COMBINATORIAL TREATMENT WITH GLUCOSE REGULATED

PROTEIN-170 AND MELANOMA DIFFERENTIATION ASSOCIATED GENE-7

CROSS-REFERENCE TO RELATED APPLICATIONS

The present application claims the benefit of U.S. Provisional Application No. 61/053,548, filed May 15, 2008, which is hereby incorporated by reference in its entirety.

GRANT INFORMATION

The invention was made with government support under grants R21 CA121848, ROl CA 129111, POl CA 104177, and CA016056 awarded by the National Cencer Institute. The government has certain rights in the invention.

1. INTRODUCTION

The present invention relates to the combined use of (i) a Glucose Regulated Protein- 170 (GRP- 170) molecule and (ii) a Melanoma Differentiation Associated Gene-7 molecule in methods which inhibit the proliferation and/or survival of cancer cells.

2. BACKGROUND OF THE INVENTION

2.1 MDA-7 Melanoma differentiation associated gene-7 (mda-7) (Jiang et al.,

1995) is a secreted cytokine belonging to the interleukin (IL)-IO family designated as IL-24 (Pestka et al., 2004). Multiple independent studies demonstrate that delivery of mda-7/IL-24 by a replication incompetent adenovirus, Ad.mda-7, or as a GST-MD A- 7 fusion protein selectively kills diverse cancer cells. In contrast to its harmful effects on tumor cells, mda-7/IL-24 does not induce toxicity in normal endothelial and epithelial cells, fibroblasts, melanocytes and astrocytes (Ekmekcioglu et al., 2001; Ellerhorst et al., 2002; Fisher, 2005; Fisher et al., 2003; Gupta et al., 2006b; Huang et al., 2001; Jiang et al., 1996; Lebedeva et al., 2005; Lebedeva et al., 2002; Madireddi et al., 2000; Mhashilkar et al., 2001; Saeki et al., 2000; Saeki et al., 2002; Sarkar et al., 2006; Sarkar et al., 2002a; Sarkar et al., 2002b; Sauane et al., 2003; Su et al.,

2001; Su et al, 1998). In addition, mda-7/IL-24 possesses potent anti-angiogenic, immunostimulatory and bystander activities (Fisher, 2005; Fisher et al., 2003; Gupta et al., 2006; Lebedeva et al., 2005). The sum of these attributes makes mda-7/IL-24 a significant candidate for cancer gene therapy (Fisher, 2005). Indeed, Ad.mda-7 has been successfully used for a Phase I clinical trial for advanced carcinomas and melanomas and has shown promising results in tumor growth inhibition and induction of cancer apoptosis (Cunningham et al., 2005; Fisher, 2005; Fisher et al., 2003; Lebedeva et al., 2005; Tong et al., 2005).

Previous studies demonstrate that Ad.mda-7 induces growth suppression and apoptosis in histologically diverse cancer cells containing single or multiple genetic defects, including alterations in p53, pl6/INK4a and/or Rb (Emdad et al., 2006; Huang et al., 2001; Jiang et al., 1996; Lebedeva et al., 2002; Lebedeva, 2005; Mhashilkar et al., 2001; Saeki et al., 2000; Su et al., 2001; Su et al., 1998). Moreover, Ad.mda-7 is equally effective in inducing apoptosis in breast and lung carcinoma and melanoma cells containing wtp53, mutp53 or which are null for p53 expression (Lebedeva et al., 2002; Madireddi et al., 2000; Saeki et al., 2000; Saeki et al., 2002; Su et al, 1998).

It has also been reported that a shorter version of MDA-7, referred to as M4, containing amino acid residues 104-206 of the wild type sequence, displays similar cancer-specific apoptosis inducing properties as the complete molecule (Gupta et al., 2006b; U.S. Patent Application Publication No. 20060292157).

2.2 Glucose-Regulated Protein- 170 In recent years, some stress proteins have gained widespread attention due to their potential roles in cancer immunotherapy. The antitutmor response has largely been attributed to the ability of some stress proteins to form complexes with tumor-derived antigens and thereby facilitate antigen cross-presentation and priming of T-effector cells. Different stress proteins exhibit different cellular functions and abilities to chaperone or bind antigens. Stress proteins are molecular chaperones, and during stress (e.g., heat shock), act to inhibit the aggregation of other damaged proteins and, in concert with other chaperones, can often refold and reactivate damaged proteins. Molecular chaperones also participate in numerous normal cellular processes such as protein folding, transport, and peptide processing and trafficking (Lindquist et al., 1988;

Clarke 1996). The cellular functions of chaperones are essential to all living organisms from prokaryotes to man (Parsell et al, 1993; Jolly et al., 2000). There are two major groups of stress proteins: (1) the heat shock protiens "hsps", which are induced by heat, ethanol, oxidative stress (such as occurs during reperfusion injury), among numerous other environments and conditions; and (2) the glucose regulatred proteins "grps", which are induced by conditions including glucose deprivation, chronic hypoxia and reductive stress, inhibition of glycosylation, and interference with calcium homeostasis (Chen et al., 1996; Craven et al., 1997; Easton et al., 2000). Grps reside in the endoplasmic reticulum (ER) while the hsps reside in the cytosol, nucleus, and mitochondria, reflecting the differential stress sensitivities of different cellular compartments (Park et al., 2003).

GRP- 170 proteins are found in all organisms examined from yeast to man and upon sequence analysis group into a single family (Chen et al., 1996; Craven et al., 1997; Easton et al., 2000). This family is related to, but divergent from, the hsp70 family which itself is a distinct sequence group or family. GRP- 170 is a major stress protein/molecular chaperone resident in the endoplasmic reticulum (Lin et al., 1993; Chen et al., 1996; Craven et al., 1997; Easton et al., 2000) that is induced by stress conditions such as hypoxia, ischemia, glucose deprivation, reductive reagents, anoxia, and interference in calcium homeostasis (Cai et al., 1993). GRP-170 is also known as ORP 150 (oxygen-regulated identified in both human and rat) and as CBP- 140 (calcium binding protein identified in mouse). GRP-170 has been shown to stabilize denatured protein more efficiently than hsp70. Studies have shown that GRP-170 is associated with the folding/processing of secretory proteins such as thyroglobulin and immunoglobulin chains (Lin et al., 1993; Kuznetsov et al., 1997), suggesting that it may be involved in protein/peptide import into the ER (Dierks et al., 1996; Spee et al., 1999; Craven et al., 1996; Tyson et al., 2000).

When purified from tumors, GRP-170 has been identified as a stress protein that can elicit antitumor immune responses. Immunization with tumor- derived GRP-170 can elicit tumor-specific CD8 ⁺ T cell responses and also significantly reduce pulmonary metastatic disease (Wang et al., 2001; Wang et al., 2003). Certain stress proteins have been reported to function as "danger signals" alerting the immune system by induction of innate immune responses, that is, secretion of pro-inflammatory cytokines as well as upregulation of certain surface molecules on APC (Binder et al., 2000; Zheng et al., 2001; Vabulas et al., 2002;

Bethke et al, 2002; Zeng et al, 2003; Manjili et al, 2005). Generation of such danger signals would in turn result in the induction of adaptive immune responses against the antigens associated with stress proteins. Several studies have supported that activation of lymphocytes and induction of immune responses could occur as soon as the immune system senses a danger signal (McLellan et al., 2000; Gallucci et al., 2001; Campisi et al., 2003). Stress proteins were also reported to enhance immunogenicity of apoptotic tumour cells leading to antitumour immune responses (Feng et al., 2001; Feng et al., 2002; Feng et al., 2003). GRP- 170 has been reported to induce danger signals that stimulate phenotypic and functional maturation of DCs, as indicated by up-regulation of MHC class II and co-stimulatory molecules, secrection of proinflammatory cytokines and chemokines (Manjili et al., 2006). More recently, it has been reported that extracellular targeting of GRP- 170 by molecular engineering strongly enhnaced the immunogenicity of a poorly immunogenic tumor in vivo (Wang et al., 2006a). The human and rat GRP- 170 (which is also known as ORP 150) proteins and DNAs encoding therefore have been disclosed in US 5,948,637 and US 6,034,232.

3. SUMMARY OF THE INVENTION

The present invention relates to methods of treating a cancer comprising administering, to a subject in need of such treatment, an effective amount of a combination of a GRP- 170 molecule and a MDA-7 molecule. The combined use of these agents allows effective therapy of cancers that may be relatively resistant to either agent alone.

In certain non-limiting embodiments, the MDA-7 molecule is a nucleic acid, for example, but not limited to, a nucleic acid encoding wild-type MDA-7 protein (SEQ ID NO: 2) or a functional equivalent thereof, such as the wild-type protein absent its signal sequence or a truncated molecule, such as M4 (amino acids 104 to 206 of SEQ ID NO: 2).

In other non-limiting embodiments, the MDA-7 molecule is a protein, for example, but not limited to, a wild-type MDA-7 protein (SEQ ID NO: 2) or a functional equivalent thereof, such as the wild-type protein absent its signal sequence or a truncated molecule, such as M4 (amino acids 104 to 206 of SEQ ID NO: X).

In certain non- limiting embodiments, the GRP- 170 molecule is a nucleic acid, for example, but not limited to, a nucleic acid encoding wild-type GRP- 170 protein (SEQ ID NO: 4) or a functional equivalent thereof.

In other non-limiting embodiments, the GRP- 170 molecule is a protein, for example, but not limited to, a wild-type GRP- 170 protein (SEQ ID NO: 4) or a functional equivalent thereof.

In specific, non- limiting embodiments of the invention, combined therapy using an MDA-7 molecule and a GRP- 170 molecule may be used to treat a cancer in a subject.

4. BRIEF DESCRIPTION OF THE FIGURES

Figure IA- 1C. Adenovirus-mediated expression of secretable grp 170 in TRAMP-C2 tumor cell. Figure IA. Schematic representation of adenovirus vector encoding a secretable form of grp 170 (Ad.sgrpl70). The COOH-terminal KNDEL signal was deleted from mouse grp 170 cDNA to produce the secreted form of grp 170. The His-tagged sgrpl70 gene under the control of a constitutively active cytomegalovirus promoter/enhancer (CMV) was inserted into the replication incompetent adenoviral vector, in which the E1/E3 sequences have been deleted. Inverted terminal repeats (ITR), which flank the E1/E3 deleted genome, are necessary for the replication of adenoviral DNA. The TRAMP-C2 cells were infected with or without Ad.5grpl70 at different MOIs. Supernatants were collected from the infected cells at different time points and analyzed for the expression of sgrpl70 using antibodies against grp 170 (Figure IB) or His-tag (Figure 1C). Figure 2A-2D. Adenovirus-mediated mda-1 inhibits TRAMP-C2 tumor cell growth by inducing apoptosis. Figure IA. Ad.mda-7 infection suppresses proliferation of C2 tumor cell in vitro. C2 cells were infected with Ad.sgrpl70, Ad.mda-7 at different MOIs or left untreated. Protein lysates (50 μg) were run on 12% SDS-PAGE and stained with anti-mda-7/IL-24 monoclonal antibody (1 :2,000) (top). C2 cells were infected with Ad.GFP, Ad.mda-7 at a MOI of 300 or left untreated. Cell proliferation was analyzed using MTT assay (bottom). Figure IB. Ad.mda-7 infection induces C2 tumor cell apoptosis. TRAMP-C2 tumor cells were infected with Ad.GFP, Ad.mda-7 or left untreated. Cells were collected at 72 h after treatment and stained with FITC-labeled Annexin-V. The percentage of Annexin-V positive cells

was analyzed by flow cytometry (*/?<0.01, Ad.mda- 7 versus Ad.GFP or untreated control). Figure 1C. Ad.mda-7 infection promotes PARP cleavage in C2 tumor cells. C2 cells were infected with or without Ad.GFP or Ad.mda-7. Cells were examined at different time points for cleavage of PARP by immunob lotting, β-actin was used as the internal loading control. Figure ID. Ad.mda-7 induces apoptosis in tumor cell but not in normal cells. TRAMP-C2 prostate tumor cells or DC 1.2 dendritic cells were infected with Ad.mda-7. Cells were stained with FITC-labeled Annexin-V 48 h later and examined using FACS (dot line - control; solid line - Ad.mda-7 treated cells). Figure 3A-3D. Intratumoral administration of adenovirus encoding mda-7/ϊL-24 and secretable grpl70 induces a systemic antitumor response. Figure 3 A. Treatment scheme for the combined therapies targeting both tumor and immune compartments. Figure 3B. Ad.sgrpl70 promotes eradication of local C2 tumors by Ad.mda-7 in immunocompetent mice. Male C57BL/6 mice are injected s.c. with TRAMP-C2 tumor cells (n=10, 2 x 106 cells per mouse). Six days later, mice (n=10) received replication-defective Ad.mda-7, Ad.sgrp 170 or Ad.mda-7 plus Ad.sgrp 170 i.t. every two days for a total of 4 doses (5 x 108 pfu per injection). Mice receiving Ad.GFP served as controls. Data are representative of three experiments (*/?< 0.02, Ad.mda-7 or Ad.sgrpl70 versus Ad.GFP on day 42; **/?< 0.01, Ad.mda-7 plus Ad.5grpl70 versus Ad.mda-7 or Ad.sgrpl70). Figure 3C. Inhibition of established distant tumors by the combined in situ tumor therapies. C2 tumor cells (1.5 x 106 cells) were inoculated s.c. into the right and left flanks of mice at the same time. Only tumors in the left flank were treated as described above. Growth of the tumors in the contralateral side was followed (*/?> 0.05, Ad.mda-7 or Ad.sgrpl70 versus PBS; ** p< 0.01, Ad.mda-7 plus Ad.sgrpl70 versus Ad.mda-7 or Ad.sgrpl70). Figure 3D. The combined therapies prior to surgery prevent the growth of secondary tumor. C2 tumor cells were inoculated s.c. into the right flank of mice. When tumor volume reached the size of 5 mm in diameters, mice were treated with Ad.GFP, Ad.mda-7, Ad.5grpl70 or Ad.mda-7 plus Ad.sgrpl70. Tumors were removed by surgery one week after the last treatment. Mice were rechallenged with C2 tumor cells in the left flank 1O d after surgical removal of the treated primary tumor (* p> 0.05, Ad.mda-7 or Ad.5grpl70 versus control; **/?< 0.01, Ad.mda-7 plus Ad.sgrpl70 versus Ad.mda- 7 or Ad.5grpl70). The results shown are from a representative two experiments.

Figure 4A-4D. Intratumoral delivery of Ad.mda-7 and Ad.sgrpl70 promotes antigen-specific immune response. Figure 4A. Establishment of TRAM-C2 tumor cell line stably expressing OVA (C2-OVA). TRAMP-C2 cells were transduced with pcDNA-OVA using FuGENE transfection reagent and selected in G418 (1 mg/ml)-containing medium. Expression of OVA was analyzed using RTPCR assays. Primers of GAPDH were used as an internal control. Figure 4B. Increased antigen- specific CTL frequency in mice following the combined therapies. Splenocytes were isolated from mice one week or three weeks after the last treatment. Cells were stimulated with OVA257-264 (top) or mitomycin C-treated C2 cells at a ratio of 20:1 (bottom). IFN-γ production was measured using an ELISPOT assay (* p< 0.01 , Ad.mda-7 or Ad.sgrpl70 versus control; **/?< 0.02, Aά.mda-1 plus Ad.sgrpl70 versus Ad.mda-7 or Ad.sgrpl70). Data (mean ± s.d.) are representative of two separate experiments in which 3 mice of each group were analyzed. Figure 4C. Co- injection of Ad.5grpl70 down-regulates Ad.mda-7 treatment induced IL-4 production in antigen-specific Tcells. Splenocytes were isolated from mice following treatment and subjected to ELISPOT assay for measuring OVA- stimulated IL-4 production (* p< 0.01, Ad.mda-7 versus Ad.sgrpl70 or Ad.mda7 plus Ad.sgrpl70). Figure 4D. Enhanced cytolytic activity of effector T-cells in mice treated with the combined therapies. Mice with established C2 tumors were treated with Ad.mda-7, Ad.sgrpl70 or Ad.mda-7 plus Ad.sgrpl70 or left untreated. Splenocytes from the treated mice were harvested one week or three weeks after the last injection. Cells were re- stimulated with OVA257-264 (SIINFEKL) in vitro for 5 d in the presence ofIL-2 (lOU/ml). The CD8+ T-cells at different E: T ratios in triplicate were analyzed for cytotoxic activity using 51Cr-labeled C2-OVA as targets. Data are representative of three experiments.

Figure 5A & 5B. CD8 ⁺ T-cells contribute to the antitumor activities mediated by the combined therapies in vivo. Figure 5 A. Depletion of CD8+ T-cell subset abolishes antitumor immunity. Male C57BL/6 mice (n=6) with established C2-OVA tumors were depleted of CD4+, CD8+ T-cells by i.p. injection of GKl.5, 2.43 mAb respectively. Isotype-matched antibodies were used as controls. (CD8 depletion versus IgG control, p< 0.01). Figure 5B. The combined in situ therapies results in a tumor-specific immune response. Mice established with C2-OVA tumors were treated with Ad.mda-7 in combination with Ad.sgrpl70 as described. C2-OVA

tumor free mice following the combined therapies were rechallenged with parental TRAMP-C2 tumor (3x10 ⁶ cells) in contralateral side.

Figure 6A-6D. Antitumor immunity remains intact following separate administration of Ad.mda-7 and Ad.sgrpl70. Figure 6A. Treatment scheme for the modified combinational therapies. Figure 6B. Injection of Ad.mda-7 and Ad.sgrpl70 either together or separately generates a comparable antitumor response. Mice with established C2 tumors were treated with Ad.mda-7, Ad.sgrpl70 together with Ad.mda-7 (T). One group of mice was treated with Ad.mda-7 and Ad.sgrpl70 separately on different days (S). Figure 6C. Both therapeutic regimens elicit similar levels of antigen-specific Tcells. Splenocytes isolated from mice one week after the last treatment and stimulated with OVA257-264. IFN-γ production was measured using an ELISPOT assay (* and **/?< 0.01, versus control). Figure 6D. T-effector cells from mice treated with Ad.mda-7 and Ad.sgrpl70 together displayed an increased cytolytic activity compared with cells from mice treated with the two therapeutic agents separately. Splenocytes from the treated mice were re-stimulated with OVA257-264 in vitro and assayed for the cytolytic activity using chromium release assays. OVA257-264-pulsed C2 cells were used as targets. */?< 0.01, Ad.mJα-7+Ad.5grpl70(T) versus Ad.mdα-7+Ad.sgrpl70(S).

