INTRODUCTION

The present application is a continuation-m-part application of United States Patent application 08/653,653, filed May 24, 1996, which is a CIP of United States Patent application 08/440,740 filed on May 12, 1995 which is a contmuation-in-part application of United States Patent application 08/063,167 filed on May 17, 1993 now issued as U.S. Patent No. 5,514,788, which is a continuation-m-part of United States Patent application 08/007,997, filed January 21, 1993, which in turn is a continuation-m-part of United States Patent application 07/939,855, filed September 2, 1992, now abandoned, which is a continuation-m-part of U.S. Patent application 07/567,286, filed August 14, 1990, now abandoned.

United States Patent application 08/653,653 is also a contmuation-m-part of United States patent application 07/927,506 filed on November 19, 1992, which is a contmuation- m-part application of United States Patent application 07/568,366 filed on August 16, 1990.

FIELD OF THE INVENTION

This invention is directed to methods for inhibiting gene expression via interference with protein translation. The invention generally relates to the field of antisense inhibition of gene expression.

BACKGROUND OF THE INVENTION

Classical therapeutics have generally focused upon interactions with proteins in efforts to moderate their disease-causing or disease-potentiating functions. Such therapeutic approaches have many limitations. Recently, antisense therapeutic and diagnostic approaches have been demonstrated to be safe and effective.

Antisense methodology is the complementary hybridization of relatively short oligomers, usually oligonucleotides or oligonucleosides, to mRNA or DNA, such that the normal, essential functions of these target nucleic acids are disrupted. Hybridization is the sequence specific hydrogen bonding of nucleobases on the oligomer to RNA or single stranded DNA according to the rules of Watson-Crick base pairing. Members of such base pairs are said to be complementary to one another.

Considerable research is being directed to the application of oligonucleotides and other oligomers as antisense agents for therapeutic purposes. Oligonucleotides have already been employed as therapeutic moieties in the treatment of disease states in animals and man. Antisense oligomer compositions have been shown to be capable of modulating expression of genes implicated in viral, fungal and metabolic diseases. Further, antisense oligonucleotides have been safely administered to humans and clinical trials of a dozen or more antisense drugs, targeted to viral and cellular gene products, have been initiated. Clinical efficacy has been demonstrated in several human trials, for both viral and cellular disease targets.

The present invention provides new antisense compounds and compositions together with methodologies for the use of certain antisense compounds for interfering with translation of selected mRNA targets.

Most antisense approaches utilize antisense oligonucleotides targeted to the AUG, or, less often, the 5'- untranslated region, 5' cap, 3 ' -untranslated region, coding or other regions of mRNA. Helene and Toulme, Biochem . et Biophyε .

Acta 1990, 1049, 99-125. It is also known to use antisense

oligonucleotides which target the 5' cap of mRNA to interfere with mRNA function by equipping the oligonucleotides with cleaving moieties, as disclosed in PCT publication WO 91/17755 (Baker) and PCT publication WO 96/06621 (Adams and Reynolds) , or by interfering with capping of nascent mRNA, as disclosed in PCT publication WO 94/22488 (Baker) .

A number of antisense oligonucleotides have been found to elicit RNAse H activity. RNAse H is a cellular endonuclease that cleaves the RNA strand of RNA:DNA duplexes; activation of this enzyme therefore results in cleavage of the RNA target, and thus can greatly enhance the efficiency of antisense inhibition. Cleavage of the RNA target can be routinely demonstrated by gel electrophoresis or Northern blotting showing a decrease in target mRNA abundance, and/or direct visualization of the cleavage products. Phosphorothioate oligodeoxynucleotides are substrates for RNAse H; however, some antisense oligomers, such as PNAs, oligonucleosides and oligonucleotides which are uniformly modified at the 2' position of the sugar, do not activate RNAse H. Kawasaki et al.,. J. Med Chem . 1993, 36, 831-841. Often a sequence which is highly active as a phosphorothioate oligodeoxynucleotide is inactive when made as an analog which is not a substrate for RNAse H. This may be true even if the affinity of the oligonucleotide for the target is increased by such a modification. Helene and Toulme, Biochem . et Biophys . Acta 1990, 1049, 109.

In the present invention, certain types of antisense oligomers which specifically hybridize to the 5' cap region of their target mRNA have been found to be surprisingly active in interfering with translation of the target mRNA into protein. These oligomers include peptide-nucleic acid (PNA) oligomers, oligonucleosides (such as those having an MMI , amide or morpholino backbone) and oligonucleotides having modifications at the 2' position of the sugar. These oligomers are believed to act in an RNAse H-independent fashion to inhibit translation of the target mRNA directly. This is believed to occur via interference with ribosome assembly on the target mRNA.

SUMMARY OF THE INVENTION

This invention provides methods for inhibiting the translation of a selected capped target mRNA by contacting the target mRNA with an antisense oligomer which is 8-25 bases in length and which is complementary to the 5' cap region of the target mRNA. The oligomer may be a 2 '-modified oligonucleotide, an oligonucleoside, or a peptide-nucleic acid oligomer. Preferred 2' modifications include 2' -OCH ₂ CH ₂ OCH ₃ , 2'-OCH ₃ , 2' -OCH ₂ CH ₂ CH _3/ 2' -OCH ₂ CH ₂ =CH ₂ and 2'-F modifications, with 2' -OCH ₂ CH ₂ OCH ₃ modifications being more preferred. Preferred oligonucleosides include those having morpholino, amide or MMI internucleoside linkages. Peptide-nucleic acid oligomers are also preferred.

In the present invention, certain types of antisense oligomers which specifically hybridize to the 5' cap region of their specific target mRNA have been found to be surprisingly active in interfering with translation of the target mRNA into protein. These oligomers include peptide-nucleic acid (PNA) oligomers, oligonucleosides (which have a non-phosphorous backbone such as an amide, morpholino or MMI backbone) and oligonucleotides having 2' -modifications. These oligomers are designed to be specifically hybridizable with the 5' cap region of the target mRNA.

BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 is a set of line graphs showing the reduction of ICAM-1 protein levels by 2' modified oligomers targeted to the 5' cap of ICAM-1. Figure 1A shows the activity of phosphodiester compounds; Figure IB shows the phosphorothioate compounds. Figure 2 is a bar graph of a Northern blot showing a significant increase in the relative abundance of the ICAM-1 transcript in cells treated with the anti-ICAM-1 oligonucleomers ISIS 11158 and 11159.

Figure 3 is a line graph showing the ability of 2' modified oligomers targeted to the 5' cap region of the E- selectin mRNA to inhibit E-selectin expression in HUVECs .

Figure 4 is a line graph showing inhibition of ICAM-1 expression in HUVECs by oligonucleotides targeting the 5' cap region of ICAM-1. Solid squares: ISIS 11158; Open diamonds: ISIS-13884; Closed circles; ISIS 13886. Figure 5 is a line graph showing inhibition of E-selectin expression in HUVECs by oligonucleotides targeting the 5' cap region of E-selectin. Open squares: ISIS 4764; Open diamonds: ISIS-11929; Open circles; ISIS 11205; Open triangles: ISIS 11928. Figure 6 is a line graph showing inhibition of VCAM-1 expression in HUVECs by oligonucleotides targeting the 5' cap region of VCAM-1. Open squares: ISIS-13181; Open diamonds: ISIS 13182; Open circles: ISIS 13183; Open triangles: ISIS 5885.

DETAILED DESCRIPTION OF THE INVENTION

It has been recognized that the majority of eukaryotic and viral RNAs and messenger RNAs have a unique chemical structure at their 5' terminus which is required in varying degrees for their maturation, stability, and efficiency of translation. The general structural features are given in S. Cory and JM Adams, J. Mol . Biol . 1975, 99, 519-547. The cap is a guanosine residue which is methylated at the nitrogen 7 position. It is joined to the 5'-most transcribed nucleotide of the RNA via a triphosphate linkage between the 5' hydroxyl groups of each residue.

The antisense oligomers in accordance with this invention specifically hybridize with a capped target mRNA transcript at its 5' end. Preferably, the oligomers will bind to a region including at least one of the first 20 nucleotides at the 5' end of the target mRNA, where the first nucleotide is adjacent to the 5' cap and connected to the methylated guanosine of the cap via the triphosphate linkage described supra . More preferably, the oligomers will bind to a region including at least one of the first five nucleotides at the 5' end of the target mRNA. The oligomers of the present invention preferably are from about 5 to about 50 bases in length. Oligomers from

about 8 to 25 bases in length are more preferred.

In the context of this invention, the term "oligomer" is intended to encompass oligonucleotides, oligonucleotide analogs, oligonucleosides or oligonucleotide-mimickmg macro- molecules, all of which have heterocyclic bases (nucleobases) positioned thereon which are capable of specifically hybridizing to a complementary base sequence. This term includes oligomers consisting of naturally occurring bases, sugars and mtersugar (backbone) linkages, as well as oligomers having non-naturally occurring portions which function similarly. Such modified or substituted oligomers are often preferred over native forms because of properties such as, for example, enhanced cellular uptake, increased stability in the presence of nucleases and/or increased affinity for a complementary target sequence. Affinity of an oligomer for its target is routinely determined by measuring the Tm of an oligomer/target pair, which is the temperature at which the oligomer and target dissociate; dissociation is detected spectrophotometrically. The higher the Tm, the greater the affinity of the oligomer for the target.

