FIELD OF THE INVENTION

The invention relates to genetic alterations associated with colon cancer. The invention relates to the discovery of genetic mutations that are associated with increased risks of familial and spontaneous colon cancer. The invention relates to prophylactic compositions and method of preventing colon cancer.

BACKGROUND OF THE INVENTION

Colon cancer is a major cause of death in the United States. Despite progress in the treatment of many forms of cancer, colon cancer continues to be responsible for deaths in the United States. Recent discoveries have shown that mutations of the human APC (Adenomatous Polyposis Coli) gene are responsible for both sporadic and familial colorectal cancers. Germ-line mutations of APC are found in inherited familial cancers such as Gardner's syndrome, attenuated adenomatous polyposis coli, heredity flat adenoma syndrome and familial adenomatous polyposis (FAP) . FAP is an autosomal dominant inherited disease predisposing the patient to colon cancer. Patients inheriting a single mutant allele of APC develop hundreds to thousands of adenomatous polyps in the second to third decades of life, which if left untreated progress to malignant carcinomas. Genetic linkage analysis localized the APC gene to human chromosome 5q21-q22, a region frequently associated with allelic loss of the wildtype 5q allele. Mutations in APC are

also implicated in sporadic colorectal cancers and in extracolonic tumors, such as gastric and small intestinal polyps, osteomas, sarcomas and desmoidal tumors.

There remains a need for identifying individuals who are at high risk of developing colon cancer. There is a need for identifying individuals who are candidates for prevention and monitoring programs to prevent the development colon cancer. There remains a need for an effective prophylactic method for reducing the risk of colon cancer in individuals who have been identified as being at high risk of developing colon cancer.

SUMMARY OF THE INVENTION

The present invention relates to methods of identifying an individual at an elevated risk of colon cancer. The methods comprise the steps of isolating genetic material from a tissue or body fluid sample from said individual and detecting a PLA2s gene mutation. A PLA2s mutation is indicative that the individual is at an elevated risk of colon cancer. The present invention relates to methods of identifying an individual at an elevated risk of colon cancer. The methods comprise the steps of isolating protein from a tissue or body fluid sample from said individual and detecting an absence of PLA2s protein or PLA2s enzyme activity in said isolated protein sample. The absence of PLA2s protein or PLA2s enzyme activity in said isolated protein sample is indicative that the individual is at an elevated risk of colon cancer.

The present invention relates to methods of preventing colon cancer or reducing risk of colon cancer in an individual who is identifying as being at an elevated risk of colon cancer. The methods comprise the steps of identifying an individual predisposed to colon cancer by detecting a PLA2s gene mutation or PLA2s protein or enzyme activity deficiency and administering to said individual a prophylactically effective amount of phospholipase protein or a recombinant vector comprising a nucleotide sequence that encodes PLA2s.

The present invention relates to a transgenic animal which comprises a transgene including a nucleotide sequence that encodes PLA2s. The parental strain of the transgenic mice is null for PLA2s. The present invention relates to methods of preventing colon cancer or reducing risk of colon cancer in an individual who is identifying as being at an elevated risk of colon cancer due to a PLA2s deficiency. The methods comprise the steps of identifying an individual predisposed to colon cancer by detecting a PLA2s protein or enzyme activity deficiency and administering to said individual a prophylactically effective amount of compound that upregulates endogenous PLA2s expression.

BRIEF DESCRIPTION OF THE FIGURES Figure 1.. The PLA2s gene maps to mouse chromosome 4.

Panel A. Haplotype analysis of the loci mapped in the interspecific backcross are shown. The loci mapped are listed to the left of each row with the most proximal locus listed first. A total of 167 N ₂ progeny were typed for all the markers. Each column represents the chromosome identified in the N2 offspring that was inherited from the F ₁ parent. Black squares represent the AEJ/Gn allele. White squares represent the Mus spretus allele. The number of N ₂ progeny carrying each type of chromosome is listed below each column. Panel B. Loci were placed on the map based on the results of the interspecific backcross analysis (left side) . Distances between the loci (in centiMorgans) are listed to the left of the chromosome. The interspecific backcross map is aligned with the composite map of mouse chromosome 4 (right side) . The distance from the centromere is listed. The alignment of the two maps are shown by the dotted line. The predicted location of Moml is shown by the double-headed arrow. Underlined loci have their human genome localization listed to the right. Figure 2. Expression of intestinal PLA2s in nine inbred mouse strains.

Expression of PLA2s mRNA in the small intestine (SI) and large intestine (LI) of 9 inbred strains. Total RNA (20 g) from either small or large intestine was subjected to northern blot analysis. The membrane was hybridized to PLA2s cDNA. After exposure, the membranes were rehybridized to 18S rRNA to demonstrate the presence of RNA in each lane. Size markers are shown to the left.

Panel A) Illustrates the strains that exhibit high levels of PLA2s expression, with C57BL/6J(B6) mice included as a control.

Panel B) Illustrates the strains that exhibit low levels of PLA2s expression, with AKR/J (AKR) mice included as a control. Strains that expressed high levels of PLA2s, consistently had higher expression levels in the small intestine in comparison to the large intestine. The 2.6 kb transcript is of unknown origin and was consistently detected in strains expressing PLA2s.

Figure 3. RFLP analysis of the PLA2s gene reveals a BamHI polymorphism that is concordant with expression levels. Genomic DNA (5.0 g per lane) from 11 inbred strains was digested with BamHI. The DNA was electrophoresed in a 0.8% agarose gel and transferred to a Hybond N+ filter. Hybridization was carried out under high stringency with a ^32p - dCTP labeled mouse PLA2s cDNA carrying the entire coding sequence. The sizes of the identified restriction fragments are shown.

Figure 4. The sequence of the Mouse PLA2s cDNA. The nucleotide sequence and predicted amino acid sequence of mouse PLA2s is shown. The pairs of black boxes above the nucleotide sequence denote intron/exon junctions as determined by sequencing a genomic close. The mouse PLA2s gene is encoded by five exons. The single underlined region indicates the signal sequence that is removed from the mature product. The boxed sequence denotes the BamHI site that is mutated in Moml ^s strains; the thymidine insertion is shown within the box. The predicted amino acid sequence of wildtype PLA2s is shown immediately below the nucleotide sequence. The

two predicted protein products of the Moml susceptible strains is shown from the site of the thymidine insertion. The dashed amino acid sequence, (labelled B6alt) is the predicted peptide derived from the splicing of exon 3 into exon 5, thus the gap encompassing exon 4 (see Figure 5) . The dotted amino acid sequence (labelled B6) is the truncated product generated from the correctly spliced mRNA.

Figure 5. RT-PCR analysis of intestinal RNA reveals the presence of PLA2s in all strains and an alternatively spliced product in Moml ^s strains.

RT-PCR products derived from total RNA isolated from the small intestine of 9 inbred strains listed at the top. PCR products were electrophoresed on 2.0% agarose gels and visualized with ethidium bromide. The primers used for PCR were 5' -GAAACCATACCACCATCCAA-3' (SEQ ID NO:l) and 5'- CCAGGACTCTCTTAGGTACG-3' (SEQ ID NO:2) which amplified nucleotides 11 to 747 of the murine PLA2s cDNA (Figure 4) . The size marker is the 1 kb ladder (Gibco-BRL, Gaithersburg, MD) , with some sizes shown for orientation located to the right of the gel. The negative control is the same components as all other lanes except no reverse transcriptase was added. The results reveal that all strains contain PLA2s mRNA. The results also demonstrate that all strains carrying the Moml ^s allele of PLA2s exhibit a novel RT-PCR product. Figure 6. Identification of the PLA2s polymorphism.

Panel A) cDNA sequence surrounding the polymorphic BamHI derived from B6, MA/MyJ and AKR intestinal RNA. The thymidine insertion in the B6 strain is indicated by the arrowhead. RT-PCR products were purified from a 2.0% low melt agarose gel and sequenced. The primer used for sequencing the polymorphic region was 5' -GCGCAGTTTGGGGAAAT-3' (SEQ ID NO:3) corresponding to bp 113 to 130 of the PLA2s cDNA.

Panel B) Sequence of the novel RT-PCR product detected in B6 intestinal RNA. The nucleotide sequence surrounding the novel junction between exon 3 and exon 5 identified in B6 mice is shown. The different exons are denoted by brackets.

Panel C) The presence of the BamHI polymorphism is confirmed in genomic DNA. PCR products were generated from genomic DNA from B6 and AKR mice. 100 ng of genomic DNA was amplified with primers 5'-GAGAGCTGACAGCATGAAGG-3' (SEQ ID NO:4) and 5'-CCGTTTCTGACAGGAGTTCTGGTT-3' (SEQ ID NO:5) corresponding to bp 31 and 368 of the PLA2s cDNA. Sequencing was performed using the primer 5' -GCGCAGTTTGGGGAAAT-3 (SEQ ID NO:3); corresponding to by 113 to 130 of the PLA2s cDNA. The thymidine insertion in the B6 strain is indicated by the arrowhead.

Figure 7 shows the human PLA2s gene sequence. Figure 8 shows a list of restriction enzymes that cut within and outside of the coding sequence.

DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION It has been discovered that mutations in the gene that encodes a secreted form of type II non-pancreatic phospholipase A2 (PLA2s) are associated with increased numbers of polyps in the colons of laboratory animals that have a mutation in the murine form of the APC gene (Min) which is the gene associated with familial colon cancer. A correlation between specific alleles of PLA2s and tumor susceptibility has been observed. Genetic alterations of PLA2s has the observed to modify or influence the number of intestinal tumors resulting from a mutation in the Ape gene. PLA2s is a low molecular weight (14 kDa) group II phospholipase belonging to a diverse family of enzymes that hydrolyze the sn-2 fatty acyl ester bond of phosphoglycerides to produce free fatty acids and lysophospholipids. PLA2s is one of the enzymes involved in the production of arachidonic acid, which is the rate limiting substrate for the production of leukotrienes and prostaglandins. Additionally, PLA2s has been implicated in the pathophysiology of acute pancreatitis, rheumatoid arthritis and asthma. High levels of PLA2s expression have been detected in rat and murine small intestine. The PLA2s enzyme has been localized to Paneth cells at the base of the crypts of Lieberkuhn. Expression of this

enzyme coincides with the appearance of mature Paneth cells, suggesting the presence of PLA2s during the establishment and maintenance of the villus epithelium.

The catalytic domain of PLA2s is at His48. The calcium binding domain is N-terminal to that the His 48 residue. Further, there are multiple cysteine residues throughout the protein which are involved in the formation of disulfide bridges necessary for the active conformation of the protein. Mutations in PLA2s coding sequences which will effect calcium binding and/or His48 and/or disulfide bridge formation will result in the decrease or elimination of enzyme activity. Accordingly, substitution mutations in the PLA2s coding sequences which result in amino acid residue changes that effect calcium binding and/or His48 and/or disulfide bridge formation will result in the decrease or elimination of enzyme activity. Similarly, frameshift mutations due to deletions or insertions in the PLA2s coding sequences which result in a single or multiple amino acid residue changes to amino acid sequence that effect calcium binding and/or His48 and/or disulfide bridge formation will result in the decrease or elimination of enzyme activity. Further, mutations that result in formation of truncated protein effect calcium binding and/or His48 and/or disulfide bridge formation will result in the decrease or elimination of enzyme activity. The discovery of the association of PLA2s mutations with elevated risk of developing colon cancer can be used in conjunction with available screening technology to identify and characterize an individual's genetic predisposition for developing colon cancer. Individuals who have been identified as being at risk of colon cancer due to an APC mutation are at an additionally higher risk if identified as also having mutations in one or both PLA2s genes. The combination of APC mutation with a homozygous mutation in PLA2s renders the individual at being at a higher elevated risk. Individuals who have been identified as having normal APC are at an higher risk of colon cancer if identified as having mutations in one or both PLA2s genes.