5. DETAILED DESCRIPTION OF THE INVENTION

For clarity of description, and not by way of limitation, the detailed description of the invention is divided into the following subsections: (i) MDA-7 molecules; (ii) GRP- 170 molecules; and (iii) Methods of treatment.

5 1 MDA-7 MOLECULES

A MDA-7 molecule is, as defined herein, either a nucleic acid encoding a MDA-7 protein or a MDA-7 protein. 5.1.1 MDA-7 PROTEIN

A MDA-7 protein is a protein (which may or may not be glycosylated or otherwise chemically modified) which is structurally and functionally substantially related to wild-type human MDA-7 protein having SEQ ID NO: 2, which induces

apopotosis of FO-I and MeWo melanoma cells (Sarkar et al., 2002b). M4 has been shown to have apoptosis-promoting activity in DU- 145 prostate cancer cells (Gupta et al., 2006b).

One non- limiting example of a MDA-7 protein for use according to the invention is the wild-type human MDA-7 protein having the amino acid sequence set forth as SEQ ID NO: 2, Genbank Accession Number U16261.

Another non-limiting example of a MDA-7 protein for use according to the invention is a protein, the amino acid sequence of which is at least 90 percent or at least 95 percent homologous to the wild type human MDA-7 protein having SEQ ID NO: 2, and which exhibits apopotosis-inducing activity against FO-I and/or

MeWo and/or DU- 145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells). Homology may be determined by standard homology-determining programs, such as BLAST or FASTA.

Another non-limiting example of a MDA-7 protein for use according to the invention is M4, which has an amino acid sequence consisting essentially of amino acid residues 104 to 206 of SEQ ID NO: 2. "104 to 206" means the sequence set forth in SEQ ID NO: 2 from amino acid 104 through amino acid 206, inclusive.

Another non-limiting example of a MDA-7 protein for use according to the invention is a protein, the amino acid sequence of which is at least 90 percent or at least 95 percent homologous to M4 (the amino acid sequence of which is residues 104 to 206 of SEQ ID NO: 2), and which induces apopotosis of FO-I and/or MeWo and/or DU-145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Another non-limiting example of a MDA-7 protein for use according to the invention is a protein comprising amino acids 49 to 206 of SEQ ID NO: 2 but lacking, either because they are absent or through substitution, amino acids 1-48 of SEQ ID NO: 2, which is the secretory peptide.

Another non-limiting example of a MDA-7 protein for use according to the invention is a protein, the sequence of which is at least 90 percent or at least 95 percent homologous to amino acids 49 to 206 of SEQ ID NO: 2 but lacking, either because they are absent or through substitution, amino acids 1 to 48 of SEQ ID NO: 2, which is the secretory peptide, where said protein induces apopotosis of FO-I and/or MeWo and/or DU-145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Other non- limiting examples of MDA- 7 proteins which may be used according to the invention are set forth in United States Patent Application Publication No. 20060292157 by Fisher and Gupta, filed December 2, 2005, SN 11/292571. A MDA-7 protein of the invention may comprise or be linked to a molecule that facilitates its biological activity. As a first example, such molecule may be a secretory signal peptide; where a nucleic acid encoding a MDA-7 protein is introduced into a cell, said secretory peptide would facilitate the secretion of the MDA-7 protein so as to produce a "bystander" effect (Su et al., 2001). The secretory peptide may be the secretory peptide of wild-type MDA-7 (i.e., residues 1-48), or another naturally occurring or synthetic secretory peptide e.g. cleavable signal peptide of human gamma-interferon (Colley et al., 1989) or the NH2 -terminal leader sequence of mouse immunoglobulin light chain precursor (Koren et al., 1983). As a second example, the molecule may facilitate cell or tissue compartmentalization; e.g., the molecule may be a KDEL peptide that would favor retention of the variant in the endoplasmic reticulum, or the molecule may facilitate passage across a cell membrane, into the nucleus or through the blood brain barrier. As a third non- limiting example, utilization of the FFAT motif, a membrane targeting determinant found in several apparently unrelated lipid binding proteins (Loewen et al., 2003) may be used to facilitate targeting to the cell membrane. As a fourth non-limiting example, the 15 -residue targeting motif of cAMP-dependent protein kinase anchoring protein (d- AKAPI) which targets proteins to either ER or mitochondria depending on interaction with each organelle (Ma and Taylor, 2002) may be used for targeting to both these organelles simultaneously. A MDA-7 protein of the invention, in an alternative embodiment, may comprise a protein lacking an amino-terminal secretory signal sequence. A MDA-7 protein lacking a secretory peptide may contain an exogenously added N-terminal methionine residue or alternatively start with the glutamine or glycine residues at positions 49 or 50 respectively of the unprocessed native protein (SEQ ID NO: 2). The present invention also provides for signal peptide lacking MDA-7 protein containing any additional modification as set forth below, to improve stability or activity.

A MDA-7 protein of the invention may comprise elements or be linked to elements that improve its stability or activity. These modifications include but are

not limited to N-terminal acetylation or C-terminal amidation, incorporation of D- amino acids or unnatural amino acids including but not limited to β-alanine, ornithine, hydroxyproline; or substitution at the peptide termini with biotin or long chain alkanes; addition of certain side chain modifications including but not limited to phosphorylation of serine, threonine or tyrosine residues; cyclisation via intramolecular disulphide bond formation; and formation of cyclic amides or radioconjugates. Stabilization of the peptide or protein may be further achieved by, as non- limiting examples, utilization of matrices that enhance delivery, increase stability or achieve controlled release rate such as natural and synthetic biopolymers and cell responsive matrices (Zisch et al., 2003), or alginate microcapsules (Schneider et al., 2003).

The MDA-7 protein of the invention may be produced by any method known in the art. Such methods include but are not limited to chemical synthesis and recombinant DNA techniques. With regard to production of MDA-7 variants using recombinant DNA techniques, the present invention provides for nucleic acids encoding said variants. Such nucleic acids may either be nucleic acid fragments of the aforelisted mda-1 nucleic acids encoding the variants, or may be nucleic acids designed, using the genetic code, to encode such variants.

Further, an MDA-7 protein of the invention may be comprised in a fusion protein, for example, a GST-fusion, as set forth in the examples sections below.

5.1.2 MDA-7 NUCLEIC ACIDS

A MDA-7 molecule for use according to the invention may be a nucleic acid encoding a MDA-7 protein, as described above.

One non- limiting example of such a MDA-7 molecule is a nucleic acid as set forth in SEQ ID NO: 1 (GenBank Accession No. U16261; Jiang et al., 1995, Oncogene 11 :2477-2486).

Another non-limiting example of such a MDA-7 molecule is a nucleic acid, the sequence of which is at least 90 percent or at least 95 percent homologous to SEQ ID NO: 1 (where homology may be determined using standard programs such as BLAST or FASTA, and see Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University

Avenue, Madison, Wis. 53705), and which encodes a protein that induces apopotosis in FO-I and/or MeWo and/or DU- 145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Another non-limiting example of such a MDA-7 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of SEQ ID NO: 1 under stringent conditions (as set forth in "Current Protocols in Molecular Biology," Volume 1, Ausubel et al., eds. John Wiley:New York NY pp. 2.10.1-2.10.16, first published in 1989 but with annual updating, wherein maximum hybridization specificity for DNA samples immobilized on nitrocellulose filters may be achieved through the use of repeated washings in a solution comprising 0.1-2 x SSC (15-30 mM NaCl, 1.5-3 mM sodium citrate, pH 7.0) and 0.1% SDS (sodium dodecylsulfate) at temperatures of 65-68 ⁰ C or greater. For DNA samples immobilized on nylon filters, a stringent hybridization washing solution may be comprised on 40 mM NaPO4, pH 7.2, 1-2% SDS and 1 mM EDTA), and which encodes a protein that induces apopotosis of FO-I and/or MeWo and/or DU- 145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Another non-limiting example of such a MDA-7 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 1 from nucleotide 275 to nucleotide 895, which is the coding region. Another non-limiting example of such a MDA-7 molecule is a nucleic acid consisting essentially of a sequence which is at least 90 percent or at least 95 percent homologous to nucleotides 275 to 895 of SEQ ID NO: 1 and which encodes a protein that induces apopotosis of FO-I and/or MeWo and/or DU- 145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells). Another non-limiting example of such a MDA-7 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 275 to 895 of SEQ ID NO: 1 under stringent conditions (above) and which encodes a protein that induces apopotosis of FO-I and/or MeWo and/or DU- 145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells). Another non-limiting example of such a MDA-7 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 1 from nucleotide 419 to nucleotide 895, which is the portion encoding human wild-type MDA-7 lacking the secretory sequence.

Another non-limiting example of such a MDA-7 molecule is a nucleic acid which is at least 90 percent or at least 95 percent homologous to nucleotides 419 to 895 of SEQ ID NO: 1 and which encodes a protein that induces apopotosis of FO-I and/or MeWo and/or DU-145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Another non-limiting example of such a MDA-7 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 419 to 895 of SEQ ID NO: 1, and which encodes a protein that induces apopotosis of FO-I and/or MeWo and/or DU-145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Another non-limiting example of such a MDA-7 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 1 from nucleotide 584 to nucleotide 895.

Another non-limiting example of such a MDA-7 molecule is a nucleic acid which is at least 90 percent or at least 95 percent homologous to nucleotides 584 to 895 of SEQ ID NO: 1, and which encodes a protein that induces apopotosis of FO- 1 and/or MeWo and/or DU-145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

Another non-limiting example of such a MDA-7 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 584 to 895 of SEQ ID NO: 1, and which encodes a protein that induces apopotosis of FO-I and/or MeWo and/or DU-145 cancer cells (e.g. in at least 10 percent of cells or in at least 20 percent of cells).

5.1.3 EXPRESSION VECTORS CARRYING MDA-7

In preferred embodiments, an MDA-7 molecule which is a nucleic acid may be comprised within a larger molecule. For example, to render the MDA-7 protein-encoding nucleic acid expressible, it may be linked to one of more elements that promote expression. For example, the MDA-7 nucleic acid may be operably linked to a suitable promoter element, such as, but not limited to, the cytomegalovirus immediate early (CMV) promoter, the Rous sarcoma virus (RSV) long terminal repeat promoter, the human elongation factor lα promoter, the human ubiquitin c promoter, etc. It may be desirable, in certain embodiments of the invention, to use an inducible promoter. Non- limiting examples of inducible promoters include the murine

mammary tumor virus promoter (inducible with dexamethasone), commercially- available tetracycline-responsive or ecdysone -responsive promoters, etc. It may also be desirable to utilize a promoter which is selectively active in the cancer cell to be treated, for example the PEG-3 gene promoter (U.S. No. 6,472,520). Examples of tissue- and cancer cell-specific promoters are well known to those of ordinary skill in the art.

Other elements that may be incorporated into a molecule comprising a MDA-7-encoding nucleic acid include transcription start sites, stop sites, polyadenylation sites, ribosomal binding sites, etc. Further, a MDA-7 nucleic acid may be linked to a nucleic acid encoding a non-MDA-7 protein or peptide, to encode a fusion protein.

The MDA-7 molecule which is a nucleic acid, for example together with one or more of the elements listed above, may be comprised in a vector, which may be a virus, a phage, a plasmid, a cosmid, etc. Suitable expression vectors include virus-based vectors and non- virus based DNA or RNA delivery systems. Examples of appropriate virus-based vectors include, but are not limited to, those derived from retroviruses, for example Moloney murine leukemia-virus based vectors such as LX, LNSX, LNCX or LXSN (Miller and Rosman, 1989, Biotechniques 7:980-989); lentiviruses, for example human immunodeficiency virus ("HIV"), feline leukemia virus ("FIV") or equine infectious anemia virus ("EIAV")-based vectors (Case et al, 1999; Curran et al, 2000; Olsen, 1998; United States Patent Nos. 6,255,071 and 6,025,192); adenoviruses (Zhang, 1999; Connelly, 1999; Stratford-Perricaudet, 1990; Rosenfeld, 1991; Wang et al, 1991; Jaffe et al, 1992; Quantin et al, 1992; Rosenfeld et al, 1992; Mastrangeli et al, 1993; Ragot et al, 1993; Hayaski et al, 1994; Bett et al, 1994), for example Ad5/CMV-based El -deleted vectors (Li et al, 1993); adeno-associated viruses, for example pSub201 -based AAV2-derived vectors (Walsh et al, 1992); herpes simplex viruses, for example vectors based on HSV-I (Geller and Freese, 1990); baculoviruses, for example AcMNP V-based vectors (Boyce and Bucher, 1996); SV40, for example SVluc (Strayer and Milano, 1996); Epstein-Barr viruses, for example EB V-based replicon vectors (Hambor et al, 1988); alphaviruses, for example Semliki Forest virus- or Sindbis virus-based vectors (Polo et al, 1999); vaccinia viruses, for example modified vaccinia virus (MVA)-based vectors (Sutter and Moss, 1992) or any other class of viruses that can efficiently transduce human

tumor cells and that can accommodate the nucleic acid sequences required for therapeutic efficacy.

Non- limiting examples of non- virus-based delivery systems which may be used according to the invention include, but are not limited to, so-called naked nucleic acids (Wolff et al., 1990), nucleic acids encapsulated in liposomes (Nicolau et al., 1987), nucleic acid/lipid complexes (Legendre and Szoka, 1992), and nucleic acid/protein complexes (Wu and Wu, 1991).

In specific, non- limiting embodiments of the invention, the expression vector is an El -deleted human adenovirus vector of serotype 5, although those of ordinary skill in the art would recognize that many of the different naturally-occurring human Ad serotypes or Ad vectors derived from non-human adenoviruses may substitute for human Ad 5-derived vectors. In a preferred, specific, non-limiting embodiment, a recombinant replication-defective Ad.mda-7 virus for use as an mda-1 vector may be created in two steps as described in Su et al., 1998, Proc. Natl. Acad. Sci. U.S.A. 95:14400-14405. Specifically, the coding region of the mda-1 gene may be cloned into a modified Ad expression vector pAd.CMV (Falck-Pedersen et al., 1994). This vector contains, in order, the first 355 bp from the left end of the Ad genome, the CMV promoter, DNA encoding splice donor and acceptor sites, the coding region of the mda-1 cDNA, DNA encoding a polyA signal sequence from the β globin gene, and ~3 kbp of adenovirus sequence extending from within the ElB coding region. This arrangement allows high-level expression of the cloned sequence by the CMV promoter, and appropriate RNA processing. The recombinant virus may be created in vitro in 293 cells (Graham et al., 1977) by homologous recombination between an m<iα-7-containing version of pAd.CMV and plasmid pJM17, which contains the whole of the Ad genome cloned into a modified version of pBR322 (McGrory et al, 1988). pJM17 gives rise to Ad genomes in vivo, but they are too large to be packaged in mature Ad capsids. This constraint is relieved by recombination with the vector to create a packageable genome (Id.) containing the mda-1 gene. The recombinant virus is replication defective in human cells except 293 cells, which express adenovirus ElA and ElB. Following transfection of the two plasmids, infectious virus may be recovered, and the genomes may be analyzed to confirm the recombinant structure, and then virus may be plaque purified by standard procedures (Volkert and Young, 1983).

In a specific, non-limiting embodiment of the invention, the infectivity of an adenovirus vector carrying a MDA-7 molecule may be improved by inserting an Arg-Gly-Asp motif into the fiber know (Ad5-Delta24RGD), as described in Lamfers et al, 2002, Cancer Res. 62:5736-5742.

5.2 GRP-170 MOLECULES

A GRP-170 molecule is, as defined herein, either a nucleic acid encoding a GRP-170 protein or a GRP-170 protein. 5.2.1 GRP-170 PROTEIN

A GRP-170 protein is a protein (which may or may not be glycosylated or otherwise chemically modified) which is structurally and functionally substantially related to wild-type GRP-170 protein having SEQ ID NO: 4 (mouse) or SEQ ID NO: 6 (human). GRP-170 is also known as ORP 150 (oxygen-regulated protein identified in both human and rat), as CBP- 140 (calcium binding protein identified in mouse), and as Hyoul (hypoxia up-regulated 1 identified in mouse and rat).

One non- limiting example of a GRP-170 protein for use according to the invention is the wild-type mouse GRP-170 protein having the amino acid sequence set forth as SEQ ID NO: 4, Genbank Accession Number is AAF6554. Another non- limiting example of a GRP-170 protein for use according to the invention is the wild-type human GRP-170 (ORP 150) protein having the amino acid sequence set forth as SEQ ID NO: 6, Genbank Accession Number is any one of the AAC50947, ABC75106, or ABD14370. Since GRP-170 is also known as ORP150, CGP-140 and Hyoul, besides Genbank Number AAF6554, AAC50947, ABC75106, or ABD14370, exemplary members of the GRP-170 family include, without limitation, those identified in Genbank Accession Numbers are AAB35051 (mouse CBP-140), AAH50107 (mouse Hyoul), NP 067370 (mouse Hyoul), Q63617 (rat ORP150), AAH65310 (rat Hyoul), AAB05672 (rat ORP150), each of which and its corresponding nucleic acid accession is hereby incorporated by reference in its entirety.

Another non-limiting example of a GRP-170 protein for use according to the invention is a polypeptide variant of the wild-type Grp-170 protein having the amino acid sequence set forth as SEQ ID NO: 4 or SEQ ID NO: 6.

A polypeptide "variant," as used herein, is a polypeptide that differs from a wild-type mouse GRP- 170 protein in one or more substitutions, deletions, additions and/or insertions, such that the immunogenicity of the polypeptide is not substantially diminished. In other words, the ability of a variant to react with antigen- specific antisera may be enhanced or unchanged, relative to the wild-type GRP- 170 protein, or may be diminished by less than 50%, and preferably less than 20%, relative to the native GRP- 170 protein. Such variants may generally be identified by modifying one of the above polypeptide sequences and evaluating the reactivity of the modified polypeptide with antigen-specific antibodies or antisera as described herein. It is also preferable that the GRP- 170 variant possesses comparable peptide binding activity (described above). The full-length GRP- 170 is an ER-associated glycoprotein with a C-terminal ER retention sequence of KNDEL and an N-terminal (first 32 amnio acids, 1 to 32 of SEQ ID NO: 4 or SEQ ID NO: 6) signal peptide for ER translocation (Yu et al., 2002; Pelham, 1990). Preferred variants include those in which one or more portions, such as an N-terminal (first 32 amino acids, 1 to 32 of SEQ ID NO: 4 or SEQ ID NO: 6) signal peptide or a C-terminal ER retention sequence, has been removed. Other preferred variants include variants in which a small portion (e.g., 1-30 amino acids, preferably 5-15 amino acids) has been removed from the N- and/or C-terminal of the mature protein. Polypeptide variants preferably exhibit at least about 70%, more preferably at least about 90% and most preferably at least about 95% identity to the identified polypeptides. Two polynucleotide or polypeptide sequences are said to be "identical" if the sequence of nucleotides or amino acids in the two sequences is the same when aligned for maximum correspondence as described below. Comparisons between two sequences are typically performed by comparing the sequences over a comparison window to identify and compare local regions of sequence similarity. A "comparison window" as used herein, refers to a segment of at least about 20 contiguous positions, usually about 30 to about 75, or about 40 to about 50, in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.

Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein, the amino acid sequence of which is at least 90 percent or at least 95 percent homologous to the wild type GRP- 170 protein having SEQ ID NO: 4 or SEQ ID NO: 6, and which facilitates the antigen-cross presentation and priming

of T-effector cells, and elicits anti-tumor immune responses. Homology may be determined by standard homology-determining programs, such as BLAST or FASTA. Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein comprising amino acids 33 to 999 of SEQ ID NO: 4 but lacking, either because they are absent or through substitution, amino acids 1-32 of SEQ ID NO: 4, which is the N-terminal signal peptide for ER-translocation.

Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein, the sequence of which is at least 90 percent or at least 95 percent homologous to amino acids 33 to 999 of SEQ ID NO: 4 but lacking, either because they are absent or through substitution, amino acids 1 to 32 of SEQ ID NO: 4, which is the N-terminal signal peptide for ER-translocation.

Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein comprising amino acids 33 to 999 of SEQ ID NO: 6 but lacking, either because they are absent or through substitution, amino acids 1-32 of SEQ ID NO: 6, which is the N-terminal signal peptide for ER-translocation.

Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein, the sequence of which is at least 90 percent or at least 95 percent homologous to amino acids 33 to 999 of SEQ ID NO: 6 but lacking, either because they are absent or through substitution, amino acids 1 to 32 of SEQ ID NO: 6, which is the N-terminal signal peptide for ER-translocation.

Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein comprising amino acids 1 to 994 of SEQ ID NO: 4 but lacking, either because they are absent or through substitution, amino acids 995-999 of SEQ ID NO: 4, which is the C-terminal ER retention sequence. Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein, the sequence of which is at least 90 percent or at least 95 percent homologous to amino acids 1 to 994 of SEQ ID NO: 4 but lacking, either because they are absent or through substitution, amino acids 995 to 999 of SEQ ID NO: 4, which is the the C-terminal ER retention sequence. Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein comprising amino acids 1 to 994 of SEQ ID NO: 6 but lacking, either because they are absent or through substitution, amino acids 995-999 of SEQ ID NO: 6, which is the C-terminal ER retention sequence.

Another non-limiting example of a GRP- 170 protein for use according to the invention is a protein, the sequence of which is at least 90 percent or at least 95 percent homologous to amino acids 1 to 994 of SEQ ID NO: 6 but lacking, either because they are absent or through substitution, amino acids 995 to 999 of SEQ ID NO: 6, which is the the C-terminal ER retention sequence.

Other non- limiting examples of GRP- 170 (or ORP 150) proteins which may be used according to the invention are set forth in United States Patent No. 5,948,637 by Ikeda et al, issued September 7, 1999, and United States Patent Application Publication No. 2007/0243209 by Segal et al., filed October 28, 2006, SN 11/554,022.

A GRP- 170 protein of the invention may comprise or be linked to a molecule that facilitates its biological activity. As a first example, such molecule may be a secretory signal peptide; where a nucleic acid encoding a GRP- 170 protein is introduced into a cell, said secretory peptide would facilitate the secretion of the GRP- 170 protein so as to produce a "bystander" effect (Su et al., 2001). The secretory peptide may be the secretory peptide of wild-type GRP-170 (e.g.., residues 1-32 of SEQ ID NO: 4 or SEQ ID NO: 6), or another naturally occurring or synthetic secretory peptide e.g. cleavable signal peptide of human gamma-interferon (Colley et al., 1989) or the NH ₂ -terminal leader sequence of mouse immunoglobulin light chain precursor (Koren et al., 1983). As a second example, the molecule may facilitate cell or tissue compartmentalization; e.g., the molecule may be a KDEL or KNDEL peptide that would favor retention of the variant in the endoplasmic reticulum, or the molecule may facilitate passage across a cell membrane, into the nucleus or through the blood brain barrier. As a third non-limiting example, utilization of the FFAT motif, a membrane targeting determinant found in several apparently unrelated lipid binding proteins (Loewen et al., 2003) may be used to facilitate targeting to the cell membrane. As a fourth non-limiting example, the 15-residue targeting motif of cAMP-dependent protein kinase anchoring protein (d- AKAPI) which targets proteins to either ER or mitochondria depending on interaction with each organelle (Ma and Taylor, 2002) may be used for targeting to both these organelles simultaneously.

A GRP-170 protein of the invention, in an alternative embodiment, may comprise a protein lacking an amino -terminal secretory signal sequence. A GRP-170 protein lacking a secretory peptide may contain an exogenously added N- terminal methionine residue or alternatively start with the leucine or alanine residues

at positions 33 or 34 respectively of the unprocessed native protein (SEQ ID NO: 4). The present invention also provides for signal peptide lacking GRP- 170 protein containing any additional modification as set forth below, to improve stability or activity. A GRP- 170 protein of the invention may comprise elements or be linked to elements that improve its stability or activity. These modifications include but are not limited to N-terminal acetylation or C-terminal amidation, incorporation of D-amino acids or unnatural amino acids including but not limited to β-alanine, ornithine, hydroxyproline; or substitution at the peptide termini with biotin or long chain alkanes; addition of certain side chain modifications including but not limited to phosphorylation of serine, threonine or tyrosine residues; cyclisation via intramolecular disulphide bond formation; and formation of cyclic amides or radioconjugates. Stabilization of the peptide or protein may be further achieved by, as non- limiting examples, utilization of matrices that enhance delivery, increase stability or achieve controlled release rate such as natural and synthetic biopolymers and cell responsive matrices (Zisch et al., 2003), or alginate microcapsules (Schneider et al., 2003).

The GRP- 170 protein of the invention may be produced by any method known in the art. Such methods include but are not limited to chemical synthesis and recombinant DNA techniques. With regard to production of GRP- 170 variants using recombinant DNA techniques, the present invention provides for nucleic acids encoding said variants. Such nucleic acids may either be nucleic acid fragments of the aforelisted grp-170 nucleic acids encoding the variants, or may be nucleic acids designed, using the genetic code, to encode such variants. Further, a GRP-170 protein of the invention may be comprised in a fusion protein, for example, a His-tagged fusion, as set forth in the example sections below, or as a GST fusion protein.

5.2.2 GRP-170 NUCLEIC ACIDS A GRP-170 molecule for use according to the invention may be a nucleic acid encoding a GRP-170 protein, as described above.

One non- limiting example of such a GRP- 170 molecule is a nucleic acid as set forth in SEQ ID NO: 3 (GenBank Accession No. AF228709) encoding a wild-type mouse GRP- 170 protein.

Another non-limiting example of such a GRP- 170 nolecule is a nucleic acid as set forth in SEQ ID NO: 5 (GenBank Accession No. AB009979) encoding a wild-type human GRP- 170 (ORP 150) protein.

Another non-limiting example of such a GRP- 170 molecule is a nucleic acid, the sequence of which is at least 90 percent or at least 95 percent homologous to SEQ ID NO: 3 or SEQ ID NO: 5 (where homology may be determined using standard programs such as BLAST or FASTA, and see Sequence

Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, Wis. 53705).

Another non-limiting example of such a GRP- 170 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of SEQ ID NO: 3 or SEQ ID NO: 5 under stringent conditions (as set forth in "Current Protocols in Molecular Biology," Volume 1, Ausubel et al., eds. John Wiley :New York NY pp. 2.10.1-2.10.16, first published in 1989 but with annual updating, wherein maximum hybridization specificity for DNA samples immobilized on nitrocellulose filters may be achieved through the use of repeated washings in a solution comprising 0.1-2 x SSC (15-30 mM NaCl, 1.5-3 mM sodium citrate, pH 7.0) and 0.1% SDS (sodium dodecylsulfate) at temperatures of 65-68 ⁰ C or greater. For DNA samples immobilized on nylon filters, a stringent hybridization washing solution may be comprised on 40 mM NaPO4, pH 7.2, 1-2% SDS and 1 mM EDTA), and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses.

Another non-limiting example of such a GRP- 170 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 3 from nucleotide 97 to nucleotide 3000, which is the portion encoding mouse wild-type GRP-170 lacking the N-terminal signal peptide for ER-translocation. Another non-limiting example of such a GRP-170 molecule is a nucleic acid which is at least 90 percent or at least 95 percent homologous to nucleotides 97 to 3000 of SEQ ID NO: 3 and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses.

Another non-limiting example of such a GRP- 170 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 97 to 3000 of SEQ ID NO: 3, and which facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses.

Another non-limiting example of such a GRP- 170 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 5 from nucleotide 97 to nucleotide 3000, which is the portion encoding human wild-type GRP-170 (ORP 150) lacking the N-terminal signal peptide for ER-translocation. Another non-limiting example of such a GRP-170 molecule is a nucleic acid which is at least 90 percent or at least 95 percent homologous to nucleotides 97 to 3000 of SEQ ID NO: 5 and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses. Another non-limiting example of such a GRP-170 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 97 to 3000 of SEQ ID NO: 5, and which facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses. Another non-limiting example of such a GRP-170 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 3 from nucleotide 1 to nucleotide 2975, which is the portion encoding mouse wild-type GRP-170 lacking C-terminal ER retention sequence.

Another non-limiting example of such a GRP-170 molecule is a nucleic acid which is at least 90 percent or at least 95 percent homologous to nucleotides 1 to 2975 of SEQ ID NO: 3, and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses.

Another non-limiting example of such a GRP-170 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 1 to 2975 of SEQ ID NO: 3, and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses.

Another non-limiting example of such a GRP- 170 molecule is a nucleic acid consisting essentially of that portion of SEQ ID NO: 5 from nucleotide 1 to nucleotide 2975, which is the portion encoding human wild-type GRP- 170 (ORP 150) lacking C-terminal ER retention sequence. Another non-limiting example of such a GRP- 170 molecule is a nucleic acid which is at least 90 percent or at least 95 percent homologous to nucleotides 1 to 2975 of SEQ ID NO: 5, and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses. Another non-limiting example of such a GRP- 170 molecule is a nucleic acid, the entire length of which hybridizes to the entire length of the complement of nucleotides 1 to 2975 of SEQ ID NO: 5, and which encodes a protein that facilitates the antigen-cross presentation and priming of T-effector cells, and elicits anti-tumor immune responses.

5.2.3 EXPRESSION VECTORS CARRYING GRP- 170

In preferred embodiments, a GRP- 170 molecule which is a nucleic acid may be comprised within a larger molecule. For example, to render the GRP- 170 protein-encoding nucleic acid expressible, it may be linked to one of more elements that promote expression. For example, the GRP- 170 nucleic acid may be operably linked to a suitable promoter element, such as, but not limited to, the cytomegalovirus immediate early (CMV) promoter, the Rous sarcoma virus (RSV) long terminal repeat promoter, the human elongation factor lα promoter, the human ubiquitin c promoter, etc. It may be desirable, in certain embodiments of the invention, to use an inducible promoter. Non- limiting examples of inducible promoters include the murine mammary tumor virus promoter (inducible with dexamethasone), commercially- available tetracycline-responsive or ecdysone -responsive promoters, etc. It may also be desirable to utilize a promoter which is selectively active in the cancer cell to be treated, for example the PEG-3 gene promoter (U.S. No. 6,472,520). Examples of tissue- and cancer cell-specific promoters are well known to those of ordinary skill in the art.

Other elements that may be incorporated into a molecule comprising a GRP-170-encoding nucleic acid include transcription start sites, stop sites, polyadenylation sites, ribosomal binding sites, etc.

The GRP- 170 molecule which is a nucleic acid, for example together with one or more of the elements listed above, may be comprised in a vector, which may be a virus, a phage, a plasmid, a cosmid, etc.

Suitable expression vectors include virus-based vectors and non- virus based DNA or RNA delivery systems. Examples of appropriate virus-based vectors include, but are not limited to, those derived from retroviruses, for example Moloney murine leukemia-virus based vectors such as LX, LNSX, LNCX or LXSN (Miller and Rosman, 1989); lentiviruses, for example human immunodeficiency virus ("HIV"), feline leukemia virus ("FIV") or equine infectious anemia virus ("EIAV")-based vectors (Case et al, 1999,; Curran et al, 2000,; Olsen, 1998; United States Patent Nos. 6,255,071 and 6,025,192); adenoviruses (Zhang, 1999; Connelly, 1999; Stratford-Perricaudet, 1990; Rosenfeld, 1991; Wang et al, 1991; Jaffe et al, 1992; Quantin et al, 1992; Rosenfeld et al, 1992; Mastrangeli et al, 1993; Ragot et al, 1993; Hayaski et al, 1994; Bett et al, 1994), for example Ad5/CMV-based El- deleted vectors (Li et al, 1993); adeno-associated viruses, for example pSub201- based AAV2-derived vectors (Walsh et al, 1992); herpes simplex viruses, for example vectors based on HSV-I (Geller and Freese, 1990); baculoviruses, for example AcMNP V-based vectors (Boyce and Bucher, 1996); SV40, for example SVluc (Strayer and Milano, 1996); Epstein-Barr viruses, for example EBV -based replicon vectors (Hambor et al, 1988); alphaviruses, for example Semliki Forest virus- or Sindbis virus-based vectors (Polo et al, 1999); vaccinia viruses, for example modified vaccinia virus (MVA)-based vectors (Sutter and Moss, 1992) or any other class of viruses that can efficiently transduce human tumor cells and that can accommodate the nucleic acid sequences required for therapeutic efficacy. Non- limiting examples of non- virus-based delivery systems which may be used according to the invention include, but are not limited to, so-called naked nucleic acids (Wolff et al, 1990), nucleic acids encapsulated in liposomes (Nicolau et al, 1987), nucleic acid/lipid complexes (Legendre and Szoka, 1992), and nucleic acid/protein complexes (Wu and Wu, 1991). In specific, non- limiting embodiments of the invention, the expression vector is an E 1/E3 -deleted human adenovirus vector of serotype 5, although those of ordinary skill in the art would recognize that many of the different naturally-occurring human Ad serotypes or Ad vectors derived from non-human adenoviruses may substitute for human Ad 5-derived vectors. In a preferred, specific, non-limiting

embodiment, a recombinant replication-defective Ad.grp-170 virus for use as a grp- 170 vector may be created in two steps as described in Su et al, 1998, Proc. Natl. Acad. Sci. U.S.A. 95:14400-14405. Specifically, the coding region of the grp-170 gene may be cloned into a modified Ad expression vector p Ad. CMV (Falck-Pedersen et al., 1994). This vector contains, in order, the first 355 bp from the left end of the Ad genome, the CMV promoter, DNA encoding splice donor and acceptor sites, the coding region of the grp-170 cDNA, DNA encoding a polyA signal sequence from the β globin gene, and ~3 kbp of adenovirus sequence extending from within the ElB coding region. This arrangement allows high-level expression of the cloned sequence by the CMV promoter, and appropriate RNA processing. The recombinant virus may be created in vitro in 293 cells (Graham et al., 1977) by homologous recombination between an grp- 170-containing version of pAd.CMV and plasmid pJM17, which contains the whole of the Ad genome cloned into a modified version of pBR322 (McGrory et al., 1988). pJM17 gives rise to Ad genomes in vivo, but they are too large to be packaged in mature Ad capsids. This constraint is relieved by recombination with the vector to create a packageable genome (Id.) containing the grp-170 gene. The recombinant virus is replication defective in human cells except 293 cells, which express adenovirus ElA and ElB. Following trans fection of the two plasmids, infectious virus may be recovered, and the genomes may be analyzed to confirm the recombinant structure, and then virus may be plaque purified by standard procedures (Volkert and Young, 1983).

In a specific, non-limiting embodiment of the invention, the infectivity of an adenovirus vector carrying a GRP-170 molecule may be improved by inserting an Arg-Gly-Asp motif into the fiber know (Ad5-Delta24RGD), as described in Lamfers et al., 2002, Cancer Res. 62:5736-5742.

In non-limit embodiments, a single vector may contain nucleic acid encoding a MDA-7 protein and a GRP-170 protien, operably linked to the same or different promoter elements.

5.3 METHODS OF TREATMENT

The present invention provides for methods of treating cancer in a subject in need of such treatment by administration of a therapeutic formulation which combines a MDA-7 molecule with a GRP- 170 molecule. Combination therapy, as referred to herein, means a therapeutic regimen in which the patient is treated with both agents in the same regimen, but the agents (mda-7 nucleic acid or protein and grp-170 nucleic acid or protein) may be administered simultaneously or non- simulataneously (for example, the agents may be administered individually, with or without a time interval between administration). Administration may be by any route known in the art, including systemic intravenous or intra-arterial, intra-tumoral (injection into the tumor or a site suspected of containing tumor cells including the tumor site following surgical, debulking or excision), intra-thecal, pulmonary, intranasal, or by instillation into the site of tumor excision. Administration of a MDA-7 molecule encompasses administering a nucleic acid comprising a nucleic acid encoding a MDA-7 protein, in expressible form, or a purified MDA-7 protein in a suitable therapeutic formulation.

Administration of a GRP-170 molecule encompasses administering a nucleic acid comprising a nucleic acid encoding a GRP-170 protein, in expressible form, or a purified GRP-170 protein in a suitable therapeutic formulation.

The present invention provides for treatment of cancer in a subject in need of such treatment using a combination of a suitable dose and formulation of a Grp-170 and a MDA-7 molecule as set forth in the following paragraphs including but not limited to a naked DNA vector, a viral vector, a liposome formulation, a purified peptide, etc.

In preferred, non-limiting embodiments, the nucleic acid encoding a MDA-7 protein and/or a Grp-170 protein may be comprised in a viral vector, operably linked to a promoter element that is inducible or constitutively active in the target cell. In preferred, non-limiting embodiments, the viral vector is a replication-defective adenovirus (as described in section (3) above).

In a specific, non-limiting embodiment of the invention, a viral vector containing a nucleic acid encoding a MDA-7 and/or a GRP-170 protein in expressible form, operably linked to a suitable promoter element(s), may be administered to a

population of target cells at a multiplicity of infection (MOI) ranging from 10-300 MOI.