Specific examples of some preferred oligomers envisioned for this invention are oligonucleosides, which contain non- phosphorus mtersugar linkages, for example short chain heteroatomic or heterocyclic mtersugar linkages. Most preferred are those with CH ₂ -NH-0-CH ₂ , CH ₂ -N(CH ₃ ) -0-CH ₂ [known as the methylene (methylimmo) or MMI backbone] , CH ₂ -0-N(CH ₃ ) -CH ₂ , CH ₂ -N(CH ₃ ) -N(CH ₃ ) -CH ₂ and 0-N(CH ₃ ) -CH ₂ -CH ₂ backbones (where phosphodiester is 0-P-0-CH ₂ ) . These and other preferred backbones are disclosed in WO92/20823 and U.S. Patent 5,378,825, both of which are coassigned to the assignee of the present invention and are incorporated herein in their entirety. Other preferred nitrogen-containing backbones are the amide backbones of De Mesmaeker et al . , Ace . Chem . Res . 1995, 28, 366-374. Of these, CH _? -CO-NR-CH ₂ , also called amide- 3, and CH ₂ -NH-CO-CH ₂ , also called amιde-4, are more preferred. Also preferred are oligomers having morpholino backbone structures (Summerton, J.E. and Weller, D.D., U.S. Patent

5,034,506) . In other preferred embodiments, such as the peptide-nucleic acid (PNA) backbone, the phosphodiester backbone of a native oligonucleotide may be replaced with a polyamide backbone, the bases being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone (P.E. Nielsen, M. Egholm, R.H. Berg, 0. Buchardt, Science 1991, 254, 1497) .

Combinations of the native phosphodiester (P=0) backbone and/or modified backbones may be used. Alternating P=0/MMI or P=S/MMI backbones are two presently preferred embodiments.

Other preferred oligomers are oligonucleotides having modifications on one or more sugar moieties, preferably at the 2' position. Some examples of suitable 2' modifications are C _x to C ₁₀ lower alkyl, substituted lower alkyl, alkoxyalkoxy, alkaryl or aralkyl; F; Cl; Br; CN; CF ₃ ; OCF ₃ ; 0-, S-, or N- alkyl; SH, SCH ₃ , OCN, alkylamines such as 0(CH ₂ ) _n NH ₂ where n is from 1 to about 10; 0(CH ₂ ) _n CH ₃ where n is from 1 to about 10; or other groups which improve the pharmacokinetic or pharmacodynamic properties of the oligomer or the affinity of the. oligomer for its target, or which stabilize the oligomer. Presently, more preferred oligomers include MMI and morpholino oligonucleosides, PNAs, 2'-F, 2'-0-alkyl, preferably 2'-0-CH ₃ and 2' -0-CH ₂ CH ₂ CH ₃ , and 2 ' -alkoxyalkoxy oligonucleotides, most preferably, 2 ' -0CH ₂ CH ₂ 0CH ₃ [also known as 2' -0- (2-methoxyethyl) or 2' -methoxyethoxy] . It is not necessary that the oligomer be uniformly modified in the aforementioned way(s) .

Oligomers with at least one modified nucleobase are also comprehended by the invention.

Many of the oligomers used in accordance with this invention may be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including Applied Biosystems. Any other means for solid or liquid phase synthesis may also be employed; synthesis of the oligomers is well within the talents of the routineer. It is well known to use these techniques to prepare 2'-modified oligonucleotides, backbone-modified oligomers and other oligomers.

In the methods of the invention, a capped target mRNA is contacted with an oligomer. In the context of this invention, a "target" mRNA is the mRNA whose translation is to be specifically inhibited through antisense interaction. The antisense oligomers of the invention are designed to be specifically hybridizable with a complementary nucleotide sequence on their mRNA target. The term "target" or "target region" also encompasses this sequence of the mRNA, i.e., the particular region to which the antisense oligomer is complementary. In the context of this invention, to "contact" a target rnRNA with an oligomer means to add the oligomer, either in vi tro or ex vivo, to a cell suspension or tissue sample containing or suspected of containing said target mRNA, or to administer the oligomer to cells or tissues within an animal which contain or are suspected to contain the target mRNA. The oligomer is usually in a liquid carrier or part of a pharmaceutical composition which may contain additional ingredients in addition to carrier.

"Hybridization", in the context of this invention, means hydrogen bonding, also known as Watson-Crick base pairing, between complementary nucleobases. Guanine and cytosme are examples of complementary bases which are known to form three hydrogen bonds between them. Adenine and thymme are examples of complementary bases which form two hydrogen bonds between them. Triple-strand formation, or triplexmg, is a particular form of hybridization of an oligomer to a double-stranded region of the target, such as a hairpin region on an RNA molecule. "Specifically hybridizable" and "complementary" are terms which are used to indicate a sufficient degree of complementarity such that stable and specific binding occurs between the RNA target and the oligomer. It is understood that an oligomer need not be 100% complementary to its target nucleic acid sequence to be specifically hybridizable. An oligomer is specifically hybridizable when binding of the oligomer to the target interferes with the normal function of the target molecule to cause a loss of utility, and there is a sufficient degree of complementarity to avoid non-specific

binding of the oligomer to non-target sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, or, in the case of in vi tro assays, under conditions in which the assays are conducted.

The oligomers of the invention are designed to be specifically hybridizable with the 5' cap region of a capped target mRNA. As herein defined, "5' cap region" refers to the region of said target mRNA which includes at least one of the first 20 bases at the 5' terminus of said target mRNA. In other words, at least one of nucleotides 1-20 where nucleotide number 1 is adjacent to the cap structure.

The following are instances in which the methods and compositions of the present invention have been used effectively. The present invention is not limited to these targets or these compositions. ICAM-1

A number of oligomers which target the human intercellular adhesion molecule-1 (ICAM-1) mRNA transcript have been evaluated for activity at reducing ICAM-1 expression in human vascular endothelial cells. ICAM-1 is one of several cell adhesion molecules expressed on the surface of vascular endothelium and participates in a variety of immune and inflammatory responses. ICAM-1 is also expressed on non- endothelial cells in response to inflammatory mediators. Elevated levels of ICAM-1 expression have been observed in a number of disease states such as rheumatoid arthritis and psoriasis, and ICAM-1 has become a target of therapeutic interest. Clinical trials are presently underway for an antisense oligonucleotide that inhibits the expression of human

ICAM-1, in patients with a variety of disease conditions: rheumatoid arthritis, ulcerative colitis, Crohn's disease, psoriasis and prevention of renal transplant rejection. Efficacy has already been demonstrated in a Phase II trial of this drug, ISIS 2302, in Crohn's disease. Genetic Engineering News, March 1, 1997, pg. 1; New York Times, Friday, February 28, 1997.

It has now been found that RNAse H activity is not necessary for good antisense activity when antisense oligomers are targeted to the 5' cap region of the ICAM-1 transcript. Surprisingly, oligomers which do not activate RNAse H, or at least are RNAse H-independent, have been found to be surprisingly active when targeted to this region. Data were obtained for fully 2'-modified oligomers which are not substrates for RNAse H. The target region was nucleotides 1-20 (where nucleotide 1 is immediately adjacent to the cap structure) of the ICAM-1 transcript. A dose response analysis of nine different oligomers was performed to determine their efficacy for inhibition of ICAM-1 cell surface protein expression in comparison to a phosphorothioate deoxyoligonucleotide, ISIS 3067 (SEQ ID NO: 1; TCTGAGTAGCAGAGGAGCTC) , targeted to the same region. This compound had previously been shown to be very effective at inhibition of ICAM-1 expression. WO 92/03139 (Bennett et al . ) , J. Immunol . (1994) 152:3530-3540.

The oligomers studied were 2' -methoxy (also referred to as 2 ' -O-methyl) , 2 ' -propoxy (also referred to as 2 ' -0-propyl) , 2'-

O-allyl, 2' -methoxyethoxy and 2'-fluoro analogs of this sequence with either a phosphorothioate (P=S) or phosphodiester

(P=0) backbone. These compounds, listed in Table 1, were tested for their ability to reduce ICAM-1 protein levels in HUVEC cells. All compounds in Table 1 have the same sequence, SEQ ID NO: 1.

TABLE 1

ISIS # 2' modification Backbone

3061 Deoxy (-H) Phosphodiester (P=0)

3214 Methoxy (-OCH ₃ ) " " 7081 Propoxy (-OCH ₂ CH ₂ CH ₃ )

11158 Methoxyethoxy (-OCH ₂ OCH ₂ CH ₃ )

12461 Allyl (-OCH _? CH ₂ =CH ₂ ) " " 3067 Deoxy (-H) Phosphorothioate (P=S) 3224 Methoxy (-OCH ₃ ) " ^» 11665 Fluoro (-F) " "

11159 Methoxyethoxy (OCH ₂ OCH ₂ CH ₃ )

12462 Al lyl ( -OCH ₂ CH ₂ =CH ₂ )

In the phosphodiester series (Figure 1A) , the 2' -methoxyethoxy (ISIS 11158) was most potent, and the least potent was the 2'- O-allyl (ISIS 12461) . In the phosphorothioate series (Figure IB) the most potent oligomer was again the 2' -methoxyethoxy analog (ISIS 11159) and the least potent was the 2' -deoxy, ISIS 3067, which was included for comparative purposes. Scrambled controls were ISIS 10588 (P=S deoxy) , ISIS 12344 (P=0, 2'- methoxyethoxy) and ISIS 12345 (P=S, 2 ' -methoxyethoxy) .

IC50's (concentration required for 50% inhibition of ICAM- 1 levels) were calculated for some of these compounds. ISIS 3067 (P=S, deoxy) was found to have an IC50 of approximately 20 nM. Of the 2' -modified compounds, ISIS 3224 (P=S, 2' -methoxy) had an IC50 of approximately 24 nM, ISIS 11665 (P=S, 2'-F) had an IC50 of approximately 10 nM and ISIS 11159, (P=S, 2'- methoxyethoxy) had an IC50 of approximately 3 nM. These compounds are preferred. The phosphodiester 2' -methoxyethoxy compound, ISIS 11158, had an IC50 of approximately 9 nM. This compound is also preferred.

