BACKGROUND

Adoptive transfer of T cells with engineered anti-tumor specificity or anti-pathogen specificity are under development. In such strategies, an exogenous immune receptor such as an alpha beta T cell receptor, or a gamma delta T cell receptor or a chimeric antigen receptor having a particular anti-tumor specificity, or a particular anti-pathogen specificity is transferred to either autologous T cells from a patient, or, e.g. in case of an allogeneic stem cell transplantation into a patient, in corresponding allogeneic T cells. For example, a leukemic patient that is undergoing blood stem cell transplantation will during the treatment also be lymphodepleted. Hence, such a patient can also benefit from e.g. infusion of donor T cells that have been engineered to express a specific anti-leukemic T cell receptor. Described herein are compositions and methods comprising cells expressing receptors that selectively recognize a unique configuration in proteins expressed by one or more MHC associated genes, wherein said unique configuration is associated with one or more disease conditions.

INCORPORATION BY REFERENCE

All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference. The full content of the priority applications PCT/EP2018/063210 and EP18205587.1 is also incorporated by reference to the same extent as if each priority application was specifically and individually indicated to be incorporated by reference.

SUMMARY

Provided herein is a pharmaceutical composition that comprises a dosage form of a polypeptide construct that selectively binds CD277 on a cancer cell or a dosage form of a cell expressing said polypeptide construct that selectively binds CD277 on said cancer cell; and at least one of (i) a dosage form of an agent that increases activity of RhoB

GTPase in said cancer cell; and (ii) a dosage form of an agent that increases activity of a phosphoantigen in said cancer cell. In an aspect, a pharmaceutical composition comprises a dosage form of an agent that increases activity of RhoB GTPase and a dosage form of an agent that increases activity of a phosphoantigen. In an aspect, a pharmaceutical composition comprises a dosage form of an agent that increases activity of RhoB GTPase and a dosage form of an agent that increases activity of a phosphoantigen wherein an agent that increases activity of a phosphoantigen is administered prior to, concurrent with, or after an agent that increases activity of a RhoB GTPase. In an aspect, an agent that increases activity of a RhoB GTPase increases translocation of a RhoB GTPase to a cell membrane of a cancer cell, maintains RhoB GTPase at a cell membrane of a cancer cell, increases translocation of a RhoB GTPase away from a nucleus of a cancer cell, increases expression of a gene or transcript encoding a RhoB GTPase, increases stability of a RhoB GTPase, increases an interaction between a RhoB GTPase and CD277, activates RhoB GTPase, increases an interaction between a RhoB GTPase and GTP, reduces an interaction between a RhoB GTPase and GDP, increases an amount of GTP in a cancer cell, increases availability of GTP in a cancer cell, or any combination thereof In an aspect, CD277 can be in a J-configuration. In an aspect, a polypeptide construct comprises at least one of a g-TCR polypeptide sequence or a d-TCR polypeptide sequence. In an aspect, a polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence. In an aspect, a polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence and wherein a g -TCR

polypeptide sequence can be a y9-TCR polypeptide sequence or fragment thereof. In an aspect, a polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence and wherein a d -TCR

polypeptide sequence can be a 02-TCR polypeptide sequence or a fragment thereof.

In an aspect, a polypeptide, preferably a y chain of a ydTCR or a d chain of a ydTCR or a gdT C R or a fragment thereof comprises a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprises at least 60% percent identity to a sequence generated from primer sequences from Table 3. A polypeptide as defined herein may also be named a polypeptide construct to emphasize that is is preferably a molecule that has been produced using recombinant DNA techniques.

In an aspect, a nucleic acid molecule encodes a sequence that comprises a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprises a sequence that has at least 60% percent identity to a sequence generated from the primer sequences from Table 3.

In an aspect, a nucleic acid construct is provided comprising a nucleic acid molecule that encodes a sequence comprising a sequence that at least 60% identity to a sequence from Table 4 and/or comprising a sequence that has at least 60% percent identity to a sequence generated from primer sequences from Table 3.

In an aspect, a pharmaceutical composition can be administered to a subject comprising at least one of a solid cancer and leukemia. In an aspect, a pharmaceutical composition can be administered to a subject comprising acute myeloid leukemia. In an aspect, a pharmaceutical composition can be administered to a subject. A subject can comprise a mutation in a gene that correlates with RhoB GTPase expression or activity. In an aspect, a pharmaceutical composition can be administered to a subject wherein a subject comprises a mutation in a gene that correlates with reduced RhoB GTPase expression or activity. In an aspect, a pharmaceutical composition can be administered to a subject wherein a subject comprises a mutation in a gene that can correlate with reduced or inhibited interactions between CD277 and RhoB GTPase. In an aspect, an agent that increases activity of a RhoB GTPase can perform by indirectly or directly binding a RhoB GTPase. In an aspect, an agent that increases activity of a phosphoantigen can perform by indirectly or directly binding a RhoB GTPase. In an aspect, a dosage form of a polypeptide construct comprises a sequence that comprises at least 60% percent identity to a sequence from Table 3 or Table 4. In an aspect, a dosage form of a polypeptide construct comprises a sequence that comprises at least 60% percent identity to a sequence generated from Table 3, a sequence selected from Table 4, and combinations thereof. In an aspect, an agent that increases activity of a phosphoantigen can be a mevalonate pathway inhibitor. In an aspect, an agent that increases activity of a phosphoantigen can be an aminobisphosphonate. In an aspect, an agent that increases activity of a

phosphoantigen can be at least one of pamidronate and zoledronate. In an aspect, an agent that increases activity of a RhoB GTPase increases translocation of a RhoB GTPase to a cell membrane of a cancer cell, maintains RhoB GTPase at a cell membrane of a cancer cell, increases translocation of a RhoB GTPase away from a nucleus of a cancer cell, increases expression of a gene or transcript encoding a RhoB GTPase in a cancer cell, increases stability of a RhoB GTPase in a cancer cell, increases an interaction between a RhoB GTPase and CD277 in a cancer cell, activates RhoB GTPase in a cancer cell, increases an interaction between a RhoB GTPase and GTP in a cancer cell, reduces an interaction between a RhoB GTPase and GDP in a cancer cell, increases an amount of GTP in a cancer cell, increases availability of GTP in a cancer cell, or any combination thereof

Disclosed herein is a method of treatment comprising administering a pharmaceutical composition to a subject in need thereof In an aspect, a subject comprises a mutation in a gene that correlates with reduced or inhibited interactions between CD277 and RhoB GTPase. In an aspect, a subject comprises at least one of a solid cancer and leukemia. Disclosed herein is a method of treatment comprising administering to a subject in need thereof a pharmaceutical composition that comprises an agent selected from the group consisting of: an agent that increases activity of a RhoB GTPase in a cancer cell of a subject, a pharmaceutical composition comprising a polypeptide construct that selectively binds CD277 on said cancer cell. In an aspect, a method can further comprise

administering to a subject in need thereof an agent that increases activity of a

phosphoantigen in a cancer cell of a subject in need thereof.

Disclosed herein is a method of treatment comprising administering to a subject in need thereof a dosage form of a polypeptide construct that selectively binds CD277 on a cancer cell or a dosage form of a cell expressing a polypeptide construct that selectively binds CD277 on a cancer cell; and at least one of (i) a dosage form of an agent that increases activity of RhoB GTPase in a cancer cell; and (ii) a dosage form of an agent that increases activity of a phosphoantigen in a cancer cell. In an aspect, a treatment comprises administering a dosage form of an agent that increases activity of RhoB GTPase and a dosage form of an agent that increases activity of a phosphoantigen. In an aspect, an agent that increases activity of a RhoB GTPase can be a mevalonate pathway inhibitor. In an aspect, an agent that increases activity of a RhoB GTPase can be a mevalonate pathway inhibitor that can be an aminobisphosphonate. In an aspect, an agent that increases activity of a RhoB GTPase can be a mevalonate pathway inhibitor that can be at least one of pamidronate and zoledronate. In an aspect, a polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence. In an aspect, a polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence and wherein a g -TCR polypeptide sequence can be a y9-TCR polypeptide sequence or fragment thereof.

In an aspect, a polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence and wherein a d -TCR polypeptide sequence can be a 02-TCR polypeptide sequence or a fragment thereof In an aspect, a cell can be an ab T cell. In an aspect, an agent that increases activity of a phosphoantigen performs by indirectly or directly binding a phosphoantigen. In an aspect, a method can further comprise administering a dosage form comprising a cytokine. In an aspect, a dosage form of a polypeptide construct comprises a sequence that comprises at least 60% percent identity to a sequence from Table 3 or Table 4. In an aspect, a dosage form of a polypeptide construct comprises a sequence that comprises at least 60% percent identity to a sequence generated from Table 3, a sequence selected from Table 4, and combinations thereof.

Disclosed herein is a method of treatment, comprising administering to a subject in need thereof a pharmaceutical composition comprising an agent that increases activity of a RhoB GTPase in a cancer cell of a subject, and a pharmaceutical composition that comprises a cell that expresses a ng9nd2 T cell receptor, wherein a T cell isolated from a subject secretes a small protein by at least one fold as compared to a comparable T cell isolated from a comparable subject absent an administering. In an aspect, a small protein can be a cytokine. In an aspect, a small protein can be a cytokine and is IFNy. In an aspect, a T cell isolated from a subject secretes a small protein by at least 5 fold over to a comparable T cell isolated from a comparable subject absent an administering. In an aspect, a T cell isolated from a subject secretes a small protein by at least 10 fold over to a comparable T cell isolated from a comparable subject absent an administering. Disclosed herein is a method of treatment comprising administering to a subject in need thereof a dosage form of an agent that increases activity of RhoB GTPase in a cancer cell and a dosage form of an agent that increases activity of a phosphoantigen in a cancer cell. In an aspect, an agent that increases activity of a RhoB GTPase can be a mevalonate pathway inhibitor. In an aspect, an agent that increases activity of a RhoB GTPase can be a mevalonate pathway inhibitor that can be an aminobisphosphonate. In an aspect, an agent that increases activity of a RhoB GTPase can be a mevalonate pathway inhibitor that can be at least one of pamidronate and zoledronate. In an aspect, an agent that increases activity of a phosphoantigen performs by indirectly or directly binding a phosphoantigen. In an aspect, a method can further comprise administering a dosage form of a polypeptide construct that selectively binds CD277 on a cancer cell or a dosage form of a cell expressing said polypeptide construct that selectively binds CD277 on a cancer cell.

In an aspect, a cell is provided comprising and/or expressing a polypeptide, preferably a y chain of a ydTCR or a d chain of a y TCR or a ydTCR or a fragment thereof comprising a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprises at least 60% percent identity to a sequence generated from the primer sequences from Table 3.

In an aspect, a cell is provided comprising and/or expressing a nucleic acid molecule encoding a sequence that comprises a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprising a sequence that has at least 60% percent identity to a sequence generated from the primer sequences from Table 3.

Provided herein are compositions comprising engineered cells expressing a polypeptide construct that selectively binds a J-configuration or J-confirmation of CD277 on a target cell. In some cases is provided a polypeptide construct described herein that selectively binds a J-configuration of CD277 on a target cell, wherein said polypeptide construct is expressed in an engineered cell. Also provided are nucleotide sequences incorporating a polypeptide construct described herein that selectively binds a J-configuration of CD277 on a target cell.

Provided herein are methods and compositions comprising a polypeptide construct that selectively binds a J-configuration of CD277 on a target cell, nucleotides encoding said polypeptide construct or cells expressing said polypeptide construct. In some

embodiments, a polypeptide construct that binds a J-configuration of CD277 on a target cell comprises at least one gd T cell receptor or fragment or variant thereof.

