell cultures and collections of primary cells. The term "primary" in this context refers to the usual meaning in the art of tissue culture. It typically is used to identify "normal" untransformed cells that are taken from an individual and untransformed progeny thereof. The primary cell is typically restricted in the number of cell divisions it can undergo. At the end of this number the cells stop dividing and eventually die, leading to what is generally referred to as a crisis of a culture. This is also referred to as primary cells reaching senescence. Sometimes a number of cells survive the crises and have acquired unlimited cell division potential. Such cells are typically not referred to as primary cells. Also tumor cells are not considered primary cells, also not when just in culture.

"Transplanting", "implanting", "transplantation", "grafting" and "graft" are used to describe the process by which cells, preparations, and collections of the invention are delivered to the site within the patient where the cells are intended to exhibit a favorable effect, such as repairing damage to a patient's tissues, treating a disease, injury or trauma, or genetic damage or environmental insult to an organ or tissue caused by, for example an accident or other activity. Cells, preparations, and compositions can also be delivered in a remote area of the body by any mode of administration relying on cellular migration to the appropriate area in the body to effect transplantation. "Isolated" or "purified" refers to altered "by the hand of man" from the natural state i.e. anything that occurs in nature is defined as isolated when it has been removed from its original environment, or both. "Isolated" also defines a

composition, for example, a mammalian kidney- derived cell population, that is separated from contaminants (i.e. substances that differ from the cell). In an aspect, a population or composition of cells is substantially free of cells and materials with which it may be associated in nature. "Isolated" or "purified" or "substantially pure", with respect to mammalian kidney- derived cells, refers to a population of mammalian kidney- derived cells that is at least about 50%, at least about 75%, preferably at least about 85%, more preferably at least about 90%, and most preferably at least about 95% pure, with respect to mammalian kidney- derived cells making up a total cell population. Recast, the term "substantially pure" refers to a population of mammalian kidney- derived cells of the present invention that contain fewer than about 50%, preferably fewer than about 30%, preferably fewer than about 20%, more preferably fewer than about 10%, most preferably fewer than about 5%, of lineage committed kidney cells in the original unamplified and isolated population prior to subsequent culturing and

amplification. Purity of a population or composition of cells can be assessed by appropriate methods that are well known in the art. The present invention also provides a method of treatment, which uses mammalian kidney- derived cells of the invention or specifically differentiated mammalian kidney- derived cell populations derived from cells of the invention for therapy comprising administering the cells to an individual in need thereof. Cells of the invention or differentiated cells derived from mammalian kidney- derived cells of the invention can be used to treat disorders involving tubular, vascular, interstitial, or glomerular structures of the kidney. For example, the cells can be used to treat diseases of the glomerular basement membrane such as Alports Syndrome; tubular transport disorders such as Bartter syndrome, cystinuria or nephrogenic diabetes insipidus; progressive kidney diseases of varied etiologies such as diabetic nephropathy or glomerulonephritis; Fabry disease, hyperoxaluria, and to accelerate recovery from acute tubular necrosis. The cells can also be used to treat disorders such as acute kidney failure, acute nephritic syndrome, analgesic nephropathy, atheroembolic renal disease, chronic kidney failure, chronic nephritis, congenital nephrotic syndrome, end-stage renal disease, Goodpasture's syndrome, IgM mesangial proliferative glomerulonephritis, interstitial nephritis, kidney cancer, renal cancer, hypernephroma; adenocarcinoma of renal cells, kidney damage, kidney infection, kidney injury, kidney stones, lupus nephritis, membranoproliferative GN I, membranoproliferative GN II, membranous nephro athy, minimal change disease, necrotizing glomerulonephritis,

nephroblastoma, nephrocalcinosis, nephrogenic diabetes insipidus, nephropathy - IgA, nephrosis (nephrotic syndrome), polycystic kidney disease, poststreptococcal GN, reflux nephropathy, renal artery embolism, renal artery stenosis, renal disorders, renal papillary necrosis, renal tubular acidosis type I, renal tubular acidosis type II, renal underperfusion, renal vein thrombosis, focal segmental glomerulosclerosis (FSGS), ANCA vasculitis with renal involvement, renal limited vasculitis, ANCA glomerulonephritis, renal trombotic microangiopathy (TMA), and kidney transplantation related: hyper acute rejection, acute rejection, subacute rejection or chronic allograft nephropathy/IFTA (interstitial fibrosis and tubular atrophy).

Shortage of donor organs has increased consideration for use of historically excluded grafts. Ex-vivo perfusion is an emerging technology that holds the potential for organ resuscitation and reconditioning, potentially increasing the quality and number of organs available for transplantation. The present invention provides improved means and methods for perfusing organs. The means and methods allow for improved quality of transplantation organs subsequent to perfusion and even render at least some organs that would otherwise have been discarded for quality reasons suitable for transplantation.

Flow and pressure-based machine perfusion has shown improved kidney graft function and survival, especially among expanded criteria donors. Perfusion and in particular pressure-based machine transfusion is demonstrating promising results in preservation and resuscitation of kidney, liver, pancreas, heart, and also lung grafts. The Food and Drug Administration approved of XPS XVIVO Perfusion System (XVIVO Perfusion Inc., Englewood, Colorado, USA), a device for preserving and resuscitating lung allografts initially considered unsuitable for

transplantation. In the present invention the perfusion fluid is changed to conditioned medium (defined elsewhere herein), or conditioned medium is added to the perfusion fluid. This improves preservation of the organ. This also improves the quality of the organ for transplantation, at least in part by facilitating epithelial repair in the organ.. The invention provides a medium conditioned by cultured perivascular stromal cells (conditioned medium) wherein the medium is obtained by preparing a suspension of a mammalian kidney or part thereof; culturing cells of the suspension in the presence of a cell culture surface for adherent cells; producing a single cell suspension from cells that adhered to the cell culture surface; collecting Chondroitin Sulfate Proteoglycan 4 (CSPG4) positive cells from said single cells suspension and culturing collected CSPG4 positive cells in the presence of a cell culture surface for adherent cells and a medium and harvesting the medium of the culture to obtain the conditioned medium. The conditioned medium is preferably a medium conditioned by kidney- derived cells according to the invention. The medium preferably comprises hepatocyte growth factor (HGF).