Total cellular RNA was isolated from oligomer-treated HUVECs and analyzed to determine if inhibition of ICAM-1 protein expression resulted from antisense-promoted degradation of the target transcript. Surprisingly, Northern blot analysis showed a significant increase in the relative abundance of the ICAM-1 transcript in cells treated with the anti-ICAM-1

oligonucleotides (ISIS 11158 and 11159) . This is shown in Figure 2. ICAM-1 protein expression was completely inhibited at these oligonucleotide concentrations.

ISIS 11929 is an antisense oligonucleotide targeted to E- selectin, another cellular adhesion molecule, and was included in this experiment as a control. Treatment of cells with ISIS

11929 did not cause an increase in ICAM-1 mRNA levels, but did cause an increase m E-selectin mRNA levels.

Polysome profiles were utilized to determine the effect of antisense oligonucleotide treatment upon translation of the target ICAM-1 transcript. ICAM-1 protein and mRNA levels were measured after treatment with ISIS 11159 or ISIS 12345

(control) . Cell surface expression of ICAM-1 protein was determined by FACS analysis of a small portion of treated cells; ISIS 11159 was found to reduce ICAM-1 levels by 84% compared to untreated controls. The scrambled control oligomer ISIS 12345 reduced ICAM expression by only 3%. Cytosolic extracts of the remaining cells were prepared and sedimented by sucrose gradient centrifugation. Gradients were fractionated, RNA was isolated from each fraction and analyzed on a 1% denaturing agarose gel to demonstrate acceptable separation of the subpolysomal and polysomal pools. Determination of the distribution of the ICAM-1 transcript by northern blotting showed a significant difference in the polysome profile for ISIS 11159 treated cells compared to cells treated with the control oligomer ISIS 12345 or untreated control cells. The ISIS 11159 showed the majority (67%) of the full-length ICAM-1 transcript localized in the subpolysome fraction (40S, 60S and 80S ribosome fractions) whereas the control ISIS 12345-treated and untreated cells showed the maηonty (73% and 69% respectively) of the full length ICAM-1 transcript in the polysome fractions. This demonstrates that ISIS 11159 is interfering with translation directly, by interfering with ribosome assembly onto the target mRNA. Peptide-nucleic acid (PNA) oligomers targeted to the 5' cap have also been shown to inhibit ICAM-1 expression. A PNA oligomer, ISIS 10535 (SEQ ID NO: 2), was synthesized, which is

a shortened version of SEQ ID NO: 1 made as a PNA, with three arginines added at the 5' end and one lysine added at the 3' end. This oligomer was electroporated into U937 cells and a potent dose-response was obtained. ICAM-1 was reduced to below baseline levels at higher doses of ISIS 10535. Under these electroporation conditions, ISIS 10535 had an IC50 of less than 5 μM and ISIS 3067 had an IC50 of over 20 μM. Therefore, ISIS 10535 is preferred. E-selectin Other adhesion molecules have been identified which are involved in the adherence of white blood cells to vascular endothelium and subsequent migration out of the vasculature. One of these is E-selectin, also known as endothelial leukocyte adhesion molecule-1 (ELAM-1) . A series of 2'-fluoro phosphorothioate oligonucleotides targeted to human E-selectin were synthesized and tested for ability to inhibit E-selectin protein expression. Of over 30 oligonucleotide sequences complementary to various regions of the E-selectin message (5' cap, 5' UTR, AUG, coding region, intron, 3' UTR) , by far the most active was ISIS 9984 (SEQ ID NO: 3; GAAGTCAGCCAAGAACAGCT) , targeted to the 5' cap region (nucleotides 1-20) of the human E-selectin mRNA.

Analogs of this sequence were synthesized with 2 '-deoxy, 2 '-propoxy, or 2' -methoxyethoxy modifications . These compounds were tested for their ability to inhibit E-selectin expression in HUVECs. As shown in Figure 3, in this experiment the deoxy phosphorothioate compound, ISIS 4764, had an IC50 of less than 10 nM. The 2'F phosphorothioate analog, ISIS 9984, and the 2'- methoxyethoxy phosphodiester analog, ISIS 11929, both had IC50s well below this and these two compounds are preferred. Human cytomegalovirus (HCMV)

The human CMV genome is the most complex of the herpes viruses in terms of its genomic structure. Replication- defective mutants of human CMV have only been isolated for two viral genes, the immediate early complex (IE1/IE2) and the DNA polyτnerase. These genes are known to play major roles in human CMV gene expression. They have been selected as primary

targets for antisense compound design.

The molecular biology of immediate early transcription m

CMV has been as well elucidated as that of any transcriptional unit in the eucaryotic cell. Briefly, synthesis of the major immediate early transcript (IE1) is controlled by a number of transcriptional response molecules known to operate m cell- specific and differentiation specific manners. The IE1/IE2 mRNA is an abundant capped RNA which encodes both IE1 and IE2 proteins, by differential splicing of the mRNA. IE1 controls the expression of itself as well as that of the IE2 gene product. At the initial phase of immediate early transcription, only IE1 mRNA is synthesized by the cellular RNA polyτnerase . IE2 mRNA is made by processing of the IE1 mRNA during this early time of infection. The IE2 protein is capable of transcriptionally activating many of the CMV early and late genes in a manner similar to other known transactivatmg proteins of cellular and viral origin. Thus, the IE2 protein is believed to be one of the master switches for CMV gene expression. An antisense drug targeted to CMV IE2 mRNA, is presently in clinical trials and has been shown to be active against CMV retmitis m AIDS patients.

The sequence of the CMV IE1/IE2 mRNA transcript is known (Stenberg, R.M., Witte, P.R. and Stmski, M.F., J. Virol . 1985, 56, 665-675; Stenberg, R.M. , Thomsen, D.R., and Stmski, M.F., J. Virol . 1984, 49: 190-199) . The 5' end of the mRNA is now known to terminate with a "G" (oligonucleotides 1-21 are shown) :

CMV IE1/IE2 mRNA 5' end 5' pppGUCAGAUCGCCUGGAGACGCC SEQ ID NO: 4 Dose-response experiments were done to identify active antisense compounds for inhibition of CMV replication. ISIS 3300, a phosphorothioate oligonucleotide which is fully 2'- methoxy, was found to be active. This compound (SEQ ID NO: 5: TGGCGTCTCCAGGCGATCTGA) is complementary to the 5' cap region (nucleotides 2-22) of the IE1/IE2 transcript and is preferred. Analogs of SEQ ID NO: 5 were also tested for activity against CMV. The modifications, and IC ₅₀ s for these oligomers, along

with parallel controls, are shown in Table 2:

TABLE 2

2' modifications of oligonucleotides targeted to the 5' cap of human CMV IE mRNA (SEQ ID NO: 5)

ISIS# CHEMICAL MODIFICATION IC ₅₀ (μM)

3246 P=S, deoxy 0.7

3300 P=S, uniform 2'-0-methyl 0.3

3300 P=S, uniform 2 ' -O-methyl 0.2

4155 P=S, uniform 2'-0-propyl 0.2 4952 P=0, uniform 2'-fluoro >4.0

4979 P=S, uniform 2'-fluoro 0.6

3904 neg. control: P=S, uniform 2 '-O-methyl 3.0

2922 pos. control: P=S 0.2

Oligonucleotides having IC50s of 1 μM or below in Table 2 are preferred.

Oligonucleotides were directly tested for ability to inhibit expression of IE1 and IE2 protein products in stably transfected U373 neuroblastoma cells expressing a single CMV protein. IE1 is translated into a 72kD polypeptide product. IE2 is differentially spliced into two polypeptide products, a 55kD product and an 86 kD product.

A series of phosphorothioate 2 ' -methoxy modified oligonucleotides were tested for their ability to inhibit the 55kD IE2 product. Oligonucleotides (75 nM, 5 μg/ml lipofectin) targeted to the 5' cap region were found to be more active than oligonucleotides targeted elsewhere on the mRNA. ISIS 3300, targeted to nucleotides 2-22 of IE1/IE2 mRNA, inhibited synthesis of the 55 kD product by over 50% at this concentration. ISIS 6871 (GGCGTCTCCAGGCGATCTGAC, SEQ ID NO: 6) , targeted to nucleotides 1-21, inhibited synthesis of this product by over 65%. ISIS 12659 (GGCGTCTCCAGGCGATCTGA, SEQ ID

NO: 7) , targeted to nucleotides 2-21 of the mRNA, inhibited

55kD levels by approximately 90% and ISIS 12660

(TGGATGGCGTCTCCAGGCGA, SEQ ID NO: 8) , targeted to nucleotides 7-26, inhibited 55kD synthesis by over 75%.

In stable transfectants expressing the 72kD IE1 protein

product, ISIS 3300 (SEQ ID NO: 5) was found to inhibit expression of the 72kD protein with an IC50 of approximately 75 nM. The methoxyethoxy analog of this oligomer, ISIS 11938, had an IC50 of approximately 25 nM. Thus antisense oligomers targeting the 5' terminus of the CMV IE1/IE2 mRNA can effectively inhibit synthesis of multiple protein products of this transcript. Additional oligomers targeted to ICAM-1

Additional oligomers targeted to the 5' cap region of human ICAM-1 have been designed and tested for the ability to reduce ICAM-1 expression. These oligomers are shown in Table 3. Target regions are given as nucleotide numbers on the target ICAM-1 mRNA, where nucleotide 1 (n.t. 1) is immediately adjacent to the 5' cap. In these oligomers the nucleotide at the 3' end of the oligomer was a 2 ' -deoxynucleotide for ease of synthesis. Every cytosine residue which was not at the 3' terminus of an oligomer was a 5-methylcytosine residue. If the 3' terminal nucleoside was a cytosine, it was not 5-methylated. In the table, 2'MOE = 2' methoxyethoxy (2' -0-CH ₂ CH ₂ 0-CH ₃ . MMI = methylene (methylimino) backbone.