In another specific, non- limiting embodiment, the amount of a viral vector administered to a subject may be 1 X 10 ⁸ pfu to 1 X 10 ¹² pfu. In specific, non-limiting embodiments, a nucleic acid encoding a

MDA-7 protein and/or a GRP- 170 protein, comprised in a vector or otherwise, may be introduced into a cell ex vivo and then the cell may be introduced into a subject. For example, a nucleic acid encoding mda-7 and/or grp-170 may be introduced into a cell of a subject ex vivo and then the cell containing the nucleic acid may be optionally propagated and then (with its progeny) introduced into the subject. Alternatively, a MDA-7 or a GRP-170 protein may be used in protein/peptide therapy of a subject in need of such treatment. As such, the MDA-7 or GRP-170 protein of the invention may be prepared by chemical synthesis or recombinant DNA techniques, purified by methods known in the art, and then administered to a subject in need of such treatment. MDA-7 or GRP-170 protein may be comprised, for example, in solution, in suspension, and/or in a carrier particle such as microparticles, liposomes, or other protein-stabilizing formulations known in the art. In a non- limiting specific example, formulations of MDA-7 or GRP-170 protein may stabilized by addition of zinc and/or protamine stabilizers as in the case of certain types of insulin formulations. Alternatively, in specific non-limiting embodiments, a MDA-7 or GRP-170 protein may be linked covalently or non-covalently, to a carrier protein which is preferably non-immunogenic. Or the MDA-7 or GRP-170 protein may be chemically modified; for example, it may be PEGylated.

In preferred, non- limiting embodiments, a MDA-7 or a GRP-170 protein/peptide is administered in an amount which achieves a local concentration in the range of 18 to 50 ng per microliter. For example, and not by way of limitation, a subject may be administered a range of 50-100 mg per kilogram (this may, for example, be used per tumor weight for intra-tumoral injection). For a human subject, the dose range may be between 100 - 2500 mg/treatment or between 1000-2500 mg/day. In one specific non-limiting example, the concentration achieved in the target tissue/environment of the cells to be treated is between about 10 nM- 500 nM, or between about 5OnM- 200 nM, and preferably about 100 nM).

A nucleic acid comprising a nucleic acid encoding a MDA-7 protein combined with a nucleic acid comprising a nucleic acid encoding a GRP-170 protein,

as described above, may be introduced into at least one cancer cell of a subject by methods known in the art. For example, but not by way of limitation, a solution comprising an effective amount of the nucleic acid encoding the MDA-7 or GRP- 170 protein (optionally comprised in a larger nucleic acid) may be introduced (i) into a cavity resulting from the complete or partial surgical excision of a tumor mass, (ii) into a tumor mass by direct intratumoral injection, (iii) into the bloodstream of the subject, or (iv) into the extracellular space, if any, surrounding the tumor. In preferred specific embodiments of the invention, infection of the target cell may be achieved by exposure to approximately 100 plaque-forming units of an adenovirus vector comprising a MDA-7 or GRP- 170 protein encoding nucleic acid. Clinical protocols as used in the published Phase I studies of mda-7 gene therapy, or derivative protocols, may also be used (Cunningham et al, 2005; Tong et al, 2005). In a non- limiting embodiment treatment is performed by administering between 2 X 10 ¹⁰ to 2 X 10 ¹² Ad.mda-7 viral particles (i.e. 5 X 10 ⁸ to 5 X 10 ¹⁰ pfu/ml) delivered to the central region of the target tumor. The viral formulation is stored in a saline solution containing 10% glycerol in frozen form below 6O ⁰ C. Prior to injection the formulation is diluted with 5% glucose to the required viral titre. A marker dye such as Isosulfan blue may be injected with the formulation to precisely localize the injection site. Injections are performed twice weekly for around 3 weeks. Evaluations of treatment are performed by measurement of tumor size, analysis of biopsy tissue for presence of mda-7 or grp-170 gene expression in tumor cells, measurement of apoptosis indices in resected cells, measurement of cytokines, immunological responses etc (Cunningham et al., 2005; Tong et al., 2005). When delivered together or separately, the route of delivery may be same or a different method may be used depending on suitability to the specific formulation. The choice of route and timing is within the scope of routine practice and knowledge of a person with skill in the related art.

The present invention encompasses the use of the aforementioned combinations of a MDA-7 molecule and a GRP-170 molecule for treatment of cancer including but not limited to prostate cancer, melanoma, glioblastoma, pancreatic cancer, colon cancer, gastric cancer, hepatocarcinoma, breast cancer, lung cancer, ovarian cancer, testicular cancer, uterine cancer, cervical cancer, lymphoma and leukemia.

The present invention encompasses pharmaceutical compositions comprising amounts of a MDA-7 molecule and a GRP- 170 molecule which, when used together (simulataneously, concurrently, or sequentially) are effective in treating a cancer, as set forth above. The present invention encompasses therapy kits comprising separate formulations of a MDA-7 molecule and a GRP- 170 molecule in amounts which, when used simulataneously, concurrently, or sequentially, are effective in treating a cancer, as set forth above.

The following sections contain non-limiting specific examples illustrating the invention which are hereby incorporated into the detailed description section by reference.

6. EXAMPLE

6.1 METHODS AND MATERIALS Mice and cell lines. 8 to 12-week-old male C57BL/6 mice purchased from the National Institutes of Health animal facilities were maintained in a pathogen- free facility at Roswell Park Cancer Institute. Animal care and experiments were approved by the Institutional Animal Care and Use Committee. TRAMP-C2 cell line was derived from a prostate tumor that arose in a TRAMP (Transgenic Adenocarcinoma of Mouse Prostate) mouse in the C57BL/6 background (Foster et al., 1997). The TRAMP-C2 cells, C2 cells transduced with OVA (C2-OVA) and B 16 melanoma cells are maintained in DMEM containing 10% fetal bovine serum, 2mM L-glutamine, and 100U/ml penicillin/streptomycin.

Adenovirus construction and characterization. The recombinant replication-defective Ad.mda-7 virus was created in two steps as described previously (Su et al., 1998). The adenovirus carrying a secretable form of the grpl70 gene (Ad.5grpl70) was constructed using BD Adeno-X™ Adenoviral Expression System (BD Bioscience, Palo Alto, CA). To distinguish the secretable grpl70 from endogenous grpl70, a His-tag was fused to the C-terminus of mouse grpl70, in which the KNDEL endoplasmic reticulum signal has been eliminated (Wang et al., 2006a). This modified cDNA was inserted into the Nhe I/Xba I cloning sites of the pShuttle 2 plasmid, and subsequently cloned into I-Ceu I/PI-Sce I sites of Adenoviral vector. All adenoviral vectors were produced in HEK293 cells and infection titers were determined by plaque tittering on 293 cells. Viruses were concentrated and purified

using AdenoPACK Maxi columns (Sartorius Stedim Biotech) according to the procedure provided by the manufacturer. Endotoxin levels are determined by using a chromogenic limulus amebocyte lysate kinetic assay kit (Kinetic-QCL; Biowhittaker, Walkersville, MD). Cells were infected with viruses with different multiplicity of infection (MOI) under standard culture conditions. Expression of the secreted grpl70 in the supernatants of the infected cells was examined using antibodies against grpl70 and His-tag as previously Palo Alto, CA) and propidium iodide for 15 min at room temperature, and analyzed by Flow cytometry. In addition, cells were subjected to immunoblotting analysis using antibodies for Poly (ADP-ribose) polymerase (PARP) (Santa Cruz Biotech).

Cell proliferation assay. Cells (2x 10 ⁴ cells/well) were seeded in 96- well tissue culture plates and treated with Ad.mda-7 at a MOI of 300. At the indicated times, medium is removed, and 100 μl PBS containing 5 mg/ml MTT (Sigma, St. Louis, MO) is added to each well. The cells were incubated at 37°C for 4 h and then an equal volume of solublization solution (0.01 N HCl in 10% SDS) is added to each well and mixed thoroughly. The absorbance from the plates is read on a Bio-Rad Microplate Reader at 595 nm.

Tumor studies. 2x10 ⁶ TRAMP-C2 tumor cells suspended in 100 μl sterile PBS were injected into the left dorsal flank of mice. When the tumors reach 4-5 mm ² (approximately one week after tumor inoculation), animals were randomly divided into five groups and received Ad.GFP, Ad.mda-7, Ad.sgrpl70, or Ad.mda-7 plus Ad.5grpl70. Viruses were administrated intratumorally in 50 μl PBS (5 x 10 ⁸ pfu per mouse). For the group receiving the combined therapies, 2.5 x 10 ⁸ pfu of each virus was administrated. All treatments were given every other day for a total of 4 doses. Tumor growth is monitored by measuring perpendicular tumor diameters using an electronic digital caliper. To determine the effect of the combined therapies on distant tumors, mice were established with tumors in both flanks. The different adenoviruses as described above were delivered into tumors in the left flank only. Growth of contralateral tumors was followed to determine systemic antitumor immunity. Depletion of CD4 ⁺ , CD8 ⁺ Tcell subsets was accomplished by i.p. injection of 200 μg GKl .5 and 2.43 mAb respectively as previously described (Wang et al., 2006b). Effective depletion of cell subsets was maintained by the antibody injections once a week for the duration of experiment.

Enzyme-linked immunosorbent spot (ELISPOT) and CTL assays. Splenocytes were isolated from immunized mice two weeks after immunization and stimulated with 1 μg/ml H-2K ^b restricted CTL epitope OVA257-264 (SIINFEKL) or mitomycin C-treated C2 tumor cells to determine antigen-specific, IFN-γ secreting T- cells as previously described (Wang et al., 2003). For CTL assay, splenocytes were stimulated with mitomycin C-treated tumor cells or 1 μM OVA257-264 in the presence of IL-2 (20 U/ml) for 6 days. CD8 ⁺ T-cells were used as effector cells in a chromium release assay as described (Wang et al., 2003).

Statistical analysis. Statistical analysis of tumor growth inhibition, cytotoxicity assays, and ELISPOT assay were done using paired or unpaired Student's t test, as appropriate. Ps < 0.05 were considered statistically significant.

6.2 RESULTS

Construction and validation of adenovirus vector encoding secretable grp 170. We recently reported that extracellular targeting of grp 170 significantly improved the immunogenicity of a poorly immunogenic tumor (Wang et al., 2006a). To enhance the immunogenicity of mda- 7-mediated tumor cell-specific apoptosis and promote systemic antitumor immunity, we constructed a secreted form of mouse grp 170 (sgrpl70) by deleting the COOH-terminal ERretention signal 'KNDEL' (Fig. IA). Therefore, instead of being retained in the ER, the modified grp 170 should be secreted after protein synthesis. To distinguish the modified gene product from the endogenous grp 170, the His-tag was fused to the COOH terminus of the sgrpl70 gene. The fusion gene of sgrpl70-His was inserted into El/E3-deleted denovirusbased vectors under the control of CMV promoter for constitutive and effective gene expression (i.e., Ad.sgrpl70). The replication-defective virus vectors encoding this new fusion gene were successfully packaged and expanded in HEK293 cells. As a model for our studies, we selected the TRAMP-C2 cell line that was established form the spontaneous tumor of the autochthonous transgenic adenocarcinoma of mouse prostate (TRAMP) model (Foster et al., 1997). Upon subcutaneous transplantation into syngeneic male C57BL/6 mice, TRAMP-C2 cells form slowly growing, vascularized and poorly immunogenic tumors. Following infection of C2 tumor cells with Ad.5grpl70 at different MOIs, expression of the secretable grp 170 gene was examined in the supernatants of the infected cells. Robust expression of the sgrpl70 gene could be observed from day 1 at a MOI of 100 (Fig. IB). An increase in the level

of secreted grpl70 was seen in cells infected with Ad.sgrpl70 at a higher MOI (Fig. IB). The expression peaked at around 48 h and remained stable for up to 4 d (data not shown). The secretable form of modified grpl70 in the supernatants was further verified by immunoblotting using anti-His-tag antibodies (Fig. 1C). In addition, the infection of C2 cells with Ad.sgrpl70 at a MOI of up to 500 had no observable effect on C2 cell viability in vitro, indicating that sgrpl70 overexpression/?er se does not exert a cytotoxic antitumor effect.

Adenovirus-mediated mda-7/lL-24 expression inhibits TRAMP-C2 tumor cell growth by inducing tumor apoptosis. In light of the limited information on the antitumor activity of m<iα-7/IL-24 in murine tumor cells, we therefore first determined whether adenovirus-mediated m<iα-7/IL-24 expression could induce growth suppression and apoptosis in TRAMP-C2 tumor cells (Fig. 2). Immunoblotting analysis confirmed the expression of m<iα-7/IL-24 gene in C2 cells infected with Ad.mda-7 at different MOIs (Fig. 2A, upper). Ad.mda-7 generated multiple bands because of glycosylation, ranging in size from 20 to 30 kDa. A significant inhibition of proliferation (p=0.00l) was observed in C2 tumor cells treated with Ad.mda-7 at a MOI of 300 compared with that in cells treated with PBS or Ad.GFP (Fig. 2A, bottom). Treatment with Ad.mda-7 showed no significant growth inhibition in normal cells, consistent with previous reports (Fisher et al., 2003; Fisher et al., 2005). In addition, co-infection of C2 cells with Ad.sgrpl70 had no effect on mda-7/IL- 24-induced growth suppression in C2 tumor cells (data not shown).

Annexin V staining followed by fluorescent-activated cell sorting analysis (FACS) was carried out to determine early apoptotic changes in C2 cells after infection with 300 pfu/cell of Ad.GFP or Ad.mda-7 (Fig. 2B). Whereas significant increase in apoptotic cells were observed in C2 tumor cells following Ad.mda-7 infection, no such change was evident in C2 cells treated with Ad.GFP or left untreated. In addition, cleavage of PARP was detected only in C2 cells infected with Ad.mda-7 (Fig. 2C), suggesting that overexpression of mda-7/ϊL-24 in mouse tumor cells induces apoptosis in an manner similar to that observed in human cancer cells (Fisher 2005). Furthermore, the effect of Ad.mda-7 on the viability of cancer and normal cells was evaluated by Annexin V staining and FACS (Fig. 2D). The Ad.mda- 7 infection resulted in a profound increase in apoptosis of C2 tumor cells. In contrast, no significant apoptosis was seen in normal cell line DC 1.2 (Fig. 2D). These studies

indicate that Ad.mda-7 displays similar cancer-specific growth suppressive and apoptosis-inducing properties in TRAMP-C2 prostate cancer cells, with no toxic effects in normal cells.

Intratumoral delivery of adenovirus encoding secretable grpl70 enhances therapeutic efficacy of mda-7/IL-24-based gene therapy. We next assessed the therapeutic effects of intratumoral (i.t) injection of apoptosisinducing mda-7/lL-24 in conjunction with immunostimulatory adjuvant grpl70 on weakly immunogenic TRAMP-C2 tumors (Fig. 3). Immunization with irradiated C2 cells did not protect mice from subsequent tumor challenge (data not shown). Groups of C57BL/6 mice were established in the right flank with C2 tumors. When tumor size reached 5 mm in diameter, mice were treated with Ad.GFP, Ad.mda-7, Ad.sgrpl70 or Ad.mda-7 plus Ad.sgrpl70 (total 5x 10 ⁸ pfu per injection) (Fig. 3A). It was observed that administration of Ad.GFP or PBS (data not shown) had little effect on C2 tumors, whereas treatment with either Ad.mda-7 or Ad.sgrpl70 significantly delayed tumor growth. However, treatment with Ad.mda- 7 combined with Ad.sgrp 170 exhibited much more potent tumor-suppressive activities (Fig. 3B). Additionally, tumors in 20% of mice treated with Ad.mda-7 plus Ad.sgrpl70 showed complete and prolonged regression.

We additionally tested whether injection with Ad.mda-7 and Ad.5grpl70 could induce systemic immune responses that can control established tumors. The C2 tumors were inoculated into both the left and right flanks of mice. The tumor-bearing mice were treated in the right flank only with Ad.mda-7, Ad.5grpl70, Ad.mda-7 plus Ad.sgrpl70 or PBS (Fig. 3C). By comparison with the control group, mice receiving Ad.mda-7 plus Ad.sgrpl70 showed a significant inhibition in tumor growth on the untreated, contralateral flank, whereas in mice injected with Ad.mda-7, growth of contralateral tumors was essentially unimpeded. Although injection of Ad.sgrpl70 appeared to delay tumor growth to some extent, there was no statistical significance when compared to the control group. Nearly half of prostate cancer patients with clinically localized tumor undergo surgery to remove all or most of the cancer during the early phase of their disease. Therefore, we examined whether the combined in situ tumor therapies using Ad.mda-7 and Ad.5grpl70 prior to surgery could prevent tumor growth after rechallenge. Mice established with C2 tumors in the right flank received Ad.GFP, Ad.mda-7, Ad.5grpl70 or Ad.mda-7 plus Ad.sgrpl70. All primary tumors were surgically

removed one week after the last treatment. The mice were then challenged with C2 tumor cells in the left flank 10 days later. As shown in Fig. 3D, mice treated with Ad.mda-7 plus Ad.sgrpl70 were protected from rechallenge with C2 tumor, whereas those treated with Ad.GFP or Ad.mda-7 alone were still susceptible. It was seen that Ad.sgrpl70 treatment failed to protect mice from rechallenge with the same tumor, suggesting that the m<iα-7/IL-24-mediated tumor apoptosis plays an important role in induction of antitumor responses. Moreover, treatment of local tumor with Ad.mda-7 plus Ad.sgrpl70 prior to surgery was observed to more effectively reduce lung metastasis established by intravenous inoculation of C2 tumor cells, as compared to the treatment with either Ad.mda-7 or Ad.sgrp 170.

Co-administration of Ad.mda-7 and Ad.sgrpl70 induces an antigen and tumor-specific immunity. To facilitate immuno-monitoring of antigen-specific immune response elicited by the combined therapies, we established a TRAMP-C2 tumor cell line expressing a model antigen OVA. The expression of OVA gene in transduced C2 cells was confirmed by RT-PCR (Fig. 4A). Mice established with C2- OVA tumors were treated with Ad.mda-7, Ad.sgrpl70, or Ad.mda-7 plus Ad.sgrpl70. Splenocytes were isolated from the treated mice one or three weeks following the last injection. The ELISPOT assay was used to examine the OVA-specific IFN-γ production by splenocytes upon stimulation with MHC I-restricted CTL epitope for OVA, i.e., OVA257-264 (SIINFEKL) (Fig. 4B, top). Compared with those from Ad.mda-7 or Ad.sgrpl70 treated mice, a significant elevation in the level of IFN-γ was observed in cells from animals treated with Ad.mda-7 plus Ad.sgrpl70. It is also evident that splenocytes of Ad.m<iα-7-treated mice produced more IFN-γ compared with those from control mice, which agrees with the previous report showing the immunomodulatory effects of mda-7/IL-24. However, levels of IFN-γ secreted by these cells were much lower than those derived from the group treated with combined therapies, even when examined three weeks following the treatment. Similar results were obtained when splenocytes from the treated mice were stimulated with mitomycin C-treated tumor cells (Fig. 4B, bottom), suggesting that introduction of 5grpl70 into Ad.mda-7 treated tumor promotes tumor-specific IFN-γ production.