According to the invention, identification of mutations in the PLA2s gene indicates elevated risk of colon cancer. According to the present invention, methods, kits and reagents are provided which can be used to screen individuals to determine if they belong in an elevated risk group for colon cancer. In an individual who is a member of a high risk group, such as an individual who has been identified as having an APC mutation, a homozygous mutation in the PLA2s gene indicates the individual has an extremely elevated risk of familial colon cancer. In an individual who is a member of a high risk group, such as an individual who has been identified as having an APC mutation, a heterozygous mutation in the PLA2s gene indicates the individual has an elevated risk of familial colon cancer. In an individual who is not a member of a high risk group, such as an individual who has been identified as having normal APC alleles, a homozygous mutation in the PLA2s gene indicates the individual has an elevated risk of spontaneous colon cancer. In an individual who is not a member of a high risk group, such as an individual who has been identified as having normal APC alleles, a heterozygous mutation in the PLA2s gene indicates the individual has a somewhat elevated risk of spontaneous colon cancer.

Individuals with APC mutations can be identified following the U.S. Patent Number 5,352,775, which is incorporated herein by reference.

Identifying individuals with PLA2s mutations and thereby determining whether individuals are at high risk is useful in the health management of such individuals. Individuals identified as being at genetically higher risk of colon cancer can be monitored extensively and more often than is prescribed for individuals not genetically predisposed to colon cancer. In addition, such individuals identified as being at higher risk of colon cancer can take preventative steps and treatments to reduce and minimize the risk of colon cancer.

Mutations which can reduce or eliminate the production of functioning PLA2s include: mutations in the regulatory

regions that facilitate gene expression include alterations of sequence or genetic rearrangement and point mutations within the coding region such as a deletion or substitution which causes a frameshift in the reading frame and the production of a wholly or partially inactive enzyme. Such mutations may be identified by a variety of well known techniques. The lack of production of mRNA may be detected, for example, using Northern blot analysis or RT-PCR. The lack of production of normal, functional PLA2s protein may be detected, for example, using Western blot analysis, immunoassay or enzyme activity assays. Genomic DNA may be analyzed to detect mutations by Southern blot analysis including restriction fragment length polymorphism analysis, oligonucleotide hybridization using allele specific probes, direct nucleotide sequencing of PCR amplified regulatory and coding sequences, single strand conformation polymorphism (SSCP) using PCR amplified regulatory and coding sequences and fragment size analysis of PCR amplified microsatellite DNA.

Assays can be designed using these techniques to detect the presence or absence of normal PLA2s genes, mRNA and protein as well as the presence or absence of mutated forms of PLA2s genes, mRNA and protein. In addition, assays can be designed for quantitative analysis of PLA2s mRNA, protein and enzyme activity. The techniques for performing these analyses are well known to those having ordinary skill in the art and are generally described in Sambrook et al, eds. "Molecular Cloning: A Laboratory Manual" 2nd Edition, Cold Spring Harbor Laboratory Press 1989, which is incorporated herein by reference. The PLA2s gene is published in two segments as Genbank as accession numbers: M22429 J0704 and M22431 J0704, which are incorporated herein by reference. These segments are shown in Figure 7. This information can be used to design probes, primers and antibodies useful to detect mutations in PLA2s genes and/or PLA2s enzyme activity deficiency and thereby identify individuals at elevated risk of colon cancer.

RNA may be extracted from tissue samples such as biopsy samples and analyzed by Northern blot analysis. Using probes which hybridize to PLA2s mRNA, Northern blot analysis provides the means to determine the presence or absence of mRNA that hybridizes to PLA2s specific probes. The absence of such mRNA is indicative of an absence of PLA2s expression. Known quantities of PLA2s mRNA are used as controls. The present invention relates to kits for performing Northern blot analysis which comprise an container having a PLA2s specific probe and instructions for performing the assay. Optionally, positive and/or negative controls may be provided and/or representative photos or diagrams of positive and/or negative results.

Similarly, the presence or absence of mRNA that hybridizes to PLA2s specific probes may be determined by RT- PCR. RNA is extracted from tissue samples such as biopsy samples and used in as substrate together with PLA2s specific PCR primers in PCR reactions. If no nucleic acid molecules are amplified, the lack of PLA2s mRNA is indicated. The absence of such mRNA is indicative of an absence of PLA2s expression. Known quantities of PLA2s mRNA are used as controls. The present invention relates to kits for performing RT-PCR analysis which comprise an container having a PLA2s specific primers and instructions for performing the assay. Optionally, positive and/or negative controls may be provided and/or representative photos or diagrams of positive and/or negative results.

Assays to detect the presence and/or quantity of PLA2s protein including assays to detect the presence and/or quantity of PLA2s enzyme activity are also useful to identify individuals at increased risk of colon cancer. Protein is extracted from tissue samples such as biopsy samples or fecal samples and analyzed to detect the presence and/or quantity of proteins that cross react with PLA2s specific antibodies or to detect the presence and/or quantity of PLA2s enzyme activity. In some preferred embodiments, protein is acid purified from tissue samples. In some preferred embodiments, acid extraction is performed using the method of Franson RC, et al . 1983,

Solubilization and characterization of a neutral-active, calcium-dependent, phospholipase A ₂ from rabbit heart and isolated chick embryo myocytes. Lung 160:275-284, which is incorporated herein by reference. Known quantities of functional PLA2s are used as controls.

Western blot analysis and immunoassay are useful to detect the presence of protein that binds to PLA2s specific antibodies. Western blot analysis is a technique whereby the presence of protein which hybridizes to PLA2s specific antibodies can be detected and analyzed for size. Immunoassay do not measure protein size. Western blot and immunoassay will not detect the presence of proteins encoded by frameshifted genes if the antibodies recognize epitopes eliminated by the frame shift. Thus, antibodies which bind to epitopes on PLA2s which are eliminated in frameshift PLA2s mutations are useful to identify PLA2s mutations. In some embodiments, Western blot and immunoassay are performed using antibodies that specifically bind to epitopes that include the catalytic domain of PLA2s, particularly epitopes that include His48. Further, Western blot and immunoassay may be performed using antibodies that specifically bind to epitopes that include the calcium binding domain. Alternately, Western blot and immunoassay are performed using antibodies that specifically bind to epitopes that present due to the formation of disulfide bridges necessary for the active conformation of the protein.

As used herein, the term "antibody" is meant to refer to complete, intact antibodies, and Fab fragments and F(ab) ₂ fragments thereof. Complete, intact antibodies include monoclonal antibodies such as murine monoclonal antibodies, chimeric antibodies and humanized antibodies. The production of antibodies and the protein structures of complete, intact antibodies, Fab fragments and F(ab) ₂ fragments and the organization of the genetic sequences that encode such molecules are well known and are described, for example, in Harlow, E. and D. Lane (1988) ANTIBODIES : A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. which is incorporated herein by reference. Briefly, for example, the

PLA2s protein, or an immunogenic fragment thereof is injected into mice. The spleen of the mouse is removed, the spleen cells are isolated and fused with immortalized mouse cells. The hybrid cells, or hybridomas, are cultured and those cells which secrete antibodies are selected. The antibodies are analyzed and, if found to specifically bind to the PLA2s protein, the hybridoma which produces them is cultured to produce a continuous supply of antibodies.

The present invention relates to kits for performing Western blot analysis or immunoassay which comprise an container having a PLA2s specific antibody and instructions for performing the assay. Additional immunoassay reagents may optionally be provided as described below. Optionally, positive and/or negative controls may be provided and/or representative photos or diagrams of positive and/or negative results.

PLA2s enzyme activity assays are well known such as those methods taught in Marshall L.A. et al . , J. Lipid Mediators Cell Signalling 10:295-313 (1994), which is incorporated herein by reference. PLA2s enzyme activity assays can be used to detect and/or quantify the presence of function PLA2s protein in a sample. Protein is extracted from tissue samples such as biopsy samples or fecal samples and analyzed to determine the presence and/or amount of activity to process PLA2s substrate. Known quantities of functional PLA2s are used as controls.

Genetic analysis of genomic DNA may be employed to detect mutations on the PLA2s gene. Some such analyses can be performed directly on extracted genomic DNA to identify genetic rearrangements of the PLA2s gene. Other analyses include the amplification of the exons and adjacent sequences followed by analysis of the amplified DNA. In each case, mutations in the PLA2s gene can be identified.

Southern blot analysis may be employed on extracted genomic DNA to identify the presence of nucleotide sequences that hybridize to PLA2s specific probes and for performing restriction fragment length polymorphism analysis to determine

if a mutation involving the PLA2s gene results in the elimination of restriction enzyme sites within the coding sequence, or creation of a restriction enzyme site normally not present, or a genetic rearrangement in which the a chromosomal mutation results in the relocation of the PLA2s gene within the genome. Figure 8 shows a list of restriction enzymes that cut within and outside of the coding sequence. These restriction enzymes can be used in RFLP analysis to identify polymorphisms that indicate mutations in the PLA2s gene. The restriction enzymes listed as cutting within the coding sequence are particularly useful to identify polymorphisms that indicate mutations with the PLA2s coding sequences that can be used in RFLP analysis. Further, restriction enzymes not listed can be used to identify the creation of new restriction sites due to mutations.

If polymorphisms are detected by RFLP analysis, the location of the polymorphism can be determined by comparison with the known sequence, using controls as well as using probes that detect smaller regions of the gene. If a polymorphism is detected that is not located within the open reading frame, these polymorphisms provide epidemiological data which is useful to correlate the different alleles of PLA2s as defined by the polymorphisms to the phenotype of individuals carrying them, i.e. the incidence of colon cancer for carriers of the different alleles. Any difference detected can result in subtle expression differences that can contribute to disease risk or protection. Polymorphisms/alleles of PLA2s can be detected by a variety of procedures described herein including Southern blots, SSCP, SSLP etc. The present invention relates to kits for performing

Southern blot analysis including RFLP which comprise an container having a PLA2s specific probe and instructions for performing the assay. Optionally, positive and/or negative controls may be provided and/or representative photos or diagrams of positive and/or negative results.

Oligonucleotide hybridization using allele specific probes can be sued to determine the presence or absence of

nucleotide sequences that hybridize to PLA2s specific probes. Probes that hybridize to normal PLA2s genes but that will not hybridize to known mutations of PLA2s genes or probes that hybridize to mutated PLA2s genes but that will not hybridize to the normal PLA2s gene can be used to detect the presence or absence of mutations and/or normal genes.