The medium to be conditioned by the perivascular stromal cells can be AMEM or DMEM supplemented with 10% normal human serum or 5% human platelet lysates. Synthetic, Xeno-free or serum-free media are also available. An example of a suitable medium is StemMACS™ MSC Expansion Medium from Milteyni. The medium is preferably placed over confluent or semi-confluent cultures of perivascular stromal cells and incubated. The incubation is typically 24 hours or less. A suitable incubation period is 4-6 hours. The medium is typically collected by filtration of the supernatant of the cells (suitable a 0,45 uM or 0,22 uM filter). The collected medium can be processed to remove nutrients and waste if needed. For instance by means of ultrafiltration. The cut-off of the ultrafiltration filter is typically such that small proteins are retained (3-20 Kd). The cut-off is preferably such that at least hepatocyte growth factor is retained. Hepatocyte growth factor/scatter factor (HGF/SF) is a paracrine cellular growth, motility and morphogenic factor. It is secreted by mesenchymal cells and targets and acts primarily upon epithelial cells and endothelial cells, but also acts on haemopoietic progenitor cells and T cells. It has been shown to have a major role in embryonic organ development, specifically in myogenesis, in adult organ regeneration and in wound healing. It is secreted as a single inactive polypeptide and is cleaved by serine proteases into a 69-kDa alpha-chain and 34-kDa beta-chain. A disulfide bond between the alpha and beta chains produces the active, heterodimeric molecule.

Medium of the present invention can be, (ultra)-filtered, concentrated or diluted to arrive at the conditioned medium of the invention.

Conditioned medium of the invention is preferably used to perfuse organs ex-vivo. The medium performs better than standard perfusion fluids. The invention further provides a method of perfusion of an organ with a perfusion fluid wherein the perfusion fluid comprises medium that is conditioned by cultured perivascular stromal cells. The organ is preferably a human organ. Preferably the organ is a kidney, liver, pancreas, heart, or lung (or a transplantable part thereof). The heart is herein a muscular organ. The invention further provides a method of improving donor organ quality ex vivo or epithelial repair of an organ ex vivo comprising perfusing the organ with perfusion fluid comprising medium that is conditioned by cultured perivascular stromal cells. The medium is a preferably a conditioned medium of the invention. The invention further provides the use of HGF for improving donor organ quality ex vivo or epithelial repair of an organ ex vivo. Ex-vivo (machine) perfusion of solid organs using a method of the invention provides the opportunity for resuscitation and reconditioning of suboptimal grafts, and expanding the number and quality of donor organs. BRIEF DESCRIPTION OF THE DRAWINGS

Fig 1. Isolation method of human kPSCs. A) NG2 is expressed in the human kidney mainly around the arteries, arterioles and afferent and efferent arterioles of the glomerulus. CD271 (B) and PDGFR-β (C) are also expressed within the glomeruli and around the peritubular capillaries. D) Schematic representation of the isolation method. In order to obtain NG2 positive hkPSCs, human kidneys are continuously perfused with digestive enzymes to single kidney cells. Afterwards crude kidney cell suspensions were cultured on plastic for selection on plastic adherence and subsequently sorted for NG2 positivity resulting in the appearance of spindle shaped cells. Left scale bar in A, B and C 50 μηι, right scale bars in A 20 μηι.

Fig 2. Characterization of human kPSCs. A) hkPSCs have a similar morphology compared to bmMSCs and are positive for NG2 and PDGFR-B as shown with confocal images (B). C) Populations doubling of hkPSCs after FACS-confirmed NG2 positivity from three different isolations. D) Representative FACS analysis show that hkPSCs are positive for the pericytic markers NG2, PDGFR-β and CD 146 and the MSC markers CD73, CD90 and CD105 while being negative for CD31, CD34, CD45, CD56. hkPSCs express type I HLA (H LA-ABC) and are negative for type II HLA (HLA-DR). E) Mean fluorescent intensity of the different markers (n=3 donors.) F) Tri-lineage differentiation. hkPSCs differentiate into bone and cartilage but not into adipocytes.

Fig 3. Transcriptome analysis of human kPSCs compared to bmMSCs. A) When comparing all transcripts (35000), bmMSCs and hkPSCs show a similar expression profile as depicted by a pearson correlation score of 0.9625. B) hkPSCs and bmMSCs show an hierarchical clustering per cell type. C) Hierarchical clustering is also observed in Hox genes. D) Differential expression of HoxDl l and HoxDIO, homeobox factors important for nephrogenesis, as confirmed by PCR. (GEO accession GSE77227,

http://www.ncbi. nlm.nih.gov/geo/query/acc.cgi?acc=GSE77227)

Fig 4. Immunomodulatory and vascular stabilization function of hkPSCs A) Cytokine expression profile of unstimulated human kPSCs and bmMSCs B) PBMC suppression assay. Proliferation of activated peripheral blood mononuclear cells

(PBMCs) was decreased when cocultured with both hkPSCs and bmMSCs in a dose dependent matter, (ratio is number of activated PBMCs vs number of MSCs) C) When HUVECs are cocultured with either hkPSCs and bmMSCs endothelial networks were formed, which was not observed in monoculture. There were no significant differences in vascular plexus formation comparing coculture with bmMSCs or hkPSCs (D). E) No differences were observed in excretion of vascular growth factors by hkPSCs compared to bmMSCs. n=3 biological triplicates. ** p<0.001, n.s non-significant.

Fig. 5 hkPSCs are able to enhance epithelial repair in a wound scratch assay. A) Brightfield images showing representative images of the wound scratch assay in control medium or conditioned medium of hkPSCs and bmMSCs across a time period of 14 hours. B) Quantification of the rate of wound closure in all three conditions after 0, 4, 7, 14 and 28 hours. The wound closes significantly faster in the presence of hkPSC conditioned medium compared to bmMSC conditioned medium or control medium. C)Excretion of growth factors in the conditioned medium. HGF is excreted by hkPSCs but not by bmMSCs. n=3 biological triplicates. * p<0.05, ** pO.001, *** pO.0001

Fig 6. hkPSCs are able to survive and integrate into the kidney interstitium in a neonatal injection method. A) Cells and fluorescent microspheres were injected into the kidney of neonatal mice (PND1). B) Injection into the kidney was confirmed by fluorescent microspheric beads (*). C) hkPSCs injected into the kidneys of neonatal mice (PND1) were localized in the cortical interstitium as shown with specific antibodies for human mitochondria and human nuclei respectively (arrows). D) No bmMSCs could be found in the kidney 4 days after injection. Scale bar B) 500um, scale bar in C and D 50 um.