Furthermore, ELISPOT assay was performed to measure the tumor- specific secretion of IL-4 by splenocytes from the treated animals. It was observed that splenocytes of Ad.mda-7 treated mice produced higher levels of IL-4 compared to cells from animals treated with Ad.sgrpl70 or Ad.mda-7 plus Ad.sgrpl70 (Fig.4C).

Effector CD8+-T cell function, i.e., cytolytic activity, was assessed by chromium release assay using C2-OVA tumor cell as a target (Fig. 4D). At effector-target (E:T) ratios of 100: 1 and 50: 1, significantly increased cytolytic activities were observed in Ad.mda-7 plus Ad.sgrpl70-treated group when compared to Ad.mda- 7 or Ad.5grpl70-treated group. Similar results were obtained when OVA257-264-pulsed C2 cells were used as targets in the cytolytic assays (data not shown).

CD8+ T-cells are primarily involved in the systemic antitumor effects provided by the combined gene therapies. We next examined the immune effector cells involved in the antitumor immunity generated by the combined in situ therapies. C2-OVA tumor-bearing mice were depleted of CD4+ or CD8+ T-cell subsets by antibody injections prior to the initiation of treatment (Fig. 5A). It was found that depletion of CD8+ T-cell abrogated the therapeutic efficacy of the combined treatments, indicating that CD 8+ T-cell plays a critical role in tumor eradiation. However, antitumor immunity remained intact in mice depleted of CD4+ T-cell or those treated with control IgG. In addition, a higher cure rate following administration of Ad.mda-7 and Ad.sgrpl70 was observed in C2-OVA tumor model compared to parental C2 tumor model (50% versus 20%), most likely due to the surrogate antigen OVA transduced into the cells. To determine whether the antitumor immune response in C2-OVA tumor model was directed against only OVA antigen, we re-challenged C2-OVA tumor free mice which had undergone the combined treatments with parental C2 tumor (Fig.5B). 80% of mice were resistant to the secondary tumor challenge, suggesting that the treatment of C2-OVA tumor with Ad.mda-7 and Ad.5grpl70 also induced immune responses against other endogenous antigens in addition to OVA. However, these mice developed aggressively growing tumors when re-challenged with B 16 melanoma tumor, indicating tumor specificity of the antitumor immune response.

Separate intratumoral administration of Ad.mda-7 and Ad.sgrpl70 is capable of inducing antitumor immunity. To determine whether i.t. injection of mda- 7/IL-24 and sgrpl70 at the same time is required for the generation of systemic immunity, a modified treatment protocol was used to deliver Ad.mda-7 and

Ad.5grpl70 at different time points as described in Fig. 6A. In contrast to Ad.mda-7 - treated group, significant enhancement of m<iα-7/IL-24-targeted therapy by sgrpl70 was observed in mice receiving the two therapeutic agents either together (T) or separately (S) (Fig. 6B, p< 0.01 for Ad.mda-7 plus Ad.sgrpl70 (T) or Ad.mda-7 plus

Ad.sgrpl70 (S) versus Ad.mda-7 group). Although administration of Ad.mda-7 and Ad.sgrpl70 together seemed to provide an improved control of treated tumors compared to the delivery of these two molecules on different days, there was no statistic difference between these two treatment groups (p> 0.05). Upon stimulation with the OVA257-264 peptide, splenocytes derived from C2-OVA-bearing mice treated with either with Ad.mda-7 plus Ad.sgrpl70 (T) or Ad.mda-7 plus Ad.sgrpl70 (S) both displayed a robust, but comparable production of IFN-γ (Fig. 6C). However, cytolytic activity assays showed that concurrent delivery of Ad.mda-7 and Ad.5grpl70 at the same time promoted a more potent CTL response than separate administration of Ad.mda-7 and Ad.sgrpl70 (Fig. 6D).

6.3 DISCUSSION

Identification of mda-7/lL-24, a cancer-specific apoptosis-inducing cytokine, has provided a unique opportunity to develop molecular-targeted cancer therapies (Fisher PB, 2005). However, to achieve ultimate tumor control, it would be ideal if integrating an immunotherapeutic protocol into the design of the mda-7-based treatment can generate systemic antitumor immunity. In this study we have evaluated a novel adenovirus-mediated gene therapy involving tumor apoptosisinducing gene mda-7/ϊL-24 and an immunostimulatory adjuvant grpl70. In an established mouse prostate cancer TRAMP-C2 model, concurrent intratumoral administration of secretable grpl70 significantly enhanced therapeutic efficacy of the mda-7/ϊL-24- based gene therapy strategy via promoting antigen and/or tumor-specific immune responses. Two features make grpl70 a highly potent, "physiological" mammalian adjuvant that can be used for active immunotherapy: a cross-priming carrier and activator of the innate immunity (Park et al., 2006; Manjili et al., 2006). Based on our recent report demonstrating that extracellular targeting of grpl70 dramatically improves the immunogenicity of poorly immunogenic tumors, including melanoma (Wang et al., 2006a) and prostate cancer (Gao et al., unpublished data), we postulate that tumor specific killing by adenovirus-mediated mda-7/lL-24 expression, taken together with simultaneous release of tumor-derived grpl70, will provide both 'danger' signals and tumorassociated antigens to APCs (e.g., DCs), leading to strong tumor-specific immunity. In consistent with other reports, we have shown that replication-incompetent adenoviral vector encoding mda- 7/IL-24 is capable of

selectively inducing tumor-specific apoptosis in mouse TRAMP-C2 tumor line in vitro whereas no harmful effects are observed in normal cells. However, intratumoral administration of either Ad.mda-7 or Ad.sgrpl70 alone is not sufficient to augment a robust systemic antitumor response in this prostate cancer model, even though a significant delay in tumor growth was observed in treated C2 tumors. Our studies demonstrate that the unique combination of tumor-suppressor mda-7/lL-24 and immunochaperone grpl70 resulted in a highly effective control of not only local treated tumors, but also distant untreated tumors.

A significant increase in antigen-specific CD8 ⁺ T-cell frequency and tumor-specific cytolytic activity were displayed in mice treated with Ad.mda-7 and Ad.sgrpl70, as compared to mice treated with either Ad.mda-7 or Ad.sgrpl70, suggesting that extracellular targeting of ER chaperone grpl70 is a critical factor for initiation of tumor- specific and effective systemic immune responses. An early study by Miyahara et al. showed that adenoviral-mediated mda- 7/IL-24 transfer induced anticancer immunity in UV -induced fibrosarcoma model (Miyahara et al., 2006). In agreement with the finding, we have shown that mda-7/lL-24 did exhibit immunostimulatory activities in our experiment, as indicated by enhanced IFN -γ production in OVA or tumorspecifϊc T-cells from Ad.mda-7 treated mice. However, the treatment failed to elicit effective systemic immunity against distant or secondary TRAMP-C2 tumors, which have been known to be poorly immunogenic. The discrepancy between our data and data by Ramesh's group might be related to the use of different tumor models. Interestingly, it was observed that splenocytes from Ad.m<iα-7-treated mice consistently produced higher levels of IL-4 than those from animals treated with Ad.sgrpl70 or Ad.mda-7 plus Ad.sgrpl70 (Fig. 4C), which lends support to an early study in which murine mda-7, also called IL-4-induced secreted protein (FISP), was postulated to be a type 2 cytokine (Schaefer et al., 2001). However, more studies are needed to determine the pleiotropic functions of the novel tumor suppressor.

In light of the findings that stress proteins are capable of stimulating ThI -polarizing cytokine production (Wang et al., 2002; Baker-Lepain et al., 2004; Wan et al., 2004) and preferentially activating antigen-specific CD8 T-cells (Chen et al., 2000; Ramirez et al., 2005), it is tempting to postulate that, in addition to facilitating antigen transport and subsequent uptake and presentation by APCs, the secreted grpl70 acts as a ThI polarizing adjuvant during mda- 7/IL-24-induced tumor

cell apoptosis, promoting IFN-γ-producing Type 1 CD8 ⁺ T cells (TcI). It has been shown that TcI cells are more effective in delaying tumor growth and progression than that of functionally distinct Tc2 cells (Dobrzanski et al., 2006). Nonetheless, it is evident that the presence of the secretable form of grpl70 in tumor microenvironment markedly increases the immunogenicity of the m<iα-7/IL-24-mediated tumor cell death and improves the therapeutic efficacy of m<iα-7/IL-24-based tumor-targeted therapy. In addition, the results obtained from our studies have also eliminated the concerns that intratumoral injection of grpl70 might antagonize the pro-apoptotic activity of mda-7/IL-24, since stress protein generally plays a protective role in various cellular processes, including apoptosis. However, co-infection of TRAMP-C2 cells with sgrpl70 has little impact on Ad.m<iα-7-mediated tumor apoptosis and growth inhibition in vitro. It may be due to the fact that there was no accumulation of the secreted form of grpl70 in the ER and extracellular targeting of grpl70 does not affect the expression of other ER chaperones, e.g., grp78/Bip (Wang et al., 2006b), which has been implicated as an intracellular target for mda-7/IL-24 (Gupta et al., 2006). Furthermore, evaluation of the combined strategies targeting both tumor and immune compartments in vivo indicates that both tumor-specific apoptosis induction by mda-7/IL-24 and immunostimulatory adjuvant activities of sgrpl70 contribute to the synergistic or additive antitumor effects provided by the combined therapies. In support of our results obtained from ELISPOT and CTL assays, antibody depletion studies in vivo further confirmed that CD8 -T cell is required for the enhanced antitumor response observed in mice treated with Ad.mda-7 and Ad.5grpl70. Given that depletion of CD8 ⁺ T cells does not completely diminish the antitumor effects mediated by the combined therapies, it is possible that other immune effector cells may participate in the tumor control, such as NK cells. Our previous study showed that both NK cell and CD8+-T cells are required for tumor rejection elicited by vaccination with grpl70-secreting tumor cells (Wang et al., 2006a). In addition, studies from other groups also reported that extracellular targeting of stress protein or intratumoral administration of stress protein (e.g., hsp70)-encoding adenovirus promotes expansion and activity of NK cell (Strbo et al., 2003; Ren et al., 2004). The enhanced antigen- specific CTL response and systemic antitumor immunity in animals treated with the Ad.sgrpl70 in conjuction with Ad.mda-7 strongly indicates that extracellular targeting of grpl70 in the tumor milieu promotes antigen priming and cellular immunity. Our earlier studies have shown that the largest

ER chaperone grpl70 is highly efficient in binding polypeptide chains (Park et al., 2003; Wang et al., 2006b) and grpl70 purified from tumor exhibits a more potent therapeutic efficacy than other stress proteins (Wang et al., 2001).

The enhanced immunogenicity may be attributed to its highly efficient chaperoning capability. Structure deletion studies revealed that grpl70 contains two unique substrate -binding regions, i.e., the β-sheet domain and the Cterminal helix domain (Park et al., 2003). Furthermore, our recent studies have demonstrated that molecular chaperoning function is essential for the high potency of grpl70 as an immune adjuvant, e.g., interaction with APCs, antigen binding, and generation of antitumor immunity (Park et al., 2006). Supporting evidence also came from other groups suggesting that the ability of chaperone-peptide complexes to generate an antigen-specific CTL response correlates with the affinity with which the chaperone binds substrates or peptides (Moroi et al., 2000; MacAry et al., 2004). Given the high potency of grpl70 as an antigen carrier and immunostimulatory adjuvant compared to other stress proteins, we are currently evaluating therapeutic strategies combining Ad.5grpl70 with tumor-targeted standard cancer treatments, e.g., radiotherapy and chemotherapy in preclinical models.

This gene-based vaccine strategy tested here has several important advantages for clinical application. It has unique capacity to induce individual tumor- specific immune responses against a broad array of mutated tumor antigens, obviating the need to prepare vaccines from surgically resected tumor specimens ex vivo. Furthermore, the intratumoral immunotherapy drastically reduces the possibility of tumor escape due to antigen loss or tumor heterogeneity, since the approach uses the tumor against itself and grpl70 derived from tumor cells is directed against a diverse antigenic repertoire. In contrast to conventional stress proteinbased vaccination approach, the efficacy of which is strictly limited by the quantity of stress proteins and the availability of tumor specimens, the mda-7/IL-24 and sgrpl70-based therapy described here is universally applicable and more cost effective, since the vaccine is generated at the site of the patient's own tumor using his own tumor antigens. Compared to other tumor targeted gene therapy approaches for inducing cell death in rapidly dividing cells, e.g., replication-competent oncolytic adenovirus (44) and a herpes simplex virus thymidine kinase suicide gene (HSV-TK) (41), m<iα-7/IL-24- based approach should be more safer in the clinic because of the cancer specificity of mda-7/ϊL-24 and its 'bystander' activities (Su et al., 2005).

Among the solid tumors, CaP is ideally suited for the first test of efficacy of this idea because this non-essential organ expresses a wide array of unique antigens and highly accessible to gene transfer by using digital or transrectal ultrasound guidance (Ayala et al., 2006). In addition, primary CaP is relatively slow growing and thus sequential gene therapy approaches can be incorporated safely into treatment strategies. Serum prostate-specific antigen (PSA) can be easily used to monitor treatment response. The strategy may also prove effective against CaP cells that are androgen-independent, since mda-7/ϊL-24 causes release of tumor antigens from CaP regardless of their androgen sensitivity. Thus, this approach may be useful in combination with androgendeprivation therapy and can be tested in hormone- refractory CaP.

While surgery is necessary for cure, it is possible that early removal of localized prostate cancer by radical prostatectomy may preclude an opportunity to generate effective long-term immune protection. We found that surgical removal of TRAMP-C2 tumor alone does not elicit tumor-protective immunity in mice (data not shown). In the present study, we demonstrate that antitumor immunity generated by the combined therapies still remains intact in animals following surgical removal of the treated local tumors. Therefore, one possibility would be to treat patients with clinically localized prostate cancer but high risk for recurrence with the molecular- targeted therapies described here before surgical removal of the primary tumor. The primed individual tumor-specific immune responses could provide improved protection against CaP recurrence or metastasis. Furthermore, our studies have also shown that a comparable antitumor response can be generated in mice treated with Ad.mda-7 and Ad.sgrpl70 either together or separately. However, it is evident that administration of these therapeutic agents at the same time elicited a more robust CTL response than delivery of the two molecules at different times, as indicated by the higher level of cytolytic activity in effector T-cells. It appears that simultaneous introduction of mda-7/ϊL-24 and sgrpl70 is preferred in the clinic setting, however, additional experiments should be carried out to further define and optimize the treatment protocol.

Taken together, this study evaluated a dual molecular target-based therapy with significant promise for improving prostate cancer therapy, which may also have potential applications for other neoplastic diseases. This novel approach exploits an immunostimulatory chaperone molecule, i.e., grpl70, in combination with

a nontoxic cancer-specific apoptosisinducing gene, mda-7/ϊL-24. Given the encouraging phase I clinical studies with Ad.mda-7 (Cunningham et al., 2005; Tong et al., 2005) and minimal toxic side effects in mouse models and clinical trials with stress protein-based vaccines (Wang et al., 2006a), this strategy merits further evaluation for potential clinical use. Moreover, these data provide a rationale for combining chaperone grpl70 with other conventional therapeutic modalities (e.g., radiotherapy) to induce durable systemic immunity, which may provide an even greater opportunity for prostate cancer patients to be cured of their cancer.

7. SEQUENCES

SEQ ID NO: 1 cttgcctgcaaacctttacttctgaaatgacttccacggctgggacgggaaccttccacc 60 cacagctatgcctctgattggtgaatggtgaaggtgcctgtctaacttttctgtaaaaag 120 aaccagctgcctccaggcagccagccctcaagcatcacttacaggaccagagggacaaga 180 catgactgtgatgaggagctgctttcgccaatttaacaccaagaagaattgaggctgctt 240 gggaggaaggccaggaggaacacgagactgagagatgaattttcaacagaggctgcaaag 300 cctgtggactttagccagacccttctgccctcctttgctggcgacagcctctcaaatgca 360 gatggttgtgctcccttgcctgggttttaccctgcttctctggagccaggtatcaggggc 420 ccagggccaagaattccactttgggccctgccaagtgaagggggttgttccccagaaact 480 gtgggaagccttctgggctgtgaaagacactatgcaagctcaggataacatcacgagtgc 540 ccggctgctgcagcaggaggttctgcagaacgtctcggatgctgagagctgttaccttgt 600 ccacaccctgctggagttctacttgaaaactgttttcaaaaactaccacaatagaacagt 660 tgaagtcaggactctgaagtcattctctactctggccaacaactttgttctcatcgtgtc 720 acaactgcaacccagtcaagaaaatgagatgttttccatcagagacagtgcacacaggcg 780 gtttctgctattccggagagcattcaaacagttggacgtagaagcagctctgaccaaagc 840 ccttggggaagtggacattcttctgacctggatgcagaaattctacaagctctgaatgtc 900 tagaccaggacctccctccccctggcactggtttgttccctgtgtcatttcaaacagtct 960 cccttcctatgctgttcactggacacttcacgcccttggccatgggtcccattcttggcc 1020 caggattattgtcaaagaagtcattctttaagcagcgccagtgacagtcagggaaggtgc 1080 ctctggatgctgtgaagagtctacagagaagattcttgtatttattacaactctatttaa 1140 ttaatgtcagtatttcaactgaagttctatttatttgtgagactgtaagttacatgaagg 1200

cagcagaatattgtgccccatgcttctttacccctcacaatccttgccacagtgtgg ggc 1260 agtggatgggtgcttagtaagtacttaataaactgtggtgctttttttggcctgtctttg 1320 gattgttaaaaaacagagagggatgcttggatgtaaaactgaacttcagagcatgaaaat 1380 cacactgtctgctgatatctgcagggacagagcattggggtgggggtaaggtgcatctgt 1440 ttgaaaagtaaacgataaaatgtggattaaagtgcccagcacaaagcagatcctcaataa 1500 acatttcatttcccacccacactcgccagctcaccccatcatccctttcccttggtgccc 1560 tccttttttttttatcctagtcattcttccctaatcttccacttgagtgtcaagctgacc 1620 ttgctgatggtgacattgcacctggatgtactatccaatctgtgatgacattccctgcta 1680 ataaaagacaacataactca 1700