Isolated nucleic acid molecules that comprise a nucleotide sequence identical or complementary to a fragment of the PLA2s gene, particularly the coding sequence, that are at least 10 nucleotides are useful to practice the methods of the invention. In some embodiments, the isolated nucleic acid molecules consist of a nucleotide sequence identical or complementary to a fragment of the PLA2s gene, particularly the coding sequence, which is at least 10 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleotide sequence identical or complementary to a fragment of the PLA2s gene, particularly the coding sequence, which is 15-150 nucleotides. In some embodiments, the isolated nucleic acid molecules comprise or consist of a nucleotide sequence identical or complementary to a fragment of the PLA2s gene, particularly the coding sequence, which is 15-30 nucleotides. Isolated nucleic acid molecules that comprise or consist of a nucleotide sequence identical or complementary to a fragment of the PLA2s gene, particularly the coding sequence, which is at least 10 nucleotides are useful as probes for identifying PLA2s genes in genomic samples and cDNA sequence generated from RNA from samples, PCR primers for amplifying PLA2s genes and cDNA.

The nucleotide sequences in the PLA2s gene, particularly the coding sequence be used to design probes, primers and complimentary molecules which specifically hybridize to allele specific PLA2s sequences.

The present invention also includes labelled oligonucleotides which are useful as probes for performing oligonucleotide hybridization methods to identify the presence or absence of PLA2s nucleotide sequences. Accordingly, the present invention includes probes that can be labelled and

hybridized to allele specific nucleotide sequences of the PLA2s gene, particularly the coding sequence. The labelled probes of the present invention are labelled with radiolabelled nucleotides or are otherwise detectable by readily available nonradioactive detection systems. In some preferred embodiments, probes comprise oligonucleotides consisting of between 10 and 100 nucleotides. In some preferred, probes comprise oligonucleotides consisting of between 10 and 50 nucleotides. In some preferred, probes comprise oligonucleotides consisting of between 12 and 20 nucleotides. The probes preferably contain nucleotide sequence completely identical or complementary to a fragment of an allele specific nucleotide sequences.

The present invention relates to kits for performing oligonucleotide hybridization analysis which comprise an container having a PLA2s specific probe and instructions for performing the assay. Optionally, positive and/or negative controls may be provided and/or representative photos or diagrams of positive and/or negative results. Genomic PLA2s genes sequences are amplified by PCR and analyzed to detect the presence or absence of sequence mutations. Genomic samples may be obtained from tissue, blood or other body fluids by routine collection methods. Chromosomal DNA is extracted and examined. The presence of mutated PLA2s genes and/or the absence of normal PLA2s genes can be detected.

In some embodiments, direct sequencing of coding sequence and sequences adjacent to exons is performed following amplification of such sequences. A comparison of the sequence of amplified DNA to the known normal sequence indicates the presence or absence of mutations. Mutations can also be identified using single strand conformation polymorphism (SSCP) and duplex analysis using amplified sequences and constructs having normal sequences. According to another embodiment, fragment size analysis may be performed using PCR amplified microsatellite DNA. The actual size of amplified microsatellite DNA may be compared to the predicted size of

normal microsatellite DNA. Deviation of the actual size of amplified microsatellite DNA from the predicted size of normal microsatellite DNA indicates a mutation in the PLA2s gene.

PCR may be used to amplify all or a portion of the genomic sequence that encode Pla2. PCR technology is practiced routinely by those having ordinary skill in the art and its uses in diagnostics are well known and accepted. Methods for practicing PCR technology are disclosed in "PCR Protocols: A Guide to Methods and Applications", Innis, M.A. , et al . Eds. Academic Press, Inc. San Diego, CA (1990) which is incorporated herein by reference. Applications of PCR technology are disclosed in "Polymerase Chain Reaction" Erlich, H.A., et al . , Eds. Cold Spring Harbor Press, Cold Spring Harbor, NY (1989) which is incorporated herein by reference. Some simple rules aid in the design of efficient primers. Typical primers are 18-28 nucleotides in length having 50% to 60% g+c composition. The entire primer is preferably complementary to the sequence it must hybridize to. Preferably, primers generate PCR products 100 basepairs to 2000 base pairs. However, it is possible to generate products of 50 base pairs to up to 10 kb and more.

PCR primers are designed which amplify the region of the PLA2s gene that includes the site where mutations occur.

Examples of such primers are as follows : Primers ABl, AB2, AB3 and AB4 amplify the region upstream of the first exon and exon one. This region contains information for regulating gene expression.

ABl GCAAGGGGCTCTAAGAATTG (SEQ ID NO:6)

AB2 TGGGAATAGAAAAGAGGGCT (SEQ ID NO: 7) AB3 CCAGGACATACTTCCTGTGA (SEQ ID NO: 8)

AB4 TGCTCTTGACAGGACATCAG (SEQ ID NO:9) Primers msatl and msat2 amplify the region surrounding the microsatellite and can be used to detect microsatellite instability. msatl TGTATCATGGGGTTCTCCAC (SEQ ID NO:10) msat2 TCCCATCCAACCTAAGTCCA (SEQ ID NO: 11)

Primers ex21 and ex22 amplify exon 2 and the surrounding sequences. ex21 AGTGTGACAGAGGAAGTCAC (SEQ ID NO:12) ex22 TTGGGAGTTGTCTGGTGATG (SEQ ID NO:13) Primers ex31 and ex32 amplify exon 3 and the surrounding sequences. ex31 AGGAAGGAGAGTAGCAGAGA (SEQ ID NO:14) ex32 ACCCAGTGACTTTGCAACAG (SEQ ID NO:15) Primers ex41 and ex42 amplify exon 4 and the surrounding sequences. ex41 GCATGTTGGAACTTCTGCTC (SEQ ID NO:16) ex42 CTCAGGCTGTGTTAATGCCT (SEQ ID NO:17) Primers ex51 and ex52 amplify exon 5 and the surrounding sequences. ex51 TCTCCAACTAGGAGCTTCTG (SEQ ID NO:18) ex52 TTATTCAGAAGAGACCCCCC (SEQ ID NO:19) . The present invention relates to kits for performing genomic DNA analysis which comprise an container having a set PLA2s specific primers such as those described herein and instructions for performing the assay. Optionally, positive and/or negative controls may be provided and/or representative photos or diagrams of positive and/or negative results. In kits for performing SSCP, the sequence which hybridizes to the amplified sequences may be provided in a container. The present invention relates to a transgenic non- human mammal that comprises the recombinant expression vector that comprises a nucleic acid sequence that encodes the PLA2s. Transgenic non-human mammals are the endogenous ability to produce function PLA2s. Examples include Black 6 mice which are PLA2s ^" . The techniques for generating transgenic animals are well known. One having ordinary skill in the art using standard techniques, such as those taught in U.S. Patent No. 4,873,191 issued October 10, 1989 to Wagner and U.S. Patent No. 4,736,866 issued April 12, 1988 to Leder, both of which are incorporated herein by reference, can produce transgenic animals which express PLA2s. Preferred animals are rodents, particularly goats, rats and mice. Such animals are useful as

animal models to identify and characterize PLA2s inhibitors. Parent lines of the mice normally develop multiple polyps. The presence and expression of the transgene reduces the number of polyps which develop. Effective PLA2 inhibitors will inactivate the PLA2s expressed by the transgene and the transgenic mice will revert to the phenotype similar to the parent line.

If an individual is identified as having an PLA2s mutation or PLA2s protein or enzyme activity deficiency, the present invention provides prophylactic methods for preventing or reducing the risk of colon cancer. These methods essentially supply the patient identified as being in a higher risk group an amount of functional PLA2s to compensate for any deficiency. In the prophylactic methods of the invention, an individual is screened using the identification methodology described above to establish a PLA2s mutation or PLA2s protein or enzyme activity deficiency. In preferred embodiments, the patient is also screened for APC genotype to further characterize the risk group to be assigned. Once an individual has been screened and determined to have a PLA2s mutation or PLA2s protein or enzyme activity deficiency, a composition is administered to such an individual to counteract the deficiency and provide the individual with sufficient PLA2s to reduce the risk of colon cancer. The method of the invention thus comprises 1) identifying individuals with PLA2s mutations by genotyping or PLA2s protein or enzyme activity deficiencies by biopsy or stool sample analysis, and 2) administering to such an individual a composition effective to provide the individual with sufficient PLA2s to make up for the PLA2s deficiency. Providing the individual with sufficient PLA2s to make up for the PLA2s deficiency renders the individual less likely to develop polyps, thereby reducing the risk of colon cancer.

Another aspect of the invention relates to compositions for delivering PLA2s to individuals identified as being at an elevated risk of colon cancer in order to prevent or reduce the risk of such individuals developing colon cancer.

In an individual who is a member of a high risk group, such as an individual who has been identified as having an APC mutation, a homozygous mutation in the PLA2s gene indicates the individual has an extremely elevated risk of familial colon cancer. In an individual who is a member of a high risk group, such as an individual who has been identified as having an APC mutation, a heterozygous mutation in the PLA2s gene indicates the individual has an elevated risk of familial colon cancer. In an individual who is not a member of a high risk group, such as an individual who has been identified as having normal APC alleles, a homozygous mutation in the PLA2s gene indicates the individual has an elevated risk of spontaneous colon cancer. In an individual who is not a member of a high risk group, such as an individual who has been identified as having normal APC alleles, a heterozygous mutation in the PLA2s gene indicates the individual has a somewhat elevated risk of spontaneous colon cancer.

Genotype individuals to detect PLA2s mutations and determine whether individuals are at high risk is useful in the health management of such individuals. Individuals identified as being at genetically higher risk of colon cancer can be monitored extensively and more often than is prescribed for individuals not genetically predisposed to colon cancer. In addition, such individuals identified as being at higher risk of colon cancer can take preventative steps and treatments to reduce and minimize the risk of colon cancer.

According to the invention, patients are screened to identify those with PLA2s gene mutations or PLA2s protein of enzyme activity deficiencies. In preferred embodiments, the individuals are also screened for APC genotype. Individuals, particularly those identified at being in one of the higher risk groups are then administered compositions of the invention to prevent or reduce the risk of colon cancer. Compositions include protein compositions, PLA2s genes in combination with the appropriate vectors including gene therapy vectors or microbial vectors.

U.S. Patent Number 5,354,677, U.S. Patent Number 5,328,842, U.S. Patent Number 5,322,776, U.S. Patent Number 5,302,400, U.S. Patent Number 5,294,698, U.S. Patent Number 5,279,957, U.S. Patent Number 5,164,315, U.S. Patent Number 5,130,130, U.S. Patent Number 5,045,462, U.S. Patent Number 5,019,508, U.S. Patent Number 4,978,609, U.S. Patent Number 4,079,125, which are each incorporated herein by reference, describe phospholipase proteins and methods of making the same. Pharmaceutical compositions according to the invention comprise a pharmaceutically acceptable carrier in combination with phospholipase, particularly, PLA2s. Pharmaceutical formulations for are well known and pharmaceutical compositions comprising phospholipase may be routinely formulated by one having ordinary skill in the art. Suitable pharmaceutical carriers are described in Remington ' s Pharmaceutical Sciences, A. Osol, a standard reference text in this field, which is incorporated herein by reference. The present invention relates to an pharmaceutical composition that comprises a pharmaceutically acceptable carrier and phospholipase, particularly, PLA2s. The phospholipase is preferably sterile and combined with a sterile pharmaceutical carrier.