Table 3 Oligomers targeted to the 5' cap region of ICAM-1

10

The oligomers shown in Table 3 were tested for their ability to inhibit human ICAM-1 protein expression in human umbilical vein endothelial cells (HUVECs) as described in

Example 7 except that the human ICAM-1 monoclonal antibody mAb84H10 (AMAC Inc., Westbrook ME) was used. Bennett et al.

(1990) J. Immunol . 152:3530-3540.

When the phosphodiester/2 ' -methoxyethoxy (PO/2'MOE) oligomers ISIS 13884 and 13886 were tested in this assay, ISIS 13884 was found to have an IC50 of approximately 40 nM. ISIS 13886 was tested only up to concentrations of 50 nM and an IC50 was not obtained at this low dose. However, extrapolation of the dose-response curve gave an estimated IC50 of approximately 60 nM. This is shown in Figure 4. Both ISIS 13884 and 13886 are preferred embodiments of the present invention. For comparison, the phosphodiester 2' -methoxyethoxy compound, ISIS 11158, targeted to the extreme 5' end of the ICAM-1 message, had an IC50 of approximately 5 nM in the same experiment.

ISIS 14289-14292 are oligomers with alternating MMI/P=0 backbones. ISIS 14289 (SEQ ID NO: 1) is a 20mer and ISIS 14290, 14291 and 14292 are progressively shortened versions of this sequence. ISIS 14293-14296 are corresponding oligomers with alternating MMI/P=S backbones. Antisense activity (IC50) of these oligomers was determined by measurement of cell surface expression of ICAM-1 protein following treatment with each oligomer at six concentrations in the range of 4 to 40 μM for delivery by electroporation into U937 cells, and 6.2 to 200 nM for delivery by Lipofectin into HUVECs. "N.A." indicates that an IC50 was not obtained in the given dose range. The results are shown in Table 4 :

Table 4 Antisense activity of MMI oligomers targeted to ICAM-1 5' cap

These results suggest that conditions for MMI oligomer uptake have not yet been optimized but that MMI oligomers are able to inhibit ICAM-1 expression. Based on this preliminary data, ISIS 14293, 14294 and 14295 are presently preferred, based on the IC50s obtained in the presence of LIPOFECTIN™. Additional oligomers targeted to E-selectin

Additional oligomers targeted to the 5' cap region of human E-selectin have been designed and tested for the ability to reduce E-selectin expression. These oligomers are shown in Table 5.

Table 5 Oligomers targeted to the 5' cap region of E-selectin

NJ

O

10

These oligomers were tested for the ability to reduce human E- selectin expression in HUVECs using the ELISA assay described in Example 7. In this assay, the phosphorothioate oligodeoxynucleotide ISIS 4764 demonstrated an IC50 of approximately 10 nM. In the same experiment, both 2'- methoxyethoxy oligonucleotides, ISIS 11929 and 11928, as well as the 2'-fluoro oligonucleotide, ISIS 11205, gave IC50s which were too low to measure, i.e., well below 3 nM. At an oligomer concentration of 50 nM these three compounds gave virtually 100% inhibition of E-selectin expression. This is shown in Figure 5. These compounds are therefore highly preferred. In an equivalent experiment, ISIS 4764 again demonstrated an IC50 of 10 nM. The P=S/2'O-methyl oligonucleotide ISIS 14043 also had an IC50 of 10 nM. The P=S/2 ' -0-propyl compound, ISIS 9218, demonstrated an IC50 of 25 nM and the scrambled control, ISIS 14044, was inactive. ISIS 11929, 11928, and 11205 again gave IC50s which were too low to measure, i.e., well below 3 nM. VCAM-1

Vascular cell adhesion molecule-1 (VCAM-1) , like ICAM-1, is a member of the immunoglobulin gene superfamily. Also like ICAM-1 and E-selectin, VCAM-1 is induced on the luminal surface of vascular endothelium in response to inflammatory stimuli.

A series of oligomers targeted to the 5' cap region of human VCAM-1 were designed and synthesized, using the VCAM-1 sequence published by Cybulsky et al . (1991) Proc . Natl . Acad. Sci . , USA, 88:7859-7863. These oligomers are shown in Table 7. In these oligomers the nucleotide at the 3' end of the oligomer was a 2' -deoxynucleotide for ease of synthesis.

Table 7 Oligomers targeted to the 5' cap region of VCAM-1

NJ NJ

These compounds were tested for the ability to inhibit VCAM-1 expression in HUVECs, using the ELISA assay described in Example 7 and a mouse anti-human VCAM-1 monoclonal antibody (Genzyme Corp, Cambridge MA) . Bennett et al . (1990) J. Immunol . 152:3530-3540. In this assay, ISIS 13181, 13182 and 13183 all displayed IC50s below 10 nM and are therefore highly preferred. The phosphorothioate oligodeoxynucleotide, ISIS 5884 displayed an IC50 of approximately 10-12 nM. This is shown in Figure 6. In a subsequent experiment, these compounds were tested again and ISIS 14040 and 14041 were also tested. Again, all compounds had IC50s below approximately 10 nM and ISIS 14040 and 14041 are therefore also highly preferred. All six compounds tested gave greater than about 85% inhibition of VCAM-1 expression at the highest dose tested, which was 100 nM. ISIS 13181 consistently caused 100% inhibition of VCAM-1 expression at this dose.

While the present invention has been described with specificity in accordance with certain of its preferred embodiments, the following examples serve only to illustrate the invention and are not intended to limit the same.

EXAMPLES

Example 1: Oligonucleotide synthesis

Unmodified oligodeoxynucleotides are synthesized on an automated DNA synthesizer (Applied Biosystems model 380B) using standard phosphoramidite chemistry with oxidation by iodine, (β-cyanoethyldiisopropyl-phosphoramidites are purchased from Applied Biosystems (Foster City, CA) . For phosphorothioate oligonucleotides, the standard oxidation bottle is replaced by a 0.2 M solution of ³ H-1, 2-benzodithiole-3-one 1,1-dioxide in acetonitrile for the stepwise thiation of the phosphite linkages. The thiation cycle wait step is increased to 68 seconds and is followed by the capping step.

2'-methoxy oligonucleotides are synthesized using 2'- methoxy _/ β-cyanoethyldiisopropyl-phosphoramidites (Chemgenes, Needham MA) and the standard cycle for unmodified oligonucleotides, except the wait step after pulse delivery of tetrazole and base is increased to 360 seconds. Other 2'-

- -

alkoxy oligonucleotides are synthesized by a modification of this method, using appropriate 2'-modified amidites such as those available from Glen Research, Inc., Sterling, VA.

2' -fluoro oligonucleotides are synthesized as described in Kawasaki et al . , J. Med. Chem . 1993, 36, 831-841. Briefly, the protected nucleoside N ⁶ -benzoyl-2' -deoxy-2' -fluoroadenosme was synthesized utilizing commercially available 9-β-D- arabmofuranosyladenine as starting material and by modifying literature procedures whereby the 2'-α-fluoro atom is introduced by a S _N 2-displacement of a 2' -β-0-tπfyl group.

Thus N ⁶ -benzoyl-9-β-D-arabιnofuranosyladenιne was selectively protected in moderate yield as the 3 ' , 5' -ditetrahydropyranyl

(THP) intermediate. Deprotection of the THP and N ⁶ -benzoyl groups by was accomplished using standard methodologies and standard methods were used to obtain the 5' -dimethoxytrityl-

(DMT) and 5' -DMT-3 ' -phosphoramidite intermediates.

The synthesis of 2' -deoxy-2' -fluoroguanosme was accomplished using tetraisopropyldisiloxanyl (TPDS) protected 9-β-D-arabιnofuranosylguanme as starting material, and c o n v e r s i o n t o t h e i n t e r m e d i a t e diisobutyrylarabmofuranosylguanosme. Deprotection of the TPDS group was followed by protection of the hydroxyl group with THP to give dnsobutyryl di-THP protected arabmofuranosylguanme. Selective O-deacylation and triflation was followed by treatment of the crude product with fluoride, then deprotection of the THP groups. Standard methodologies were used to obtain the 5' -DMT- and 5'-DMT-3'- phosphoramidites.

Synthesis of 2' -deoxy-2' -fluorouridme was accomplished by the modification of a literature procedure in which 2, 2'- anhydro-1-β-D-arabmofuranosyluracιl was treated with 70% hydrogen fluoride-pyπdme. Standard procedures were used to obtain the 5' -DMT and 5' -DMT-3'phosphoramidites.

2' -deoxy-2' -fluorocytidme was synthesized via ammation of 2 ' -deoxy-2 ' -fluorouridme, followed by selective protection to give N ⁴ -benzoyl-2' -deoxy-2 ' -fluorocytidme. Standard procedures were used to obtain the 5' -DMT and 5'-DMT-

3'phosphoramidites.