SEQ ID NO: 2

Met Asn Phe GIn GIn Arg Leu GIn Ser Leu Trp Thr Leu Ala Arg Pro 1 5 10 15

Phe Cys Pro Pro Leu Leu Ala Thr Ala Ser GIn Met GIn Met VaI VaI 20 25 30

Leu Pro Cys Leu GIy Phe Thr Leu Leu Leu Trp Ser GIn VaI Ser GIy

35 40 45

Ala GIn GIy GIn GIu Phe His Phe GIy Pro Cys GIn VaI Lys GIy VaI

50 55 60 VaI Pro GIn Lys Leu Trp GIu Ala Phe Trp Ala VaI Lys Asp Thr Met 65 70 75 80

GIn Ala GIn Asp Asn lie Thr Ser Ala Arg Leu Leu GIn GIn GIu VaI

85 90 95

Leu GIn Asn VaI Ser Asp Ala GIu Ser Cys Tyr Leu VaI His Thr Leu 100 105 110

Leu GIu Phe Tyr Leu Lys Thr VaI Phe Lys Asn Tyr His Asn Arg Thr

115 120 125

VaI GIu VaI Arg Thr Leu Lys Ser Phe Ser Thr Leu Ala Asn Asn Phe

130 135 140 VaI Leu lie VaI Ser GIn Leu GIn Pro Ser GIn GIu Asn GIu Met Phe

145 150 155 160

Ser lie Arg Asp Ser Ala His Arg Arg Phe Leu Leu Phe Arg Arg Ala

165 170 175

Phe Lys GIn Leu Asp VaI GIu Ala Ala Leu Thr Lys Ala Leu GIy GIu 180 185 190

VaI Asp lie Leu Leu Thr Trp Met GIn Lys Phe Tyr Lys Leu 195 200 205

SEQ ID NO: 3

atggcagctacagtaaggaggcagaggccaaggaggctactctgttgggccttggtg gct 60 gtcctcttggcagacctgttggcactgagcgacacattggctgtgatgtctgtagacctg 120 ggcagtgaatccatgaaggtggccattgtcaagcctggagtgcccatggagattgtattg 180 aacaaggaatctcggaggaaaactccagtgactgtgaccttgaaagaaaatgaaaggttt 240 ttaggtgatagtgcagccggcatggccatcaagaacccaaaggctacgctccgttatttc 300 cagcacctccttggaaaacaggcggataaccctcatgtggccctttaccggtcccgtttc 360 ccagaacatgagctaattgttgacccacagaggcagactgtgcgcttccagatcagtccg 420 cagctgcagttctctcccgaggaggtactgggcatggttctgaactactcccgttccttg 480 gctgaagattttgctgaacaacccattaaggatgcagtgatcaccgtgccagcctttttc 540 aaccaggctgagcgccgagctgtgctgcaggctgctcggatggctggcctcaaggtgctg 600 cagctcatcaatgacaacactgccacagccctcagctacggtgtcttccgccggaaagat 660 atcaattccactgcacagaacgtcatgttctatgacatgggctcgggcagcactgtgtgc 720 accatcgtcacctaccagacagtgaagactaaggaggctgggatgcaaccacagctgcag 780 atccggggcgtgggatttgaccgcaccctgggtggcctggagatggagcttcggcttcga 840 gaacacctggctaagctcttcaatgagcagcgcaagggccagaaagccaaggatgttcgg 900 gaaaacccccgggccatggccaaactgcttcgggaagccaaccggcttaaaaccgtcctg 960 agtgccaacgctgatcacatggcacagattgagggcttgatggatgatgtggacttcaag 1020 gccaaagtaactcgagtggaattcgaggagctgtgtgcagatttgtttgaccgtgtgcct 1080 ggacctgtgcagcaggccttgcagagtgcagagatgagcttggatcaaattgagcaggtg 1140 atcctggtgggcggggccactcgtgttcccaaagttcaagaagtgctgctcaaggccgtg 1200 ggcaaggaggaactaggaaagaacatcaatgcggacgaagctgctgccatgggggctgtg 1260 taccaggcagcggcgctcagcaaggccttcaaagtgaagccatttgttgtgcgggatgct 1320 gtcatttacccaatcctggtggagttcacaagggaggtggaggaggagcctgggctccga 1380 agcctgaaacacaataagcgtgtgctcttctcccgaatggggccctaccctcagcgcaaa 1440 gtcatcacctttaaccgctacagccatgatttcaacttccacatcaactacggtgacctg 1500 ggcttcctggggcctgaggatcttcgggtatttggctcccagaatctgaccacagtaaaa 1560

ctaaaaggcgtgggagagagcttcaagaaatatcccgactatgagtccaaaggcatc aag 1620 gcccactttaacctggatgagagtggcgtgctcagtttagacagggtggagtccgtattt 1680 gagaccctggtggaggatagcccagaggaagaatctactcttaccaaacttggcaacacc 1740 atatccagcctgtttggaggtggtacctcatcagatgccaaagagaatggtactgatgct 1800 gtacaggaggaagaggagagccccgctgaggggagcaaggatgagcctgcagagcagggg 1860 gaactcaaggaagaagctgaacccccagcagaggagacctctcagcctccaccctctgag 1920 cctaagggggatgcagcccgtgagggagagaaacctgatgaaaaagagagtggggacaag 1980 cctgaggcccagaagcccaatgagaaggggcaagcagggcctgagggtgctgctccagct 2040 cctgaggaggacaaaaagccgaaacctgcccggaagcagaaaatggtggaggagataggt 2100 gtggagctggctgtcttggacctgcctgacttgccagaggatgagctggcccgttctgtg 2160 cagaaacttgaagaactgaccctgcgcgacctagagaagcaggagagggagaaagctgcc 2220 aacagcttggaggctttcatctttgagacccaggacaagctgtaccagcctgagtaccag 2280 gaagtgtccactgaggaacagcgggaggagatctcggggaaactcagcgccacttctacc 2340 tggctggaggatgagggatttggagccaccactgtgatgctgaaggacaagctggctgag 2400 ctgagaaagctgtgccaagggctgttttttcgggtggaagaacgcaggaaatggccagag 2460 cggctttcagctctggataatctcctcaaccattccagcattttcctcaagggtgcccgg 2520 ctcatcccggagatggaccaggtcttcactgaagtggagatgacgacattagagaaagtt 2580 atcaatgacacctgggcctggaagaatgcaactctggccgaacaagccaagcttcctgcc 2640 acagagaagcctgtgctgctttcaaaagacattgaggccaaaatgatggccctggaccgg 2700 gaggtacagtatctactcaataaggccaagtttaccaagccacggccacggcccaaagac 2760 aagaatggcacccgggcagaacctcccctcaatgccagtgctggtgaccaagaggagaag 2820 gtcattccacctgcaggccagactgaagaggcgaaacccattttagaacctgacaaagaa 2880 gagactggtacggaaccagcagactcggagcctctggaattaggaggtcctggagctgga 2940 cctgaacaggaagagcagtcagcaggacagaagcggccttcaaagaacgatgaactataa 3000

SEQ ID NO: 4

Met Ala Ala Thr VaI Arg Arg GIn Arg Pro Arg Arg Leu Leu Cys Trp Ala 1 5 10 15

Leu VaI Ala VaI Leu Leu Ala Asp Leu Leu Ala Leu Ser Asp Thr Leu Ala

20 25 30

VaI Met Ser VaI Asp Leu GIy Ser GIu Ser Met Lys VaI Ala lie VaI Lys 35 40 45 50 Pro GIy VaI Pro Met GIu lie VaI Leu Asn Lys GIu Ser Arg Arg Lys Thr

55 60 65

Pro VaI Thr VaI Thr Leu Lys GIu Asn GIu Arg Phe Leu GIy Asp Ser Ala

70 75 80 85

Ala GIy Met Ala lie Lys Asn Pro Lys Ala Thr Leu Arg Tyr Phe GIn His 90 95 100

Leu Leu GIy Lys GIn Ala Asp Asn Pro His VaI Ala Leu Tyr Arg Ser Arg

105 110 115

Phe Pro GIu His GIu Leu lie VaI Asp Pro GIn Arg GIn Thr VaI Arg Phe 120 125 130 135 GIn lie Ser Pro GIn Leu GIn Phe Ser Pro GIu GIu VaI Leu GIy Met VaI

140 145 150

Leu Asn Tyr Ser Arg Ser Leu Ala GIu Asp Phe Ala GIu GIn Pro lie Lys 155 160 165 170

Asp Ala VaI lie Thr VaI Pro Ala Phe Phe Asn GIn Ala GIu Arg Arg Ala 175 180 185

VaI Leu GIn Ala Ala Arg Met Ala GIy Leu Lys VaI Leu GIn Leu lie Asn

190 195 200

Asp Asn Thr Ala Thr Ala Leu Ser Tyr GIy VaI Phe Arg Arg Lys Asp lie 205 210 215 220 Asn Ser Thr Ala GIn Asn VaI Met Phe Tyr Asp Met GIy Ser GIy Ser Thr

225 230 235

VaI Cys Thr lie VaI Thr Tyr GIn Thr VaI Lys Thr Lys GIu Ala GIy Met

240 245 250 255

GIn Pro GIn Leu GIn lie Arg GIy VaI GIy Phe Asp Arg Thr Leu GIy GIy 260 265 270

Leu GIu Met GIu Leu Arg Leu Arg GIu His Leu Ala Lys Leu Phe Asn GIu

275 280 285

GIn Arg Lys GIy GIn Lys Ala Lys Asp VaI Arg GIu Asn Pro Arg Ala Met 290 295 300 305 Ala Lys Leu Leu Arg GIu Ala Asn Arg Leu Lys Thr VaI Leu Ser Ala Asn

310 315 320

Ala Asp His Met Ala GIn lie GIu GIy Leu Met Asp Asp VaI Asp Phe Lys 325 330 335 340

Ala Lys VaI Thr Arg VaI GIu Phe GIu GIu Leu Cys Ala Asp Leu Phe Asp 345 350 355

Arg VaI Pro GIy Pro VaI GIn GIn Ala Leu GIn Ser Ala GIu Met Ser Leu

360 365 370

Asp GIn lie GIu GIn VaI lie Leu VaI GIy GIy Ala Thr Arg VaI Pro Lys 375 380 385 390 VaI GIn GIu VaI Leu Leu Lys Ala VaI GIy Lys GIu GIu Leu GIy Lys Asn

395 400 405 lie Asn Ala Asp GIu Ala Ala Ala Met GIy Ala VaI Tyr GIn Ala Ala Ala 410 415 420 425

Leu Ser Lys Ala Phe Lys VaI Lys Pro Phe VaI VaI Arg Asp Ala VaI lie 430 435 440

Tyr Pro lie Leu VaI GIu Phe Thr Arg GIu VaI GIu GIu GIu Pro GIy Leu

445 450 455

Arg Ser Leu Lys His Asn Lys Arg VaI Leu Phe Ser Arg Met GIy Pro Tyr 460 465 470 475 Pro GIn Arg Lys VaI lie Thr Phe Asn Arg Tyr Ser His Asp Phe Asn Phe

480 485 490

His lie Asn Tyr GIy Asp Leu GIy Phe Leu GIy Pro GIu Asp Leu Arg VaI 495 500 505 510

Phe GIy Ser GIn Asn Leu Thr Thr VaI Lys Leu Lys GIy VaI GIy GIu Ser 515 520 525

Phe Lys Lys Tyr Pro Asp Tyr GIu Ser Lys GIy lie Lys Ala His Phe Asn

530 535 540

Leu Asp GIu Ser GIy VaI Leu Ser Leu Asp Arg VaI GIu Ser VaI Phe GIu 545 550 555 560 Thr Leu VaI GIu Asp Ser Pro GIu GIu GIu Ser Thr Leu Thr Lys Leu GIy

565 570 575

Asn Thr lie Ser Ser Leu Phe GIy GIy GIy Thr Ser Ser Asp Ala Lys GIu 580 585 590 595

Asn GIy Thr Asp Ala VaI GIn GIu GIu GIu GIu Ser Pro Ala GIu GIy Ser 600 605 610

Lys Asp GIu Pro Ala GIu GIn GIy GIu Leu Lys GIu GIu Ala GIu Pro Pro

615 620 625

Ala GIu GIu Thr Ser GIn Pro Pro Pro Ser GIu Pro Lys GIy Asp Ala Ala 630 635 640 645 Arg GIu GIy GIu Lys Pro Asp GIu Lys GIu Ser GIy Asp Lys Pro GIu Ala

650 655 660

GIn Lys Pro Asn GIu Lys GIy GIn Ala GIy Pro GIu GIy Ala Ala Pro Ala 665 670 675 680

Pro GIu GIu Asp Lys Lys Pro Lys Pro Ala Arg Lys GIn Lys Met VaI GIu 685 690 695

GIu lie GIy VaI GIu Leu Ala VaI Leu Asp Leu Pro Asp Leu Pro GIu Asp

700 705 710

GIu Leu Ala Arg Ser VaI GIn Lys Leu GIu GIu Leu Thr Leu Arg Asp Leu 715 720 725 730 GIu Lys GIn GIu Arg GIu Lys Ala Ala Asn Ser Leu GIu Ala Phe lie Phe

735 740 745

GIu Thr GIn Asp Lys Leu Tyr GIn Pro GIu Tyr GIn GIu VaI Ser Thr GIu 750 755 760 765

GIu GIn Arg GIu GIu lie Ser GIy Lys Leu Ser Ala Thr Ser Thr Trp Leu 770 775 780

GIu Asp GIu GIy Phe GIy Ala Thr Thr VaI Met Leu Lys Asp Lys Leu Ala

785 790 795

GIu Leu Arg Lys Leu Cys GIn GIy Leu Phe Phe Arg VaI GIu GIu Arg Arg

800 805 810 815 Lys Trp Pro GIu Arg Leu Ser Ala Leu Asp Asn Leu Leu Asn His Ser Ser

820 825 830 lie Phe Leu Lys GIy Ala Arg Leu lie Pro GIu Met Asp GIn VaI Phe Thr 835 840 845 850

GIu VaI GIu Met Thr Thr Leu GIu Lys VaI lie Asn Asp Thr Trp Ala Trp 855 860 865

Lys Asn Ala Thr Leu Ala GIu GIn Ala Lys Leu Pro Ala Thr GIu Lys Pro

870 875 880

VaI Leu Leu Ser Lys Asp lie GIu Ala Lys Met Met Ala Leu Asp Arg GIu 885 890 895 900 VaI GIn Tyr Leu Leu Asn Lys Ala Lys Phe Thr Lys Pro Arg Pro Arg Pro

905 910 915

Lys Asp Lys Asn GIy Thr Arg Ala GIu Pro Pro Leu Asn Ala Ser Ala GIy 920 925 930 935

Asp GIn GIu GIu Lys VaI lie Pro Pro Ala GIy GIn Thr GIu GIu Ala Lys 940 945 950

Pro lie Leu GIu Pro Asp Lys GIu GIu Thr GIy Thr GIu Pro Ala Asp Ser

955 960 965

GIu Pro Leu GIu Leu GIy GIy Pro GIy Ala GIy Pro GIu GIn GIu GIu GIn 970 975 980 985 Ser Ala GIy GIn Lys Arg Pro Ser Lys Asn Asp GIu Leu*** 990 995

SEQ ID NO: 5 atggcagacaaagttaggaggcagaggccgaggaggcgagtctgttgggccttggtggct 60 gtgctcttggcagacctgttggcactgagtgatacactggcagtgatgtctgtggacctg 121 ggcagtgagtccatgaaggtggccattgtcaaacctggagtgcccatggaaattgtcttg 181 aataaggaatctcggaggaaaacaccggtgatcgtgaccctgaaagaaaatgaaagattc 241 tttggagacagtgcagcaagcatggcgattaagaatccaaaggctacgctacgttacttc 301 cagcacctcctggggaagcaggcagataacccccatgtagctctttaccaggcccgcttc 361 ccggagcacgagctgactttcgacccacagaggcagactgtgcactttcagatcagctcg 421 cagctgcagttctcacctgaggaagtgttgggcatggttctcaattattctcgttctcta 481 gctgaagattttgcagagcagcccatcaaggatgcagtgatcaccgtgccagtcttcttc 541 aatcaggccgagcgccgagctgtgctgcaggctgctcgtatggctggcctcaaagtgctg 601 cagctcatcaatgacaacaccgccactgccctcagctatggtgtcttccgccggaaagat 661 attaacaccactgcccagaatatcatgttctatgacatgggctcaggcagcaccgtatgc 721 accattgtgacctaccagatggtgaagactaaggaagctgggatgcagccacagctgcag 781

atccggggagtaggatttgaccgtaccctggggggcctggagatggagctccggctt cga 841 gaacgcctggctgggcttttcaatgagcagcgcaagggtcagagagcaaaggatgtgcgg 901 gagaacccgcgtgccatggccaagctgctgcgtgaggctaatcggctcaaaaccgtcctc 961 agtgccaacgctgaccacatggcacagattgaaggcctgatggatgatgtggacttcaag 1021 gcaaaagtgactcgtgtggaatttgaggagttgtgtgcagacttgtttgagcgggtgcct 1081 gggcctgtacagcaggccctccagagtgccgaaatgagtctggatgagattgagcaggtg 1141 atcctggtgggtggggccactcgggtccccagagttcaggaggtgctgctgaaggccgtg 1201 ggcaaggaggagctggggaagaacatcaatgcagatgaagcagccgccatgggggcagtg 1261 taccaggcagctgcgctcagcaaagcctttaaagtgaagccatttgtcgtccgagatgca 1321 gtggtctaccccatcctggtggagttcacgagggaggtggaggaggagcctgggattcac 1381 agcctgaagcacaataaacgggtactcttctctcggatggggccctaccctcaacgcaaa 1441 gtcatcacctttaaccgctacagccatgatttcaacttccacatcaactacggcgacctg 1501 ggcttcctggggcctgaagatcttcgggtatttggctcccagaatctgaccacagtgaag 1561 ctaaaaggggtgggtgacagcttcaagaagtatcctgactacgagtccaagggcatcaag 1621 gctcacttcaacctggatgagagtggcgtgctcagtctagacagggtggagtctgtattt 1681 gagacactggtagaggacagcgcagaagaggaatctactctcaccaaacttggcaacacc 1741 atttccagcctgtttggaggcggtaccacaccagatgccaaggagaatggtactgatact 1801 gtccaggaggaagaggagagccctgcagaggggagcaaggacgagcctggggagcaggtg 1861 gagctcaaggaggaagctgaggccccagtggaggatggctctcagcccccaccccctgaa 1921 cctaagggagatgcaacccctgagggagaaaaggccacagaaaaagaaaatggggacaag 1981 tctgaggcccagaaaccaagtgagaaggcagaggcagggcctgagggcgtcgctccagcc 2041 ccagagggagagaagaagcagaagcccgccaggaagcggcgaatggtagaggagatcggg 2101 gtggagctggttgttctggacctgcctgacttgccagaggataagctggctcagtcggtg 2161 cagaaacttcaggacttgacactccgagacctggagaagcaggaacgggaaaaagctgcc 2221 aacagcttggaagcgttcatatttgagacccaggacaagctgtaccagcccgagtaccag 2281 gaagtgtccacagaggagcagcgtgaggagatctctgggaagctcagcgccgcatccacc 2341 tggctggaggatgagggtgttggagccaccacagtgatgttgaaggagaagctggctgag 2401 ctgaggaagctgtgccaagggctgttttttcgggtagaggagcgcaagaagtggcccgaa 2461 cggctgtctgccctcgataatctcctcaaccattccagcatgttcctcaagggggcccgg 2521 ctcatcccagagatggaccagatcttcactgaggtggagatgacaacgttagagaaagtc 2581 atcaatgagacctgggcctggaagaatgcaactctggccgagcaggctaagctgcccgcc 2641 acagagaagcctgtgttgctctcaaaagacattgaagctaagatgatggccctggaccga 2701 gaggtgcagtatctgctcaataaggccaagtttaccaagccccggccccggcctaaggac 2761 aagaatgggacccgggcagagccacccctcaatgccagtgccagtgaccagggggagaag 2821 gtcatccctccagcaggccagactgaagatgcagagcccatttcagaacctgagaaagta 2881 gagactggatccgagccaggagacactgagcctttggagttaggaggtcctggagcagaa 2941 cctgaacagaaagaacaatcgacaggacagaagcggcctttgaagaacgacgaactataa 3000