In some embodiments, for example, PLA2s can be formulated as a solution, suspension, emulsion or lyophilized powder in association with a pharmaceutically acceptable vehicle. Examples of such vehicles are water, saline, Ringer's solution, dextrose solution, and 5% human serum albumin. Liposomes and nonaqueous vehicles such as fixed oils may also be used. The vehicle or lyophilized powder may contain additives that maintain isotonicity (e.g., sodium chloride, mannitol) and chemical stability (e.g., buffers and preservatives) . The formulation is sterilized by commonly used techniques.

An injectable composition may comprise ICEe and/or ICEδ in a diluting agent such as, for example, sterile water, electrolytes/dextrose, fatty oils of vegetable origin, fatty esters, or polyols, such as propylene glycol and polyethylene glycol. The injectable must be sterile and free of pyrogens.

In some preferred embodiments, the phospholipase protein administered orally or rectally. In cases where phospholipase is administered orally, it is provided in an enteric formulation so that it can avoid degradation by stomach acids. Enteric formulations are described in U.S. Patent Number 4,601,896, U.S. Patent Number 4,729,893, U.S. Patent Number 4,849,227, U.S. Patent Number 5,271,961, U.S. Patent Number 5,350,741, and U.S. Patent Number 5,399,347, which are each hereby incorporated herein by reference. Oral and rectal formulation are taught in Remington's Pharmaceutical Sciences, 18th Edition, 1990, Mack Publishing Co., Easton PA. which is incorporated herein by reference. Alternative embodiments include sustained release formulations and implant devices which provide continuous delivery of phospholipase to the colon.

Pharmaceutical compositions according to the invention include delivery components in combination with nucleic acid molecules that encode PLA2s which further comprise a pharmaceutically acceptable carriers or vehicles, such as, for example, saline. Any medium may be used which allows for successful delivery of the nucleic acid. One skilled in the art would readily comprehend the multitude of pharmaceutically acceptable media that may be used in the present invention.

The pharmaceutical compositions of the present invention may be administered by any means that enables the active agent to reach the agent's site of action in the body of a mammal. Pharmaceutical compositions may be administered parenterally, i.e., intravenous, subcutaneous, intramuscular. Intravenous administration is the preferred route. Dosage varies depending upon known factors such as the pharmacodynamic characteristics of the particular agent, and its mode and route of administration; age, health, and weight of the recipient; nature and extent of symptoms, kind of concurrent treatment, frequency of treatment, and the effect desired. A prophylactically effective dose is one in which the incidence of polyp development or cancer is decreased upon administration of such a dose compared to the incidence of

polyp development or cancer which would occur in the absence of such a dose. It is contemplated that a prophylactically effect vie dose will be that which raised the level of functional PLA2s enzyme activity in an individual identified as being in a high risk group to the level of a normal individual without PLA2s mutations or deficiencies.

Nucleic acid molecules that encode pla2s may be delivered using any one of a variety of delivery components, such as recombinant viral expression vectors or other suitable delivery means, so as to affect their introduction and expression in the patient's cells, particularly colon cells. In general, viral vectors may be DNA viruses such as recombinant adenoviruses and recombinant vaccinia viruses or RNA viruses such as recombinant retroviruses. Other recombinant vectors include recombinant prokaryotes which can infect cells and express recombinant genes. In addition to recombinant vectors, other delivery components are also contemplated such as encapsulation in liposomes, transferrin- mediated transfection and other receptor-mediated means. The invention is intended to include such other forms of expression vectors and other suitable delivery means which serve equivalent functions and which become known in the art subsequently hereto.

In one embodiment of the present invention, DNA is delivered to competent host cells by means of an adenovirus. One skilled in the art would readily understand this technique of delivering DNA to a host cell by such means. Although the invention preferably includes adenovirus, the invention is intended to include any virus which serves equivalent functions.

In another embodiment of the present invention, RNA is delivered to competent host cells by means of a retrovirus. One skilled in the art would readily understand this technique of delivering RNA to a host cell by such means. Any retrovirus which serves to express the protein encoded by the RNA is intended to be included in the present invention.

In another embodiment of the present invention, nucleic acid is delivered through folate receptor means. The nucleic acid sequence to be delivered to a cell is linked to polylysine and the complex is delivered to cells by means of the folate receptor. U.S. Patent 5,108,921 issued April 28, 1992 to Low et al . , which is incorporated herein by reference, describes such delivery components.

According to another aspect of the invention, the nucleotide sequence that encodes PLA2s is inserted into an expression vector of a non-toxic enteric bacteria host. The host is then administered to an individual where it colonizes the gut and produces PLA2s. Examples of suitable host strains include E. coli, Lactobacillus sp. and bacteria describe din Fu, et al . 1994 Cancer Research 54:6297-6301 and Virgilio, et al . 1994 Proc. Natl . Acad. Sci . USA 91:12530-12534 which are both incorporated herein by reference.

As used herein, the term "expression vector" is meant to refer to a plasmid, phage, viral particle or other vector which, when introduced into an appropriate host, contains the necessary genetic elements to direct expression of the coding sequence that encodes the PLA2s. The coding sequence is operably linked to the necessary regulatory sequences. Expression vectors are well known and readily available. Examples of expression vectors include plasmids, phages, viral vectors and other nucleic acid molecules or nucleic acid molecule containing vehicles useful to transform host cells and facilitate expression of coding sequences.

Another aspect of the invention relates to the administration of compounds useful to upregulate expression of endogenous PLA2s in an individual identified as having an APC mutation. Such compounds include TNF, IL-1, IL-6 and endotoxins.

EXAMPLES Example 1 Blood samples or appropriate tissue samples are taken from patients for analysis. Blood samples can be taken for

genotyping. Alternatively, tissue biopsies can be taken from individuals being examined for other maladies.

Genomic DNA is isolated from these samples by standard procedures. The DNA is analyzed for PLA2s allele/polymorphism/mutation. Several protocols exist to determine status of PLA2s allele. The most direct protocol is to amplify the entire gene with the specified oligonucleotides Oligo pair Size amplified and sequenced

AB1-AB2 575 AB3-AB4 578 msatl-msat2 160 ex21-ex22 405 ex31-ex32 400 ex41-ex42 445 ex51-ex52 505

The PCR conditions are as follows: After PCR the fragments are purified on a Quagen column and sequenced by TAQ DYE-DEOXY sequencing an automated PCR method based on Sanger-Coulson method of DNA sequencing. The results are analyzed and compared with known PLA2s from both human, mouse and rat genes.

After the gene sequence is determined, the sequence data is examined for gross alternations such as large insertions or deletions of nucleotide sequences, especially in the open reading frame. Sequence data is also examined to identify single base insertion and deletions. Example 2 Summary

Mutations in the APC gene are responsible for various familial and sporadic colorectal cancers. Min (Multiple intestinal neoplasia) mice carry a dominant mutation in the murine homolog of the Ape (Adenomatous polyposis coli) gene. Min mice develop multiple adenomas throughout their small and large intestine. Recent studies have identified a modifier locus, Moml, which maps to the distal region of chromosome 4. Moml dramatically influences Min-induced tumor number. We report here the identification of a candidate gene for Moml.

The gene for secretory type II Phospholipase A2 (PLA2s) maps between D4Mitl6 and D4Mitl3 on the distal region of chromosome 4, the same region that contains Moml, and displays 100% concordance between allele type and tumor susceptibility. Expression and sequencing analysis revealed that Moml susceptible strains are most likely null for PLA2s activity. Our results indicate that PLA2s acts as a novel gene which modifies polyp number by altering the cellular microenvironment within the intestinal crypt. Introduction

An induced mutant mouse strain is being used as a model to better understand the genetic elements influencing the progression of colorectal tumorigenesis. The Min (Multiple mtestinal neoplasia) strain, established from an ethylnitrosourea-treated C57BL/6J (B6) male mouse, carries a fully penetrant dominant mutation. Mice heterozygous for the Min mutation develop numerous adenomas throughout the small and large intestinal tract and severe anemia (a result of intestinal bleeding) . The observed phenotype in the Min animals closely resembles the clinical features observed in patients with FAP. Genetic linkage analysis localized the Min mutation to mouse chromosome 18, in a region known to contain the Ape gene, the murine homolog of the human APC gene. Further studies revealed that the Min mutation (hereafter called Apc ^Min ) results from a nonsense mutation in exon 15 of the Ape gene; the same type of mutation is frequently found in human FAP kindreds.

The genetic and phenotypic similarities observed between Min mice and FAP patients suggests that the Min mouse model offers a powerful system to study this human disease. Examination of FAP kindreds demonstrate that family members inheriting the same APC mutation may differ dramatically in tumor burden. Although environmental factors may be partially responsible, modifier genes have been proposed to account for some of this variability. The use of a genetically defined system such as the Min mouse model, facilitates the identification of these modifier loci. Min mice differ greatly

in the number of intestinal tumors depending on their genetic background. B6 mice (parental congenic strain) heterozygous for the Apc ^Min mutation exhibit an average of 29 tumors throughout their small and large intestines, while their FI progeny produced from crosses to either AKR/J (AKR) , MA/MyJ or Mus castaneus (CAST/Ei) mice exhibit an average of only 5.8, 5.7, and 3.0 tumors, respectively. These studies indicate that at least one dominantly acting allele is modifying the influence of the Apc ⁱⁿ mutation on tumor susceptibility. Quantitative trait loci (QTL) mapping subsequently identified an unlinked locus, Moml (Modifier of Min 1) , in the distal region of chromosome 4 between D4Mitl6 and D4Mitl3. Moml is estimated to account for approximately 50% of the genetic variation in adenoma number in both AKR and MA/MyJ intraspecific backcrosses as compared to B6. Interestingly, Moml also resides in a region of synteny with human chromosome lp35, a region frequently associated with loss of heterozygosity in human plasmacytomas, neuroblastomas and colon cancer. It has not yet been determined whether the product of the Moml gene product acts autonomously or non-cell autonomously with respect to the tumor cell lineage. PCR analysis has shown that 100% of spontaneous Min-induced intestinal adenomas have lost their wildtype Ape allele, suggesting that Ape acts as a classical tumor suppressor gene. Multilabel immunocytochemical analysis of these adenomas has demonstrated that the intestinal lesions consist of a mixture of differentiated enterocytes, enteroendocrine, goblet and Paneth cells; these findings are similar to what is observed in human adenomatous polyps. The presence of multiple lineages in these adenomas suggests that a multipotent stem cell population located in the base of intestinal crypts is the site of initiation for Apc ^Min induced tumorigenesis. Therefore, any modifier gene expressed in the crypt microenvironment would have a potential role in altering tumor progression.

We report here the genetic mapping, expression and sequence analysis of a candidate gene for the Moml locus. The

present data are consistent with the hypothesis that Moml is encoded by a secreted form of type II non-pancreatic phospholipase A2 (PLA2s) .