Fig 7: a) In the micro-array data, NG2 is increased in kPSCs compared to bmMSCs while pax2 and CD24 are negative. CD24 is also not observed on protein level as shown by facs histogram (b). This, in combination with the lack of adipocyte differentiation, suggests that kPSCs are a different cell type compared to previously described kidney pericytes and kidney MSC.

Fig. 8 HGF-receptor blocking. When the HGF-R is blocked when conditioned medium of kPSC is added to a wound scratch assay, a decrease in wound closure is observed, suggesting that HGF in the conditioned medium of kPSCs is one of the more prominent factors for wound closure in the conditioned medium. EXAMPLES

MATERIALS AND METHODS Isolation and expansion of clinical grade human kidney derived perivascular stromal cells

Cells were isolated from human transplant grade kidneys discarded for surgical reasons using clinical grade protocols, enzymes and products. For all kidneys a research consent was given and the study was approved by the local medical ethical committee and the ethical advisory board of the consortium.

Kidneys were flushed with UW cold storage solution (Bridge to life, Elkhorn, Wisconsin, US)) containing heparin (Leo Pharma, Ballerup, Denmark) directly after surgery and stored on ice. Within 30 hours kidneys were flushed again with UW and the perirenal fat and kidney capsule were removed. The renal artery was cannulated and the kidney was perfused via a pump driven (Masterflex Applikon, Schiedam, the Netherlands) recirculation system at 37 degrees with DMEM-F12 (Lonza) at 300ml/min. . Afterwards the kidney was perfused with collagenase (2500 units, NB1, Serva) and DNAse (2,5 ml Pulmozyme, Genentech) at 37°C with a flow of 300ml/min. After approximately 30 minutes, the tissue was digested and the cell suspension was washed in DMEM-F12 containing 10% fetal calf serum. Afterwards the cells were either directly put into culture or frozen in liquid nitrogen.

Kidney cell suspension was cultured in alphaMEM (Lonza, Verviers, Belgium) containing 5% platelet lysates, glutamine (Lonza, Basel, Switzerland) and penicillin/streptomyzine (Lonza) and cells were cultured in tissue culture flasks until confluency was reached. At passage 1 cells were trypsinized and NG2 cell enrichment was performed using MACS according to manufacturer's protocol (Miltenyi Biotech, Gladbach, Germany). Afterwards the NG2 positive selection was cultured in aMEM containing 5% platelet lysate. The cultures were maintained at 37°C and 5% carbon dioxide. Half of the medium was refreshed twice a week. When the cells reached confluence, the cells were collected using trypsin (Lonza) and re- plated at 4 xl03 cells/cm2. Experiments were performed with FACS confirmed homogeneous NG2 positive hkPSCs between passages 4-8 in aMEM 5% platelet lysate unless stated differently. Population doublings (PDs) were calculated for hKPSC from three different donors from the first FACS confirmed homogeneous population with the following formula: PD=log2(Ni N0) where NO is the number of cells plated and Ni the number of cells after trypsinization of a 100% confluent cell culture bottle.

Isolation and expansion of human bone marrow derived mesenchymal stromal cells

Ethical committee approval and written consent from the donors was obtained for the aspiration of human bone marrow. Heparinized bone marrow was aspirated under local or general anesthesia. The mononucleated cell fraction was isolated by Ficoll density gradient separation and plated in tissue culture flasks at a density of 160 xlO ³ mononucleated cells/cm2 in alphaMEM (Lonza) supplemented with penicillin/ streptomycin (Lonza) and 5% platelet lysate. The cultures were maintained at 37°C 5% carbon dioxide. Half of the medium was refreshed twice a week. When the MSC colonies or cultures reached confluence, the cells were collected using trypsin (Lonza) and re-plated at 4 xlO ³ cells/cm ² . Experiments were performed between passages 4-8.

Morphology and immunophenotype analysis

The expanded cell populations were characterized by morphology (spindle shaped cells) which was imaged with an inverted bright-field microscope (Leica DFC 295). For immunophenotyping, the cells were stained for NG2, PDGFR-β, CD146, CD73, CD90, CD 105, CD31, CD34, CD45, CD56, HLA class I (ABC) and HLA class II (DR). All specific fluorochrome-labeled antibodies and isotype controls were purchased from BD Bioscience (BD Bioscience, Franklin Lakes, NJ, USA) except for CD 105 (Ancell Corporation, Bayport, MN, USA).

Microarray sample preparation and data analysis

RNA was isolated from biological triplicates using Trizol reagent (Life

Technologies, Bleiswijk, the Netherlands) and the RNeasy kit (Qiagen, Heidelberg, Germany) according to the manufacturer's protocol. The quality and quantity of RNA was assessed using a Nanodrop spectrophotometer (Nanodrop Technologies, Wesington, USA) and a Bioanalyzer (Agilent Technologies, Santa Clara USA). Gene expression profiling was performed by Aros Applied Biotechnology (Aarhus, Denmark). cDNA and cRNA synthesis, labeling and subsequent hybridization on the Human HT12 V4 Gene Expression Beadchips (Illumina Inc., San Diego, USA) were performed according to manufacturer's protocols. The beadchips, targeting more than 47000 gene transcripts, were scanned using iSCAN system (Illumina Inc., San Diego, USA) and fluorescence intensities were uploaded into