SEQ ID NO: 6

Met Ala Asp Lys VaI Arg Arg GIn Arg Pro Arg Arg Arg VaI Cys Trp Ala

1 5 10 15

Leu VaI Ala VaI Leu Leu Ala Asp Leu Leu Ala Leu Ser Asp Thr Leu Ala

20 25 30

VaI Met Ser VaI Asp Leu GIy Ser GIu Ser Met Lys VaI Ala lie VaI Lys 35 40 45 50

Pro GIy VaI Pro Met GIu lie VaI Leu Asn Lys GIu Ser Arg Arg Lys Thr

55 60 65

Pro VaI lie VaI Thr Leu Lys GIu Asn GIu Arg Phe Phe GIy Asp Ser Ala

70 75 80 85 Ala Ser Met Ala lie Lys Asn Pro Lys Ala Thr Leu Arg Tyr Phe GIn His

90 95 100

Leu Leu GIy Lys GIn Ala Asp Asn Pro His VaI Ala Leu Tyr GIn Ala Arg

105 110 115

Phe Pro GIu His GIu Leu Thr Phe Asp Pro GIn Arg GIn Thr VaI His Phe 120 125 130 135

GIn lie Ser Ser GIn Leu GIn Phe Ser Pro GIu GIu VaI Leu GIy Met VaI

140 145 150

Leu Asn Tyr Ser Arg Ser Leu Ala GIu Asp Phe Ala GIu GIn Pro lie Lys

155 160 165 170 Asp Ala VaI He Thr VaI Pro VaI Phe Phe Asn GIn Ala GIu Arg Arg Ala

175 180 185

VaI Leu GIn Ala Ala Arg Met Ala GIy Leu Lys VaI Leu GIn Leu He Asn

190 195 200

Asp Asn Thr Ala Thr Ala Leu Ser Tyr GIy VaI Phe Arg Arg Lys Asp He 205 210 215 220

Asn Thr Thr Ala GIn Asn He Met Phe Tyr Asp Met GIy Ser GIy Ser Thr

225 230 235

VaI Cys Thr He VaI Thr Tyr GIn Met VaI Lys Thr Lys GIu Ala GIy Met

240 245 250 255 GIn Pro GIn Leu GIn He Arg GIy VaI GIy Phe Asp Arg Thr Leu GIy GIy

260 265 270

Leu GIu Met GIu Leu Arg Leu Arg GIu Arg Leu Ala GIy Leu Phe Asn GIu

275 280 285

GIn Arg Lys GIy GIn Arg Ala Lys Asp VaI Arg GIu Asn Pro Arg Ala Met 290 295 300 305

Ala Lys Leu Leu Arg GIu Ala Asn Arg Leu Lys Thr VaI Leu Ser Ala Asn

310 315 320

Ala Asp His Met Ala GIn He GIu GIy Leu Met Asp Asp VaI Asp Phe Lys

325 330 335 340 Ala Lys VaI Thr Arg VaI GIu Phe GIu GIu Leu Cys Ala Asp Leu Phe GIu

345 350 355

Arg VaI Pro GIy Pro VaI GIn GIn Ala Leu GIn Ser Ala GIu Met Ser Leu

360 365 370

Asp GIu lie GIu GIn VaI lie Leu VaI GIy GIy Ala Thr Arg VaI Pro Arg 375 380 385 390

VaI GIn GIu VaI Leu Leu Lys Ala VaI GIy Lys GIu GIu Leu GIy Lys Asn

395 400 405 lie Asn Ala Asp GIu Ala Ala Ala Met GIy Ala VaI Tyr GIn Ala Ala Ala

410 415 420 425 Leu Ser Lys Ala Phe Lys VaI Lys Pro Phe VaI VaI Arg Asp Ala VaI VaI

430 435 440

Tyr Pro He Leu VaI GIu Phe Thr Arg GIu VaI GIu GIu GIu Pro GIy He

445 450 455

His Ser Leu Lys His Asn Lys Arg VaI Leu Phe Ser Arg Met GIy Pro Tyr 460 465 470 475

Pro GIn Arg Lys VaI He Thr Phe Asn Arg Tyr Ser His Asp Phe Asn Phe

480 485 490

His He Asn Tyr GIy Asp Leu GIy Phe Leu GIy Pro GIu Asp Leu Arg VaI

495 500 505 510 Phe GIy Ser GIn Asn Leu Thr Thr VaI Lys Leu Lys GIy VaI GIy Asp Ser

515 520 525

Phe Lys Lys Tyr Pro Asp Tyr GIu Ser Lys GIy He Lys Ala His Phe Asn

530 535 540

Leu Asp GIu Ser GIy VaI Leu Ser Leu Asp Arg VaI GIu Ser VaI Phe GIu 545 550 555 560

Thr Leu VaI GIu Asp Ser Ala GIu GIu GIu Ser Thr Leu Thr Lys Leu GIy

565 570 575

Asn Thr He Ser Ser Leu Phe GIy GIy GIy Thr Thr Pro Asp Ala Lys GIu

580 585 590 595 Asn GIy Thr Asp Thr VaI GIn GIu GIu GIu GIu Ser Pro Ala GIu GIy Ser

600 605 610

Lys Asp GIu Pro GIy GIu GIn VaI GIu Leu Lys GIu GIu Ala GIu Ala Pro

615 620 625

VaI GIu Asp GIy Ser GIn Pro Pro Pro Pro GIu Pro Lys GIy Asp Ala Thr 630 635 640 645

Pro GIu GIy GIu Lys Ala Thr GIu Lys GIu Asn GIy Asp Lys Ser GIu Ala

650 655 660

GIn Lys Pro Ser GIu Lys Ala GIu Ala GIy Pro GIu GIy VaI Ala Pro Ala

665 670 675 680 Pro GIu GIy GIu Lys Lys GIn Lys Pro Ala Arg Lys Arg Arg Met VaI GIu

685 690 695

GIu lie GIy VaI GIu Leu VaI VaI Leu Asp Leu Pro Asp Leu Pro GIu Asp

700 705 710

Lys Leu Ala GIn Ser VaI GIn Lys Leu GIn Asp Leu Thr Leu Arg Asp Leu 715 720 725 730

GIu Lys GIn GIu Arg GIu Lys Ala Ala Asn Ser Leu GIu Ala Phe lie Phe

735 740 745

GIu Thr GIn Asp Lys Leu Tyr GIn Pro GIu Tyr GIn GIu VaI Ser Thr GIu

750 755 760 765 GIu GIn Arg GIu GIu lie Ser GIy Lys Leu Ser Ala Ala Ser Thr Trp Leu

770 775 780

GIu Asp GIu GIy VaI GIy Ala Thr Thr VaI Met Leu Lys GIu Lys Leu Ala

785 790 795

GIu Leu Arg Lys Leu Cys GIn GIy Leu Phe Phe Arg VaI GIu GIu Arg Lys 800 805 810 815

Lys Trp Pro GIu Arg Leu Ser Ala Leu Asp Asn Leu Leu Asn His Ser Ser

820 825 830

Met Phe Leu Lys GIy Ala Arg Leu lie Pro GIu Met Asp GIn lie Phe Thr

835 840 845 850 GIu VaI GIu Met Thr Thr Leu GIu Lys VaI lie Asn GIu Thr Trp Ala Trp

855 860 865

Lys Asn Ala Thr Leu Ala GIu GIn Ala Lys Leu Pro Ala Thr GIu Lys Pro

870 875 880

VaI Leu Leu Ser Lys Asp lie GIu Ala Lys Met Met Ala Leu Asp Arg GIu 885 890 895 900

VaI GIn Tyr Leu Leu Asn Lys Ala Lys Phe Thr Lys Pro Arg Pro Arg Pro

905 910 915

Lys Asp Lys Asn GIy Thr Arg Ala GIu Pro Pro Leu Asn Ala Ser Ala Ser

920 925 930 935 Asp GIn GIy GIu Lys VaI lie Pro Pro Ala GIy GIn Thr GIu Asp Ala GIu

940 945 950

Pro lie Ser GIu Pro GIu Lys VaI GIu Thr GIy Ser GIu Pro GIy Asp Thr

955 960 965

GIu Pro Leu GIu Leu GIy GIy Pro GIy Ala GIu Pro GIu GIn Lys GIu GIn 970 975 980 985

Ser Thr GIy GIn Lys Arg Pro Leu Lys Asn Asp GIu Leu *** 990 995

8. REFERENCES

Ayala G, Satoh T, Li R, et al. Biological response determinants in HSV-tk + ganciclovir gene therapy for prostate cancer. MoI Ther 2006; 13:716-28.

Baker-LePain JC, Sarzotti M, Nicchitta CV. Glucose-regulated protein 94/glycoprotein 96 elicits bystander activation of CD4+ T cell ThI cytokine production in vivo. J Immunol 2004; 172:4195-203.

Bethke K, Staib F, Distler M et al. Different efficiency of heat shock proteins (HSP) to activate human monocytes and dendritic cells: superiority of HSP60. J. Immunol. 2002; 169: 6141-8. Bert AJ, Haddara W, Prevec L, Graham FL. An efficient and flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3. Proc Natl Acad Sci U S A. 1994 Sep 13;91(19):8802-6.

Binder RJ, Anderson KM, Basu S, Srivastava PK. Cutting edge: heat shock protein gp96 induces maturation and migration of CDl IcI cells in vivo. J. Immunol. 2000; 165: 6029-35.

Boyce FM, Bucher NL. Baculovirus-mediated gene transfer into mammalian cells. Proc Natl Acad Sci U S A. 1996 Mar 19;93(6):2348-52.

Cai JW, Henderson BW, Shen JW, Subjeck JR. Induction of glucose regulated proteins during growth of a murine tumor. J Cell Physiol 1993; 154:229-37. Campisi J, Leem TH, Fleshner M. Stress-induced extracellular Hsp72 is a functionally significant danger signal to the immune system. Cell Stress Chaperones 2003; 8: 272-86.

Chen, X., Easton, D., Oh, H. J., Lee-Yoon, D. S., Liu, X., and Subjeck, J. (1996) The 170 kDa glucose regulated stress protein is a large HSP70-, HSPl 10- like protein of the endoplasmic reticulum, FEBS Lett. 380, 68-72.

Chen CH, Wang TL, Hung CF, et al. Enhancement of DNA vaccine potency by linkage of antigen gene to an HSP70 gene. Cancer Res 2000; 60:1035-42. Clarke AR. Molecular chaperones in protein folding and translocation. Curr Opin Struct Biol 1996; 6:43-50. Colley KJ, Lee EU, Adler B, Browne JK, Paulson JC. Conversion of a

Golgi apparatus sialyltransferase to a secretory protein by replacement of the NH2- terminal signal anchor with a signal peptide. J Biol Chem. 1989 Oct 5;264(30): 17619- 22.

Connelly S. Adenoviral vectors for liver-directed gene therapy. Curr Opin MoI Ther. 1999 Oct;l(5):565-72.

Craven RA, Egerton M, Stirling CJ. A novel Hsp70 of the yeast ER lumen is required for the efficient translocation of a number of protein precursors. EMBO J 1996; 15:2640-50.

Craven, R. A., Tyson, J. R., and Stirling, C. J. (1997) A novel subfamily of Hsp70s in the endoplasmic reticulum, Trends Cell Biol. 7, 277-282.

Cunningham CC, Chada S, Merritt JA, Tong A, Senzer N, Zhang Y, Mhashilkar A, Parker K, Vukelja S, Richards D, Hood J, Coffee K, Nemunaitis J. 2005. Clinical and local biological effects of an intratumoral injection of mda-7

(IL24; INGN 241) in patients with advanced carcinoma: a phase I study. MoI Ther 11(1):149-159.

Curran MA, Kaiser SM, Achacoso PL, Nolan GP. Efficient transduction of nondividing cells by optimized feline immunodeficiency virus vectors. Mol Ther. 2000 Jan;l(l):31-8.

Dierks T, Volkmer J, Schlenstedt G, et al. A microsomal ATP -binding protein involved in efficient protein transport into the mammalian endoplasmic reticulum. EMBO J 1996; 15:6931-42.

Dobrzanski MJ, Reome JB, Hylind JC, Rewers-Felkins KA. CD8- mediated type 1 antitumor responses selectively modulate endogenous differentiated and nondifferentiated T cell localization, activation, and function in progressive breast cancer. J Immunol 2006; 177:8191- 201.

Easton, D. P., Kaneko, Y., and Subjeck, J. R. (2000) The hspl 10 and Grpl 70 stress proteins: newly recognized relatives of the Hsp70s, Cell Stress Chaperones 5, 276-290.

Ekmekcioglu S, Ellerhorst J, Mhashilkar AM, Sahin AA, Read CM, Prieto VG, Chada S, Grimm EA. 2001. Down-regulated melanoma differentiation associated gene (mda-7) expression in human melanomas. Int J Cancer 94(l):54-59.

Ellerhorst JA, Prieto VG, Ekmekcioglu S, Broemeling L, Yekell S, Chada S, Grimm EA. 2002. Loss of MDA-7 expression with progression of melanoma. J Clin Oncol 20(4): 1069-1074.

Emdad L, Sarkar D, Lebedeva IV, Su ZZ, Gupta P, Mahasreshti PJ, Dent P, Curiel DT, Fisher PB. 2006. Ionizing radiation enhances adenoviral vector

expressing mda-7/IL-24-mediated apoptosis in human ovarian cancer. J Cell Physiol 208(2):298-306.

Falck-Pedersen E, Heinflink M, Alvira M, Nussenzveig DR, Gershengorn MC. Expression of thyrotropin-releasing hormone receptors by adenovirus-mediated gene transfer reveals that thyrotropin-releasing hormone desensitization is cell specific. MoI Pharmacol. 1994 Apr;45(4):684-9.

Feng H, Zeng Y, Whitesell L, Katsanis E. Stressed apoptotic tumour cells express heat shock proteins and elicit tumourspecific immunity. Blood 2001; 97: 3505-512. Feng H, Zeng Y, Graner MW, Katsanis E. Stressed apoptotic tumour cells stimulate dendritic cells and induce specific cytotoxic T cells. Blood 2002; 100: 4108-115.

Feng H, Zeng Y, Graner MW, Likhacheva A, Katsanis E. Exogenous stress proteins enhance the immunogenicity of apoptotic tumour cells and stimulate antitumor immunity. Blood 2003; 101 : 245-52.

Fisher PB, Gopalkrishnan RV, Chada S, Ramesh R, Grimm EA, Rosenfeld MR, Curiel DT, Dent P. 2003. mda-7/IL-24, a novel cancer selective apoptosis inducing cytokine gene: from the laboratory into the clinic. Cancer Biol Ther 2 (4 Suppl l):S23-37. Fisher PB. 2005. Is mda-7/IL-24 a "magic bullet" for cancer? Cancer

Res 65(22):10128-10138.

Foster BA, Gingrich JR, Kwon ED, Madias C, Greenberg NM. Characterization of prostatic epithelial cell lines derived from transgenic adenocarcinoma of the mouse prostate (TRAMP) model. Cancer Res 1997; 57:3325- 30.

Gallucci S, Matzinger P. Danger signals: SOS to the immune system. Curr. Opin. Immunol. 2001; 13: 114-19

Geller AI, Freese A. Infection of cultured central nervous system neurons with a defective herpes simplex virus 1 vector results in stable expression of Escherichia coli beta-galactosidase. Proc Natl Acad Sci U S A. 1990 Feb;87(3): 1149- 53.

Graham FL, Smiley J, Russell WC, Nairn R. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol. 1977 Jul;36(l):59-74.

Gupta P, Su ZZ, Lebedeva IV, Sarkar D, Sauane M, Emdad L, Bachelor MA, Grant S, Curiel DT, Dent P, Fisher PB. 2006a. mda-7/IL-24: Multifunctional cancer-specific apoptosis-inducing cytokine. Pharmacol Ther 111 : 596-628. Gupta P, Walter MR, Su ZZ, Lebedeva IV, Emdad L, Randolph A,

Valerie K, Sarkar D, Fisher PB. 2006b. BiP/GRP78 is an intracellular target for mda- 7/IL-24 induction of cancer-specific apoptosis. Cancer Res. 66(16) : 8182-8191.

Haley et al., The human EGF receptor gene: structure of the 110 Kb locus and identification of sequences regulating its transcription. Oncogene Res. 1987, 1 :375-396.

Hambor JE, Hauer CA, Shu HK, Groger RK, Kaplan DR, Tykocinski ML. Use of an Epstein-Barr virus episomal replicon for anti-sense RNA-mediated gene inhibition in a human cytotoxic T-cell clone. Proc Natl Acad Sci U S A. 1988 Jun;85(l l):4010-4. Hayashi Y, DePaoli AM, Burant CF, Refetoff S. Expression of a thyroid hormone-responsive recombinant gene introduced into adult mice livers by replication-defective adenovirus can be regulated by endogenous thyroid hormone receptor. J Biol Chem. 1994 Sep 30;269(39):23872-5.

Huang EY, Madireddi MT, Gopalkrishnan RV, Leszczyniecka M, Su Z, Lebedeva IV, Kang D, Jiang H, Lin JJ, Alexandre D, Chen Y, Vozhilla N, Mei

MX, Christiansen KA, Sivo F, Goldstein NI, Mhashilkar AB, Chada S, Huberman E, Pestka S, Fisher PB. 2001. Genomic structure, chromosomal localization and expression profile of a novel melanoma differentiation associated (mda-7) gene with cancer specific growth suppressing and apoptosis inducing properties. Oncogene 20(48):7051-7063.