In order to further study the role of PLA2s in development and pathogenesis, we determined its chromosome location in the mouse. We initially mapped PLA2s between the D4Mitl6 and D4Mitl3 loci, which is the same region of mouse chromosome 4 that contains the Moml locus. Analysis of the PLA2s gene from different inbred mouse strains revealed a 100% concordance between allele type and tumor number. Based on our mapping of PLA2s to distal chromosome 4, the correlation between specific alleles of PLA2s and tumor susceptibility, and the expression of PLA2s at the tumor initiation site, we propose that Moml encodes the gene for PLA2s. Hence, PLA2s is the first genetically defined locus that can modify or influence the number of intestinal tumors resulting from a mutation in the Ape gene. Results Chromosomal location of the PLA2s gene in the mouse An interspecific backcross mapping panel was used to localize PLA2s in the mouse. Genomic DNAs from AEJ/Gn and Mus spretus parental control mice were digested with fourteen restriction endonucleases and analyzed by Southern blot hybridization using the PLA2s probe. An informative restriction fragment length polymorphism (RFLP) was detected with the restriction endonuclease BamHI (see Experimental Procedures) . The segregation pattern of the PLA2s gene was followed in 195 N2 progeny; each mouse was either homozygous for the AEJ/Gn allele or heterozygous for the M. spretus and AEJ/Gn alleles. The allele distribution pattern of PLA2s was compared to known gene and microsatellite markers which scan the entire mouse genome. The segregation analysis revealed that the PLA2s gene resides on mouse chromosome 4. The specific location of PLA2s was determined by minimizing the number of multiple recombinations along the length of the chromosome (Figure 1 Panel A) . The results positioned PLA2s between D4Mitl48 and D4Mitl3 (Figure 1 Panel B in the distal

region of chromosome 4. The order of the loci and the ratio of the number of recombinants to the total number of N2 offspring examined are: centromere - D4Mitl6 - 19/183 - D4Mitl48 - 1/170

- PLA2s - 8/172 - D4Mitl3 - telomere. The genetic distance between loci in centiMorgans (± standard error) are: centromere - D4Mitl6 - 10.3 ± 2.2 cM - D4Mitl48 - 0.6 + 0.6 cM

- PLA2s - 4.6 ± 1.6 - D4Mitl3 - telomere. No double or multiple recombinants were detected between D4Mitl6 and D4Mit 13. The localization of PLA2s to the region between D4Mitl48 and D4Mitl3 coupled with the observation that PLA2s is expressed at high levels in the murine small intestine, suggested that PLA2s was a candidate gene for the Moml locus. Comparison of PLA2s expression levels between Moml resistant and susceptible strains. B6 mice carrying the Apc ^Min mutation typically have an average of 28.5 ± 7.9 tumors and do not live past 4 months of age. However, when B6 Apc ⁱⁿ /+ mice were crossed with AKR, MA/MyJ or CAST/Ei mice, the FI progeny inheriting the Apc ^min allele demonstrated a dramatic decrease in tumor burden (an average of 5.8 ± 4.3, 5.7 ± 4.0, and 3.0 ± 1.8 tumors, respectively) along with an increased lifespan. QTL mapping suggested that the strains demonstrating resistance to tumor formation have a dominant modifier gene responsible for suppressing the Min phenotype. Thus, B6 mice are considered susceptible to multiple intestinal adenomas and would carry the Moml ^s allele, while AKR, MA/MyJ and CAST/Ei mice are resistant to multiple intestinal adenomas and would carry the Moml ^r allele. Therefore, we hypothesized that if PLA2s was involved, the level or quality of mRNA or protein expression would differ between susceptible (Moml ^s ) and resistant (Moml ^r ) strains. To test this hypothesis, we compared PLA2s expression in various tissues between B6 and AKR mice by northern blot analysis. No detectable expression was observed in the spleen, lung, thymus, heart, skin or brain of either Bt or AKR mice. PLA2s expression was limited to the small and large intestine of the AKR strain, where an 800 bp transcript was detectable after an overnight exposure to autoradiography film (Figure 2) . In

contrast, no transcript was detected in the small or large intestine of B6 mice after a similar exposure. However, upon longer exposure, a low level of expression was observed in the small and large intestine of B6 mice. These results indicated that PLA2s expression was greatly reduced in the intestinal tract of B6 mice compared to AKR mice, consistent with the candidacy of the PLA2s gene for the Moml locus.

To further explore the identity of PLA2s with Moml, we examined PLA2s expression in MA/MyJ and CAST/Ei, two strains also determined to contain the Moml ^r allele. High levels of the 800 bp transcript were detected in the small and large intestines of these strains (Figure 2 Panel A) . We next examined 6 additional strains to determine if the absence of PLA2s expression was unique to B6. Northern blot analysis identified 2 strains, C3H/HeJ and CBA/J, with high levels of

PLA2s expression in the large and small intestine. However, northern blot analysis revealed 4 strains, P/J, A/J, C58/J

(Figure 2 Panel B) and 129/SvJ, with greatly reduced levels of

PLA2s, similar to the expression level observed in B6 mice. Though none of these strains have been tested for their Moml phenotype, we predict that the C3H/HeJ and CBA/J strains carry a Moml ^r allele, while the A/J, P/J, C58/J and 129/SvJ strains carry a Moml ^s allele. Consistent with this prediction, it has recently been reported that 129/SvJ mice carrying a targeted mutation in the Ape gene develop high numbers of intestinal adenomas, indicating that the 129/SvJ strain carries a susceptible Moml allele. The reduced level of PLA2s expression observed in Moml ^s strains compared with the high level of PLA2s expression observed in Moml ^r strains is consistent with the hypothesis that the PLA2s gene represents the Moml locus. Detection of a RFLP concordant with PLA2s expression

The low levels of PLA2s expression observed in B6 mice could be the result of a mutation in the promoter region resulting in a decreased transcription rate or a mutation in the transcribed region resulting in a decreased half-life of the PLA2s mRNA. To distinguish between these possibilities, genomic DNA from B6 and AKR mice was digested with several

restriction endonucleases to identify RFLPs for the PLA2s gene. Southern blot analysis identified three enzymes, BamHI, Mspl and TaqI that revealed RFLPs between the B6 and AKR strains. Specifically, digestion of genomic DNA with BamHI produced a 9.0 kb restriction fragment in the B6 strain and two restriction fragments of 2.5 kb and 6.5 kb in the AKR strain (Figure 3) . To assess whether this RFLP was linked to the expression of PLA2s, 9 additional inbred strains were analyzed by RFLP analysis. Interestingly, the 5 inbred strains expressing high levels of PLA2s (AKR, MA/MyJ, C3H/HeJ, CBA/J, and CAST/Ei) exhibited the 2.5 kb and 6.5 kb BamHI restriction fragments, while the 5 inbred strains expressing low levels of PLA2s (B6, A/J, P/J, 129/SvJ and C58/J) exhibited the 9.0 kb BamHI restriction fragment (Figure 3) . Thus, there is a 100% concordance between specific CamHI RFLPs and PLA2s expression levels. Digestion of genomic DNA from the 10 inbred strains with Mspl or TaqI did not produce a RFLP which correlated with PLA2s expression. These data indicated that the level of expression observed in the different strains was tightly linked to the BamHI RFLP. The lack of concordance with other identified RFLPs suggests that the level of expression is not the result of a gross chromosomal rearrangement. Isolation and sequence analysis of the murine PLA2s cDNA

To further analyze the molecular basis of the PLA2s polymorphism detected between the AKR and B6 strains, the mouse PLA2s cDNA was isolated from an ileal cDNA (C57BL/6J X C2H)FI library. Screening with a rat PLA2s cDNA probe yielded two positive clones, MPla2s-2 and MPla2s-6. Both clones were most likely derived from the C3H allele, since PLA2s expression is much higher in C3H mice than in B6 mice. Sequence analysis revealed that both clones contained the entire PLA2s open reading frame including the N-terminal signal peptide (Figure 4) . Clone MPla2s-6 also included a potential polyadenylation site closely followed by a stretch of adenines indicative of poly-A+ tail. Sequence comparison indicated that the clones were 99% identical at the nucleotide level with the available murine PLA2s sequence determined from BALB/c cDNA (GENBANK

Accession #X74266) and 86% identical at the nucleotide level with the rat PLA2s sequence.

Identification of an insertion mutation in Moml ^s mice

Comparison of the nucleotide sequence of the mouse PLA2s cDNA (Figure 4) with the published rat and human PLA2s cDNAs revealed the presence of a conserved BamHI site at position 207. Since the BamHI RFLP identified was 100% concordant with the Moml phenotype, we determined whether the BamHI site in the open reading frame of PLA2s was polymorphic between Moml ^r and Moml ^s strains. RT-PCR of total RNA from the small and large intestines of 9 mouse strains (including B6 and AKR) was performed to determine the conservation of the BamHI site located at position 207 of the PLA2s gene (Figure 4) . To amplify the entire coding region of the murine PLA2s RNA, oligodeoxynucleotide primers derived from the 5' and 3' noncoding regions were prepared based on the sequence of the MPla2s-6 cDNA clone (see Experimental Procedures) . All the strains assayed, regardless of the PLA2s allele, produced a PCR product of approximately 720 bp. In addition to the 720 bp product, all the inbred strains containing the 9.0 kb BamHI allele produced a smaller 610 bp PCR product (Figure 5 Panel A) .

Sequence analysis of the 720 bp RT-PCR product from AKR intestinal RNA and the 720 and 610 bp RT-PCR products from B6 intestinal RNA revealed that a BamHI site was present in the AKR product but was absent in the B6 products. A single base pair insertion was detected in the B6 strain within the BamHI site (Figure 6 Panel A) . The insertion of a thymidine residue at this site results in the destruction of the BamHI site in the B6 strain and the production of the 9.0 kb fragment determined from RFLP analysis (Figure 3) . The mutated sequence 5' -GGATTCC-3' (SEQ ID NO:20) is detected in all strains containing the 9.0 kb BamHI allele and exhibiting reduced expression of PLA2s by northern blot analysis. The insertion results in a frameshift mutation that creates a stop codon 13 amino acids downstream in exon 4 (Figure 4) . In contrast, the RT-PCR product from the AKR strain contained the BamHI site

that was observed in both C3H/HeJ and BALB/c mice (Figure 4) . Similarly, the BamHI site was detected in all inbred strains possessing the 2.5 and 6.5 kb BamHI restriction, consistent with this site causing the polymorphism. Sequence analysis of the 610 bp B6 fragment revealed the presence of the thymidine insertion at the BamHI site located in exon 3. In addition, the 610 bp fragment was found to result from exon 3 splicing directly into exon 5, with the exclusion of exon 4 (Figure 6 Panel B) . To confirm the sequencing results, the 720 bp RT-PCR products from both B6 and AKR intestinal RNA were subjected to BamHI digested into 2 smaller fragments approximately 120 bp and 600 bp in length, while both the 720 bp and 610 bp fragments amplified from B6 mRNA failed to digest with BamHI (data now shown) . Determination that the thymidine insertion is present in genomic DNA