GenomeStudio Software (Illumina Inc, San Diego, USA) Genes with a detection p- value of >0.05 for all samples were excluded. Subsequent data was quantile normalized and the Pearsons correlation coefficient was calculated (r ² ). Differential expression was analyzed using the gene expression module of Genome Studio (Illumina). For the table of the top differential expressed genes, genes with the highest diff. score were sorted on highest fold increase. Average signals>200 in either the bmMSCs or hKPSCs were taken and predicted values and open reading frames were excluded. False discovery rates (FDR) were calculated according to Benjamini and Hochberg for a total number of 8462 transcripts. All genes in the top 5 up- and down- regulated genes showed significant differential expression. For the heatmap the delta average signal of bmMSCs vs hkPSCs was set to 200 (which is the threshold of the measurement) and 2600 genes selected were analysed for clustering in R software. Clustering in R software was also performed for 27 homeobox genes. Expression of HoxDIO and HoxDl l was confirmed by Quantitative real-time polymerase chain reaction (PCR) in duplo of the same biological triplicates by using iQ SYBR Green Supermix on iCycler realtime detection system (BioRad, Veenendaal, the Netherlands). The real-time PCR primers of HoxDIO are AG AC AGTT GG AC AG AT C C G AA(fw) and

CGAAATGAGTTTGTTGCGCTTAT (rv) and of HoxD 11

TCGACCAGTTCTACGAGGCA (fw), and AAAAACT CGCGTTCCAGTTCG (rev). The amplification reaction volume was 12.5 in total, consisting of 6.25 iQ SYBR Green PCR master mix, 0.5 primers, 2.5 cDNA and 3.25 μΕ water. The messenger RNA (mRNA) level was normalized to the housekeeping gene glycerine aldehyde-3-phosphate dehydrogenase (GAPDH).

Tri-lineage differentiation potential

hkPSCs and bmMSCs were cultured in adipogenic, osteogenic and chondrogenic medium according to the manufactures protocols (Lonza). After 3 weeks of culture, in the adipogenic differentiation assay lipid droplets were stained using Oil Red O and in the osteogenic differentiation assay calcium depositions were stained with Alizarin Red. For chondrogenic differentiation cell pellets were formalin-fixed (4% PFA O/N) and embedded in paraffin. Subsequently 5 μηι sections were de- paraffinized, rehydrated and stained with 1% toluidine blue for 20 min. All differentiation assays were analysed with an inverted bright-field microscope (Leica DFC 295).

Cytokine excretion, peripheral blood mononuclear cell isolation and proliferation assay

hkPSCs and bmMSCs of 3 different donors were plated in flat-bottom 96-well plates and after 5 days of culture supernatants were harvested and cytokine expression profiles were determined in the supernatant with the Bio-Plex Human Cytokine 17-Plex Panel following the manufacturer's instructions (Bio-Rad

Laboratories, Veenendaal, the Netherlands). Cytokines in culture medium were also measured as a negative control.

Peripheral blood mononuclear cells (PBMCs) were isolated from buffy coats of healthy blood donors by density gradient centrifugation using Ficoll-isopaque and frozen in liquid nitrogen until use. Cultured hkPSCs and bmMSCs (passage 6-8) of 3 different donors were plated in flat-bottom 96-well plates (Costar, Sigma- Aldrich) and allowed to attach overnight in DMEM-F12 with 10% normal human serum (NHS). Culture in 10% NHS was chosen as platelet lysates are able to suppress PBMC proliferation on their own (data not shown). PBMCs were stimulated with anti-CD3/antiCD28 Dynabeads (Invitrogen) and were seeded in triplicate at a concentration of lxlO ⁵ cells/well. Stromal cells were added to the PBMC

proliferation assay in a ratio of 1:4 and 1:8. After 5 days ³ H-thymidine (0.5 mCi) was added and after 16 hours ³ H-thymidine incorporation was determined as a measure of proliferation. Vascular plexus assay

Human umbilical cords were obtained from the Leiden University Medical Center (Leiden, The Netherlands) after informed consent from the parents.

Human umbilical vein endothelial cells (HUVECs) were isolated according to Jaffe et al, with minor modifications: trypsin/EDTA (Sigma/Aldrich, Steinheim,

Germany) was used to enzymatically detach the endothelial cells from the vein and the endothelial cells were cultured on fibronectin-coated flasks (isolated from bovine plasma; Sigma/ Aldrich) and refreshed twice a week with EC-medium consisting of M199 Earl's salt with L-glutamine (Invitrogen, Carlsbad, US), supplemented with 10% (v/v) fetal calf serum (PAA Cell Culture Company), pen/strep (PAA Cell Culture Company, Pasching, Germany) 1000 IU of heparin (Leo Pharma, Ballerup, Denmark) and 25 mg bovine pituitary extract (BPE) (Invitrogen). HUVECs were used at passage 2-3. [14] Stromal cells and HUVECS were cocultured in a 96-wells plate (Costar, Sigma- Aldrich) for 1 week in a 4: 1 ratio as described previously. [15] After 1 week cells were fixated for 10 minutes with ice-cold methanol (100%) and endothelial sprouting was visualized with CD31 immune fluorescence (BD Bioscience, Franklin Lakes, NJ, USA, Zeiss LSM500). The percentage capillary coverage was analyzed with imageJ software.

Kidney epithelial wound scratch assay

hkPSCs and bmMSCs of 3 different donors were plated in a density of 200.000 cells/well in a 6 well culture plate (Costar, Sigma-Aldrich) and cultured for 48 hours. HK2 cells were seeded in PTEC medium consisting of a 1: 1 ratio of

Dulbecco's modified Eagle's medium and Ham's F-12 (Seromed Biochem, Berlin, Germany) supplemented with insulin (5μg/ml), transferrin (5μg/ml), selenium (5ng/ml), hydrocortisone (36 ng/ml), tr-iodothyrinine (40 pg/ml) and epidermal growth factor (10 ng/ml) (Sigma-Aldrich) in a density of 500.000 cells/well in a 6 wells cell culture plate (Costar) and cultured until confluent. A scratch wound was created in the monolayer of HK2 cells using a 200μ1 pipette tip. After the scratch, cells were washed with PBS and provided either with fresh medium (aMEM 5% PL) or with complete conditioned medium from either hkPSCs or bmMSCs.

Scratched were imaged at 4, 7, 14 and 28 hours at the same position in

duplicateswith an inverted bright-field microscope (Leica DFC 295). The scratch area was measured at each time point using ImageJ software and the percentage wound closure was calculated.