Huang XF, Ren W, Rollins L, et al. A broadly applicable, personalized heat shock proteinmediated oncolytic tumor vaccine. Cancer Res 2003; 63:7321-9.

Jaffe HA, Danel C, Longenecker G, Metzger M, Setoguchi Y,

Rosenfeld MA, Gant TW, Thorgeirsson SS, Stratford-Perricaudet LD, Perricaudet M, et al. Adenovirus-mediated in vivo gene transfer and expression in normal rat liver. Nat Genet. 1992 Aug;l(5):372-8.

Jiang H, Lin JJ, Su ZZ, Goldstein NI, Fisher PB. 1995. Subtraction hybridizaton identifies a novel melaoma differentiation associated gene, mda-7,

modulated during human melanoma differentiation, growth and progression. Oncogene 11 :2477-2486.

Jiang H, Su ZZ, Lin JJ, Goldstein NI, Young CS, Fisher PB. 1996. The melanoma differentiation associated gene mda-7 suppresses cancer cell growth. Proc Natl Acad Sci U S A 93(17):9160-9165.

Jolly C, Morimoto RI. Role of the heat shock response and molecular chaperones in oncogenesis and cell death. J Natl Cancer Inst 2000; 92:1564-72.

Koren R, Burstein Y, Soreq H. Synthetic leader peptide modulates secretion of proteins from microinjected Xenopus oocytes. Proc Natl Acad Sci U S A. 1983 Dec;80(23):7205-9.

Kuznetsov G, Chen LB, Nigam SK. Multiple molecular chaperones complex with misfolded large oligomeric glycoproteins in the endoplasmic reticulum. J Biol Chem 1997; 272:3057-63.

Lamfers ML, Grill J, Dirven CM, Van Beusechem VW, Geoerger B, Van Den Berg J, Alemany R, Fueyo J, Curiel DT, Vassal G, Pinedo HM, Vandertop WP, Gerritsen WR. Potential of the conditionally replicative adenovirus Ad5- Delta24RGD in the treatment of malignant gliomas and its enhanced effect with radiotherapy. Cancer Res. 2002 Oct 15;62(20):5736-42.

Lebedeva IV, Su ZZ, Chang Y, Kitada S, Reed JC, Fisher PB. 2002. The cancer growth suppressing gene mda-7 induces apoptosis selectively in human melanoma cells. Oncogene 21(5):708-718.

Lebedeva IV, Sarkar D, Su ZZ, et al. Bcl-2 and Bcl-x(L) differentially protect human prostate cancer cells from induction of apoptosis by melanoma differentiation associated gene-7, mda-7/IL-24. Oncogene 2003; 22:8758-73. Lebedeva IV, Sauane M, Gopalkrishnan RV, Sarkar D, Su ZZ, Gupta

P, Nemunaitis J, Cunningham C, Yacoub A, Dent P, Fisher PB. 2005. mda-7/IL-24: exploiting cancer's Achilles' heel. MoI Ther 11(1):4-18.

Legendre JY, Szoka FC Jr. Delivery of plasmid DNA into mammalian cell lines using pH-sensitive liposomes: comparison with cationic liposomes. Pharm Res. 1992 Oct;9(10): 1235-42.

Li Q, Kay MA, Finegold M, Stratford-Perricaudet LD, Woo SL. Assessment of recombinant adenoviral vectors for hepatic gene therapy. Hum Gene Ther. 1993 Aug;4(4):403-9.

Lin HY, Masso-Welch P, Di YP, Cai JW, Shen JW, Subjeck JR. The 170-kDa glucose-regulated stress protein is an endoplasmic reticulum protein that binds immunoglobulin. MoI Biol Cell 1993; 4:1109-19.

Lindquist S, Craig EA. The heat- shock proteins. Annu Rev Genet 1988; 22:631-77.

Loewen CJ, Roy A, Levine TP. A conserved ER targeting motif in three families of lipid binding proteins and in Opilp binds VAP. EMBO J. 2003 May l;22(9):2025-35.

Ma Y, Taylor S. A 15 -residue bifunctional element in D-AKAPl is required for both endoplasmic reticulum and mitochondrial targeting. J Biol Chem. 2002 JuI 26;277(30):27328-36.

MacAry PA, Javid B, Floto RA, et al. HSP70 peptide binding mutants separate antigen delivery from dendritic cell stimulation. Immunity 2004; 20:95-106.

Madireddi MT, Su ZZ, Young CS, Goldstein NI, Fisher PB. 2000. Mda-7, a novel melanoma differentiation associated gene with promise for cancer gene therapy. Adv Exp Med Biol 465:239-261.

Manjili MH, Park J, Facciponte JG, Subjeck JR. HSPl 10 induces ' 'danger signals' ' upon interaction with antigen presenting cells and mouse mammary carcinoma. Immunobiology 2005; 210: 295-303. Manjili MH, Park J, Facciponte JG, Wang X-Y, Subjeck JR.

Immunoadjuvant chaperone, GRP 170, induces "danger signals" upon interaction with dendritic cells. Immmunol Cell Biol 2006.

Mastrangeli A, Danel C, Rosenfeld MA, Stratford-Perricaudet L, Perricaudet M, Pavirani A, Lecocq JP, Crystal RG. Diversity of airway epithelial cell targets for in vivo recombinant adenovirus-mediated gene transfer. J Clin Invest. 1993 Jan;91(l):225-34.

McGrory WJ, Bautista DS, Graham FL. A simple technique for the rescue of early region I mutations into infectious human adenovirus type 5. Virology. 1988 Apr;163(2):614-7. McLellan AD, Brocker EB, Kampgen E. Dendritic cell activation by danger and antigen-specific T-cell signalling. Exp. Dermatol. 2000; 9: 313-22.

Mhashilkar AM, Schrock RD, Hindi M, Liao J, Sieger K, Kourouma F, Zou-Yang XH, Onishi E, Takh O, Vedvick TS, Fanger G, Stewart L, Watson GJ, Snary D, Fisher PB, Saeki T, Roth JA, Ramesh R, Chada S. 2001. Melanoma

differentiation associated gene-7 (mda-7): a novel anti-tumor gene for cancer gene therapy. MoI Med 7(4):271-282.

Miller AD, Rosman GJ. Improved retroviral vectors for gene transfer and expression. Biotechniques. 1989 Oct; 7(9):980-2, 984-6, 989-90. Miyahara R, Banerjee S, Kawano K, et al. Melanoma differentiation- associated gene-7 (mda- 7)/interleukin (IL)-24 induces anticancer immunity in a syngeneic murine model. Cancer Gene Ther 2006; 13:753-61.

Moroi Y, Mayhew M, Trcka J, et al. Induction of cellular immunity by immunization with novel hybrid peptides complexed to heat shock protein 70. Proc Natl Acad Sci U S A 2000; 97:3485-90.

Nicolau C, Legrand A, Grosse E. Liposomes as carriers for in vivo gene transfer and expression. Methods Enzymol. 1987;149:157-76.

Olsen JC. Gene transfer vectors derived from equine infectious anemia virus. Gene Ther. 1998 Nov;5(l l):1481-7. Park J, Easton DP, Chen X, MacDonald IJ, Wang XY, Subjeck JR.

The chaperoning properties of mouse grpl70, a member of the third family of hsp70 related proteins. Biochemistry 2003; 42:14893-902.

Park J, Facciponte JG, Chen X, et al. Chaperoning function of stress protein grpl70, a member of the hsp70 superfamily, is responsible for its immunoadjuvant activity. Cancer Res 2006; 66:1161-8.

Parsell DA, Taulien J, Lindquist S. The role of heatshock proteins in thermotolerance. Philos Trans R Soc Lond B Biol Sci 1993; 339:279-85; discussion 285-6.

Pelham HR. The retention signal for soluble proteins of the endoplasmic reticulum. Trends Biochem Sci. 1990 Dec;15(12):483-6.

Polo JM, Belli BA, Driver DA, Frolov I, Sherrill S, Hariharan MJ, Townsend K, Perri S, Mento SJ, Jolly DJ, Chang SM, Schlesinger S, Dubensky TW Jr. Stable alphavirus packaging cell lines for Sindbis virus and Semliki Forest virus- derived vectors. Proc Natl Acad Sci U S A. 1999 Apr 13;96(8):4598-603. Quantin B, Perricaudet LD, Tajbakhsh S, Mandel JL. Adenovirus as an expression vector in muscle cells in vivo. Proc Natl Acad Sci U S A. 1992 Apr l;89(7):2581-4.

Ragot T, Vincent N, Chafey P, Vigne E, Gilgenkrantz H, Couton D, Cartaud J, Briand P, Kaplan JC, Perricaudet M, et al. Efficient adenovirus-mediated

transfer of a human minidystrophin gene to skeletal muscle of mdx mice. Nature. 1993 Feb 18;361(6413):647-50.

Ramirez SR, Singh- Jasuja H, Warger T, et al. Glycoprotein 96- activated dendritic cells induce a CD8-biased T cell response. Cell Stress Chaperones 2005; 10:221-9.

Ren W, Strube R, Zhang X, Chen SY, Huang XF. Potent tumor- specific immunity induced by an in vivo heat shock protein-suicide gene -based tumor vaccine. Cancer Res 2004; 64:6645-51.

Rosenfeld MA, Siegfried W, Yoshimura K, Yoneyama K, Fukayama M, Stier LE, Paakkό PK, Gilardi P, Stratford-Perricaudet LD, Perricaudet M, et al. Adenovirus-mediated transfer of a recombinant alpha 1 -antitrypsin gene to the lung epithelium in vivo. Science. 1991 Apr 19;252(5004):431-4.

Rosenfeld MA, Yoshimura K, Trapnell BC, Yoneyama K, Rosenthal ER, Dalemans W, Fukayama M, Bargon J, Stier LE, Stratford-Perricaudet L, et al. In vivo transfer of the human cystic fibrosis transmembrane conductance regulator gene to the airway epithelium. Cell. 1992 Jan 10;68(l): 143-55.

Saeki T, Mhashilkar A, Chada S, Branch C, Roth JA, Ramesh R. 2000. Tumor-suppressive effects by adenovirus-mediated mda-7 gene transfer in non-small cell lung cancer cell in vitro. Gene Ther 7(23):2051-2057. Saeki T, Mhashilkar A, Swanson X, Zou-Yang XH, Sieger K, Kawabe

S, Branch CD, Zumstein L, Meyn RE, Roth JA, Chada S, Ramesh R. 2002. Inhibition of human lung cancer growth following adenovirus-mediated mda-7 gene expression in vivo. Oncogene 21(29):4558-4566.

Sarkar D, Su ZZ, Lebedeva IV, Sauane M, Gopalkrishnan RV, Dent P, Fisher PB. 2002a. mda-7 (IL-24): signaling and functional roles. Biotechniques Suppl:30-39.

Sarkar D, Su ZZ, Lebedeva IV, Sauane M, Gopalkrishnan RV, Valerie K, Dent P, Fisher PB. 2002b. mda-7 (IL-24) Mediates selective apoptosis in human melanoma cells by inducing the coordinated overexpression of the GADD family of genes by means of p38 MAPK. Proc Natl Acad Sci U S A 99(15): 10054-10059.

Sarkar D, Dent, P and Fisher, P. B. 2006. Melanoma Differentiation Associated Gene-7 (mda-7)/ Interleukin-24 (IL-24), mda-7/IL-24: Current perspectives on a unique member of the IL-10 family of cytokines. Anti-Inflammatory & Anti- Allergy Agents in Medicinal Chemistry 5: 259-274.

Sauane M, Gopalkrishnan RV, Sarkar D, Su ZZ, Lebedeva IV, Dent P, Pestka S, Fisher PB. 2003. MDA-7/IL-24: novel cancer growth suppressing and apoptosis inducing cytokine. Cytokine Growth Factor Rev 14(1):35-51.

Schaefer G, Venkataraman C, Schindler U. Cutting edge: FISP (IL-4- induced secreted protein), a novel cytokine-like molecule secreted by Th2 cells. Journal of Immunology 2001; 166:5859-63.

Schneider S, Feilen P, Cramer H, Hillgartner M, Brunnenmeier F, Zimmermann H, Weber MM, Zimmermann U. Beneficial effects of human serum albumin on stability and functionality of alginate microcapsules fabricated in different ways. J Microencapsul. 2003 Sep-Oct; 20(5):627-36

Spee P, Subjeck J, Neefjes J. Identification of novel peptide binding proteins in the endoplasmic reticulum: ERp72, calnexin, and grpl70. Biochemistry 1999; 38: 10559-66.

Stratford-Perricaudet LD, Levrero M, Chasse JF, Perricaudet M, Briand P. Evaluation of the transfer and expression in mice of an enzyme-encoding gene using a human adenovirus vector. Hum Gene Ther. 1990 Fall;l(3):241-56.

Strayer DS, Milano J. SV40 mediates stable gene transfer in vivo. Gene Ther. 1996 Jul;3(7):581-7.

Strbo N, Oizumi S, Sotosek-Tokmadzic V, Podack ER. Perform is required for innate and adaptive immunity induced by heat shock protein gp96. Immunity 2003; 18:381-90.

Su ZZ, Madireddi MT, Lin JJ, Young CS, Kitada S, Reed JC,

Goldstein NI, Fisher PB. 1998. The cancer growth suppressor gene mda-7 selectively induces apoptosis in human breast cancer cells and inhibits tumor growth in nude mice. Proc Natl Acad Sci U S A 95(24): 14400-14405.

Su Z, Lebedeva IV, Gopalkrishnan RV, Goldstein NI, Stein CA, Reed JC, Dent P, Fisher PB. 2001. A combinatorial approach for selectively inducing programmed cell death in human pancreatic cancer cells. Proc Natl Acad Sci U S A 98(18):10332-10337. Su Z, Emdad L, Sauane M, et al. Unique aspects of mda-7/IL-24 antitumor bystander activity: establishing a role for secretion of MDA-7/IL-24 protein by normal cells. Oncogene 2005; 24:7552-66.

Sutter G, Moss B. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc Natl Acad Sci U S A. 1992 Nov 15;89(22): 10847-51.

Tong AW, Nemunaitis J, Su D, Zhang Y, Cunningham C, Senzer N, Netto G, Rich D, Mhashilkar A, Parker K, Coffee K, Ramesh R, Ekmekcioglu S, Grimm EA, van Wart Hood J, Merritt J, Chada S. 2005. Intratumoral injection of INGN 241, a nonreplicating adenovector expressing the melanoma-differentiation associated gene-7 (mda-7/IL24): biologic outcome in advanced cancer patients. MoI Ther l l(l):160-172.

Tyson JR, Stirling CJ. LHSl and SILl provide a lumenal function that is essential for protein translocation into the endoplasmic reticulum. EMBO J 2000; 19:6440-52. Vabulas RM, Braedel S, HiIfN et al. The endoplasmic reticulumresident heat shock protein Gp96 activates dendritic cells via the Toll-like receptor 2/4 pathway. J. Biol. Chem. 2002; 277: 20 847-53.

Volkert FC, Young CS. The genetic analysis of recombination using adenovirus overlapping terminal DNA fragments. Virology. 1983 Feb;125(l):175-93. Walsh CE, Liu JM, Xiao X, Young NS, Nienhuis AW, Samulski RJ.

Regulated high level expression of a human gamma-globin gene introduced into erythroid cells by an adeno-associated virus vector. Proc Natl Acad Sci U S A. 1992 Aug 1;89(15):7257-61.

Wan T, Zhou X, Chen G, et al. Novel heat shock protein Hsp70Ll activates dendritic cells and acts as a ThI polarizing adjuvant. Blood 2004; 103:1747- 54.

Wang Q, Konan V, Taylor MW. Expression of the APRT gene in an adenovirus vector system as a model for studying gene therapy. Adv Exp Med Biol. 1991;309B:61-6. Wang XY, Kazim L, Repasky EA, Subjeck JR. Characterization of heat shock protein 110 and glucose-regulated protein 170 as cancer vaccines and the effect of fever-range hyperthermia on vaccine activity. J Immunol 2001; 166:490-7.

Wang Y, Kelly CG, Singh M, et al. Stimulation of ThI -polarizing cytokines, C-C chemokines, maturation of dendritic cells, and adjuvant function by the peptide binding fragment of heat shock protein 70. J Immunol 2002; 169:2422-9.

Wang XY, Kazim L, Repasky EA, Subjeck JR. Immunization with tumor-derived ER chaperone grpl70 elicits tumor-specific CD8+ T-cell responses and reduces pulmonary metastatic disease. Int J Cancer 2003; 105:226-31.

Wang XY, Arnouk H, Chen X, Kazim L, Repasky EA, Subjeck JR. Extracellular targeting of endoplasmic reticulum chaperone glucose-regulated protein 170 enhances tumor immunity to a poorly immunogenic melanoma. J Immunol 2006a; 177:1543-51. Wang XY, Facciponte JG, Subjeck JR. Molecular chaperones and cancer immunotherapy. Handb Exp Pharmacol 2006b: 305 -29.

Wolff JA, Malone RW, Williams P, Chong W, Acsadi G, Jani A, Feigner PL.Direct gene transfer into mouse muscle in vivo. Science. 1990 Mar 23;247(4949 Pt I): 1465-8. Wu GY, Wu CH. Delivery systems for gene therapy. Biotherapy.

1991;3(l):87-95.

Yu LG, Andrews N, Weldon M, Gerasimenko OV, Campbell BJ, Singh R, Grierson I, Petersen OH, Rhodes JM. An N-terminal truncated form of Orpl50 is a cytoplasmic ligand for the anti-pro liferative mushroom Agaricus bisporus lectin and is required for nuclear localization sequence-dependent nuclear protein import. J Biol Chem. 2002 JuI 5;277(27):24538-45.

Zeng Y, Feng H, Graner MW, Katsanis E. Tumour-derived, chaperone-rich cell lysate activates dendritic cells and elicits potent antitumor immunity. Blood 2003; 101 : 4485-91. Zhang WW. Development and application of adenoviral vectors for gene therapy of cancer. Cancer Gene Ther. 1999 Mar-Apr;6(2):l 13-38.

Zheng H, Dai J, Stoilova D, Li Z. Cell surface targeting of heat shock protein gp96 induces dendritic cell maturation and antitumor immunity. J. Immunol. 2001; 167: 6731-5. Zisch AH, Lutolf MP, Hubbell JA. Biopolymeric delivery matrices for angiogenic growth factors. Cardiovasc Pathol. 2003 Nov-Dec;12(6):295-310.

Various publications are cited herein, which are hereby incorporated by reference in their entireties.