In an aspect, a composition is provided: comprising, consisting of or essentially consisting of:

(1) a polypeptide, preferably a y chain of a ydTCR or a d chain of a ydTCR or a ydTCR or a fragment thereof comprises a sequence that at least 60% percent identity to a sequence from Table 4 and/or comprises at least 60% percent identity to a sequence generated from the primer sequences from Table 3,

(2) a nucleic acid molecule encoding a sequence that comprises a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprises a sequence that has at least 60% percent identity to a sequence generated from the primer sequences from Table 3,

(3) a cell or a population of cells comprising and/or expressing a polypeptide, preferably a y chain of a ydTCR or a d chain of a y TCR or a ydTCR or a fragment thereof comprising a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprises at least 60% percent identity to a sequence generated from the primer sequences from Table 3, and/or

(4) a cell or a population of cells comprising and/or expressing a nucleic acid molecule encoding a sequence that comprises a sequence that comprises at least 60% percent identity to a sequence from Table 4 and/or comprising a sequence that has at least 60% percent identity to a sequence generated from the primer sequences from Table 3.

In an embodiment of the above-identified aspect, a composition is provided that does not consist of or does not essentially consist of:

(1) a polypeptide, preferably a y chain of a ydTCR or a d chain of a ydTCR or a ydTCR or a fragment thereof consisting of anyone of SEQ ID NO: 103-120,

(2) a nucleic acid molecule encoding a sequence consisting of anyone of SEQ ID NOT03-120,

(3) clone 3, clone 5 or Gl 15 as ydTCR as later indentified herein by an amino acid sequence or encoding nucleic acid sequence,

(4) a cell or a population of cells (preferably T cells) comprising or expressing clone 3, clone 5 or Gl 15 as later identified herein.

Throughout the application, unless otherwise stated,“Gl 15”,“clone 3 (same as 03)” and “clone 5 (same as 05)” refer to y962TCR Gl 15, clone 3 and clone 5, respectively, as disclosed in WO 2013/147606 and WO 2017/212074. Provided herein are compositions comprising engineered cells that express polypeptide constructs that selectively bind to a configuration of CD277 that is formed as a result of metabolic changes in distressed cells such as cancer cells, wherein said metabolic changes cause expression of generic stress molecules that are upregulated upon transformation or distress. In certain embodiments, this configuration can be the J-configuration. In some cases, the J-configuration of CD277 is formed as a result of RhoB transmigration within said distressed cell.

Provided herein are engineered cells expressing polypeptide constructs comprising gdT cell receptors (TCR) or fragments thereof, which selectively bind the J-configuration of CD277 on a target cell. In certain cases, the gdT cell receptors (TCR) or fragments thereof, comprise at least one of Vy9 and V02 chains and fragments thereof. In some cases are engineered cells described herein that can be provided to a subject in

conjunction with at least one additional agent selected from an intermediate of the mammalian mevalonate pathway, such as isopentenyl pyrophosphate (IPP), and the microbial 2- C-methyl-D-erythiitol 4-phosphate (MEP) pathway.

Provided herein is an unbiased, genome-wide screening method that identifies mediators of the activation of predetermined receptors in specific cells, for instance tumor cells. Provided are systems, and kits for use in the unbiased genome-wide screening method. Further disclosed herein are compositions that target mediators identified by the screening method described herein. In specific embodiments are compositions useful to boost or restore optimal activation of a predetermined receptor such as Vy9Vd2 TCR.

In certain embodiments are methods of providing effective therapies for conditions that benefit from targeted cell clearance, such as cancer, said methods comprising providing a composition comprising a polypeptide construct described herein, nucleotide encoding the same, or cells expressing the same and optionally at least one agent useful to boost formation of the J-configuration of CD277, or the binding of the polypeptide construct to said J-configuration.

Provided herein is a pharmaceutical composition comprising a polypeptide construct that selectively binds a J-configuration of CD277 on a target cell, and wherein said polypeptide construct is expressed in an engineered cell. In some embodiments, the polypeptide construct binds the J-configuration of CD277 with higher selectivity as compared to a CD277 molecule which is not in said J-configuration. In some

embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a leukemia cell.

In some embodiments, the polypeptide construct comprises at least one of a g-TCR polypeptide sequence or a d-TCR polypeptide sequence, or a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence. In some embodiments, the g -TCR polypeptide sequence is a y9-TCR polypeptide sequence or fragment thereof. In some embodiments, the d -TCR polypeptide sequence is a 02-TCR polypeptide sequence or a fragment thereof. In yet another embodiment, the CD277 is present as a dimer.

Provided herein is a method of treating cancer in a subject comprising providing to the subject an effective amount of a pharmaceutical composition comprising a polypeptide construct that selectively binds CD277 on a cancer cell when said CD277 molecule is in a J-configuration, and wherein said polypeptide construct is optionally expressed in an engineered cell. Further provided herein is a method of clearing cancer cells in a subject in need thereof comprising providing to the subject an effective amount of a

pharmaceutical composition comprising a polypeptide construct that selectively binds CD277 on said cancer cells when said CD277 is in a J-configuration, or an effective amount of engineered cells that express said polypeptide construct.

In an aspect, a method of treating cancer is provided wherein a polypeptide, a nucleic acid molecule, a cell or a population of cells composition are administrated to a subject in need thereof, wherein said polypeptide, nucleic acid molecule, cell or composition are:

(1) a polypeptide, preferably a y chain of a ybTCR or a d chain of a ybTCR or a ybTCR or a fragment thereof comprises a sequence that at least 60% percent identity to a sequence from Table 4 and/or comprises at least 60% percent identity to a sequence generated from primer sequences from Table 3, (2) a nucleic acid molecule encoding a sequence that comprises a sequence that at least 60% percent identity to a sequence from Table 4 and/or comprises a sequence that has at least 60% percent identity to a sequence generated from primer sequences from Table 3,

(3) a cell or a population of cells comprising and/or expressing a polypeptide, preferably a y chain of a ybTCR or a d chain of a ybTCR or a ybTCR or a fragment thereof comprising a sequence that at least 60% percent identity to a sequence from Table 4 and/or comprises at least 60% percent identity to a sequence generated from primer sequences from Table 3, (4) a cell or a population of cells comprising and/or expressing a nucleic acid molecule encoding a sequence that comprises a sequence that at least 60% percent identity to a sequence from Table 4 and/or comprising a sequence that has at least 60% percent identity to a sequence generated from primer sequences from Table 3 and/or

(5) a composition comprising a polypeptide as defined in (1), a nucleic acid molecule as defined in (2) or a cell or a population of cells as defined in (3) or (4).

In an aspect, is provided the polypeptide as defined in (1), the nucleic acid molecule as defined in (2) the cell or the population of cells as defined in (3) or (4) or the composition as defined in (5) for use as a medicament.

In an aspect, is provided a use of the polypeptide as defined in (1), the nucleic acid molecule as defined in (2) the cell or the population of cells as defined in (3) or (4) or the composition as defined in (5) for the manufacture of a medicament for preventing, treating, regressing, curing and/or delaying cancer.

In some cases, the polypeptide construct recognizes the J-configuration of CD277 with higher selectivity as compared to a CD277 molecule which is not in said J-configuration. In some embodiments, the formation of said J-configuration requires at least an interaction of RhoB with CD277 and / or compartmentalization of CD277. In some embodiments, formation of said J-configuration requires interaction of intracellular phosphoantigen with CD277 subsequent to said interaction of RhoB with CD277. In some instances, the polypeptide construct comprises at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence, or a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence.

In some cases, the methods comprise administering an agent that increases translocation of RhoB GTPase to a cell membrane of said cancer cell, or administering an agent that modulates RhoB GTPase, wherein the agent targets at least one of a GTPase activating protein (GAP), a guanine nucleotide exchange factor (GEF), and a guanine nucleotide dissociation inhibitor (GDI). In some instances, the method comprises genotyping the subject for a mutation that correlates with RhoB GTPase expression or activity. In some instances, the method comprises genotyping a gene selected from a gene encoding a protein selected from a GTPase activating protein (GAP), a guanine nucleotide exchange factor (GEF), and a guanine nucleotide dissociation inhibitor (GDI), wherein the protein modulates RhoB GTPase.

Provided herein is a method of engineering T cells comprising a) providing immune-cells expressing low amounts of additional (innate) co-receptors; b) providing a nucleic acid sequence encoding a yO-T-ccll receptor chain, and a nucleic acid sequence encoding a 52- T-cell receptor chain, wherein the yO-T-ccll receptor chain and the 52 -T cell receptor chain selectively bind CD277 when said CD277 is in a J-configuration; and c) introducing the nucleic acid sequences of step b) into the T-cells to provide for an engineered T-cell with a y952T-ccll receptor comprising the yO-T-ccll receptor chain of step b) and the 52- T-cell receptor chain of step b).

Further provided herein is a method of screening a target cell for a genetic or epigenetic variation that results in the lack of T cell receptor recognition comprising a) contacting a cell expressing a T cell receptor with a target cell; b) detecting a level of immune activation of the cell expressing a T cell receptor; c) identifying the target cell as one of i) having the genetic or epigenetic variation when immune activation is below a threshold level; or ii) not having the genetic or epigenetic variation when immune activation is above a threshold level; and d) comparing the target cell genotype to a control genotype when immune activation is below the threshold level to identify the genetic or epigenetic variation.

In some embodiments, the target cell is a cancer cell. In some instances, the T cell receptor is a Vy9V52 T cell receptor. In some cases, detecting the level of immune activation comprises quantifying production of at least one cytokine by the cell expressing a T cell receptor. In some embodiments, the cytokine is at least one of interferon-g and TNF a. In some cases, the genetic or epigenetic variation is a single nucleotide polymorphism. In some cases, the zygosity of the target cell correlates with said having the genetic or epigenetic variation or said not having the genetic or epigenetic variation. In some instances, the method further comprises the step of identifying a gene proximal to the genetic or epigenetic variation. In some cases, the gene is located within about 300,000 base pairs of the genetic or epigenetic variation.

In some embodiments, the method further comprises the step of modulating the expression of the gene and assessing the effects of modulating on the quantity of immune activation of the cell expressing a T cell receptor. In some cases, said modulating comprises knocking out the gene. In some cases, the cell expressing a T cell receptor with a target cell is a T cell. In some instances, the control genotype is a genotype of a control cell, wherein the control cell causes immune activation of the cell expressing a T cell receptor when in contact with the cell expressing a T cell receptor. In some instances, said immune activation of the cell expressing the T cell receptor is

characterized by at least a two-fold increase in production of a cytokine or analogous functional read out. In some instances, said immune activation of the cell expressing the T cell receptor is characterized by at least a ten-fold increase in production of a cytokine or analogous functional read out. In some instances, said immune activation of the cell expressing the T cell receptor is characterized by at least a hundred-fold increase in production of a cytokine or analogous functional read out. In some instances, said contacting comprises adding the cell expressing a T cell receptor and the control cell to the same container. In some instances, contacting comprises adding the cell expressing a T cell receptor and the control cell to the same container.

In some embodiments, the target cell is a B cell leukemia cell line. In some

embodiments, the target cell is an Epstein Barr virus transformed cell. In some embodiments, the genetic mutation is located in a gene encoding a protein that regulates a RhoGTPase. In some instances, the protein is a GTPase activating protein or guanine nucleotide exchange factor. In some cases, the genetic mutation results in reducing or inhibiting interactions between CD277 and RhoB GTPase.

Provided herein is a method comprising a) screening a subject for a mutation in a gene encoding a protein, wherein the protein post-translationally regulates a RhoGTPase in a target cell of the subject; and b) treating the subject with a Vy9V02 TCR+ T cell- mediated therapy when the mutation does not reduce or inhibit formation of a J- configuration in CD277. In some embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a leukemic cell. In some embodiments, the protein is a GTPase activating protein or guanine nucleotide exchange factor. In some embodiments, screening comprises genotyping the gene or a portion thereof. In some embodiments, screening comprises a method selected from nucleic acid amplification, sequencing, and oligonucleotide probe hybridization.

Provided herein is a method of clearing cancer cells in a subject in need thereof comprising a) administering an agent to the subject that increases activity of a RhoB GTPase in a cancer cell of the subject; and b) administering a T cell that expresses a Ug9Ud2 T cell receptor. In some embodiments, the agent increases translocation of the RhoB GTPase to a cell membrane of the cancer cell. In some embodiments, the agent maintains RhoB GTPase at a cell membrane of the cancer cell. In some embodiments, the agent increases translocation of the RhoB GTPase away from a nucleus of the cancer cell. In some embodiments, the agent increases expression of a gene or transcript encoding the RhoB GTPase. In some embodiments, the agent increases stability of the RhoB GTPase. In some embodiments, the agent increases an interaction between the RhoB GTPase and CD277. In some embodiments, the agent activates RhoB GTPase. In some

embodiments, the agent increases an interaction between the RhoB GTPase and GTP. In some embodiments, the agent reduces an interaction between the RhoB GTPase and GDP.