To rule out post-transcriptional processing as a cause of the thymidine insertion in exon 3, 100 ng of genomic DNA from AKR and B6 mice were subjected to long range PCR using oligodeoxynucleotide primers specific for exons 3 and 5 of the PLA2s gene. The resultant 2.2 kb products from AKR and B6 were purified and sequenced. As expected, the insertion of a thymidine at the BamHI restriction site was observed in the mutant B6 product, while a normal BamHI site was observed in the wildtype AKR product (Figure 6 Panel C) . These results demonstrate that the insertion of a thymidine at the BamHI site is responsible for the RFLP identified by Southern blot analysis. Moreover, these results indicate that this mutation is responsible for the Moml ^s phenotype. DISCUSSION

Moml and PLA2s

Genetic modifiers of cancer prevalence have long been predicted to exist. The generation of mouse models of human cancer coupled with the advances of QTL analysis have enabled the identification of these modifier loci. Moml was phenotypically identified and shown to contribute up to 50% of the genetic variance responsible for intestinal neoplasia in

Min mice. The results described here indicate that allelic variants of the PLA2s gene are responsible for Moml phenotypes. That is, genetic and molecular analysis demonstrated that 1) the gene for PLA2s maps to the same chromosomal region as Moml and 2) the strain that is susceptible to multiple intestinal adenomas express a mutated form of PLA2s. Moreover, we determined the expression pattern of PLA2s in 6 strains of mice not analyzed for their Moml allele and found they fell into two distinct classes; the first class like the wildtype AKR pattern and the second class like the mutant B6 pattern of expression. Thus we predict that C3H/HeJ, CBA/J and M. spretus mice will be resistant to multiple adenoma formation (as are AKR, MA/MyJ and CAST/Ei mice) while P/J, A/J, C58/J, 129/SvJ, and AEJ/GnJ mice would be susceptible to multiple adenoma formation (as in B6 mice) .

Southern blot analysis revealed that the PLA2s expression differences detected between the inbred strains was 100% concordant with a BamHI polymorphism. Cloning and sequencing of the PLA2s cDNA from both Moml ^r and Moml ^s strains revealed that the BamHI polymorphism mapped to the middle of exon 3. The polymorphism results from the insertion of a single thymidine residue in the BamHI site which causes a frameshift mutation resulting in a stop codon in exon 4 (Figure 4) . Analysis of frameshift and nonsense mutations have revealed that these mutations often result in decreased steady-state levels of mRNA, consistent with the dramatically lower steady- state levels of PLA2s mRNA (Figure 2 Panel A and Panel B) . In addition, analysis of the RT-PCR products revealed that a second transcript is present in intestinal RNA isolated from mice carrying the Moml ^s allele (Figure 5) . This second transcript results from the splicing of exon 3 into exon 5, skipping exon 4 (where the nonsense codon occurs) (Figure 4) . However, this alternative splicing still results in a +1 shift in the open reading frame yielding a novel carboxyl terminus for the truncated PLA2s protein. The appearance of an alternatively spliced PLA2s transcript in B6 mice is consistent

with recent reports which identified exon skipping due to the presence of nonsense codons within the deleted exon.

In Moml ^s strains, if the two alternative transcripts are translated, the resultant proteins would most likely be non- functional. The product of the normally spliced transcript would result in the addition of a novel 13 amino acids followed by a stop codon (Figure 4) . This predicted product would be a truncated protein missing 12 of the 14 conserved cysteine residues critical for maintaining secondary structure and stability. The protein product derived from the alternatively spliced form would contain a novel 37 amino acid carboxyl terminal end (Figure 4) . This form would also be predicted to lack enzymatic activity due to loss of the structural integrity of the PLA2s products of roughly 5.2 KDa and 7.6 KDa would be generated, instead of the wildtype 14 KDa secreted PLA2s.

These results indicate that the increased tumor susceptibility in Moml ^s strains is either due to the expression of abnormal PLA2s protein product(s) or due to the lack of wildtype PLA2s enzyme activity. Since the resistance to tumor formation observed in hybrid FI mice generated from a cross between a Moτnl ^s strain and a Moml ^r strain is dominant, the most likely hypothesis is that the presence of wildtype PLA2s enzyme activity confers resistance to multiple adenoma formation, while the truncated product(s) have no effect on adenoma formation.

PLA2s and inflammation

Our data demonstrate there exists a set of inbred strains

(B6, A/J, C58/J, P/J and 129/SvJ) that harbor a germline null mutation for the PLA2s gene. There is no consensus as to how many distinct PLA2s related genes exist in the mammalian genome. Initial Southern blot hybridization results suggested that there is a single type II phospholipase A2 locus in both the human and rat. However, two distinct sequences related to, yet distinct from the human PLA2s gene have been identified. Furthermore, a novel PLA2s gene expressed mainly in heart which lacks one of the 7 characteristic disulfide bonds has been cloned and sequenced. These results suggest that there exists

multiple forms of PLA2s in the mammalian genome. The type II nonpancreatic secreted phospholipase A2 has been widely implicated in being instrumental in the inflammatory process and arthritis. However our results indicate that several inbred strains lack this enzyme. To our knowledge, no data has been presented that indicates that B6 mice (or other Moml ^s strains) have an altered or impaired inflammatory response. A thorough comparison of the inflammatory process needs to be performed between Moml ^s and Moml ^r strains to further elucidate the role of PLA2s in inflammation and arthritis.

The role of PLA2s in modifying tumor susceptibility

PLA2s is one of several enzymes involved in generating arachidonic acid and lysophosphatidic acid. Arachidonic acid is the rate limiting substrate for the generation of prostaglandins (via the cyclooxygenase pathway) and leukotrienes (via the lipoxygenase pathway) . Although previous studies have suggested the potential roles of Phospholipase C and prostaglandins in the development of intestinal adenomas, no evidence implicating PLA2s has been found. The role of prostaglandins in the susceptibility to adenoma formation is unclear. However, numerous studies have demonstrated that non- steroidal anti-inflammatory drugs (NSAIDs) confer a protective effect in the generation of colon adenomas in both human epidemiological studies as well as in animal models. The mechanism of action of the NSAIDs, such as Sulindac, is presumed to be by inhibiting cyclooxygenase, resulting in a decrease in prostaglandin production. Studies have determined that Sulindac significantly decreased the activities of phosphatidylinositol-specific phospholipase C and the levels of prostaglandin E2 in colonic mucosa and tumors. Thus, various investigators hypothesized that the decrease of specific prostaglandins contributes to tumor protection and regression. Since our results indicate that increased levels of PLA2s also result in a protective effect, it suggests that Sulindac and other NSAIDs ameliorates polyp formation by a more complicated mechanism. One possibility is that NSAID treatment results in the induction of PLA2s synthesis and secretion.

An alternative hypothesis for the mode of action of PLA2s might be in its role in lipid homeostasis. Though it is believed that pancreatic type I PLA2s is responsible for the digestion of fatty acids, the presence of high quantities of type 11 PLA2s in the intestine is suggestive of a role in the digestion of dietary fats. There is a strong positive correlation between fatty acid intake and an increased susceptibility to colon cancer. Thus, dietary lipids might interact with the intestinal villi to stimulate the formation of aberrant crypts. Therefore, the presence of high levels of PLA2s in the intestine would provide a protective effect by inactivating the harmful affects of dietary fatty acids. Alternatively, PLA2s might be important at maintaining normal intestinal flora; different types of dietary fat have been associated with alteration of the normal intestinal flora. Diets high in saturated fatty acid are associated with increased amounts of the anaerobic bacteria, Bacteroids. It has recently been demonstrated that purified type II PLA2s, isolated from mouse intestines, possesses potent bactericidal activity. Since PLA2s is secreted from Paneth cells and these cells secrete many bactericidal proteins, including lysozyme and defensins it is not surprising that PLA2s has a role in microbial defense mechanisms. Thus, the Moml ^r strains have high levels of PLA2s in their intestinal lumen to help protect and/or control the intestinal flora, while the Moml ^s strains would lack sufficient levels of PLA2s to affect bactericidal activity. Bacteroides and other anaerobic bacteria have been proposed to produce toxins or convert bile salts to carcinogenic products. Thus, one potential mechanism of increased adenoma susceptibility in B6 mice is that the lack of PLA2s in the intestine allows for the proliferation of certain types of bacteria that produce carcinogenic products which facilitate polyp formation and transformation.

Murine intestinal PLA2s was independently identified as Enhancing Factor. Enhancing Factor was identified as a low molecular weight heat and acid stable polypeptide that enhanced the binding of EGF to cells. In addition, several reports have

identified a mitogenic action for PLA2s. PLA2s was found to induce DNA synthesis and proliferation independent of arachidonate products. Thus, the presence of high levels of PLA2s in intestinal crypts might provide an environment that would inhibit the formation of transformed crypts due to the enhanced accessibility of growth factors.

A final potential mechanism of PLA2s action is its role in maintenance of membrane asymmetry. PLA2s activity requires millimolar concentrations of Ca ⁺ , suggesting that PLA2s must be released into the extracellular environment to become fully active. In addition, the specificity of PLA2s in the microenvironment is mediated by membrane asymmetry; specifically, PLA2s has a preference for the head group of anionic phospholipids (i.e. phosphatidylserine (PS) and phosphatidylethanolamine (PE) located on the external membrane. Normal colonic epithelium has phosphatidylcholine (PC) on its external leaflet, the phospholipid which is a low affinity substrate of PLA2s. Taken together, these data suggest that PLA2s does not catalytically attack the membrane phospholipids of normal intestinal epithelium. In contrast, bacterial cell membranes, comprised mostly of phosphatidylglycerol (PG) , are a prime target for PLA2s action, hence its bactericidal properties (see above) . However, loss of the membrane asymmetry in intestinal epithelium could lead to increased accessibility of cell membrane phospholipids to PLA2s enzymatic activity. Colon carcinoma cells have been shown to have elevated levels of PS on their outer leaflet, making a suitable target for PLA2s digestion. If the membrane phospholipid shift occurs at an early point in the transformation of intestinal epithelium, then high levels of PLA2s in the intestinal lumen may provide a protective function by eliminating aberrant crypt cells while low levels may allow unbridled growth of transformed cells. Prospectus PLA2s represents a new class of genes that influence tumor susceptibility. We have proposed several mechanisms to explain how PLA2s activity could contribute to tumor

resistance. Regardless of the mechanism, it is probable that the mode of protection is non-cell autonomous, since PLA2s is most likely active in the intestinal lumen and not within the cell. Recently, another modifier of murine intestinal cancer that is intrinsic to the transformed cell has been identified. This modifier confers tumor resistance by causing DNA hypomethylation. The identification of this cell autonomous modifier was accomplished through the use of gene targeting and drug treatment in mice. The proposed models for PLA2s action are also testable through the use of mouse mutants and through experimental manipulation of the diet and drug treatment of Moml ^s and Moml ^r strains. The ultimate proof of PLA2s action as a modifier of tumor multiplicity in intestinal cancer will be shown by expressing a wildtype copy of the PLA2s gene within the microenvironment of the intestinal crypts in Moml ^s strains and demonstrating a reduction in the number of adenomas or by targeted ablation of the PLA2s gene in Moml ^r strains.