Growth factors in the conditioned medium of kPSCs were measured using a custom made growth factor panel following manufacturer's instruction. (R&D systems, Minneapolis, USA). Neonatal injection model

Animal experiments were approved by the University of Queensland Animal Ethics Committee and adhered to the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes. Neonates of outbred CD1 mice were used for neonatal injection. hkPSCs and bmMSCs of resp. 3 and 2 different donors were injected into the neonatal kidneys at postnatal day 1 (PND1) using a microinjection pipet in a protocol adapted from the protocol previously described [13]. In short, neonates were anesthetized and a small incision in the skin was made. Cells were re-suspended in PBS and mixed with Fluoresbrite Yellow Green microspheres (2.0 μηι; Polyscience) in a ratio of 1:50 for identification of injection sites in the neonatal kidney. Using a Eppendorf microinjector, cells were injected into the kidney through the muscle layer in a volume of 300nl, corresponding with 3000-5000 cells. Kidneys were harvested at 4 days post-injection. In total 7 mice were analyzed; 3 different mice with hkPSCs from 3 different donors; 3 mice with bmMSCs from 2 different donors and 1 sham operated mouse. In all mice, injection into the kidney was confirmed by fluorescence of the co-injected microspheres.

Immunofluorescence of kidney sections

For immunofluorescence stainings, kidney samples were fixed in 4% PFA followed by 30% sucrose overnight and embedded in TissueTek OCT compound (Sakura

Finetek, Torrance, CA). Samples were frozen in liquid nitrogen and stored at -80°C. Ten micrometer thick sections were cut and post-fixed with 4% PFA for 10 minutes at room temperature. Stainings were performed using manufacturer's protocol of the Mouse on Mouse (MOM) kit (Vector labs, Brunswig Chemie, Amsterdam, the Netherlands). Samples were stained with antibodies against human mitochondria and nuclei (Abeam, Cambridge, UK).

Statistical analysis

Differences between two groups were analyzed using unpaired two-sample t test. When more than two groups were analysed a two way ANOVA test was used with as posthoc test the Bonferroni's comparison test. Differences were considered statistically significant when p<0.05. Data analysis was performed using

GraphPad Prism, version 5.0 (Graphpad Prism Software Inc. San Diego, USA). For statistical analysis of the microarray data p-values were corrected for multiple testing according to Benjamini and Hochberg.

RESULTS

A novel method to isolate clinical grade human kidney- derived perivascular stromal cells (hkPSCs)

In order to evaluate whether hkPSCs are a potential new cell source for cell therapy for kidney diseases in a clinical setting, we chose to work with a clinical grade acceptable standard operation procedure (SOP) with the use of clinical grade materials and enzymes. This protocol is developed based on the pancreatic islet isolation protocol which is used for clinical application in our center. [16]

Perivascular stromal cells were isolated based on NG2 expression. NG2 is an integral membrane proteoglycan which is associated with perivascular cells during vascular morphogenesis. [17] Within the human kidney, NG2 is mainly expressed around the large arteries and the afferent and efferent arteriole (Fig la). NG2 expression differs from and is more restricted compared to the expression of CD271, an enrichment marker for bmMSCs [18] (Fig lb) or PDGFR-β positive perivascular cells (Fig lc). These markers are in the kidney also expressed within the glomeruli and around the peritubular capillaries. NG2 positive cells were isolated from a pool of ten transplant-grade kidneys discarded for surgical reasons. Experiments were performed and results are shown for three different donors. The average donor age was 62 years with an average estimated creatinine clearance (Cockroft) of 105 ml/min. In order to isolate NG2 positive cells, these kidneys were perfused with collagenase to dissociate into single cells, enriched based on plastic adherence then sorted based on NG2 expression (Fig Id). After enzyme

dissociation, approximately 1% of the cells were positive for NG2 in the crude cell suspensions (data not shown). Characterization of human kidney derived perivascular stromal cells

NG2 positive hkPSCs showed a bright field morphology similar to bmMSCs (Fig 2a) and, like bmMSCs, were positive for the pericyte markers NG2 and PDGFR-β as shown with confocal microscopy (Fig 2b). Population doublings are shown from flow cytometry confirmed NG2 homogeneous populations, at around passage 9 hkPSCs reached senescence (Fig 2c). In addition to NG2 hkPSCs were positive for the surface markers PDGFR-β, CD 146, CD73, CD90, CD 105 while being negative for CD31, CD34, CD45 and CD56, as determined by FACS (Fig 2d). This marker expression is robust as depicted by the mean fluorescent intensity (MFI) of cells of three different donors (Fig 2e). Whereas human bmMSCs were able to differentiate into all three lineages, hkPSCs did differentiate towards osteocytes and

chondrocytes, while no adipogenic differentiation was observed (biological triplicates) (Fig 21).

Organ specific gene expression profile of human kidney derived perivascular stromal cells

In order to further compare hkPSCs to bmMSCs, Illumina microarray expression profiling was performed on biological triplicates of different donors. Analysis of expression levels of 35000 transcripts showed that most genes have a similar expression level as depicted by the Pearson correlation coefficient of 0,9625 representing a high similarity between the cell types (Fig 3a). However, 2600 genes were differentially expressed and hierarchical clustering showed clustering of the biological triplicates according to cell source (Fig 3b). Table 1 shows the top 5 up and down regulated genes comparing bmMSCs and hkPSCs based on differential p- value. Interestingly, homeobox factor HoxDl l is in the top 5 most upregulated genes in hkPSCs. Homeobox transcription factors, which are important in anatomical patterning during development, showed hierarchical clustering when comparing bmMSCs with hkPSCs (Fig 3c). Homeobox paralogues HoxlO and Hoxl l are important in kidney development. [19, 20] Both genes are highly expressed in hkPSCs but not in bmMSCs, as confirmed by PCR (fig 3d). These results indicate that, although hkPSCs and bmMSCs may display a similar phenotype of surface markers, there are tissue specific differences in expression profile between the cell types.