In some cases, the agent increases an amount of GTP in the cancer cell. In some cases, the agent increases availability of GTP in the cancer cell. In some cases, the agent is able to bind a tumour cell of a subject and/or exhibit an anti-tumour activity in said cells of said subject as defined herein. Preferably an anti-tumour response comprises the ability to lyse a tumour cell and/or induce production of IFNy, IL-2 and/or TNFa as defined herein.

In some cases, the agent is conjugated to a moiety that binds a cell surface molecule on the cancer cell, thereby targeting the agent to the cancer cell. In some cases, the moiety comprises a small molecule compound. In some cases, the moiety comprises a peptide.

In some cases, the moiety comprises an antibody or antigen binding fragment. In some cases, the agent increases an amount of an intracellular phosphoantigen in the cancer cell. In some cases, the method comprises administering an additional agent that increases an amount of an intracellular phosphoantigen in the cancer cell. In some instances, the additional agent is a mevalonate pathway inhibitor. In some embodiments, the mevalonate pathway inhibitor is an aminobisphosphonate. In some emobidments, the aminobisphosphonate is at least one of pamidronate and zoledronate. In some cases, the subject has at least one of a solid cancer and leukemia. In some cases, the leukemia is acute myeloid leukemia. In some cases, the subject harbors a mutation in a gene that results in reduced RhoB GTPase expression or activity.

Provided herein is a method of clearing cancer cells in a subject in need thereof comprising: administering an agent to the subject that increases activity of a RhoB GTPase in a cancer cell of the subject. In some instances, the method comprises administering a T cell to the subject. In some instances, the T cell expresses a Ug9Ud2 T cell receptor. In some instances, the T cell has been engineered or genetically modified to express a Vy9V52 T cell receptor. In some instances, the T cell has been engineered or genetically modified to overexpress a Vy9V02 T cell receptor.

Provided herein is a system comprising a polypeptide construct and a cytotoxic cell, wherein the polypeptide construct selectively binds CD277 on a target cell when said CD277 is complexed to RhoB GTPase on said target cell, and wherein said polypeptide construct is expressed in an engineered cell.

Further provided herein is a method for identifying a genetic locus associated with activation of a receptor in a target cell, the method comprising a) identifying cells inducing a phenotype comprising said activation of the receptor in the target cell; b) identifying the zygocity of the cells exhibiting the phenotype; c) obtaining genotype information for the cells, the genotype information defining a genotype at each of multiple loci for different cells; and d) correlating the identified zygocity of the cells with the genotype at one of the multiple loci across the cells to identify the activating genetic locus.

In some embodiments, the genotype information defines a single nucleotide

polymorphism at each of the multiple loci. In some instances, the receptor is a Vy9V52 T cell receptor or fragment thereof. In some cases, the target cell is a cancer cell. In some cases, the target cell is a leukemia cell. In some cases, said phenotype is production of IFNy. In some cases, a gene is located proximal to at least one of the multiple loci. In some cases, said activation of the receptor involves a polypeptide construct of the target cell selectively binding a J-configuration of CD277 on a cell of the cell type. In some cases, said J-configuration is correlated with the activating genetic locus.

Provided herein is a method comprising a) obtaining target cells from a subject; b) contacting said target cells with at least one modified effector cell expressing an exogenous polypeptide construct; c) detecting a level of immune activation of said modified effector cell expressing said polypeptide construct; and d) identifying the target cells as having a nucleotide sequence polymorphism when said immune activation is above a threshold level.

In some cases, one or more of the target cells is a cancer cell. In some cases, the exogenous polypeptide construct comprises a Vy9V52 T cell receptor or fragment thereof. In some cases, said detecting the level of immune activation comprises quantifying production of at least one cytokine by the modified effector cell expressing the exogenous polypeptide construct. In some cases, the cytokine is interferon-g. In some cases, the nucleotide sequence polymorphism is a single nucleotide polymorphism.

In some cases, the method further comprises the step of identifying a gene proximal to the nucleotide sequence polymorphism. In some instances, the gene is located within about 300,000 base pairs of the nucleotide sequence polymorphism. In some embodiments, the method further comprises the step of treating the subject with an effective amount of said exogenous polypeptide construct. In some instances, the modified effector cell expressing the polypeptide construct is a T cell. In some instances, said contacting the target cells with at least one modified effector cell expressing the exogenous polypeptide construct includes contacting a CD277 molecule on the surface of at least one of said target cells with said exogenous polypeptide construct. In some instances, said exogenous polypeptide construct selectively binds a J-configuration of the CD277 molecule.

Provided herein is a method comprising a) obtaining from a subject target cells expressing CD277; b) contacting the target cells with a cell expressing an exogenous polypeptide construct selectively binds a J-configuration of the CD277 molecule; and c) detecting recognition of the J-configuration of the CD277 molecule by the polypeptide construct.

In some embodiments, one or more of the target cells is a cancer cell. In some cases, the polypeptide construct comprises a Vy9V02 T cell receptor or fragment thereof. In some cases, said detecting the recognition of the J-configuration of the CD277 molecule comprises quantifying production of at least one cytokine by the cell expressing the polypeptide construct. In some instances, the cytokine is interferon-g. In some instances, the methods further comprises providing an effective amount of said polypeptide construct to said subject. In some cases, the cell expressing the polypeptide construct is a T cell.

Provided herein is a method of predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing CD277, or an engineered cell expressing the polypeptide construct, the method comprising a) identifying target cells of the patient as having a nucleotide sequence polymorphism associated with the activity of RhoB; and b) predicting the subject to exhibit the positive therapeutic response based on said identifying the target cells as having the nucleotide sequence

polymorphism. In some embodiments, the polypeptide construct recognizes a J- configuration of CD277 and binds to it directly, or indirectly thru one or more additional biological agents.

In some embodiments, the method further comprises administering the polypeptide construct to the subject. In some embodiments, one or more of the target cells is a cancer cell. In some cases, the nucleotide sequence polymorphism is a single nucleotide polymorphism. In some instances, said activity of RhoB is a high activity compared to a RhoB activity in a subject lacking the nucleotide sequence polymorphism. In some cases, the method further comprises the step of predicting a poor therapeutic response in a second subject based on identifying target cells of the second subject as lacking the nucleotide sequence polymorphism.

Provided herein is a method comprising a) obtaining from a first subject a first set of cells expressing a CD277 molecule; b) identifying said first set of cells as having at least one of i) a high activity of RhoB compared to a second set of target cells obtained from a second subject; and ii) a nucleotide sequence polymorphism associated with the high activity of RhoB; and c) administering to said first subject, a polypeptide construct that has selective affinity for the CD277 configuration on said first set of cells as compared to the CD277 configuration on said second group of cells, or an engineered cell expressing said polypeptide construct.

In some cases, one or more of said first group of cells is a cancer cell. In some cases, one or more of the first group of cells is a leukemic cell. In some instances, the CD277 configuration on said first set of cells is the J-configuration. In some embodiments, the nucleotide sequence polymorphism is a single nucleotide polymorphism.

Provided herein is a method of predicting a positive therapeutic response in a subject to treatment with a polypeptide construct capable of recognizing a CD277 molecule, or an engineered cell expressing the polypeptide construct, the method comprising a) obtaining from the subject target cells expressing the CD277 molecule; b) identifying a J- configuration of the CD277 molecule expressed in the target cells; and c) predicting the subject to exhibit the positive therapeutic response based on said identifying the J- configuration of the CD277 molecule.

In some cases, the method further comprises the step of administering the polypeptide construct to the subject. In some cases, the method further comprising the step of predicting a poor therapeutic response in a second subject based on identifying a CD277 molecule of target cells of the second subject as lacking the J-configuration. In some cases one or more of the target cells is a cancer cell. In some cases, the method further comprising the step of identifying a nucleotide sequence polymorphism associated with the activity of RhoB in the target cells. In some instances, said activity of RhoB is a high activity compared to a RhoB activity in a subject lacking the nucleotide sequence polymorphism. In some cases, the nucleotide sequence polymorphism is a single nucleotide polymorphism. In some embodiments, said predicting is based on both said identifying the J-configuration of the CD277 molecule and said identifying the nucleotide sequence polymorphism.

Provided herein is a method of treating a cancer in a subject wherein the subject has cancer cells that are CD277 positive, comprising administering to the subject an effective amount of a pharmaceutical composition comprising a pharmaceutically acceptable agent that selectively binds to the J-configuration or J-confirmation of CD277 on said cancer cell directly, or indirectly thru one or more additional biological agents. In some embodiments, the pharmaceutically acceptable agent comprises a polypeptide construct that selectively binds to the J-configuration of the CD277 on said cancer cell. In some embodiments, the polypeptide construct comprises at least one of a g-TCR polypeptide sequence or a d-TCR polypeptide sequence. In some embodiments, the polypeptide construct comprises a variant or fragment of at least one of a g -TCR polypeptide sequence or a d -TCR polypeptide sequence. In some instances the g -TCR polypeptide sequence is a y9-TCR polypeptide sequence or fragment thereof. In some cases, the d - TCR polypeptide sequence is a 02-TCR polypeptide sequence or a fragment thereof.

In some cases, the pharmaceutically acceptable agent binds the J-configuration of CD277 with higher selectivity as compared to a CD277 molecule which is not in said J- configuration, directly, or indirectly thru one or more additional biological agents. In some embodiments, the target cell is a cancer cell. In some embodiments, the target cell is a leukemia cell. In some cases, the CD277 is present as a dimer.

BRIEF DESCRIPTION OF THE DRAWINGS

The features of the present disclosure are set forth with particularity in the appended claims. A better understanding of the features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

FIG. 1A-1B show CEPH EBV-LCL lines used for identifying genetic loci associated with engineered cells expressing a predetermined receptor, for instance Vy9V02TCR- mediated recognition. FIG. 1A shows recognition phenotype indicating whether EBV- LCL lines are recognized (+) or not (-) by Vy9V62 TCR+ T cells in three independent experiments. FIG. IB shows recognition phenotype of EBV-LCLs (black bars: not activating; grey bars: activating) was assessed by IFNy-ELIspot assay, in which EBV- LCLs were used as targets against Vy9V52TCR+ T cells in the presence of ABP pamidronate. Figure shows the number of IFNy spots of a representative experiment.

FIG. 2A-2C show SNP -Associated computational Pathway Hunt Including shRNA Evaluation (SAPPHIRE) to identify genetic loci associated with the activation of a predetermined receptor in specific cells. FIG. 2A shows the recognition of CEPH EBV- LCL lines by Vy9V52 TCR+ T cells provided the basis for deducing hypothetical zygosities of candidate loci in each cell line (black: recognized; white: not recognized; square: male; circle: female; +/-: heterozygous; / -: homozygous negative; +/:

undetermined). Members of two CEPH families are shown as examples. For CEPH ID numbers of cell lines, see FIG. 1 A. FIG. 2B shows genetic association analysis revealed 17 SNPs of which genotypes correlated 100% (r ² = 1) with predicted zygosities of cell lines. Locations and nearest neighboring genes of SNPs are indicated. The effect of knocking down candidate genes on recognition of EBV-LCL 48 by T cells transduced with either Vy9V52 TCR clone Gl 15 or an HLA-A* 0201 -restricted WTli ₂ 6_i 34-specific aPTCR are indicated by black circles (significant effect on T cell activation) and white circles (no effect). For testing recognition by WT1 aPTCR+ T cells, the EBV-LCL 48 line was pulsed with WTli ₂₆ _i34 peptide. FIG. 2C shows associating SNPs resulting from association analysis with candidate genes. The genetic region of the SNPs neighboring RhoB is shown as an example. Each bar represents one SNP and r ² values represent correlation between predicted zygosities and SNP genotypes.