After cleavage from the controlled pore glass column

(Applied Biosystems) and deblocking in concentrated ammonium hydroxide at 55°C for 18 hours, the oligonucleotides are purified by precipitation twice out of 0.5 M NaCl with 2.5 volumes ethanol . 2'- (2-methoxyethyl) -modified amidites are synthesized according to Martin, P., Helv. Chim . Acta 1995, 78,486-504. For ease of synthesis, the last nucleotide was a deoxynucleotide. All 2' -0-CH ₂ CH ₂ OCH ₃ .cytosines were 5-methyl cytosines. Synthesis of 5 -Methyl cytosine monomers :

2,2' -Anhydro[l- (jS-D-arabinofuranosyl) -5-methyluridine] :

5-Methyluridine (ribosylthymine, commercially available through Yamasa, Choshi, Japan) (72.0 g, 0.279 M) , diphenyl- carbonate (90.0 g, 0.420 M) and sodium bicarbonate (2.0 g, 0.024 M) were added to DMF (300 mL) . The mixture was heated to reflux, with stirring, allowing the evolved carbon dioxide gas to be released in a controlled manner. After 1 hour, the slightly darkened solution was concentrated under reduced pressure. The resulting syrup was poured into diethylether (2.5 L) , with stirring. The product formed a gum. The ether was decanted and the residue was dissolved in a minimum amount of methanol (ca. 400 mL) . The solution was poured into fresh ether (2.5 L) to yield a stiff gum. The ether was decanted and the gum was dried in a vacuum oven (60°C at 1 mm Hg for 24 h) to give a solid which was crushed to a light tan powder (57 g, 85% crude yield) . The material was used as is for further reactions . 2' -O-Methoxyethyl-5-methyluridine:

2,2' -Anhydro-5-methyluridine (195 g, 0.81 M) , tris{2- methoxyethyDborate (231 g, 0.98 M) and 2-methoxyethanol (1.2 L) were added to a 2 L stainless steel pressure vessel and placed in a pre-heated oil bath at 160°C. After heating for 48 hours at 155-160°C, the vessel was opened and the solution evaporated to dryness and triturated with MeOH (200 mL) . The residue was suspended in hot acetone (1 L) . The insoluble salts were filtered, washed with acetone (150 mL) and the filtrate evaporated. The residue (280 g) was dissolved in CH ₃ CN (600 mL) and evaporated. A silica gel column (3 kg) was packed in CH ₂ Cl ₂ /acetone/MeOH (20:5:3) containing 0.5% Et ₃ NH.

-

The residue was dissolved in CH ₂ C1 ₂ (250 mL) and adsorbed onto silica (150 g) prior to loading onto the column. The product was eluted with the packing solvent to give 160 g (63%) of product . 2' -O-Methoxyethyl-5' -O-dimethoxytrityl-5-methyluridine:

2' -O-Methoxyethyl-5-methyluridine (160 g, 0.506 M) was co- evaporated with pyridine (250 mL) and the dried residue dissolved in pyridine (1.3 L) . A first aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the mixture stirred at room temperature for one hour. A second aliquot of dimethoxytrityl chloride (94.3 g, 0.278 M) was added and the reaction stirred for an additional one hour. Methanol (170 mL) was then added to stop the reaction. HPLC showed the presence of approximately 70% product. The solvent was evaporated and triturated with CH ₃ CN (200 mL) . The residue was dissolved in CHC1 ₃ (1.5 L) and extracted with 2x500 mL of saturated NaHC0 ₃ and 2x500 mL of saturated NaCl . The organic phase was dried over Na ₂ S0 ₄ , filtered and evaporated. 275 g of residue was obtained. The residue was purified on a 3.5 kg silica gel column, packed and eluted with EtOAc/Hexane/Acetone (5:5:1) containing 0.5% Et ₃ NH. The pure fractions were evaporated to give 164 g of product. Approximately 20 g additional was obtained from the impure fractions to give a total yield of 183 g (57%) . 3'-0-Acetyl-2' -0-methoxyethyl- 5 ' -O-dimethoxytrityl- 5- methyluridine:

2 ' -O-Methoxyethyl-5' -0-dimethoxytrityl-5-methyluridine

(106 g, 0.167 M) , DMF/pyridine (750 mL of a 3:1 mixture prepared from 562 mL of DMF and 188 mL of pyridine) and acetic anhydride (24.38 mL, C.258 M) were combined and stirred at room temperature for 24 hours. The reaction was monitored by tic by first quenching the tic sample with the addition of MeOH. Upon completion of the reaction, as judged by tic, MeOH (50 mL) was added and the mixture evaporated at 35°C. The residue was dissolved in CHC1 ₃ (800 mL) and extracted with 2x200 mL of saturated sodium bicarbonate and 2x200 mL of saturated NaCl .

The water layers were back extracted with 200 mL of CHC1 ₃ . The combined organics were dried with sodium sulfate and evaporated to give 122 g of residue (approx. 90% product) . The residue

was purified on a 3.5 kg silica gel column and eluted using EtOAc/Hexane (4 : 1) . Pure product fractions were evaporated to yield 96 g (84%) .

3' -O-Acetyl-2' -0-methoxyethyl-5' -0-dimethoxytrityl-5-methyl-4- triazoleuridine:

A first solution was prepared by dissolving 3'-0-acetyl- 2' -0-methoxyethyl-5' -O-dimethoxytrityl-5-methyluridine (96 g, 0.144 M) in CH ₃ CN (700 mL) and set aside. Triethylamine (189 mL, 1.44 M) was added to a solution of triazole (90 g, 1.3 M) in CH ₃ CN (1 L) , cooled to -5°C and stirred for 0.5 h using an overhead stirrer. POCl ₃ was added dropwise, over a 30 minute period, to the stirred solution maintained at 0-10°C, and the resulting mixture stirred for an additional 2 hours. The first solution was added dropwise, over a 45 minute period, to the later solution. The resulting reaction mixture was stored overnight in a cold room. Salts were filtered from the reaction mixture and the solution was evaporated. The residue was dissolved in EtOAc (1 L) and the insoluble solids were removed by filtration. The filtrate was washed with 1x300 mL of NaHC0 ₃ and 2x300 mL of saturated NaCl, dried over sodium sulfate and evaporated. The residue was triturated with EtOAc to give the title compound.

2' -O-Methoxyethyl-5' -O-dimethoxytrityl-5-methylcytidine:

A solution of 3' -0-acetyl-2' -O-methoxyethyl-5' -O- dimethoxytrityl-5-methyl-4-triazoleuridine (103 g, 0.141 M) in dioxane (500 mL) and NH ₄ OH (30 mL) was stirred at room temperature for 2 hours. The dioxane solution was evaporated and the residue azeotroped with MeOH (2x200 mL) . The residue was dissolved in MeOH (300 mL) and transferred to a 2 liter stainless steel pressure vessel. MeOH (400 mL) saturated with

NH ₃ gas was added and the vessel heated to 100°C for 2 hours

(tic showed complete conversion) . The vessel contents were evaporated to dryness and the residue was dissolved in EtOAc

(500 mL) and washed once with saturated NaCl (200 mL) . The organics were dried over sodium sulfate and the solvent was evaporated to give 85 g (95%) of the title compound.

- -

N*-Benzoyl-2 ' -O-methoxyethy1 - 5 ' -0-dimethoxytrityl - 5 - methylcytidine:

2' -O-Methoxyethyl-5' -0-dimethoxytrityl-5-methylcytidine

(85 g, 0.134 M) was dissolved in DMF (800 mL) and benzoic anhydride (37.2 g, 0.165 M) was added with stirring. After stirring for 3 hours, tic showed the reaction to be approximately 95% complete. The solvent was evaporated and the residue azeotroped with MeOH (200 mL) . The residue was dissolved in CHC1 ₃ (700 mL) and extracted with saturated NaHC0 ₃ (2x300 mL) and saturated NaCl (2x300 mL) , dried over MgS0 ₄ and evaporated to give a residue (96 g) . The residue was chromatographed on a 1.5 kg silica column using EtOAc/Hexane

(1:1) containing 0.5% Et ₃ NH as the eluting solvent. The pure product fractions were evaporated to give 90 g (90%) of the title compound.

N ⁴ -Benzoyl - 2 ' -O-methoxyethy1 - 5 ' -O-dimethoxytrityl - 5 - methylcytidine-3' -amidite:

N ⁴ -Benzoyl-2 ' -O-methoxyethyl -5 ' -O-dimethoxytrityl-5- methylcytidine (74 g, 0.10 M) was dissolved in CH ₂ C1 ₂ (1 L) . Tetrazole diisopropylamine (7.1 g) and 2-cyanoethoxy-tetra-

(isopropyl)phosphite (40.5 mL, 0.123 M) were added with stirring, under a nitrogen atmosphere. The resulting mixture was stirred for 20 hours at room temperature (tic showed the reaction to be 95% complete) . The reaction mixture was extracted with saturated NaHC0 ₃ (1x300 mL) and saturated NaCl

(3x300 mL) . The aqueous washes were back-extracted with CH ₂ C1 ₂

(300 mL) , and the extracts were combined, dried over MgS0 ₄ and concentrated. The residue obtained was chromatographed on a

1.5 kg silica column using EtOAc\Hexane (3:1) as the eluting solvent. The pure fractions were combined to give 90.6 g (87%) of the title compound.