Immunomodulatory capacity of human kidney- derived perivascular stromal cells One important and extensively studied feature of MSCs is their anti-inflammatory and immunomodulatory potential. MSCs are able to regulate proliferation and cytotoxicity of T cells, macrophages and B-cells which are also major players in kidney disease and transplantation as reviewed elsewhere. [21] Therefore, we evaluated the immunomodulatory potential of hkPSCs in comparison to bmMSCs. Unstimulated human kPSCs and bmMSCs showed a similar expression profile for all major cytokines (Fig. 4a). We also evaluated the immunosuppressive capacity of hkPSCs. In a peripheral blood mononuclear cell (PBMC) suppression assay, where PBMCs were activated by polyclonal CD3/CD28 activation in the absence or presence of stromal cells, both hkPSCs and bmMSCs inhibited proliferation in a dose dependent manner (Fig 4b). However, bmMSCs were more potent in inhibiting proliferation at a lower cell ratio (8: 1 PBMCs: MSC ratio) compared to hkPSCs.

Co-culture of endothelial cells with human kidney- derived perivascular stromal cells stabilizes vascular network formation

To evaluate whether cultured hkPSCs still have pericytic capacities, cells were co- cultured with human umbilical vein endothelial cells (HUVEC). HUVECs were not able to form endothelial sprouts in monoculture. However, when co-cultured with either bmMSCs or hkPSCs, vascular plexus formation occurred (Fig 4c). There were no significant differences in vascular network formation between the cell types (Fig 4d). Both bmMSCs and hkPSCs mainly excreted Vascular Endothelial Growth Factor (VEGF) and there was no difference in the excretion of VEGF, angiopoetin 1 and angiopoetin 2 between the cell types (Fig 4e).

Enhanced renal epithelial wound repair capacity of human kidney- derived perivascular stromal cells

In order to evaluate the effect of hkPSCs on renal tubular epitheliar repair, a scratch in a monolayer of human kidney proximal tubular epithelial cells (HK2) was made. Under control culture conditions, at least 28 hours was necessary for 80% wound closure. Interestingly, when conditioned media from hkPSCs was added, significant closure was already observed after 4 hours with 80% of the wound closed after 7 hours (mean of duplicate experiments from three different donors). Importantly, 14 hours was required to reach an 80% wound closure in parallel experiments with the conditioned media from bmMSCs, (Fig 5a,b). This shows that hkPSCs can produce factors able to better support renal epithelial repair of which HGF is most likely an important factor as HGF was secreted in high levels by hkPSCs but not by bmMSCs while no differences were observed in other growth factors as PDGF-AA, PDGF-BB, endothelinl, FGF-a and FGF-B (Fig 5c). Interstitial integration and survival of human kidney-derived perivascular stromal cells in the neonatal kidney

For determining the role of hkPSCs in kidney development, hkPSCs were injected into neonatal mice at postnatal day 1 using a microinjection technique (Fig 6a,b). Interestingly, at day 4 post-injection, human kPSCS were able to integrate and survive the cortical, but not the medullary, interstitium of the mouse kidney with no evidence for rejection as shown with human specific antibodies (Fig. 6c). No such persistence was observed when human bmMSCs were injected (Fig 6d), as is consistent with our previous studies examining the fate of murine bmMSCs after neonatal injection into the kidney. [13] No integration into tubular structures was seen with either human bmMSCs or hkPSCs upon injection. The persistence of viable human hkPSCs for 4 days within the renal interstitium suggests a differential capacity for this stromal cell type in terms of tissue damage and repair.

DISCUSSION

Mesenchymal stromal cells (MSCs) are immune modulatory and anti-fibrotic cells originally isolated from the bone marrow (bmMSCs) and are characterized by their spindle shaped morphology and ability to adhere to plastic. bmMSCs are able to differentiate into fat, bone and cartilage and express the stromal markers CD 73, CD90 and CD 105 while being negative for CD34 and CD45.[1, 2] In several experimental models of kidney disease (a.o. cisplatin, glycerol and ischemia- induced injury), MSC treatment enhanced tissue repair and reduced fibrosis. [3, 4] In a transplantation model, MSC therapy could prolong graft survival and a regulatory T-cell dependent tolerance was observed. [5] These promising results led to the first clinical trials with bmMSCs in renal transplantation. Although the group sizes are small and the studies were mainly set up to show safety and feasibility of MSC therapy, the first results suggest an immunomodulatory effect of bmMSC therapy. [6-9] Previously it has been shown that perivascular stromal cells with characteristics similar to bmMSCs exist within many different solid organs, including skeletal muscle, pancreas, adipose tissue and placenta. They are characterized by their expression of NG2, PDGFR-β and CD 146 exhibit MSC-like cell surface and functional characteristics. [10] Due to the perivascular location of these cells, close interaction is possible with several cell types, including endothelial cells, epithelial cells, resident macrophages, dendritic cells and recruited inflammatory cells.

Therefore, these cells are most likely important for tissue homeostasis and control of repair processes and inflammation. [11]

MSC-like cells could also be isolated from murine kidneys (kCFU-F). Although these kCFU-F have a comparable stromal marker expression and trilineage differentiation potential compared to bmMSCs, there is a distinct gene and protein expression profile. [12] This suggests that although kCFU-F and bmMSCs may look similar, functionally there may be differences. Li et al. showed that these cells are indeed different from bmMSCs. In particular the cell fraction isolated based on HoxB7, a collecting duct marker, was able to integrate into the collecting duct in neonatal mice upon delivery while bmMSCs lacked this capacity. [13]

Previously it has been published that perivascular stromal cells from several different human organs share features with MSCs.[10] More recently it has been shown that organ derived perivascular cells may exhibit tissue-specific functions. Human myocardial perivascular cells, for example, could stimulate angiogenic responses under hypoxia and differentiate into cardiomyocytes in vivo;

characteristics not seen in perivascular cells isolated from other tissues. [22] Here we sought to isolate human kidney- derived perivascular stromal cells and show that these cells have a distinct expression profile and different functional properties compared to human bmMSCs. In order to evaluate the functionality of these cells, their interaction with several different renal cell types, including endothelial cells, proximal tubular cells and (infiltrating) immune cells, was studied. There were similarities between human bmMSCs and hkPSCs, however, hkPSCs showed a distinct mRNA expression profile, did not differentiate into adipocytes and displayed a more potent kidney epithelial wound healing capacity. Futhermore, hkPSCs were able to integrate into the interstitium of the developing kidney, while bmMSCs did not.