FIG. 3A shows RhoB was knocked out in 293 HEK cells using CRISPR/Cas system, and single cell clones were selected for stable complete knock out phenotype, and the effect of complete knock out on recognition by Vy9V52 TCR+ T cells was assessed by measuring IFNy (left panel). A guide RNA targeting an irrelevant sequence was used as the control. Level of knock out was determined using intracellular flow cytometry (right panel). Data show mean±S.E.M of two independent experiments in duplicate samples, where Mann- Whitney test was used to analyze statistical significance. FIG. 3B shows Daudi cells were lentivirally transduced with shRNA targeting RhoB, and the effect of RhoB knockdown on recognition of a cell expressing surface CD277, by engineered cells expressing polypeptide constructs described herein was assessed by measuring IFNy (left panel).

Data show mean±S.E.M of three independent experiments in duplicate samples, where Mann- Whitney test was used to analyze statistical significance. A vector encoding an irrelevant shRNA served as negative control. Knock-down level of RhoB was determined by intracellular flow cytometry (right panel) FIG. 3C shows RhoA, B and C were knocked out using CRISPR/Cas system in 293 HEK cells. A guide RNA targeting an irrelevant sequence was used as control. Level of knock out was determined using qPCR. Figure shows a representative experiment. FIG. 3D shows RhoB protein levels were measured in the recognized EBV-LCL lines 48 and 91 and the non-recognized line 22 and 93 by western blot analysis b-tubulin served as the loading control. Figure shows a representative experiment. FIG. 3E shows RhoB protein levels were measured in the recognized EBV-LCL lines 6, 12, 48, 69, 70 and 99 and the non-recognized line 22, 83,

93 and 37 by intracellular flow cytometry analysis. Data show mean±S.E.M of at least three independent experiments. FIG. 3F shows Rho inhibition of 293 HEK cells following C3 -transferase treatment was determined by using G-Lisa. Figure shows a representative experiment of the relative inhibition of RhoA activity compared to untreated sample.

FIG. 4A-4E shows RhoB activity correlates with target cell recognition by engineered cells expressing polypeptide constructs described herein, based on the binding of said polypeptide constructs with the J-configuration of CD277. FIG. 4A shows RhoB was partially knocked out in the renal cancer cell line MZ1851RC using the CRISPR/Cas system. MZ1851RC cells were treated with either pamidronate or HLA-A*0201 - restricted WTli 26+134 peptide and the effect on target cell recognition by engineered cells expressing polypeptide constructs described herein and WT1 o43TCR+ T cells, respectively, was determined by measuring IENg production. A guide RNA targeting an irrelevant sequence was used as control for knock out, while medium or irrelevant peptide loaded tumor cells were used as controls for T cell stimulation. Data show mean±S.E.M of three independent experiments, in duplicate samples. Level of knock out was determined by intracellular flow cytometry. FIG. 4B shows the effect of knock-out of RhoA, B and C in 293 HEK cells on recognition by engineered cells expressing polypeptide constructs described herein was assessed by measuring IENg production. A guide RNA targeting an irrelevant sequence was used as control. Figure shows IFNy production normalized to irrelevant knock out samples of three independent experiments, in duplicate samples. FIG. 4C shows RNA expression of RhoB was measured by qPCR in either non-recognized (black bars) or recognized (white bars) EBV-LCLs and tumor cell lines. Data is representative of 2 repeated experiments. FIG. 4D shows the non- recognized EBV-LCL line 93 or the recognized EBV-LCL 48 were pretreated with either calpeptin or C3 transferase in combination with pamidronate or IPP and the effect on stimulation of Vy9V52 TCR+ T cells was assessed by measuring IENg. The effect of Rho -modulating compounds on recognition of WTli 26+134 peptide-pulsed EBV-LCL 48 cells by WT1 aPTCR+ T cells was measured in parallel. Data shows mean -1(4 S.E.M of at least three independent experiments. FIG. 4E shows HEK 293 cells were transfected with dominant-negative (RhoB-DN), constitutively active (RhoB-CA) or wild type RhoB (RhoB-WT) and the effect of activity variants on target cell recognition by Vy9V52 TCR+ T cells in the presence of pamidronate was determined by measuring IFNy. Figure shows IFNy production normalized to wild type RhoB samples of three independent experiments. Significance of data has been analyzed by Mann- Whitney test on FIGS. 4 A, B and D, and by Knisltal- Wallis test and Dunn's multiple comparison test on FIG. 4E. FIG. 5 shows intracellular distribution of RhoB correlates with the recognition of J- configuration of CD277 in target cells by engineered cells expressing polypeptide constructs described herein. FIG. 5A shows non-recognized healthy T cells, leukemic cell line ML-I and EBV-LCL 93 cells, and recognized leukemia cell line K562, colon carcinoma cell line SW480, EBV-LCL 48 and EBV-LCL 70 cells were treated with pamidronate and loaded onto poly-L-lysine-coated coverslips. Attached cells were fixed and permeabilized, and stained using RhoB-specific antibody followed by an Alexa Fluor 488-conjugated secondary antibody. RhoB distribution was subsequently analyzed by confocal microscopy and representative images are shown (white: RhoB; dark: nucleus [DAPI]). FIG. 5B shows T cells from healthy donors, EBV-LCL line 93, 48 and 70, tumor cell lines ML-I, K562, SW480, Raji, primary AML blasts AML2913, AML2907, AML2889, AML2905, and murine and human DCs were treated with pamidronate and analyzed for the intracellular distribution of RhoB in confocal microscopy. White bars represent target cells with a non-activating phenotype, while black bars indicate target cells that are able to activate engineered cells expressing polypeptide constructs described herein. The RhoB signal ratio between nuclear and extra nuclear cellular compartments was measured using ImageJ image analysis software. Graphs show average ratios of at least 10 different cells +S.E.M. Statistical significance compared to PBL was determined by using Kruskal- Wallis test and Dunn's multiple comparison test. FIG. 5C shows the intracellular RhoB distribution and FIG. 5D the extranuclear/ nuclear RhoB signal ratios, with ABP pamidronate and soluble IPP sensitization for recognized, ABP/IPP-sensitive EBV-LCL 48 analyzed as in A and B. Graphs show average ratios of at least 10 different cells +S.E.M. Statistical significance compared to untreated EBV-LCL 48 was determined by using Mann- Whitney test. FIG. 5E shows the intracellular RhoB distribution in the presence or absence of ABP pamidronate was determined in monocyte derived human dendritic cells from two different donors. Bone marrow derived mouse dendritic cells (>95% CD1 lc+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. Graphs show average ratios of at least 10 different cells +S.E.M. Statistical significance compared to LPS treated human DCs was determined by using Mann- Whitney test. FIG. 5F shows CD34+CD38— leukemic stem cells were sorted from four patients of which leukemic blasts were recognized (AML 2889, AML 1665, AML 2575) and non-recognized (AML 2907), respectively, and the ratios between extranuclear and nuclear RhoB signal was measured. Graphs show average ratios of at least 10 different cells +S.E.M. Statistical significance compared to CD34+CD38— healthy stem cells was determined by using Mann- Whitney test.

FIG. 6A shows representative images for the intracellular distribution of RhoB in recognized and non-recognized primary AML samples. FIG. 6B shows the intracellular RhoA distribution in the presence or absence of ABP pamidronate was measured via confocal microscopy in EBV-LCL 48. FIG. 6C shows the intracellular RhoB distribution in the presence or absence of ABP pamidronate was determined in monocyte derived human dendritic cells from two different donors. Mouse bone marrow derived dendritic cells (>95% CD1 lc+) were treated with ABP pamidronate and used for intracellular labeling of RhoB. FIG. 6D shows the correlation of intracellular RhoB distribution to Vy9V52TCR T cell activation capacity of tumor target cells. Mean values of the extranuclear: nuclear RhoB intensity ratio in tumor cells were plotted against the number of IFNg spots when the same tumor cells were co-cultured with engineered cells expressing polypeptide constructs described herein.

FIG. 7A-7B show RhoB activity modulates CD277 membrane mobility and its association with the actin cytoskeleton, thereby modulating formation of the J- configuration of CD277. FIG. 7A shows HEK 293 cells were transfected with CD277- emGFP fusion constructs and treated with medium, ABP zoledronate, or calpeptin.

Zoledronate treatment was also applied to HEK 293 CD277-emGFP ⁺ cells in which RhoB was knocked out by CRISPR/Cas or in cells that were also treated with C3-transferase. The figure shows the percentage of CD277 immobile fraction upon treatments applied (+). Symbols represent single cell measurements, of 2 experiments. FIG. 7B shows HEK 293 cells were pretreated with pamidronate or with calpeptin and BTN3 molecules and filamentous actin (F-actin) were stained using a fluorescently labeled anti-CD277 antibody and fluorescent phalloidin, respectively. The colocalization of CD277 and F- actin was subsequently assessed by determining the localization correlation of both signals. Symbols represent single cell measurements, of a single experiment. The center line and error bars represent average and S.E.M., p values indicate significance analyzed by using Mann- Whitney test.

FIG. 8A-8E show RhoB interacts with CD277 molecules forming the J-configuration of CD277, and dissociates after phosphoantigen treatment. FIG. 8A shows EBV-FCF 48 cells were treated either with medium or ABP pamidronate, loaded onto poly-F-lysine- coated coverslips and permeabilized. The interaction between RhoB and CD277 was subsequently assessed by Duo link PEA using anti-RhoB and anti-CD277 antibodies. Duolink PEA without antibodies against RhoB and BTN3 served as negative control (red: PLA signal; blue: nucleus [DAPI]; dotted line: cell membrane). Figures are representative of two independent experiments. FIG. 8B shows HEK 293 cells were treated with either medium or pamidronate and co-stained with equal amount of anti-CD277-PE (donor) as well as anti-CD277-DyLight 680 (acceptor) antibodies and FRET efficiency in cells was measured as described in Materials and Methods. Data shown is meanS. E.M. of three independent experiments, in triplicate samples, where Mann- Whitney test was used to analyze statistical significance. FIG. 8C shows HEK 293 cells were pretreated either with medium or pamidronate, trypsinized, permeabilized and stained with anti-RhoB-Alexa Fluor 488 (FRET donor) and anti-CD277-DyLight 680 (FRET acceptor) antibodies.

FRET efficiency was subsequently measured by flow cytometry as described in Materials and Methods. Data show mean+S.E.M of three independent experiments, in triplicate samples, where Mann- Whitney test was used to analyze statistical significance. FIG. 8D shows concentration dependent binding of the full-length CD277 intracellular domain (BFI) with RhoGTPase in the presence or absence of the phosphoantigen cHDMAPP. Binding of BFI to RhoGTPase was measured using Bio layer Interferometry (BM) either in the absence of cHDMAPP (left panel) or presence of cHDMAPP (1 :1) (right panel). Concentrations of CD277 BFI shown in the upper panel are 6.25, 12.5, 25, 50 and 100 mM shown in grey. The kinetics fitting curves are shown as black in the lower panel, concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 mM shown in grey. The kinetics fitting curves are shown as black. FIG. 8E shows the same experimental setup but with recombinant CD277 B30.2 domain, lacking the N terminal region connector to the transmembrane domain. In the left panel, the interaction was measured without cHDMAPP. Concentrations of BTN3A1 B30.2 shown were 12.5, 25, 50, 100 and 200 mM shown in grey. The kinetics fitting curves are shown as black. In the lower panel, the interaction was measured with cHDMAPP (1 : 1). Concentrations of B30.2 domain shown are 3.75, 7.5, 15, 30 and 60 mM shown in grey.

FIG. 9A Gel filtration profile of RhoB GTPase expressed in E coli. The peak from 17.8 ml to 19.2 ml contained purified RhoB GTPase monomer. FIG. 9B shows SDS-PAGE showing the fractions (17.5-19.5 ml, 0.5ml/fraction) containing RhoB GTPase collected from the gel filtration experiment. FIG. 9C shows concentration dependent binding of the full-length CD277 intracellular domain (BFI) with RhoGTPase in the presence or absence of the phosphoantigen IPP (upper panels). Binding of BFI to RhoGTPase was measured using Bio layer Interferometry (BLI) either in the absence of IPP (left panel) or presence of IPP (1 :1) (right panel). Concentrations of CD277 BFI shown are 3.75, 7.5, 15, 30 and 60 mM shown in grey. Same experimental setup but with recombinant CD277 B30.2 domain, lacking the N terminal region connector to the transmembrane domain (lower panels). In the left panel, the interaction was measured without IPP. Concentrations of CD277 B30.2 shown were 3.75, 7.5, 15, 30 and 60 mM shown in grey. In the right panel, the interaction was measured with IPP (1 :1).