The human homolog of PLA2s has been localized to chromosome lp35, a region that exhibits loss of heterozygosity in a variety of neoplasms. However, due to the proposed non- cell autonomous mode of action for PLA2s, it is unclear as to how loss of PLA2s in tumor cells would contribute to neoplasia. The identification of PLA2s as the genetically defined Moml locus has several important implications in human cancer. One possibility of PLA2s involvement may be reflected by the variable number of adenomas identified amongst family members inheriting the same APC mutation. his variation in tumor burden could be attributable to the independent segregation of different PLA2s alleles that confer variations in expression levels or enzyme activity. Moreover allelic variation at the PLA2s locus could contribute to the susceptibility of non- familial colon cancer within the general population. Thus, population surveys would be useful to determine the extent of allelic variation as well as to provide a potential predictor to identify individuals at risk for developing intestinal cancer. Finally, the identification of PLA2s as a major modifier of intestinal polyp formation may provide a missing

link between high fat diets and increased incidence of colon cancer.

Experimental Procedures

Mice The murine chromosomal location of PLA2s was determined using interspecific backcross analysis. The interspecific backcross was [(AEJ/Gn - a bp ^H /a bp ^H x Mus spretus)F _x X AEJ/Gn - a bp ^H ] . Additional inbred strains were purchased from The Jackson Laboratory (Bar Harbor, ME) . Probes

Probes used to map the mouse PLA2s gene and screen murine cDNA libraries were derived from a 758 bp rat cDNA fragment cloned into the EcoRI site of a pGEM vector. The pGEM vector containing the rate PLA2s gene was a gift from Dr. J. Ishizaki (Shionogi Research Laboratories, Osaka, Japan) . The chromosomal location of PLA2s was determined by Southern blot analysis in 195 N2 animals. A 456 bp fragment of the rat PLA2s coding region was amplified by the PCR using the following oligodeoxynucleotide primers (ZW-1) 5' - ATGAAGGTCCTCCTGTTG-3' SEQ ID NO:21 and (ZW-2) 5'-CAGAGAGTGTCTTTTCAGC-3' SEQ ID NO:22. These primers correspond to bases 1 and 456 of the rat PLA2s coding region (GENBANK Accession #M37127) . The resulting PCR fragment was radiolabeled with [a- ³² P] -dCTP using a random primed kit (Boehringer Mannheim, Indianapolis, IN) and used for Southern blot analyses. The rat PLA2s probe hybridized to a 9.0 kb BamHI fragment in the M. spretus parental strain and a 2.5 kb BamHI fragment in the AEJ parental strain. cDNA cloning Murine PLA2s clones (MPLA2sl-6) were isolated from a (C57BL/6J x C3H)F1 ileal cDNA library made from the terminal 3.0 cm of the small intestine; the library was a generous gift from Dr. J. Gordon (Washington University School of Medicine, St. Louis, MO) . The clones were isolated following standard techniques. A 780 bp fragment of the entire coding region was amplified as above, using T3 and T7 primers which flank the insert. PCR products were purified by electrophoresis on a

Seaplaque low-melt agarose gel, radiolabeled and used for northern and Southern blot analysis. SSLP Analysis

DNA primers for SSLP analyses were made using an Applied Biosystems Model 394 DNA/RNA synthesizer. Genomic DNA isolation and agarose gel electrophoresis were performed. Primers and fragment sizes for the D4Mitl3, D4Mitl6 and D4Mitl48 microsatellite markers were as described in Dietrich et al., 1992 Genetics 131:423-447 which is incorporated herein by reference) . PCR conditions were performed as described (Ma et al., 1993 Proc. Natl. Acad. Sci. USA 90:6350-6354). The PCR protocol for the primes was an initial denaturation at 94 C for 4 min, followed by 40 cycles at 94 C for 30 sec, 55-60 C for 30 sec, 72 C for 30 sec, and ended with one 72 C extension for 7 min. The resulting D4Mitl48 fragments were visualized by ethidium bromide staining Of 3% agarose gels, while 10% and 5% polyacrylamide gels were used for D4Mitl3 and D4Mitl6, respectively. DNA isolation and Southern Blot Analysis Genomic DNAs from a variety of inbred strains were isolated from tail biopsies. High molecular weight genomic DNA was digested with the appropriate restriction endonucleases according to suppliers directions, fractionated on 0.8% Seakem Agarose gels overnight, and transferred to Hybond N+ nylon membranes. Hybridization to rat and mouse [a- ³² P] -dCTP labeled probes was performed by standard techniques. The following day membranes were washed in 1XSSCP, 0.1% SDS at 65 C for 1 hour and exposed to autoradiography film at -70 C. RNA Isolation and Northern Blot Analysis Total RNA from mouse tissues was isolated. 20 g of total RNA was size-fractionated on 1.0% formaldehyde agarose gels. Northern blots were transferred and hybridized. RT-PCR and Sequence Analysis

First strand cDNA was synthesized from 1.0 g of total RNA using oligo d(T) ₁₅ and M-MuLV reverse transcriptase. PCR was performed, as described above, using oligodeoxynucleotide primers specific for murine PLA2s. Double stranded cDNA

products were purified using QIAquick PCR purification columns

(Qiagen, Chatworth, CA) , dried and resuspended in 10 1 of H ₂ 0.

Oligodeoxynucleotide primers for PCR analysis were synthesized with -cyanoethyl phophoramidities on an Applied Biosystems 394 DNA/RNA synthesizer.

Long range PCR of genomic DNA fragments was performed using the Klen Taq I and polymerase II kit (Ab Peptides Inc., St. Louis, MO) . PCR amplification of 100 ng of genomic DNA was achieved by 25 cycles at 95 C for 5 sec, 65 C for 30 sec and 68 C for 7 min. PCR products were purified as described above. Sequencing reactions of the PCR products were performed using dyedeoxy terminator reaction chemistry for sequence analysis on an Applied Biosystems Model 373 DNA sequencer. Example 3 According to some embodiments, immunoassay comprise allowing proteins in the sample to bind a solid phase support such as a plastic surface. Detectable antibodies are then added which selectively binding to PLA2s. Detection of the detectable antibody indicates the presence of PLA2s. The detectable antibody may be a labelled or an unlabelled antibody. Unlabelled antibody may be detected using a second, labelled antibody that specifically binds to the first antibody or a second, unlabelled antibody which can be detected using labelled protein A, a protein that complexes with antibodies. Various immunoassay procedures are described in Immunoassay for the 80 's, Voller, et al . , Ed., University Park, 1981, which is incorporated herein by reference. The amount of antibodies present may be quantified by well known techniques.

Simple immunoassay may be performed in which a solid phase support is contacted with the test sample. Any proteins present in the test sample bind the solid phase support and can be detected by a specific, detectable antibody preparation. Such a technique is the essence of the dot blot, Western blot and other such similar assays. Other immunoassay may be more complicated but actually provide excellent results. Typical and preferred immunometric assays include "forward" assays for the detection of a protein

in which a first anti-protein antibody bound to a solid phase support is contacted with the test sample. After a suitable incubation period, the solid phase support is washed to remove unbound protein. A second, distinct anti-protein antibody is then added which is specific for a portion of the specific protein not recognized by the first antibody. The second antibody is preferably detectable. After a second incubation period to permit the detectable antibody to complex with the specific protein bound to the solid phase support through the first antibody, the solid phase support is washed a second time to remove the unbound detectable antibody. Alternatively, the second antibody may not be detectable. In this case, a third detectable antibody, which binds the second antibody is added to the system. This type of "forward sandwich" assay may be a simple yes/no assay to determine whether binding has occurred or may be made quantitative by comparing the amount of detectable antibody with that obtained in a control. Such "two-site" or "sandwich" assays are described by Wide, Radioimmune Assay Method, (1970) Kirkham, Ed., E. & S. Livingstone, Edinburgh, pp. 199-206, which is incorporated herein by reference.

Other types of immunometric assays are the so-called "simultaneous" and "reverse" assays. A simultaneous assay involves a single incubation step wherein the first antibody bound to the solid phase support, the second, detectable antibody and the test sample are added at the same time. After the incubation is completed, the solid phase support is washed to remove unbound proteins. The presence of detectable antibody associated with the solid support is then determined as it would be in a conventional "forward sandwich" assay. The simultaneous assay may also be adapted in a similar manner for the detection of antibodies in a test sample.

The "reverse" assay comprises the stepwise addition of a solution of detectable antibody to the test sample followed by an incubation period and the addition of antibody bound to a solid phase support after an additional incubation period. The solid phase support is washed in conventional fashion to

remove unbound protein/antibody complexes and unreacted detectable antibody. The determination of detectable antibody associated with the solid phase support is then determined as in the "simultaneous" and "forward" assays. The reverse assay may also be adapted in a similar manner for the detection of antibodies in a test sample.

The first component of the immunometric assay may be added to nitrocellulose or other solid phase support which is capable of immobilizing proteins. The first component for determining the presence of PLA2s in a test sample is anti- PLA2s antibody. By "solid phase support" or "support" is intended any material capable of binding proteins. Well-known solid phase supports include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, agaroses, and magnetite. The nature of the support can be either soluble to some extent or insoluble for the purposes of the present invention. The support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube or the external surface of a rod. Alternatively, the surface may be flat such as a sheet, test strip, etc. Those skilled in the art will know many other suitable "solid phase supports" for binding proteins or will be able to ascertain the same by use of routine experimentation. A preferred solid phase support is a 96-well microtiter plate.

To detect the quantity of PLA2s, detectable anti-PLA2s antibodies are used. Several methods are well known for the detection of antibodies. Anti-PLA2s antibodies may be labelled with a radioisotope and the amount of radioisotope may be determined using a scintillation counter.

One method in which the antibodies can be detectably labelled is by linking the antibodies to an enzyme and subsequently using the antibodies in an enzyme immunoassay (EIA) or enzyme-linked immunosorbent assay (ELISA) , such as a capture ELISA. The enzyme, when subsequently exposed to its substrate, reacts with the substrate and generates a chemical moiety which can be detected, for example, by

spectrophotometric, fluorometric or visual means. Enzymes which can be used to detectably label antibodies include, but. are not limited to malate dehydrogenase, staphylococcal nuclease, delta-5-steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase. One skilled in the art would readily recognize other enzymes which may also be used.

Another method in which antibodies can be detectably labelled is through radioactive isotopes and subsequent use in a radioimmunoassay (RIA) (see, for example, Work, et al . , Laboratory Techniques and Biochemistry in Molecular Biology, North Holland Publishing Company, N.Y., 1978, which is incorporated herein by reference) . The radioactive isotope can be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography. Isotopes which are particularly useful for the purpose of the present invention are ³ H, ¹⁵ I, ¹³¹ I, ³⁵ S, and ¹⁴ C. Preferably ¹²⁵ I is the isotope. One skilled in the art would readily recognize other radioisotopes which may also be used.

It is also possible to label the antibody with a fluorescent compound. When the fluorescent-labelled antibody is exposed to light of the proper wavelength, its presence can be detected due to its fluorescence. Among the most commonly used fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine. One skilled in the art would readily recognize other fluorescent compounds which may also be used.