Oligomers having methylene (methylimino) backbones are synthesized according to U.S. Patent 5,378,825, which is coassigned to the assignee of the present invention and is

incorporated herein in its entirety. Synthesis is done as follows:

Synthesis of (3' -CH=N-0-CH ₂ -5' ) linked oligonucleoside (an oxime linked dimer) 3' -De(oxyphosphinico) -3' - (methylidynenitrilo) - thymidylyl- (3'-» 5' ) -thymidine

A mixture of 3 ' -deoxy-3 ' -C-formyl-5' -O-tritylthymine (0.99 g, 2 mmol) , 5' -amino-3' -0- ( t-butyldiphenylsilyl) thymidine

(0.99 g, 2 mmol) and AcOH (0.3 ml) in dry CH ₂ C1 ₂ (20 ml) was stirred for 1 h at room temperature. The solvent was evapo¬ rated under vacuum and the crude blocked 3' -de (oxyphosphinico) - 3' - (methylidynenitrilo)thymidylyl- (3'→ 5' ) -3' - (t-butyldiphenyl¬ silyl) thymidine product was dissolved in THF (20 ml) . A THF solution of nBu ₄ NF (1M, 5 ml) was added to the stirred reaction mixture at room temperature. After 1 h solution was purified by silica gel chromatography (elution with CH ₂ Cl ₂ :MeOH; 99:4, v/v) to furnish 3'-deblocked dimer. The dimer was dissolved in anhydrous MeOH (50 ml) and to this a MeOH/HCl solution (0.14M, 2.5 ml) was added. The reaction mixture was stirred at room temperature for 15 h. Anhydrous pyridine (10 ml) was added to the above solution and solvents were evaporated to dryness to furnish crude oxime dimer. The crude product was purified by silica gel chromatography (elution with CH ₂ C1 ₂ :MeOH; 92:8, v/v) to furnish the title compound, 3' -De (oxyphosphinico) -3' - (methylidynenitrilo) thymidylyl- (3 '→ 5') -thymidine, (0.87 g, 89%) as a mixture of E/Z isomers. The two geometrical isomers were separated by reverse phase HPLC (Supelcosil LC18, 5μ, H ₂ 0:CH ₃ CN gradient) . (Z-isomer of title compound) ^l U NMR (DMSO- d ₆ ) δ 11.28 (br s, 2, 2NH) , 7.39 and 7.78 (2s, 2, 2C6H) , 6.92 (d, 1, Tl H ₃ „, J ₃ . _ι3 .= 6.7 Hz) , 6.15 (pseudo t, 1, T2 H-, , J\. _,2 .= 7.8 Hz, J _{V ι 2*} = 6.3 Hz) , 6.04 (dd, 1, Tl K ₁ . , J _1>>2 .= 7.1 Hz, J _λ - ₁₂ „ = 6.3 Hz) , 5.34 (d, 1, T2 OH) , 5.12 (t, 1, Tl OH) , 4.11-4.25 (m, 3, T2 H ₅ . ₅ „, T2 H ₃ .) . 3.96 (m, 1, T2 H ₄ ,) , 3.90 (m, 1, Tl H ₄ ,) , 3.49-3.69 (m, 3, Tl H ₅ , _,5 „, Tl H ₃ ,) , 2.06-2.31 (m,4, Tl H ₂ . ₂ „, T2 H ₂ , ₂ „) , 1.73 (s, 6, 2CH ₃ ) . Anal. Calcd. for C ₂₁ H ₂₇ N ₅ 0 ₉ .H ₂ 0: C, 49.31; H, 5.72; N, 13.69. Found: C, 49.32; 5.57; N, 13.59. (E- isomer of the title compound) ^l H NMR (DMSO-d ₆ ) δ 11.3 (2 br s, 2, 2NH) , 7.81 (s, 1, C ₆ H) , 7.52 (d, 1, Tl H ₃ ", J ₃ . _{, 3} ,.= 6.7 Hz) , 7.45 (s, 1, C ₆ H) , 6.10 (pseudo t, 1, T2 Hj,, J _1><2 .= 7.6 Hz, J _y . _{ι 2} « =

6.4 Hz) , 6.04 (dd, 1, Tl H^ J ^" _x . _,2 .= 7.3 Hz, J _11|2 ,= 3.4 Hz) , 5.36

(d, 1, T2 OH) , 5.16 (t, 1, Tl OH) , 4.07-4.22 (m, 3, T2 H ₃ . _i5 . _,5 .) _f

3.91 (m, 2, Tl T2 H ₄ ,) , 3.50-3.73 (m, 2, Tl H ₅ . _,s ») , 3.12 (m, 1,

Tl H ₃ .) , 2.05-2.44 (m, 4, Tl T2 H ₂ . _<2 „) , and 1.76 (s, 6, 2CH ₃ ) . MS FAB: M/z 494 (M+H) ⁺ .

Synthesis of phosphoramidate containing (3' -CH=N-0-CH ₂ -5' ) linked oligonucleoside

3' -De(oxyphosphinico) -3' - (methylidynenitrilo) -5' -O- (di¬ methyoxytriphenylmethyl) -thymidylyl- (3'-* 5') -3' -0- (jS- cyanoethyldiisopropylaminophosphiryl) thymidine

The isomeric dimer was further dimethyoxytrityled at the hydroxyl group of the 5' terminus nucleoside followed by conversion to its 3 ' -O-β-cyanoethyldiisopropylphosphoramidite derivative at the hydroxyl group at the 3' terminus nucleoside of the dimer following the procedure described in Oligonucleotide Synthesis: a practical approach, Ed. M.J. Gait, IRL Press, 1984, to yield the title compound. ^J H NMR (CDC1 ₃ ) δ 8.77 (br s, 2, 2NH) , 7.68 (s, 0.77, Tl C ₆ H E-isomer) , 7.59 (S, 0.23, Tl C ₆ H E-isomer) , 6.3 (ps t, 1, T2 CH _r ) , 6.14 (m, 0.77, Tl CHi. E-isomer) , 6.08 (m, 0.23, T _x CH^ Z-isomer) , 1.80 and 1.50 (2S, 6, 2 CH ₃ ) and other protons. ³¹ P NMR (CDCl

150.77 and 150.38 (Z-isomer) ; 150.57 and 150.38 (E-isomer) .

The protected dimer can be conveniently stored and used for coupling utilizing an automated DNA synthesizer (ABI 380B) as and when required for specific incorporation into oligomers of therapeutic value. Further as per further examples of the specification, the oxime linked dimer is reduced to a dimer bearing a corresponding hydroxylamine linkage and this in turn can be alkylated to a hydroxylmethylamine or other hydroxyalkylamine linkage.

Synthesis of (3' -CH ₂ -NH-0-CH ₂ -5' ) linked oligonucleoside

3 ' -De (oxyphosphinico) -3 ' - (methyleneimino) thymidylyl- (3' → 5' ) -thymidine

To a stirred solution of blocked dimer 3' -de (oxyphosphini- co) -3' - (methylidynenitrilo) thymidylyl- (3'→ 5' ) -3' -O- (t-butyl- diphenylsilyl) thymidine (0.49 g, 1 mmol) in glacial AcOH (5 ml) was added NaBH ₃ CN (0.19 g, 3 mmol) in 3-portions under argon at room temperature. The suspension was stirred for 1 h until bubbling of solution ceased. Additional NaBH ₃ CN (0.19 g, 3

mmol) was added in a similar manner and stirring continued for 1 h. The AcOH was removed under reduced pressure to furnish 3' -de (oxyphosphinico) -3' - (methyleneimino) - thymidylyl- (3'→ 5')- 3 ' -0- ( t-butyldiphenylsilyl) thymidine. Deblocking of this dimer as described before using nBu ₄ NF/THF and HCl/MeOH furnished the title compound, 3 ' -de (oxyphosphinico) -3 ' - (methyleneimino) - thymidylyl- (3'→ 5') -thymidine, (0.44 g, 90%) as white powder. This dimer was further purified by HPLC (as described for the 3 ' -de (oxyphosphinico) -3 ' - (methylidynenitrilo) thymidylyl - (3'→ 5' ) -thymidine dimer) to obtain an analytically pure sample. ^l E NMR (DMSO-d ₆ ) δ 11.23 (br s, 2, 2NH) , 7.83 and 7.49 (2s, 2, 2C ₆ H) , 6.82 (t, 1, NHO) , 6.14 (pseudo t, 1, T2 H _x ., J _x . _{ι 2} . = 6.9 Hz, ^, _,2 ,,= 4.3 Hz) , 5.28 (s, 1, T2 OH) , 5.08 (s, 1, Tl OH) , 4.18 (m, 1, T2 H ₃ ,) , 3.89 (m, 1, Tl H ₄ ,), 3.54-3.78 (m, 5, Tl T2 H ₅ , _<5 „, T2

H ₄ ,) , 2.76-2.94 (m, 2, T1 H ₃ „) , 2.42 (m, 1, T1 H ₃ ,) , 2.0-2.17 (m,

4, Tl, T2 H ₂ . ₂ „) , 1.77 and 1.74 (2s, 6, 2 CH ₃ ) . MS FAB: M/z 496

(M+H) ⁺ . Anal. Calcd. for C ₂₁ H ₂₉ N ₅ 0 ₉ Η ₂ 0: C, 49.12; H, 6.09; N,

13.64. Found: C, 48.99; H, 5.96; N, 13.49. Synthesis of methylated [3' -CH ₂ -N(CH ₃ ) -0-CH ₂ -5' ] linked oligonucleoside

3' -De(oxyphosphinico) -3' - [methylene (methylimino) ] thymi¬ dylyl- (3'-* 5' ) thymidine

To a stirred solution of 3 ' -de (oxyphosphinico) -3 ' - (methyl- eneimino) thymidylyl- (3 '→ 5 ' )-3 ' -O- ( t-butyldiphenylsilyl) - thymidine dimer (0.99 g, 1 mmol) in glacial AcOH (10 ml) was added aqueous HCHO (20%, 3 ml) . The solution was stirred for 5 min. at room temperature and to this was added NaBH ₃ CN (0.19 g, 3 mmol) in 3-portions under argon at room temperature. The addition of NaBH ₃ CN (0.19 g) was repeated once more and solution was further stirred for 1 h. The reaction mixture was concentrated to furnish crude 3 ' -de (oxyphosphinico) -3' - [methylene (methylimino) ] thymidylyl- (3 '→ 5' ) -3 ' -0- ( t-butyldi¬ phenylsilyl) thymidine dimer, which on deblocking (nBu ₄ NF/THF, HCl/MeOH) furnished the title compound, 3' -de (oxyphosphinico) - 3' - [methylene (methylimino) ] thymidylyl- (3'→ 5') thymidine, (0.44 g, 87%) as white solids. The 3 ' -de (oxyphosphinico) -3' - [methylene (methylimino) ] thymidylyl- (3 '→ 5') thymidinedimerwas further purified by preparative HPLC furnishing an analytically

pure sample. ^l K NMR (DMSO-d ₆ ) δ 11.30 and 11.24 (2s, 2, 2NH) , 7.82 and 7.50 (2s, 2, 2C ₆ H) , 6.15 (pseudo t, 1, T2 H _r , J _λ . _ ₂ , = 6.3 Hz, J _r,2 «= 7.3 Hz) , 6.00 (pseudo t, 1, Tl Hj,, J _11|2 ,= 4.2 Hz, J _x . _r2 „= 6.1 Hz) , 5.31 (m, 1, T2 OH) , 5.08 (m, 1, Tl, OH) , 4.17 (m, 1, T2 H ₃ .) , 3.88 (m, 1, T2 H ₄ ,) , 3.57-3.83 (m, 5, Tl T2 H ₅ , ₅ „, Tl H ₄ .) , 2.69 (m, 2, Tl H ₃ „) , 2.57 (s, 3, N-CH ₃ ) , 2.50 (m, 1, Tl H ₃ ,) , 2.05-2.14 (m, 4, Tl T2 H ₂ , ₂ „) , 1.79 and 1.76 (2s, 6, 2 CH ₃ ) . MS FAB: M/z 510 (M+H) ⁺ . Anal. Calcd. for C ₂₃ H ₃₁ N ₅ 0 ₉ H ₂ 0: C, 50.09; H, 6.31; N, 13.28. Found: C, 50.05; H, 6.21, N, 13.08. Synthesis of phosphoramidate containing [3' -CH ₂ -N(CH ₃ ) -0-CH ₂ -5'] linked oligonucleoside