FIG. 10 shows intracellular phosphoantigen accumulation induces extracellular conformational changes in CD277, resulting in formation of the J-configuration of CD277. HEK 293 cells were pretreated with medium, C3 transferase and/or pamidronate and the surface membrane of cells was subsequently stained with the fluorescent lipid conjugate BODIPY FL (FRET donor) and BTN3 molecules were labeled with mouse anti-CD277 mAbs originating either from clone 20.1 or from the clone 103.2 followed by staining with secondary Alexa Fluor 594-conjugated Fab fragment (GaM) (FRET acceptor). FRET efficiency was measured by flow cytometry and data represent mean+S.E.M of at least three independent experiments in triplicate samples. Statistical significance of data was analyzed by Mann- Whitney test.

FIG. 11 shows a model of a two-component mechanism in tumor cells that leads to recognition of the J-configuration of CD277 by engineered cells expressing a polypeptide construct described herein TCR. Non-activating phase : no accumulation of

phosphoantigens (pAg, yellow stars, which retains GDP-bound RhoB (red circles+GDP) from extranuclear areas. Activating phase component G. Accumulation of phosphoantigens is followed by more GTP-bound RhoB formation (red circles+GTP). GTP-bound RhoB undergoes subcellular re-compartmentalization (black arrows) accumulating at extranuclear areas and facilitates spatial redistribution of CD277 by promoting cytoskeletal trapping (lines extending from membrane) in the plasma membrane binding to the B30.2 domain proximal connector region (CR) of CD277 (blue

hexagon). Activating phase component It GTP-bound RhoB dissociates (black arrow) from while pAg binds to the B30.2 domain of CD277, which triggers a conformational change of the extracellular region (ER) of CD277, forming the J-configuration of CD277 leading to binding of a polypeptide construct described herein.

FIG. 12A-B show RhoB distribution in various cell types and its change upon cellular stress. In FIG. 12A, EBV-LCL line 93, CLM cell line K562, as well as healthy donor derived CD3+ T cells, CD 19+ B cells and CD 14+ cells freshly isolated from peripheral blood were incubated with 100 mM Pamidronate and subsequently analysed for the intracellular distribution of RhoB via confocal microscopy. Shown is the ratio of RhoB signal detected outside vs inside of the nuclear area. In FIG. 12B, cells irradiated with 3500 cGy and pretreated with 100 mM Pamidronate were subsequently analysed for intracellular RhoB distribution as in FIG. 12A. Ratios indicate RhoB distribution changes when compared to non-irradiated cells.

FIG. 13A shows antitumor reactivity of the isolated clones by IFNy production. T cells were co-incubated overnight with the target cell line Daudi at 1 :1 E:T ratio. Stimulation assay was performed without (upper plot) and in the presence of 100mM PAM (lower plot). Bars are representative of 1 or 2 (where error bars are present) experiments. The error bars represent SEM of the 2 biological replicates. Arrows indicate clones with known TCR sequence. FIG. 13B shows a scatter plot of IFNy production against Daudi vs HEK293FT cell lines without or in the presence of 100 mM PAM. FIG. 13C shows a stimulation assay with HEK293FT cells as targets. FIG. 14A shows the complete TRDV repertoire of the donor C. Percentages indicate prevalence of the clonotypes. Sequences with frequency of 1 read/clonotype are excluded from the analysis. FIG. 14B shows MFI of ydTCR expression of the selected TCRs (n=7) after transduction into PBMCs and selection procedure, next to control TCRs. FIG. 14C shows functional avidity of the selected TCRs in the TEG format against cell line Daudi, next to control TCRs. TEGs were included in the graph based on comparable ydTCR expression.“TEG cells”, i.e.“TEGs”, are T cells engineered to express a defined gd TCR. FIG. 15A shows staining of Daudi cells using TCR tetramers 1*10 ^L 5 Daudi cells (n=4) were stained for 30 minutes at room temperature with 100 nM SA-PE tetramer, either biotin control or containing y5TCR LM1 or CL5, and subsequently stained with fixable viability dye. Cells were incubated with 100 mM pamidronate (+PAM condition) for 2 h before staining. The stained cells were analyzed on a BD FACSCanto II (BD Bioscience). FIG. 15B shows staining of Daudi cells using TCR dextramers. 1*10 ^L 5 Daudi cells (n=4) were stained with 100 nM SA-PE dextramer and analysed in the same manner as in FIG. 15A. FIG. 15C shows staining of Daudi cells using YG-beads. 7.5*10 ^L 4 cells (n=3) were stained with 0.33 mg/ml YG beads (unconjugated or conjugated with ydTCRs LM1, CTE- CL3 or CTE-CL5) and analysed in the same manner as in FIG. 15A. FIG. 15D shows staining of Daudi cells using YG-beads. Binding competition assay using 2 anti-CD277 monoclonal antibodies (20.1 and 103.2). 7.5 10 ⁴ Daudi cells (n=2) were pre-incubated with the antibody and incubated with CL5-beads for 30 minutes at room temperature. All analyses of the FACS data were done in BD FACS Diva and graphs were generated in Graphpad Prism.“CTE” is the abbreviation of Combinatorial T cell receptor Exchange. FIG. 16 shows TEGs expressing either non- functional TCR LM1, intermediate affinity CTE-CL3 or high affinity CTE-CL5 were co-incubated with HEK293FT cells that were either pre-incubated with 100 mM pamidronate or with medium. Co-incubation was done for up to 120 minutes where after the unconjugated cells were washed away. Samples were immunostained with anti-CD3e antibody and DAPI and used for confocal microscopy analysis. Images were quantified with respect to the number of DAPI+ cells (total cells) and CD3 -positive cells (TEGs) and the ratios are represented. Analysis was done on at least ten independent images and significance was determined by non- parametric ANOVA. Results show individual measurements including mean and SD values.

FIG. 17A shows immunological synapse and quantification method. FIG. 17B shows enrichment of TCR in IS was determined by calculating the ratio of TCR signal intensity inside vs outside of synapse area. Analysis was done on at least seven independent images and significance was determined by non-parametric ANOVA. Results show individual measurements including mean and SD values. FIG. 17C and FIG. 17D show cluster size of target HEK-293FT tumor cells were either treated with lOOuM pamidronate or with medium and immunostained with CD277-AF647. Samples were subsequently used for analysis with super-resolution microscopy. Images were analysed with cluster algorithm DBSCAN. FIG. 17E shows cluster compactness of immunological synapses. FIG. 17F shows number of clusters per ROI.

FIG. 18A shows staining ofMFl cells using TCR tetramers. 1*10 ^L 5 MF1 cells (n=4) were stained for 30 minutes at room temperature with 100 nM SA-PE tetramer, either biotin control or containing ydTCR“FM1” or“CF5”, and subsequently stained with fixable viability dye. The stained cells were analyzed on a BD FACSCanto II (BD

Bioscience). FIG. 18B shows staining ofMFl cells using dextramers. 1*10 ^L 5 MF1 cells (n=4) were stained with 100 nM SA-PE dextramer. FIG. 18C and FIG. 18D show staining ofMFl cells using YG-beads. 7.5*10 ^L 4 MF1 cells (n=3) were stained with 0.33 mg/ml YG beads (unconjugated or conjugated with ydTCR“FM1”,“CTE CF3” or“CTE CL5”).

FIG. 19 shows representative flow cytometry dot plots of Daudi and ML1 cells stained with sTCR-conjugated beads.

Fig. 20 A-F show the percentage of lysed target cells (“% lysis”) in the presence (“Al”) or absence (“untr.”) of g9d2 TEG-A1 cells as determined by xCELLigence . As a positive control, target cells were co-cultured with g9d2 TEG-C15 cells (“05”, also referred to as Clone 5). Target cells (MZ1851RC, MCF-12F, Caki-2, MDA-MB-231, SK-CO-l or HT- 29) and effector cells (g9d2 TEG-A1) were co-cultured in a ratio of 1 : 1 for 72 hours. Co culture was done in the present or absence of 10 mM pamidronate (PAM), and/or in the presence or absence of CD277 blocking antibody 103.2, and/or in the presence or absence of CD277 activating antibody 20.1.

Fig. 21 A-F show the percentage of lysed target cells (“% lysis”) in the presence (“A3”) or absence (“untr.”) of g9d2 TEG- A3 cells as determined by xCELLigence . As a positive control, target cells were co-cultured with g9d2 TEG-C15 cells ((“05”, also referred to as Clone 5). Target cells (MZ1851RC, MCF-12F, Caki-2, MDA-MB-231, SK-CO-l or HT- 29) and effector cells (g9d2 TEG- A3) were co-cultured in a ratio of 1 : 1 for 72 hours. Co- culture was done in the present or absence of 10 mM pamidronate (PAM), and/or in the presence or absence of CD277 blocking antibody 103.2, and/or in the presence or absence of CD277 activating antibody 20.1.

Fig. 22 A-F show the percentage of lysed target cells (“% lysis”) in the presence (“03”) or absence (“untr.”) of g9d2 TEG-C13 cells as determined by xCELLigence. As a positive control, target cells were co-cultured with g9d2 TEG-C15 cells (((“05”, also referred to as Clone 5). Target cells (MZ1851RC, MCF-12F, Caki-2, MDA-MB-231, SK-CO-l or HT- 29) and effector cells (g9d2 TEG-C13) were co-culutered in a ratio of 1 : 1 for 72 hours. Co-culture was done in the presence or absence of 10 mM pamidronate (PAM), and/or in the presence or absence of CD277 blocking antibody 103.2, and/or in the presence or absence of CD277 activating antibody 20.1.

Fig. 23 A-F shows the level of IFN-g production (pg/mL) as determined by ELISA when co-culturing target cells in the presence (“Al”) or absence (“untr”) of g9d2 TEG-A1 cells. As a positive control, target cells were co-cultured with g9d2 TEG-C15 cells (“05”, also referred to as Clone 5). Target cells (MZ1851RC, MCF-12F, Caki-2, MDA-MB-231, SK- CO-l or HT-29) were co-cultured in a ratio of 1 : 1 for 72 hours. The co-culture was done in the presence or absence of 10 mM pamidronate (PAM), and/or in the presence or absence of CD277 blocking antibody 103.2, and/or in the presence or absence of CD277 activating antibody 20.1.

Fig. 24 A-F shows the level of IFN-g production (pg/mL) as determined by ELISA when co-culturing target cells in the presence (“A3”) or absence (“untr”) of g9d2 TEG-A3 cells. As a positive control target cells were co-cultured with g9d2 TEG-C15 cells (“05”, also referred to as Clone 5). Target cells (MZ1851RC, MCF-12F, Caki-2, MDA-MB-231, SK- CO-l or HT-29) were co-cultured in a ratio of 1 : 1 for 72 hours. The co-culture was done in the presence or absence of 10 mM pamidronate (PAM), and/or in the presence or absence of CD277 blocking antibody 103.2, and/or in the presence or absence of CD277 activating antibody 20.1.

Fig. 25 shows the level of IFN-g production (pg/mL) as determined by ELISA when co- culturing Daudi cells with g9d2 TEG-A1 (panel A) or g9d2 TEG-A6 cells (panel B) compared to untreated Daudi cells (“Untr.”). As a positive control, target cells were co- cultured with g9d2 TEG-C15 cells ((“05”, also referred to as Clone 5). Target cells (Daudi cells) were co-cultured in a ratio of 1 : 1 for 24 hours. The co-culture was done in the presence or absence of 10 mM pamidronate (PAM).