As there is a lack of specific markers of MSCs, the ISCT has proposed criteria to define MSC's. These include plastic adherence, the marker expression of CD73, CD90 and CD 105 while being negative for CD 14, CD34 and CD45 and the capacity to differentiate into bone, cartilage and fat in vitro [1]. The hkPSCs we isolated did not fulfill these criteria as there was no adipocyte differentiation. However, these criteria are based on bone marrow-derived MSCs and the lack of this capacity might actually be beneficial as it has previously been shown that MSCs injected into the renal artery in a glomerulonephritis model can turn into adipocytes in the glomeruli accompanied by glomerular sclerosis around these adipocytes. [23]

MSCs are important for tissue homeostasis most likely via the secretion of several soluble factors and microvesicles containing amongst others mRNAs and miRNAs.[24, 25] Indeed, bmMSC-conditioned medium is able to accelerate wound healing in vitro. [26, 27] In a mouse model of acute kidney injury the enhanced recovery in kidney function was similar when MSCs or MSC-derived microvesicles were injected. [24] The same is most likely true for organ-derived perivascular stromal cells. Conditioned medium from murine kidney MSC-like cells was able to enhance kidney epithelial wound healing in an in vitro wound scratch assay. [13] Here we show that the conditioned medium from human kPSCs showed an increased repair response as reflected by an increased ability in a tubular epithelial wound scratch assay to restore its structural integrity, suggesting tissue-specific paracrine signaling. An important factor in this signaling is most likely hepatic growth factor (HGF) as HGF is highly secreted by kPSCs and not by bmMSCs. HGF is since long been recognized as an important factor in kidney regeneration and attenuating renal fibrosis. This has been shown in several different animal models. [28] HGF is primarily produced in non-epithelial cells such as fibroblasts and pericytes and is able to block myofibroblast activation and therefore renal fibrosis. Moreover, HGF has a beneficial effect on renal epithelial cells as it can prevent tubular epithelial cell death both in vitro and in vivo, in the latter resulting in an improved renal function after acute kidney injury. [29-31] HGF is most likely also important in human kidney regeneration as a high expression of HGF in protocol biopsies after kidney transplantation correlated with lower levels of fibrosis. [32]

The differences between the human kPSCs of the present invention and bmMSCs mentioned above may reflect differences in memory of tissue origin or even differences in location within a tissue. Tissue origin differences were previously also observed for fibroblasts isolated from different organs. [33] In the current study, the expression profile of homeobox genes, which are important for

anatomical patterning, showed a differential upregulation of HoxDIO and HoxDl l expression by hKPSC with the latter gene in the top 5 most differentially expressed genes. Both HoxlO and Hoxll are crucial for nephrogenesis. HoxlO genes function in the differentiation and integration of the FoxDl+ renal cortical stroma while Hoxl l genes are expressed in the metanephric mesenchyme. Loss of either HoxlO or Hoxl l gene function results in the loss of ureteric bud induction, reduced branching and decreased nephrogenesis; phenotypes only described for HoxlO and 11 mutants and not for other Hox mutants. [19, 20] This potential tissue 'memory of origin' may relate to the observed differences in potential to integrate back into the kidney when injected into the renal parenchyma. Such integration was never observed for the bone marrow MSCs, while the hkPSCs of the present invention migrated into the renal interstitium and survived. While we observed integration into the cortical interstitial compartment, we did not observe any integration into the epithelium. Previously, it was reported that murine kidney-derived MSC like cells can integrate into the developing collecting duct. However, the human kPSCs were isolated from the perivascular fraction based on NG2 expression, while Li. et al isolated murine MSC-like cells based on HoxB7 expression thus the collecting duct epithelial compartment. [13]. When looking at the expression pattern of the homeobox factors, HoxB7 expression in the human kPSCs was low, while HoxDl l expression was high, indeed suggesting a different origin and therefore most likely different integration capacity and function. It remains possible that a human kidney MSC-like population similar to that isolated from mouse or reciprocally a murine kPSC population similar to the hkPSC described here may exist.

The kPSCs of the present invention are more suitable for cell therapy for at least kidney diseases compared to bmMSCs, which are currently studied in clinical trials. Their capacity to reintegrate into the renal stroma and to improve tubular epithelial wound repair would suggest that they may have a specific role in maintaining and restoring renal interstitial homeostasis. To be able to compare these cell types for future cell therapy purposes we chose to isolate the hkPSCs with a standard operation procedure (SOP) developed in our lab in a clinical grade manner, with clinical grade enzymes, materials and methods which would allow direct translation into a clinical product. With this protocol large quantities of clinical grade isolated hkPSCs can be obtained. From one human kidney on average 2.7xl0 ¹² hkPSCs can be obtained at passage 6. This means that potentially one donor kidney is be able to yield sufficient number of hkPSCs that could be used for several different patients as cell therapy. This makes human kPSCs an interesting new cell source for regenerative medicine for at least kidney diseases.

growth factor beta (449)

binding protein 2

odd Oz/ten-m homolog 4 ODZ4 1745 (55) 482 (28) -3,6 -340,5

HtrA serine peptidase 1 HTRA1 9384 2833 (621) -3,3 -299,8

(356)

fibronectin type III FNDC1 12278 189 (50) -65, 1 -256,5 domain containing 1 (1828)

early B-cell factor 3 EBF3 931 (84) 273 (51) -3,4 -243,2

Table 1. Top 5 differentially expressed genes comparing bmMSCs to hkPSCs.

Upper table: Increased expression in kPSC, sorted based on differential expression score (Diff Score). Lower table: upregulated in bmMSCs. Average signal for biological triplicates is shown. SD=standard deviation. Only samples with a detection p-value<0.05 and a fluorescent intensity>200 (background levels) are shown. All differentially expressed genes show a significant p -value after correcting for multiple testin.

CITED ART

1. Dominici M, Le Blanc K, Mueller I et al. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular

Therapy position statement. Cytotherapy. 2006;8:315-317.

2. Pittenger MF, Mackay AM, Beck SC et al. Multilineage potential of adult human mesenchymal stem cells. Science. 1999;284: 143-147.

3. Morigi M, Introna M, Imberti B et al. Human bone marrow mesenchymal stem cells accelerate recovery of acute renal injury and prolong survival in mice.

Stem Cells. 2008;26:2075-2082.

4. Wang Y, He J, Pei X et al. Systematic review and meta-analysis of mesenchymal stem/stromal cells therapy for impaired renal function in small animal models. Nephrology (Carlton). 2013; 18:201-208.