3' -De(oxyphosphinico) -3' - [methylene(methylimino) ] -5'-0- (dimethoxytriphenylmethyl) thymidylyl- ( 3 ' → 5')-3'-0-(β- cyanoethyldiisopropylaminophosphiryl) thymidine The 3 ' -de (oxyphosphinico) -3'- [methylene (methylimino) ] - thymidylyl- (3'→ 5') thymidine dimer was tritylated and phosphitylated as described in Oligonucleotide Synthesis: a practical approach, Ed. M.J. Gait, IRL Press, 1984, in an overall yield of 82%. The protected dimer was purified by silica gel column chromatography (CH ₂ C1 ₂ :MeOH:Et ₃ N; 9:1:0.1, v/v) and homogenous fractions were pooled and evaporated to furnish pure 3' -de(oxyphosphinico) -3' - [methylene (methylimino) ] - thymidylyl-5' -O- (dimethoxytriphenylmethyl) - (3'→ 5' ) -3' -O- (β- cyanoethyldiisopropylaminophosphiryl) thymidine as a white foam (used as such for DNA synthesis) . The product was isolated as a mixture of diastereoisomer: ³¹ P NMR (CDC1 ₃ ) δ 149.62 and 149.11 ppm; ^X H NMR (CDCl ₃ ) δ 6.22 (pseudo t, 1, T2 H _r , J _r,2 .= J _τ _. _{ι 2} .= 6.7 Hz) , 6.16 (pseudo t, 1, Tl H ₁₍ , J= ₁ . _{ι 2} . = J _λ . _{ι 2} „ = 5.8 Hz), 2.58, 2.56 (2s, 3, N-CH ₃ ) , 1.82, 1.49 (2s, 6, 2 CH ₃ ) , and other protons.

The above protected phosphoramidate bearing dimer can be conveniently stored and used for coupling utilizing an automated DNA synthesizer (ABI 380B) as and when required for specific incorporation into oligomers of therapeutic value. Other dimers of the inventions, as for example but not limited the above noted methylidynenitrilo, i.e., oxime, and methyleneimino, i.e., aminohydroxy, dimers are converted to their corresponding phosphoramidate derivatives in the same manner as this example and incorporated into oligonucleotide in

the standard manner as noted below. An oligomer bearing the oxime linked nucleoside dimer is reduced to an oligomer bearing a corresponding hydroxylamine linked nucleoside dimer. As noted in other examples, reduction can be effected as an CPG bound oligomer or after removal from the CPG.

Other nitrogen-containing backbones are synthesized according to WO 92/20823 which is also coassigned to the assignee of the present invention and incorporated herein in its entirety. Oligomers having amide backbones are synthesized according to De Mesmaeker et al . , Ace . Chem . Res . 1995, 28, 366-374. The amide moiety is readily accessible by simple and well-known synthetic methods and is compatible with the conditions required for solid phase synthesis of oligonucleotides. Oligomers with morpholino backbones are synthesized according to U.S. Patent 5,034,506 (Summerton and Weller) .

Peptide-nucleic acid (PNA) oligomers are synthesized according to P.E. Nielsen et al. , Science 1991, 254, 1497) .

Example 2: Cells and cell culture HUVECs were purchased from Clonetics Corp. (San Diego CA) and grown in the suggested EBM medium supplemented with 10% fetal bovine serum (from HyClone, Logan UT) . Cells were used in experiments from passages two to ten at 80-90% confluency.

Example 3: Oligonucleotide treatment of HUVECs 2 x 10 ⁵ cells/ml were washed three times with OPTI-MEM

(Gibco-BRL, Grand Island, NY) prewarmed to 37°C. Oligomers were premixed with 10 μg/ml LIPOFECTIN reagent (Gibco-BRL) in

OPTI-MEM, serially diluted to the desired concentrations and applied to washed cells. Basal and untreated (no oligomer) control cells were also treated with LIPOFECTIN. Cells were incubated for 4 hours at 37°C, at which time the medium was replaced with standard growth medium with or without 5 ng/ml TNF-α. In some experiments the cytokine medium was removed after one hour and replaced with standard medium. Incubation at 37°C was continued until the indicated times.

Example 4: Quantitation of ICAM-1 protein expression by fluorescence activated cell sorting (FACS)

Cells were removed from plate surfaces by brief trypsinization with 0.25% trypsin in PBS. Trypsin activity was quenched with a solution of 2% bovine serum albumin and 0.2% sodium azide in PBS (+Mg/Ca) . Cells were pelleted by centrifugation at 1000 rpm (Beckman GPR centrifuge) , resuspended in PBS and stained with 3 μl/10 ⁵ cells of ICAM-1 specific antibody, CD54-PE (Becton Dickinson, Mansfield MA) and 0.1 μg of control conjugated antibody, IgG2b-PE (Pharmingen,

San Diego CA) . Antibodies were incubated with the cells for 30 minutes at 4°C in the dark, under gentle agitation. Cells were washed and then resuspended in 0.3 ml of FACSFLOW buffer

(Becton Dickinson) with 0.5% formaldehyde. Expression of cell surface ICAM-1 was then determined by flow cytometry using a Becton Dickinson FACScan (San Jose, CA) . ICAM-1 expression was calculated as a percentage of control expression.

Example 5: Total RNA isolation and northern analysis

Total cellular RNA was isolated by cellular lysis using CATRIMOX-14 surfactant (Iowa Biotechnology Group, Oakdale IA) . Isolated RNA was separated on a 1.2% agarose gel containing 1.1% formaldehyde, then transferred to a nylon membrane and UV crosslinked to the membrane using a Stratagene UV crosslinker 2400 (La Jolla CA) . Blots were hybridized with cDNA probes in QUICKHYB solution (Stratagene) . Blots were washed twice at room temperature in 2x SSC with 0.1% SDS for 10 minutes each and then once in 0.1% SSC with 0.1% SDS at 65°C for 30 minutes.

Example 6 : Polysome profile analysis

Approximately 10 ^s pelleted cells, washed with PBS, were mixed into 0.3 ml cold lysis buffer (0.5% NP-40, 10 mM Tris-Cl, pH 7.4, 140 mM KCl, 5 mM MgCl ₂ , 1 mM DTT, 100 μg/ml cycloheximide, and Prime RNase inhibitor) and incubated for 5 minutes at 4°C. Nuclei were pelleted at lOOOx g, and the resulting supernatant was layered on a 10 to 35% (wt/vol) linear sucrose gradient (4 ml) with a 50% cushion (0.75 ml), in gradient buffer (10 mM Tris pH 8.0, 50 mM KOAc, 1 mM MgOAc, ImM DTT) . Gradients were centrifuged at 35,000 rpm for 3 hours at

5°C with a Beckman SW55Ti rotor. 250 μl fractions were collected with an Isco model 185 density gradient fractionator connected to a Pharmacia UV monitor and fraction collector. Collected fractions were treated with proteinase K (0.2 mg/ml) in 0.2% SDS at 42°C for 20 minutes, phenol-extracted, and ethanol-precipitated. 5 to 10 μg of tRNA was added to each fraction prior to precipitation. Precipitated RNA was applied to a 1.2% denaturing agarose gel, and analyzed by standard ethidium bromide staining and northern blotting techniques.

Example 7: ELISA screening of oligomers for activity against E-selectin gene expression:

Primary human umbilical vein endothelial (HUVEC) cells, passage 2 to 5, were plated in 96-well plates and allowed to reach confluence. Cells were washed three times with Opti-MEM (GIBCO, Grand Island NY) . Cells were treated with increasing concentrations of oligomer diluted in Opti-MEM containing 10 μg/ml DOTMA solution (Bethesda Research Labs, Bethesda MD) for 4 hours at 37°C. The medium was removed and replaced with EGM- UV (Clonetics, San Diego CA) plus oligomer. Tumor necrosis factor a was added to the medium (2.5 ng/ml) and the cells were incubated an additional 4 hours at 37°C.