DETAILED DESCRIPTION OF THE INVENTION

In an aspect, provided herein are T cells that elicit robust antitumor responses. This antitumor response is comparable or stronger than the one elicited by control sequences known in the art as clone 3, clone 5 or Gl 15 as disclosed in WO 2013/147606 and WO 2017/212074. An antitumor response may be mediated by binding between an immune cell expressing a receptor, such as a g9d2 TCR, and a target, such as a tumor cell. The binding of a tumor cell to an immune cell may be bolstered by improved receptor-target interactions. Throughout, the application the agent (i.e. a y chain of a y TCR, a d chain of a y TCR, a ydTCR or fragment thereof, a polypeptide construct, a corresponding nucleic acid, nucleic acid construct, cell, population of cells, composition) may be able to bind a tumour cell of a subject and/or exhibit an anti-tumour activity in cells of a subject as defined herein. The antitumor activity of several agents has been tested in different cells and all agents exhibit such activity. Preferably an anti-tumour response or activity comprises the ability to lyse a tumour cell and/or induce production of IFNy, IL-2 and/or TNFa as defined herein

In an aspect, provided herein can be compositions and methods that bolster binding between a target and an immune cell expressing a g9d2 TCR. In an aspect, a method can comprise increasing activity of a RhoB GTPase. In an aspect, a method can comprise increasing activity, such as accumulation, of a phosphoantigen. RhoB GTPase and phosphoantigen can be involved in bolstering expression of CD277 of a tumor cell surface thereby improving or allowing for an interaction between a tumor cell expressing CD277 and an immune cell comprising a g9d2 TCR. In an aspect, provided herein can be methods comprising improving an inside-out signaling of a tumor cell thereby allowing it to be recognized by immune cells. In an aspect, provided herein can be agents that enhance an inside out signaling of at umor cell by bolstering an expression of CD277 on a surface. Agents can act directly on CD277 or indirectly. Expression of CD277 can be bolstered by stimulating RhoB GTPase and phosphoantigena in a tumor cell. In an aspect, agents can act directly on RhoB GTPase or indirectly. In an aspect, agents can act directly on phosphoantigen or indirectly. In an aspect, an agent that can increase activity of RhoB GTPase, phosphoantigen, or a combination thereof can act indirectly or directly. In an aspect, an agent that can increase activity of RhoB GTPase, phosphoantigen, or a combination thereof can bind secondary factors that in turn increase activity of RhoB GTPase and/or phosphoantigen. In an aspect, an agent that can increase activity of RhoB GTPase, phosphoantigen, or a combination thereof can bind a number of upstream factors that in turn increase activity of RhoB GTPase and/or phosphoantigen. In an aspect, up to 10 factors upstream of RhoB GTPase or phosphoantigen can be stimulated and in turn actibity of RhoB GTPase and/or phosphoantigen is increased.

In an aspect, provided herein can be compositions of immune cells comprising g9d2 TCRs and compositios comprising agents that increase activity of RhoB GTPase and phosphoantigen. In an aspect, a y952TCR-mediated response can be enhanced by agents such as pamidronate, and alternatively through the expression of additional adhesion agents. In some aspects, activation can be followed by a recognition of a target, such as a cancerous cell expressing CD277. Recognition of a target may be mediated by the CDR3 region of the y952TCR, as well as configurational changes in CD277. In some aspects, T cell activation may utilize membrane flexibility to form a synapse comprising a T cell and a tumor cell. In some aspects, T cell activation may comprise microclustering of CD277 at a cell membrane through the interaction of a y902TCR.

All terms are intended to be understood as they would be understood by a person skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the disclosure pertains.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.

Although various features of the invention may be described in the context of a single embodiment, the features may also be provided separately or in any suitable combination. Conversely, although the invention may be described herein in the context of separate embodiments for clarity, the invention may also be implemented in a single embodiment. The following definitions supplement those in the art and are directed to the current application and are not to be imputed to any related or unrelated case, e.g., to any commonly owned patent or application. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present disclosure, the preferred materials and methods are described herein. Accordingly, the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification, the singular forms“a,”“an” and“the” include plural referents unless the context clearly dictates otherwise. In this application, the use of“or” means“and/or” unless stated otherwise. Furthermore, use of the term“including” as well as other forms, such as“include”,“includes,” and “included,” is not limiting.

The term“autologous” and its grammatical equivalents as used herein can refer to as originating from the same being. For example, a sample ( e.g ., cells) can be removed, processed, and given back to the same subject (e.g., patient) at a later time. An autologous process is distinguished from an allogenic process where the donor and the recipient are different subjects.

The term“activation” and its grammatical equivalents as used herein can refer to a process whereby a cell transitions from a resting state to an active state. This process can comprise a response to an antigen, migration, and/or a phenotypic or genetic change to a functionally active state. For example, the term“activation” can refer to the stepwise process of T cell activation. For example, a T cell can require at least two signals to become fully activated. The first signal can occur after engagement of a TCR by the antigen-MHC complex, and the second signal can occur by engagement of co-stimulatory molecules. Anti-CD3 can mimic the first signal and anti-CD28 can mimic the second signal in vitro.

Reference in the specification to“some embodiments,”“an embodiment,”“one embodiment” or“other embodiments” means that a particular feature, structure, or characteristic described in connection with the embodiments is included in at least some embodiments, but not necessarily all embodiments, of the inventions.

As used in this specification and claim(s), the words“comprising” (and any form of comprising, such as“comprise” and“comprises”),“having” (and any form of having, such as“have” and“has”),“including” (and any form of including, such as“includes” and“include”) or“containing” (and any form of containing, such as“contains” and “contain”) are inclusive or open-ended and do not exclude additional, unrecited elements or method steps. It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. Furthermore, compositions of the invention can be used to achieve methods of the invention.

The term“about” in relation to a reference numerical value and its grammatical equivalents as used herein can include the numerical value itself and a range of values plus or minus 10% from that numerical value. For example, the amount“about 10” includes 10 and any amounts from 9 to 1 1. For example, the term“about” in relation to a reference numerical value can also include a range of values plus or minus 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1% from that value.

The term“cytotoxicity” as used in this specification, refers to an unintended or undesirable alteration in the normal state of a cell. The normal state of a cell may refer to a state that is manifested or exists prior to the cell’s exposure to a cytotoxic composition, agent and/or condition. Generally, a cell that is in a normal state is one that is in homeostasis. An unintended or undesirable alteration in the normal state of a cell can be manifested in the form of, for example, cell death (e.g., programmed cell death), a decrease in replicative potential, a decrease in cellular integrity such as membrane integrity, a decrease in metabolic activity, a decrease in developmental capability, or any of the cytotoxic effects disclosed in the present application.

By“isolated” is meant the removal of a nucleic acid from its natural environment. By “purified” is meant that a given nucleic acid, whether one that has been removed from nature (including genomic DNA and mR A) or synthesized (including cDNA) and/or amplified under laboratory conditions, has been increased in purity, wherein“purity” is a relative term, not“absolute purity.” It is to be understood, however, that nucleic acids and proteins can be formulated with diluents or adjuvants and still for practical purposes be isolated. For example, nucleic acids typically are mixed with an acceptable carrier or diluent when used for introduction into cells.

The term“percent (%) identity,” as used herein, refers to the percentage of amino acid (or nucleic acid) residues of a candidate sequence that are identical to the amino acid (or nucleic acid) residues of a reference sequence after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity (i.e., gaps can be introduced in one or both of the candidate and reference sequences for optimal alignment and non-homo logous sequences can be disregarded for comparison purposes). Alignment, for purposes of determining percent identity, can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN, or Megalign (DNASTAR) software. Percent identity of two sequences can be calculated by aligning a test sequence with a comparison sequence using BLAST, determining the number of amino acids or nucleotides in the aligned test sequence that are identical to amino acids or nucleotides in the same position of the comparison sequence, and dividing the number of identical amino acids or nucleotides by the number of amino acids or nucleotides in the comparison sequence.

“Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Similarity" can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988). Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide-containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to Ser; Arg to Lys; Asn to Gln or His; Asp to Glu; Cys to Ser or Ala; Gln to Asn; Glu to Asp; Gly to Pro; His to Asn or Gln; Ile to Leu or Val; Leu to Ile or Val; Lys to Arg, Gln or Glu; Met to Leu or Ile; Phe to Met, Leu or Tyr; Ser to Thr; Thr to Ser; Trp to Tyr; Tyr to Trp or Phe; and Val to Ile or Leu.

The term“peripheral blood lymphocytes” (PBL) and its grammatical equivalents as used herein can refer to lymphocytes that circulate in the blood ( e.g ., peripheral blood).

Peripheral blood lymphocytes can refer to lymphocytes that are not localized to organs. Peripheral blood lymphocytes can comprise T cells, NK cells, B cell, or any combinations thereof.

The term“phenotype” and its grammatical equivalents as used herein can refer to a composite of an organism’s observable characteristics or traits, such as its morphology, development, biochemical or physiological properties, phenology, behavior, and products of behavior. Depending on the context, the term“phenotype” can sometimes refer to a composite of a population’s observable characteristics or traits.

“Polynucleotide” or“oligonucleotide” or“nucleic acid molecule”or“nucleic acid” as used herein refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. A nucleic acid molecule is therefore represented by a nucleic acid or nucleotide sequence. This term refers only to the primary structure of the molecule. Thus, this term includes double and single stranded DNA, triplex DNA, as well as double and single stranded RNA. It also includes modified, for example, by methylation and/or by capping, and unmodified forms of the polynucleotide. The term is also meant to include molecules that include non-naturally occurring or synthetic nucleotides as well as nucleotide analogs.

The term“peripheral blood lymphocytes” (PBL) and its grammatical equivalents as used herein can refer to lymphocytes that circulate in the blood (e.g., peripheral blood).

Peripheral blood lymphocytes can refer to lymphocytes that are not localized to organs. Peripheral blood lymphocytes can comprise T cells, NK cells, B cell, or any combinations thereof.

“Polypeptide” is used interchangeably with the terms“polypeptides” and“protein(s),” and refers to a polymer of amino acid residues. A polypeptide or a protein or a polypeptide construct is therefore represented by an amino acid sequence. A“mature protein” is a protein which is full-length and which, optionally, includes glycosylation or other modifications typical for the protein in a given cellular environment. Throughout the application, each nucleic acid molecule or polypeptide or polypeptide construct or nucleic acid construct as identified herein by a given Sequence Identity Number (SEQ ID NO) is not limited to this specific sequence as disclosed herein unless otherwise indicated.

Nucleic acids and/or nucleic acid sequences are“homologous” when they are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. Proteins and/or protein sequences are homologous when their encoding DNAs are derived, naturally or artificially, from a common ancestral nucleic acid or nucleic acid sequence. The homologous molecules can be termed homologs. For example, any naturally occurring proteins, as described herein, can be modified by any available mutagenesis method. When expressed, this mutagenized nucleic acid encodes a polypeptide that is homologous to the protein encoded by the original nucleic acid.

Homology is generally inferred from sequence identity between two or more nucleic acids or proteins (or sequences thereof). The precise percentage of identity between sequences that is useful in establishing homology varies with the nucleic acid and protein at issue, but as little as 25% sequence identity is routinely used to establish homology. Higher levels of sequence identity, e.g., 30%, 40%, 41%, 42%, 43%, 44%, 45%, 46%,

47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%,

62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%,

77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%,

92%, 93%, 94%, 95%. 96%, 97%, 98% or 99% or more can also be used to establish homology. Higher levels of sequence identity, e.g. 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more can also be used to establish homology.

The terms“identical” or“sequence identity” in the context of two nucleic acid sequences or amino acid sequences of polypeptides refers to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window. In one class of embodiments, the polypeptides herein are at least 80%, 85%, 90%, 98% 99% or 100% identical to a reference polypeptide, or a fragment thereof, e.g., as measured by BLASTP (or CLUSTAL, or any other available alignment software) using default parameters. Similarly, nucleic acids can also be described with reference to a starting nucleic acid, e.g., they can be 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%,

48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,

78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%,

93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% can also be used to establish

homology.identical to a reference nucleic acid or a fragment thereof, e.g., as measured by BLASTN (or CLUSTAL, or any other available alignment software) using default parameters (preferably nucleic acids can also be described with reference to a starting nucleic acid, e.g. they can be 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more). When one molecule is said to have certain percentage of sequence identity with a larger molecule, it means that when the two molecules are optimally aligned, said percentage of residues in the smaller molecule finds a match residue in the larger molecule in accordance with the order by which the two molecules are optimally aligned. The term“T cell” and its grammatical equivalents as used herein can refer to a T cell from any origin. For example, a T cell can be a primary T cell, e.g., an autologous T cell, a cell line, etc. The T cell can also be human or non- human.