Antibodies can also be detectably labelled using fluorescence-emitting metals such as ¹⁵² Eu, or others of the lanthanide series. These metals can be attached to the protein-specific antibody using such metal chelating groups as diethylenetriaminepentaacetic acid (DTPA) or ethylenediamine-

tetraacetic acid (EDTA) . One skilled in the art would readily recognize other fluorescence-emitting metals as well as other metal chelating groups which may also be used.

Antibodies can also be detectably labelled by coupling to a chemiluminescent compound. The presence of the chemiluminescent-labelled antibody is determined by detecting the presence of luminescence that arises during the course of a chemical reaction. Examples of particularly useful chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester. One skilled in the art would readily recognize other chemiluminescent compounds which may also be used.

Likewise, a bioluminescent compound may be used to label antibodies. Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin. One skilled in the art would readily recognize other bioluminescent compounds which may also be used.

Detection of the protein-specific antibody, fragment or derivative may be accomplished by a scintillation counter if, for example, the detectable label is a radioactive gamma emitter. Alternatively, detection may be accomplished by a fluorometer if, for example, the label is a fluorescent material. In the case of an enzyme label, the detection can be accomplished by colorometric methods which employ a substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards. One skilled in the art would readily recognize other appropriate methods of detection which may also be used.

The binding activity of a given lot of antibodies may be determined according to well known methods. Those skilled in the art will be able to determine operative and optimal assay

conditions for each determination by employing routine experimentation.

Positive and negative controls may be performed in which known amounts of PLA2s and no PLA2s, respectively, are added to assays being performed in parallel with the test assay. One skilled in the art would have the necessary knowledge to perform the appropriate controls.

Example 4

The following is the protocol for purification of the group II phospholipase A ₂ by acid extraction. (See Franson RC,

Weir DL, Thakkar J 1983, Solubilization and characterization of a neutral-active, calcium-dependent, phospholipase A ₂ from rabbit heart and isolated chick embryo myocytes. Lung 160:275-

284) . The protocol yields an active enzyme. 1. Wet weight of tissue is obtained from an individual.

A tared beaker is used.

2. Add 5 ml ice-cold distilled H ₂ 0 per 1.5g tissue; mince and then homogenize.

3. Add ice-cold H ₂ S0 ₄ to homogenate to bring final concentration to equal 1.5g tissue per 10ml/0.18N H ₂ S0 ₄ . Stir homogenate in cold-room (4°) for one hour. Homogenate will tend to precipitate. Therefore:

4. Resuspend homogenate, then centrifuge (4°) @ 12,000 X g for 30 min. Collect supernatant. 5. Dialyze supernatant against 10 mM Sodium Acetate until pH=4.5; this may require at least one change of lOmM NaAc. Do this is the cold. Reminder: Dialysis tubing should have molecular weight cut off of less than 12kD since the protein of interest is 14.5kD). Overnight dialysis in a fresh change of sodium acetate is usually required (one change of fluid) .

6. Centrifuge dialysate @ 18,000 X g for 30 min. (4°) . a. collect dialysate (supernatant) b. heat 5 min. (absolutely no more than 5 min.) at 100' centrifuge @ 12 , 000g X 30 min . to yield supernatant enriched in group II PLA ₂ .

We have found that acid extract obtained after first centrifugation is sufficiently enriched for our Western blot analysis. For Western blot analysis, we would take equal volumes of sample (acid extract) , add an aliquot of 5X SDS sample buffer to yield a final concentration of IX SDS sample buffer, and then add sufficient ION NaOH (usually one or two ul) to neutralize sample (as evidenced by restoration of blue color of bromophenol blue pH indicator included in SDS sample buffer) . Samples were then boiled 5 min. , centrifuged in a microfuge to remove insoluble materials (16,000 X G for 15 min.), and loaded onto 20% SDS-gels, 4% stacking gel, 0.75 mm thick. Appropriate low molecular weight standards, as well as authentic human recombinant synovial fluid phospholipase A ₂ were loaded on the gel. Electrophoresis was in a Bio-Rad minigel apparatus, at 200V for 45-60 min. The proteins were then transferred to either supported nitrocellulose, or PDVF, in a BioRad mini-transfer apparatus at 30V overnight in the cold, followed by 60V for 2 hr. The gels were recovered and stained with coomassie blue to monitor transfer of the proteins, and the nitrocellulose (or PDVF) was stained with Fast Green to visualize and monitor the transfer of the proteins as well as permit marking of the location of the molecular weight standards. The membranes were then washed, and incubated with polyclonal antibody to human recombinant synovial fluid phospholipase A ₂ , or in at least one case, to antibody prepared against mouse intestinal phospholipase A ₂ .

Example 5

Assay for group II PLA ₂ (PLA, ) _• adopted from L.A. Marshall et al., J. Lipid Mediators Cell Signalling 10:295-313 (1994) which is incorporated herein by reference. See also: Patriarca et al. , 1972 Phospholipases and phospholipid turnover in Escherichi Coli Spheroplasts. Biochim Biophys Acta 260:593- 600 which is incorporated herein by reference. This protocol be used with purified enzymes, subcellular fractions, or crude homogenates obtained from tissue biopsy or body fluid samples.

- 48 -

1. Incubate from 1-30 ug of protein in a 50 ul reaction mixture which consists of

• 25mM Hepes buffer at pH 7.4

• 150mM NaCl • 5mM CaCl ₂

• substrate: 100 uM [ ³ H]arachidonic acid labeled E. Coli (about 8 nmol lipid phosphorous) . Bacteria may be radiolabeled using published procedures, or purchases directly from DuPont NEN.

2. Initiate reaction by addition of substrate, and continue for 5 to 60 min. at 37°. Initial experiments will determine the incubation time during which the enzyme activity is linear. 3. The reaction is terminated by the addition of 1ml of Dole's reagent (2-propanol/hexane/0.5M H ₂ S0 ₄ ; 40:10:1, V/V). A carrier of 5 ug unlabeled arachidonic acid (stock of lmg/ml in hexane) is added, followed by 0.6ml hexane and 0.5ml distilled in H ₂ 0. The mixture is then mixed thoroughly and permitted to stand so that two phases form.

The upper phase is transferred to tubes containing lm hexane plus 75g activated BioSil A. The tubes are then vortexed thoroughly, and centrifuged @ 15,000 X g for 10 minutes to produce a supernatant which is then pipetted into scintillation vials, and then evaporated under N ₂ .

One ml of scintillation cocktail is then added to each vial, and radioactivity determined in a scintillation counter. 4. Data are calculated as % free fatty acid hydrolyzed = [ (dpm released from reaction mixture containing enzyme preparation - those released spontaneously from reaction mixtures which lack enzyme) /total dpm added to reaction mixture] X 100.

Since both the group II PLA ₂ and the high molecular weight cytosolic PLA ₂ will both utilize radiolabelled E. Coli as substrate, specificity for assay for the group II PLA ₂ may be obtained by:

• assay of acid-extracted homogenates; low pH destroys activity of the high molecular weight PLA ₂ .

• treatment of the reaction mixture with lOOmM dithiothreitol; the group II PLA ₂ are destroyed by reducing agents, whereas the high molecular weight PLA ₂ are resistant to reducing agents.

• incorporation of 12-epi-Scalardial (purchased from Biomol research labs) , a selective inhibitor of the group II PLA ₂ , into the reaction mixture.

One or more of these treatments would permit determination of the amount of enzyme activity due to the group II PLA ₂ by subtraction from assay mixtures that were not treated.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Buchberg, Arthur M. Siracusa, Linda D. Chepenik, Kenneth P. (ii) TITLE OF INVENTION: RISK FACTOR FOR COLORECTAL CANCER AND COMPOSITIONS AND METHODS OF DETECTING THE SAME (iii) NUMBER OF SEQUENCES: 22 (iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Woodcock Washburn Kurtz Mackiewicz & Norris

(B) STREET: One Liberty Place, 46th Floor

(C) CITY: Philadelphia

(D) STATE: Pennsylvania

(E) COUNTRY: USA

(F) ZIP: 19103

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: Floppy disk

(B) COMPUTER: IBM PC compatible

(C) OPERATING SYSTEM: PC-DOS/MS-DOS

(D) SOFTWARE: WordPerfect 6.1 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER:

(B) FILING DATE:

(C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: US 08/484,359

(B) FILING DATE: 07-JUN-1995

(C) CLASSIFICATION: (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: DeLuca, Mark

(B) REGISTRATION NUMBER: 33,229

(C) REFERENCE/DOCKET NUMBER: TJU-1925 (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: 215-568-3100

(B) TELEFAX: 215-568-3439

(2) INFORMATION FOR SEQ ID NO:l:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:l:

GAAACCATAC CACCATCCAA 20

(2) INFORMATION FOR SEQ ID NO:2:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:2:

CCAGGACTCT CTTAGGTACG 20

(2) INFORMATION FOR SEQ ID NO:3:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 17 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:3:

GCGCAGTTTG GGGAAAT 17 (2) INFORMATION FOR SEQ ID NO:4:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:4:

GAGAGCTGAC AGCATGAAGG 20

(2) INFORMATION FOR SEQ ID NO:5:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 24 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:5:

CCGTTTCTGA CAGGAGTTCT GGTT 24

(2) INFORMATION FOR SEQ ID NO:6:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:6:

GCAAGGGGCT CTAAGAATTG 20

(2) INFORMATION FOR SEQ ID NO:7:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:7:

TGGGAATAGA AAAGAGGGCT 20

(2) INFORMATION FOR SEQ ID NO:8:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 207 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:8:

CCAGGACATA CTTCCTGTGA 20

(2) INFORMATION FOR SEQ ID NO:9:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:9:

TGCTCTTGAC AGGACATCAG 20

(2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:10:

TGTATCATGG GGTTCTCCAC 20

(2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:11:

TCCCATCCAA CCTAAGTCCA 20

(2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:12:

AGTGTGACAG AGGAAGTCAC 20

(2) INFORMATION FOR SEQ ID NO:13: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:13:

TTGGGAGTTG TCTGGTGATG 20

(2) INFORMATION FOR SEQ ID NO:14: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:14:

AGGAAGGAGA GTAGCAGAGA 20

(2) INFORMATION FOR SEQ ID NO:15: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:15:

ACCCAGTGAC TTTGCAACAG 20

(2) INFORMATION FOR SEQ ID NO:16: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:16:

GCATGTTGGA ACTTCTGCTC 20

(2) INFORMATION FOR SEQ ID NO:17: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (xi) SEQUENCE DESCRIPTION: SEQ ID NO:17:

CTCAGGCTGT GTTAATGCCT 20

(2) INFORMATION FOR SEQ ID NO:18: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:18:

TCTCCAACTA GGAGCTTCTG 20

(2) INFORMATION FOR SEQ ID NO:19: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:19:

TTATTCAGAA GAGACCCCCC 20

(2) INFORMATION FOR SEQ ID NO:20: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 7 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:20:

GGATTCC 7

(2) INFORMATION FOR SEQ ID NO:21: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:21:

ATGAAGGTCC TCCTGTTG 18

(2) INFORMATION FOR SEQ ID NO:22: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 19 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear

(xi) SEQUENCE DESCRIPTION: SEQ ID NO:22:

CAGAGAGTGT CTTTTCAGC 19