E-selectin expression was determined by ELISA. Cells were gently washed three times with Dulbecco's phosphate-buffered saline (D-PBS) prewarmed to 37°C. Cells were fixed with 95% ethanol at 4°C for 20 minutes, washed three times with D-PBS and blocked with 2% BSA in D-PBS. Cells were incubated with E- selectin monoclonal antibody BBA-1 (R&D Systems, Minneapolis MN) diluted to 0.5 μg/ml in D-PBS containing 2% BSA for 1 hour at 37°C. Cells were washed three times with D-PBS and the bound E-selectin antibody was detected by incubation with a 1:1000 dilution of biotinylated goat anti-mouse IgG (Bethesda Research Laboratories, Gaithersberg, MD) in blocking solution for 1 hour at 37°C. Cells were washed three times with D-PBS and then incubated with a 1:1000 dilution of streptavidin conjugated to β-galactosidase (Bethesda Research Laboratories) for 1 hour at 37°C. The cells were washed three times with D- PBS for 5 minutes each. The amount of β-galactosidase bound to the specific monoclonal antibody was determined by developing

the plate in a solution of 3.3 mM chlorophenolred-β-D- galactopyranoside, 50 mM sodium phosphate, 1.5 mM MgCl ₂ ; pH=7.2 for 2 to 15 minutes at 37°C. The concentration of the product was determined by measuring the absorbance at 575 nm in an ELISA microtiter plate reader.

Example 8: ELISA assay for inhibition of HCMV replication by antisense oligonucleotides

Oligonucleotides complementary to human cytomegalovirus mRNA were tested for antiviral activity in an ELISA-based assay of HCMV replication. Normal human dermal fibroblasts

(Clonetics Corp., San Diego CA) were grown in serum-free medium

(Clonetics) and used to seed 96-well plates. When cells were approximately 80% confluent, they were pretreated with oligonucleotides. Approximately 20 hours after pretreatment the medium (containing oligonucleotides) was carefully poured off and the cells washed twice with warmed fibroblast basal medium (FBM, Clonetics) . Cells were then infected with 100 μl/well of CMV stock diluted in FBM. The plates were incubated at 37°C for two hours. The medium (containing virus) was then carefully poured off and replaced with fresh, prewarmed FBM medium, lOOμl per well. The plates were briefly incubated at

37°C and then 5 μl of oligonucleotide, diluted in FBM, was reintroduced into the medium in each well. Two days later, cells were post-treated again with oligonucleotides in the same way. On day six, the plates were prepared for ELISA.

In preparation for ELISA, the medium was carefully poured off the plates, and cells were fixed in 200 μl of absolute ethanol per well. Cells were fixed for 30 minutes at room temperature, then ethanol is removed and plates were air-dried. Plates were blocked for one hour prior to ELISA with PBS containing 2% BSA. Blocking solution was removed and 100 μl of an anti-CMV antibody, diluted 1:2000 in PBS with 1% BSA, was added. Cells were incubated in antibody for one hour at 37°C and washed three times in PBS. The secondary antibody, biotinylated goat anti-mouse IgG (Bethesda Research Labs, MD) , was diluted 1:1000 in PBS with 1% BSA, and incubated with cells for one hour at 37°C. Cells were then washed and incubated for one hour at 37°C in streptavidin-B-D-galactosidase. Color was

developed with chlorophenol red-B-D-galactopyranoside, 20 mg dissolved in 10 ml of 50 mM Na Phosphate, 1.5 mM MgCl2 ; plates were shaken for 10 minutes and the absorbance was read at 575 nm.

Example 9: Electroporation of PNA into U937 cells

Cells were washed in PBS and resuspended in PBS at 1 x 10 ⁶ cells/ml. 0.4 ml of suspension was electroporated in a BTX electroporator (San Diego CA) set at 1200μF and 140 V. Cells were cooled on ice and oligomer was added. Cells were plated in pre-warmed medium ten minutes after electroporation and ICAM-1 expression was induced overnight with 5 ng/ml TNFα. ICAM-1 expression was quantitated by FACS as in Example 4.

Example 10: Western blot analysis of inhibition of expression of IE1 and IE2 protein products Stably transfected U373 neuroblastoma cells were used, each expressing a single CMV protein product. Cells were plated at 4.5 x 10 ⁵ cells/well of a 6 well plate to obtain 55- 70% confluence the following day. Cells were treated with oligonucleotide at a concentration of 75 nM, with 5 μg/ml lipofectin, in OPTIMEM for 4 hours. Cells were refed with medium without oligonucleotide and allowed to recover overnight. Cells were harvested 16-20 hr post-treatment, washed once with PBS, suspended in Laemmli buffer (lOOμl/well) , boiled for 5 minutes and loaded on a 16% SDS-PAGE gel. Gels were run for 1.5 hours at 150 V, and transferred to membrane for western blotting. Primary antibody was anti IE 55-72-86 antibody (Virostat) diluted 1:1000 and secondary antibody was radiolabelled goat anti-mouse. Bands were visualized using a PHOSPHORIMAGER (Molecular Dynamics, Sunnyvale CA) .

Example 11: Electroporation of U937 cells with MMI oligomers

U937 cells were washed once in cold Opti-MEM (Gibco-BRL, Grand Island, NY) and resuspended at 4 x 10 ⁶ cells/ml. Oligomer was added to 0.1 ml of cells and incubated for 10 minutes on ice. Cells were transferred to a 1 mm gap electrode (BTX, San Diego, CA) and electroporated at 0. 75kV/cm. Cells were incubated at room temperature for 10 minutes and transferred to

pre-warmed medium. Cells were allowed to rest for 1.5 hours before ICAM-1 expression was induced with 5 ng/ml TNF-α overnight. Cells were stained with an anti-ICAM-1-PE antibody (Pharmingen, San Diego CA) the next day.

SEQUENCE LISTING

(1) GENERAL INFORMATION:

(i) APPLICANT: Brenda F. Baker, C. Frank Bennett,

Kevin P. Anderson and Thomas P. Condon

(ii) TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR ANTISENSE INHIBITION OF PROTEIN TRANSLATION

(iii) NUMBER OF SEQUENCES: 15

(iv) CORRESPONDENCE ADDRESS:

(A) ADDRESSEE: Jane Massey Licata, Esq.

(B) STREET: 210 Lake Drive East, Suite 201

(C) CITY: Cherry Hill

(D) STATE: NJ

(E) COUNTRY: USA

(F) ZIP: 08002

(v) COMPUTER READABLE FORM:

(A) MEDIUM TYPE: DISKETTE, 3.5 INCH, 1.44 Mb STORAGE

(B) COMPUTER: IBM 486

(C) OPERATING SYSTEM: WINDOWS FOR WORKGROUPS

(D) SOFTWARE: WORDPERFECT 5.1 (vi) CURRENT APPLICATION DATA:

(A) APPLICATION NUMBER: not yet assigned

(B) FILING DATE: herewith

(C) CLASSIFICATION: (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/653,653

(B) FILING DATE: May 24, 1996 (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/440,740

(B) FILING DATE: May 12, 1995 (vii) PRIOR APPLICATION DATA:

- -

(A) APPLICATION NUMBER: 08/063,167

(B) FILING DATE: May 17, 1993 (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 08/007,997

(B) FILING DATE: January 21, 1993 (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/939,855

(B) FILING DATE: September 2, 1992 (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/567,286

(B) FILING DATE: August 14, 1990 (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/927,506

(B) FILING DATE: November 19, 1992 (vii) PRIOR APPLICATION DATA:

(A) APPLICATION NUMBER: 07/568,366

(B) FILING DATE: August 16, 1990 (viii) ATTORNEY/AGENT INFORMATION:

(A) NAME: Jane Massey Licata

(B) REGISTRATION NUMBER: 32,257

(C) REFERENCE/DOCKET NUMBER: ISPH-0210 (ix) TELECOMMUNICATION INFORMATION:

(A) TELEPHONE: (609) 779-2400

(B) TELEFAX: (609) 779-8488 (2) INFORMATION FOR SEQ ID NO: 1:

(i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS : single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes (xi) SEQUENCE DESCRIPTION: SEQ ID NO: 1: TCTGAGTAGC AGAGGAGCTC 20

(2) INFORMATION FOR SEQ ID NO: 2: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 2: Arg Arg Arg TCTGAGTAGC AGAGGAGC Lys 18

(2) INFORMATION FOR SEQ ID NO: 3: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 3: GAAGTCAGCC AAGAACAGCT 20

(2) INFORMATION FOR SEQ ID NO: 4: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: no

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 4: GUCAGAUCGC CUGGAGACGC C 21

(2) INFORMATION FOR SEQ ID NO: 5: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 5: TGGCGTCTCC AGGCGATCTGA 21

(2) INFORMATION FOR SEQ ID NO: 6: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 21 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 6: GGCGTCTCCA GGCGATCTGA C 21

(2) INFORMATION FOR SEQ ID NO: 7: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 7: GGCGTCTCCA GGCGATCTGA 20

(2) INFORMATION FOR SEQ ID NO: 8: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 8: TGGATGGCGT CTCCAGGCGA 20

(2) INFORMATION FOR SEQ ID NO: 9: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 9: GGCTGAGGTT GCAACTCTGA 20

(2) INFORMATION FOR SEQ ID NO: 10: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 10: GCAACTCTGA GTAGCAGAGG 20

(2) INFORMATION FOR SEQ ID NO: 11: (i) SEQUENCE CHARACTERISTICS:

- -

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 11: GATCGCGTCG GACTATGAAG 20

(2) INFORMATION FOR SEQ ID NO: 12: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 18 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 12: TGAGTAGCAG AGGAGCTC 18

(2) INFORMATION FOR SEQ ID NO: 13: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 16 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 13: AGTAGCAGAG GAGCTC 16

(2) INFORMATION FOR SEQ ID NO: 14: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 14 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 14: TAGCAGAGGA GCTC 14

(2) INFORMATION FOR SEQ ID NO: 15: (i) SEQUENCE CHARACTERISTICS:

(A) LENGTH: 20 base pairs

(B) TYPE: nucleic acid

(C) STRANDEDNESS: single

(D) TOPOLOGY: linear (iv) ANTI-SENSE: yes

(xi) SEQUENCE DESCRIPTION: SEQ ID NO: 15: CGATGCAGAT ACCGCGGAGT 20