The term“TIL” or tumor infiltrating lymphocyte and its grammatical equivalents as used herein can refer to a cell isolated from a tumor. For example, a TIL can be a cell that has migrated to a tumor. A TIL can also be a cell that has infiltrated a tumor. A TIL can be any cell found within a tumor. For example, a TIL can be a T cell, B cell, monocyte, natural killer (NK) cell, or any combination thereof. A TIL can be a mixed population of cells. A population of TILs can comprise cells of different phenotypes, cells of different degrees of differentiation, cells of different lineages, or any combination thereof.

“Transposon” or“transposable element” (TE) is a vector DNA sequence that can change its position within the genome, sometimes creating or reversing mutations and altering the cell’s genome size. Transposition often results in duplication of the TE. Class I TEs are copied in two stages: first, they are transcribed from DNA to R A, and the RNA produced is then reverse transcribed to DNA. This copied DNA is then inserted at a new position into the genome. The reverse transcription step is catalyzed by a reverse transcriptase, which can be encoded by the TE itself. The characteristics of

retrotransposons are similar to retroviruses, such as HIV. The cut-and-paste transposition mechanism of class II TEs does not involve an RNA intermediate. The transpositions are catalyzed by several transposase enzymes. Some transposases non-specifically bind to any target site in DNA, whereas others bind to specific DNA sequence targets. The transposase makes a staggered cut at the target site resulting in single-strand 5’ or 3’ DNA overhangs (sticky ends). This step cuts out the DNA transposon, which is then ligated into a new target site; this process involves activity of a DNA polymerase that fills in gaps and of a DNA ligase that closes the sugar-phosphate backbone. This results in duplication of the target site. The insertion sites of DNA transposons can be identified by short direct repeats which can be created by the staggered cut in the target DNA and filling in by DNA polymerase, followed by a series of inverted repeats important for the TE excision by transposase. Cut-and-paste TEs can be duplicated if their transposition takes place during S phase of the cell cycle when a donor site has already been replicated, but a target site has not yet been replicated. Transposition can be classified as either “autonomous” or“non-autonomous” in both Class I and Class II TEs. Autonomous TEs can move by themselves while non-autonomous TEs require the presence of another TE to move. This is often because non-autonomous TEs lack transposase (for class II) or reverse transcriptase (for class I).

“Transposase” refers an enzyme that binds to the end of a transposon and catalyzes the movement of the transposon to another part of the genome by a cut and paste mechanism or a replicative transposition mechanism. In some embodiments, the transposase’s catalytic activity can be utilized to move gene(s) from a vector to the genome.

The nucleic acid sequences and vectors disclosed or contemplated herein can be introduced into a cell by“transfection,”“transformation,”“nucleofection� � or

“transduction.”“Transfection,”“transformation,� �� or“transduction,” as used herein, refer to the introduction of one or more exogenous polynucleotides into a host cell by using physical or chemical methods. Many transfection techniques are known in the art and include, for example, calcium phosphate DNA co-precipitation (see, e.g., Murray E. J. (ed.), Methods in Molecular Biology, Vol. 7, Gene Transfer and Expression Protocols, Humana Press (1991)); DEAE-dextran; electroporation; cationic liposome-mediated transfection; tungsten particle-facilitated microparticle bombardment (Johnston, Nature, 346: 776-777 (1990)); and strontium phosphate DNA co -precipitation (Brash et ah, Mol. Cell Biol., 7: 2031-2034 (1987)); and nucleofection (Trompeter et ah, J. Immunol.

Methods 274:245-256 (2003). Phage or viral vectors can be introduced into host cells, after growth of infectious particles in suitable packaging cells, many of which are commercially available.

“Promoter” refers to a region of a polynucleotide that initiates transcription of a coding sequence. Promoters are located near the transcription start sites of genes, on the same strand and upstream on the DNA (towards the 5’ region of the sense strand). Some promoters are constitutive as they are active in all circumstances in the cell, while others are regulated becoming active in response to specific stimuli, e.g., an inducible promoter. The term“promoter activity” refers to the extent of expression of nucleotide sequence that is operably linked to the promoter whose activity is being measured. Promoter activity can be measured directly by determining the amount of RNA transcript produced, for example by Northern blot analysis or indirectly by determining the amount of product coded for by the linked nucleic acid sequence, such as a reporter nucleic acid sequence linked to the promoter.

“Inducible promoter” as used herein refers to a promoter which is induced into activity by the presence or absence of transcriptional regulators, e.g., biotic or abiotic factors.

Inducible promoters are useful because the expression of genes operably linked to them can be turned on or off at certain stages of development of an organism or in a particular tissue. Examples of inducible promoters are alcohol-regulated promoters, tetracycline- regulated promoters, steroid-regulated promoters, metal-regulated promoters,

pathogenesis-regulated promoters, temperature-regulated promoters and light-regulated promoters. In one embodiment, the inducible promoter is part of a genetic switch.

The term“enhancer,” as used herein, refers to a DNA sequence that increases

transcription of, for example, a nucleic acid sequence to which it is operably linked.

Enhancers can be located many kilobases away from the coding region of the nucleic acid sequence and can mediate the binding of regulatory factors, patterns of DNA methylation, or changes in DNA structure. A large number of enhancers from a variety of different sources are well known in the art and are available as or within cloned polynucleotides (from, e.g., depositories such as the ATCC as well as other commercial or individual sources). A number of polynucleotides comprising promoters (such as the commonly- used CMV promoter) also comprise enhancer sequences. Enhancers can be located upstream, within, or downstream of coding sequences. The term“Ig enhancers” refers to enhancer elements derived from enhancer regions mapped within the immunoglobulin (Ig) locus (such enhancers include for example, the heavy chain (mu) 5’ enhancers, light chain (kappa) 5’ enhancers, kappa and mu intronic enhancers, and 3’ enhancers (see generally Paul W. E. (ed), Fundamental Immunology, 3rd Edition, Raven Press, New York (1993), pages 353-363; and U.S. Pat. No. 5,885,827).

“Coding sequence” as used herein refers to a segment of a polynucleotide that codes for a polypeptide. The region or sequence is bounded nearer the 5’ end by a start codon and nearer the 3’ end with a stop codon. Coding sequences can also be referred to as open reading frames.

“Operably linked” as used herein refers to refers to the physical and/or functional linkage of a DNA segment to another DNA segment in such a way as to allow the segments to function in their intended manners. A DNA sequence encoding a gene product is operably linked to a regulatory sequence when it is linked to the regulatory sequence, such as, for example, promoters, enhancers and/or silencers, in a manner which allows modulation of transcription of the DNA sequence, directly or indirectly. For example, a DNA sequence is operably linked to a promoter when it is ligated to the promoter downstream with respect to the transcription initiation site of the promoter, in the correct reading frame with respect to the transcription initiation site and allows transcription elongation to proceed through the DNA sequence. An enhancer or silencer is operably linked to a DNA sequence coding for a gene product when it is ligated to the DNA sequence in such a manner as to increase or decrease, respectively, the transcription of the DNA sequence. Enhancers and silencers can be located upstream, downstream or embedded within the coding regions of the DNA sequence. A DNA for a signal sequence is operably linked to DNA coding for a polypeptide if the signal sequence is expressed as a preprotein that participates in the secretion of the polypeptide. Linkage of DNA sequences to regulatory sequences is typically accomplished by ligation at suitable restriction sites or via adapters or linkers inserted in the sequence using restriction endonucleases known to one of skill in the art.

The term“transcriptional regulator” refers to a biochemical element that acts to prevent or inhibit the transcription of a promoter-driven DNA sequence under certain environmental conditions (e.g., a repressor or nuclear inhibitory protein), or to permit or stimulate the transcription of the promoter-driven DNA sequence under certain environmental conditions (e.g., an inducer or an enhancer).

The term“induction” refers to an increase in nucleic acid sequence transcription, promoter activity and/or expression brought about by a transcriptional regulator, relative to some basal level of transcription.

A“target” gene or“heterologous” gene, or“gene of interest (GOI)” refers to a gene introduced into the host cell by gene transfer. In certain cases, a polypeptide construct described herein is encoded in an engineered cell as one or more heterologous genes. "Recombinase" as used herein refers to a group of enzymes that can facilitate site-specific recombination between defined sites, where the sites are physically separated on a single DNA molecule or where the sites reside on separate DNA molecules. The DNA sequences of the defined recombination sites are not necessarily identical. Initiation of recombination depends on protein-DNA interaction, within the group there are large number of proteins that catalyze phage integration and excision (e.g., l integrase, j>C3l), resolution of circular plasmids (e.g., Tn3, gamma delta, Cre, Flp), DNA inversion for expression of alternate genes (e.g., Hin, Gin, Pin), assembly of genes during development (e.g., Anabaena nitrogen fixation genes), and transposition (e.g., IS607 transposon). Most site-specific recombinases fall into one of the two families, based on evolutionary and mechanistic relatedness. These are l integrase family or tyrosine recombinases (e.g., Cre, Flp, Xer D) and resolvase/integrase family or serine recombinase family (e.g., j>C3l, TP901-1, Tn3, gamma delta).

"Recombination attachment sites" are specific polynucleotide sequences that are recognized by the recombinase enzymes described herein. Typically, two different sites are involved (termed "complementary sites"), one present in the target nucleic acid (e.g., a chromosome or episome of a eukaryote or prokaryote) and another on the nucleic acid that is to be integrated at the target recombination site. The terms "attB" and "attP," which refer to attachment (or recombination) sites originally from a bacterial target and a phage donor, respectively, are used herein although recombination sites for particular enzymes can have different names. The recombination sites typically include left and right arms separated by a core or spacer region. Thus, an attB recombination site consists of BOB', where B and B' are the left and right arms, respectively, and O is the core region.

Similarly, attP is POP', where P and P' are the arms and O is again the core region. Upon recombination between the attB and attP sites, and concomitant integration of a nucleic acid at the target, the recombination sites that flank the integrated DNA are referred to as "attL" and "attR." The attL and attR sites, using the terminology above, thus consist of BOP' and POB', respectively. In some representations herein, the "O" is omitted and attB and attP, for example, are designated as BB’ and PP’, respectively.

As used herein, the term“CRISPR” refers to a caspase-based endonuclease comprising a caspase, such as Cas9, and a guide RNA that directs DNA cleavage of the caspase by hybridizing to a recognition site in the genomic DNA.

The term“distressed cell” or“stressed cell” as used herein refers to a cell which manifests a diseased or disordered state. Manifestations of distress can include any alteration in cellular function relative to a normal or non-stressed state including changes in gene transcription or translation, post-transcriptional or post-translational modifications, protein or enzyme activities, polypeptide conformations, cell adhesion, cell surface characteristics, and the capacity to recognize or be recognized by other cells. In some embodiments, a particular phenotype of a distressed cell (e.g. altered pattern of gene expression) is related to an intracellular abnormality such as a genetic mutation. In other embodiments, a phenotype of a distressed cell is related to abnormalities or stressors in the extracellular environment. An example of a distressed cell is a tumor cell. In specific embodiments, a distressed cell can be characterized by a transmigration of RhoB to the cell membrane. In certain cases, a distressed cell is characterized by the presence of the J- configuration of CD277 on the cell surface.

The term“epigenetic change” or“epigenetic modification” as used herein refers to any covalent or non-covalent modification of DNA other than a change in DNA sequence. In certain embodiments, an epigenetic change affects or alters the regulation and/or expression of one or more genes. It is contemplated that an epigenetic change can impact regulation of genes which are relatively proximal (e.g. within lMbp) to a chromosomal site of an epigenetic modification as well as distal (e.g. greater than lMbp away along the same chromosome or on a different chromosome) to the site of the epigenetic

modification. Non-limiting examples of an epigenetic change include DNA methylation and hydroxymethylation, histone modifications such as lysine acetylation, lysine and arginine methylation, serine and threonine phosphorylation, and lysine ubiquitination and sumoylation, and changes in chromatin structure.