5. Casiraghi F, Azzollini N, Todeschini M et al. Localization of Mesenchymal Stromal Cells Dictates Their Immune or Proinflammatory Effects in Kidney Transplantation. Am J Transplant. 2012; 12:2373-2383.

6. Perico N, Casiraghi F, Introna M et al. Autologous mesenchymal stromal cells and kidney transplantation: a pilot study of safety and clinical feasibility. Clin J Am Soc Nephrol. 2011;6:412-422.

7. Tan J, Wu W, Xu X et al. Induction therapy with autologous mesenchymal stem cells in living-related kidney transplants: a randomized controlled trial.

JAMA. 2012;307: 1169-1177. 8. Perico N, Casiraghi F, Gotti E et al. Mesenchymal stromal cells and kidney transplantation: pretransplant infusion protects from graft dysfunction while fostering immunoregulation. Transpl Int. 2013;26:867-878.

9. Reinders ME, de Fijter JW, Roelofs H et al. Autologous bone marrow- derived mesenchymal stromal cells for the treatment of allograft rejection after renal transplantation: results of a phase I study. Stem Cells Transl Med.

2013;2: 107-111.

10. Crisan M, Yap S, Casteilla L et al. A perivascular origin for mesenchymal stem cells in multiple human organs. Cell Stem Cell. 2008;3:301-313.

11. Rabelink TJ, Little MH. Stromal cells in tissue homeostasis: balancing regeneration and fibrosis. Nat Rev Nephrol. 2013;9:747-753.

12. Pelekanos RA, Li J, Gongora M et al. Comprehensive transcriptome and immunophenotype analysis of renal and cardiac MSC-like populations supports strong congruence with bone marrow MSC despite maintenance of distinct identities. Stem Cell Res. 2012;8:58-73.

13. Li J, Ariunbold U, Suhaimi N et al. Collecting duct-derived cells display mesenchymal stem cell properties and retain selective in vitro and in vivo epithelial capacity. J Am Soc Nephrol. 2015;26:81-94.

14. Jaffe EA, Nachman RL, Becker CG et al. Culture of human endothelial cells derived from umbilical veins. Identification by morphologic and immunologic criteria. J Clin Invest. 1973;52:2745-2756.

15. Orlova W, van den Hil FE, Petrus-Reurer S et al. Generation, expansion and functional analysis of endothelial cells and pericytes derived from human pluripotent stem cells. Nat Protoc. 2014;9: 1514- 1531.

16. Nijhoff MF, Engelse MA, Dubbeld J et al. Glycemic Stability Through Islet- After-Kidney Transplantation Using an Alemtuzumab-Based Induction Regimen and Long-Term Triple-Maintenance Immunosuppression. Am J Transplant. 2015.

17. Ozerdem U, Grako KA, Dahlin-Huppe K et al. NG2 proteoglycan is expressed exclusively by mural cells during vascular morphogenesis. Dev Dyn. 2001;222:218-227.

18. Watson JT, Foo T, Wu J et al. CD271 as a marker for mesenchymal stem cells in bone marrow versus umbilical cord blood. Cells Tissues Organs.

2013; 197:496-504.

19. Wellik DM, Hawkes PJ, Capecchi MR. Hoxl l paralogous genes are essential for metanephric kidney induction. Genes Dev. 2002; 16: 1423-1432.

20. Yallowitz AR, Hrycaj SM, Short KM et al. HoxlO genes function in kidney development in the differentiation and integration of the cortical stroma. PLoS One. 2011;6:e23410.

21. Leuning DG, Reinders ME, de Fijter JW et al. Clinical translation of multipotent mesenchymal stromal cells in transplantation. Semin Nephrol.

2014;34:351-364. 22. Chen WC, Baily JE, Corselli M et al. Human myocardial pericytes:

multipotent mesodermal precursors exhibiting cardiac specificity. Stem Cells. 2015;33:557-573.

23. Kunter U, Rong S, Boor P et al. Mesenchymal stem cells prevent

progressive experimental renal failure but maldifferentiate into glomerular adipocytes. J Am Soc Nephrol. 2007; 18: 1754- 1764.

24. Bruno S, Grange C, Deregibus MC et al. Mesenchymal stem cell-derived microvesicles protect against acute tubular injury. J Am Soc Nephrol.

2009;20: 1053-1067.

25. Lindoso RS, Collino F, Bruno S et al. Extracellular vesicles released from mesenchymal stromal cells modulate miRNA in renal tubular cells and inhibit ATP depletion injury. Stem Cells Dev. 2014;23: 1809-1819.

26. Smith AN, Willis E, Chan VT et al. Mesenchymal stem cells induce dermal fibroblast responses to injury. Exp Cell Res. 2010;316:48-54.

27. Walter MN, Wright KT, Fuller HR et al. Mesenchymal stem cell-conditioned medium accelerates skin wound healing: an in vitro study of fibroblast and keratinocyte scratch assays. Exp Cell Res. 2010;316:1271-1281.

28. Liu Y. Hepatocyte growth factor in kidney fibrosis: therapeutic potential and mechanisms of action. Am J Physiol Renal Physiol. 2004;287:F7-16.

29. Frei U, Daloze P, Vitko S et al. Acute rejection in low-toxicity regimens: clinical impact and risk factors in the Symphony study. Clin Transplant.

2010;24:500-509.

30. Gao X, Mae H, Ayabe N et al. Hepatocyte growth factor gene therapy retards the progression of chronic obstructive nephropathy. Kidney Int.

2002;62: 1238-1248.

31. Dai C, Yang J, Liu Y. Single injection of naked plasmid encoding hepatocyte growth factor prevents cell death and ameliorates acute renal failure in mice. J Am Soc Nephrol. 2002; 13:411-422.

32. Kellenberger T, Marcussen N, Nyengaard JR et al. Expression of hypoxia- inducible factor- lalpha and hepatocyte growth factor in development of fibrosis in the transplanted kidney. Transpl Int. 2015;28:180-190.

33. Chang HY, Chi JT, Dudoit S et al. Diversity, topographic differentiation, and positional memory in human fibroblasts. Proc Natl Acad Sci U S A.

2002;99: 12877- 12882.