In an aspect, provided can be compositions comprising gdT cells. A gdT can be an unconventional T cell population expressing a gd T cell receptor. A gdT can be a merge of TCR-secured specificity and broad non HLA-restricted antitumor reactivity, the characteristics which may open a new avenue in cancer immunotherapy. For instance, detection of tumor-infiltrating gdT cells has been associated with a positive clinical outcome in cancer patients. In an aspect, gdT cells can be involved in early cancer immune surveillance. In an aspect, gdT can be heterogeneous in terms of function and receptor expression. In an aspect, a ydTCR can be introduced into an immune cell. For example, a ydTCR can be introduced into an abT cell. In an aspect, a method comprising introducing a ydTCR into an immune cell, such as an abT cell can improve persistence of a ydTCR-bascd therapeutic. In an aspect, a method comprising introducing a ydTCR into an immune cell, such as an abT cell can improve proliferation of a ydTCR-bascd therapeutic. In an aspect, a method comprising introducing a gόT C R into an immune cell, such as an abT cell can overcome clonal heterogeneity of tumor cells in patients with advanced cancer, an improvement over c$TCR-based approaches. In an aspect, this improvement may be due to the distinct HLA- independent activation cues of the ybTCR, such as changes in lipid metabolism. In an aspect, a ybTCR therapeutic may be administered to a subject comprising a cancer with a low mutational load.

In an aspect, provided herein can be a ybTCR therapeutic that binds a target, such as CD277 on a cancer cell. Binding of a ydTCR therapeutic can comprise spatial and/or conformational changes in CD277 expressed on a target. In an aspect, binding can refer to a direct interaction. In an aspect, binding can refer to an indirect interaction. Binding can refer to an agent that binds upstream of CD277. In an aspect, an agent that binds upstream of CD277 can bind from about 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 factor away from CD277. In some aspects, a cascade of events leading to the activating state of CD277, referred to as a J-configuration of CD277, or CD277J, can induce TCR-dependent g9d2T cell activation.

In an aspect, diversity in the CDR3 region of y952TCR can contribute to the functional heterogeneity within the g9d2 T cell population as well as the expression of additional co receptors. In an aspect, functional heterogeneity within a g9d2 T cell population can be attributed to distinct phenotypic and transcriptional profiles. In an aspect, there can be clonal levels of different activation thresholds harbored within diverse g9d2T cell repertoires towards tumor cells. By expressing ydTCRs in abT cells, there can exist variation in function of a g9d2 T cell clone. In some aspect, this variation may not be solely correlated to functional avidities mediated by distinct y902TCR. In an aspect, there can be a low affinity interaction of y902TCR with CD277J. In an aspect, there can be an initial scanning mode of the ydTCR towards its target. This initial scanning can be CDR3- independent and can utilize other contact residues of the ybTCR. In an aspect, a scanning can also utilize pamidronate induced adhesion molecules. A scanning mode can be followed by a CDR3 -dependent cognate recognition, which can utilize membrane flexibility of the y902TCR and high-density recruitment during synapse formation to allow sensing the nano-clusters consisting of CD277J-configuration and possible additional membrane molecules at the target side. In an aspect, a TCR can comprise a percent identity from about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to a sequence in Table 4. In an aspect, a g9d2 can comprise a percent identity from about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to a sequence in Table 4. In an aspect, a g9d2 be generating using a sequence comprised in Table 3 or using a sequence comprising a percent identity from about 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, or up to about 100% to a sequence in Table 3.

A preferred g chain of a TCR disclosed at the amino acid and nucleic acid levels

Accordingly in an aspect, there is provided a g chain, preferably a g9 chain of a gdT C R or a part thereof comprising a sequence that has at least 40% percent identity to a sequence from Table 4 and/or comprising at least 40% percent identity to a sequence generated from primer sequences from Table 3.

In an embodiment, there is provided a g (preferably a g9) chain of a ybTCR or a part thereof comprising a CDR3 sequence that has at least 40% identity with SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 and/or comprising at least 40% identity to a sequence generated from:

primers SEQ ID NO: 16 and 27 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:74,

primers SEQ ID NO: 17 and 28 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:75,

primers SEQ ID NO: 18 and 29 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:76,

primers SEQ ID NO: 19 and 30 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:77,

primers SEQ ID NO: 20 and 31 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:78,

primers SEQ ID NO: 21 and 32 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:79,

primers SEQ ID NO: 22 and 33 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:80,

primers SEQ ID NO: 23 and 34 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:8l,

primers SEQ ID NO: 24 and 35 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:82,

primers SEQ ID NO: 25 and 36 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:83,

primers SEQ ID NO: 26 and 37 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:84.

Preferably, the identity is of at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%,

78%, 79%, 80%, 81%, 82%, 83% ,84%, 85%, 86%, 87%, 88%, 89% 90%, 91% ,92% ,93% ,94%, 95%, 96%, 97%, 98%, 99% or 100%. More preferably, the identity is of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more. Sequence similarity is also encompassed herein and is defined later herein.

In this context“part thereof’ may mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of the length of the chain. The length of the chain may be 250, 260, 270, 280, 290, 300 amino acids. In other words there is provided a gT-cell receptor chain comprising a CDR3 region, and which part is represented by an amino acid sequence having at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:74-84 and having a length of at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150,

200, 250, 300 amino acids and/or at the most 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 amino acids.

There is also provided a dT-cell receptor chain having at least 40% sequence identity or similarity with a sequence generated from:

primers SEQ ID NO: 16 and 27 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:74,

primers SEQ ID NO: 17 and 28 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:75,

primers SEQ ID NO: 18 and 29 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:76,

primers SEQ ID NO: 19 and 30 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:77, primers SEQ ID NO: 20 and 31 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:78,

primers SEQ ID NO: 21 and 32 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:79,

primers SEQ ID NO: 22 and 33 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:80,

primers SEQ ID NO: 23 and 34 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:8l,

primers SEQ ID NO: 24 and 35 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:82,

primers SEQ ID NO: 25 and 36 for the g (preferably g9) chain comprising the CDR3 with SEQ ID NO:83,

primers SEQ ID NO: 26 and 37 for the g (preferably g9) chain comprising the CDR3 with

SEQ ID NO:84.

and having a length of at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 amino acids and/or at the most 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 amino acids.

Each of these gT-cell receptor chain or part thereof is represented by an amino acid sequence that could be identified using a SEQ ID NO. Such amino acid sequences are preferably defined by InMunoGeneTics information system

(http ://www.imgt.org/IMGTScientificChart/Nomenclature/IMGT - FRCDRdefinition. html) .

In an embodiment of the above-identified aspect, a g chain of a ydTCR or a fragment thereof is provided that does not consist of or does not essentially consist of anyone of SEQ ID N0:l03-l05, 109, 111, 113, 115, 117 or 119. SEQ ID NO: 115, 117 and 119 are identical to SEQ ID NO: 109, 111 and 113, respectively, except for the sole difference that a signal peptide is present at the N-terminus of SEQ ID NO: 115, 117 and 119 (a signal peptide is not present at the N-terminus of SEQ ID NO: 109, 111 and 113).

In an embodiment of the above-identified aspect, a nucleic acid is provided that does not consist or that does not essentially consist of a nucleic acid molecule encoding a sequence consisting of anyone of SEQ ID NO: 103-105, 109, 111, 113, 115, 117 or 119. SEQ ID NO: 115, 117 and 119 are identical to SEQ ID NO: 109, 111 and 113, respectively, except for the sole difference that a signal peptide is present at the N-terminus of SEQ ID NO: 115, 117 and 119 (a signal peptide is not present at the N-terminus of SEQ ID NO: 109, 111 and 113).

A preferred d chain of a TCR disclosed at the amino acid and nucleic acid levels

Accordingly in an aspect, there is provided a d chain, preferably a 52 chain of a y5TCR or a part thereof comprising a sequence that has at least 40% percent identity to a sequence from Table 4 and/or comprising at least 40% percent identity to a sequence generated from primer sequences from Table 3.

In an embodiment, there is provided a 52 chain of a TCR or a part thereof comprising a CDR3 sequence that has at least 40% identity with SEQ ID NO: 86, 87, 88, 89, 90, 91,

92, 93, 94, 95, 96, 97, 98, 99, 100, 101 and/or comprising at least 40% identity to a sequence generated from:

primers SEQ ID NO: 38 and 54 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:86,

primers SEQ ID NO: 39 and 55 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 87,

primers SEQ ID NO: 40 and 56 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:88,

primers SEQ ID NO: 41 and 57 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 89,

primers SEQ ID NO: 42 and 58 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:90,

primers SEQ ID NO: 43 and 59 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:9l,

primers SEQ ID NO: 44 and 60 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:92,

primers SEQ ID NO: 45 and 61 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:93,

primers SEQ ID NO: 46 and 62 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:94,

primers SEQ ID NO: 47 and 63 for thc5 (preferably 52) chain comprising the CDR3 with SEQ ID NO:95,

primers SEQ ID NO: 48 and 64 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:96,

primers SEQ ID NO: 49 and 65 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:97,

primers SEQ ID NO: 50 and 66 for the 5 (preferably 52) chain comprising the CDR3 with SEQ ID NO:98,

primers SEQ ID NO: 51 and 67 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:99,

primers SEQ ID NO:52 and 68 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 100,

primers SEQ ID NO: 53 and 69 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 101.

Preferably, the identity is of at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 60%, 60%, 61%,

62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%,

77%, 78%, 79%, 80%, 81%, 82%, 83% ,84%, 85%, 86%, 87%, 88%, 89% 90%, 91%

,92% ,93% ,94%, 95%, 96%, 97%, 98%, 99% or 100%. More preferably, the identity is of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more. Sequence similarity is also encompassed herein and is defined later herein.

In this context“part thereof’ may mean at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% of the length of the chain. The length of the chain may be 250, 260, 270, 280, 290, 300 amino acids. In other words there is provided a dT-cell receptor chain comprising a CDR3 region, and which part is represented by an amino acid sequence having at least 60% sequence identity or similarity with amino acid sequence SEQ ID NO: 86-101 and having a length of at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 amino acids and/or at the most 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 amino acids.

There is also provided a dT-cell receptor chain having at least 40% sequence identity or similarity with a sequence generated from:

primers SEQ ID NO: 38 and 54 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 86, primers SEQ ID NO: 39 and 55 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 87,

primers SEQ ID NO: 40 and 56 for the5 (preferably 52) chain comprising the CDR3 with SEQ ID NO:88,

primers SEQ ID NO: 41 and 57 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 89,

primers SEQ ID NO: 42 and 58 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:90,

primers SEQ ID NO: 43 and 59 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:9l,

primers SEQ ID NO: 44 and 60 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:92,

primers SEQ ID NO: 45 and 61 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:93,

primers SEQ ID NO: 46 and 62 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:94,

primers SEQ ID NO: 47 and 63 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:95,

primers SEQ ID NO: 48 and 64 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:96,

primers SEQ ID NO: 49 and 65 for the5 (preferably 52) chain comprising the CDR3 with SEQ ID NO:97,

primers SEQ ID NO: 50 and 66 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:98,

primers SEQ ID NO: 51 and 67 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:99,

primers SEQ ID NO:52 and 68 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 100,

primers SEQ ID NO: 53 and 69 for the 52 chain comprising the CDR3 with SEQ ID NO:l0l

and having a length of at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, 300 amino acids and/or at the most 300, 250, 200, 150, 100, 90, 80, 70, 60, 50, 40, 30, 20, 10, 5 amino acids.

Each of these dT-cell receptor chain or part thereof is represented by an amino acid sequence that could be identified using a SEQ ID NO. Such amino acid sequences are preferably defined by InMunoGeneTics information system

(http ://www.imgt.org/IMGTScientificChart/Nomenclature/IMGT -

FRCDRdefinition. html) .

In an embodiment of the above-identified aspect, a d chain of a ydTCR or a fragment thereof is provided that does not consist of or does not essentially consist of anyone of SEQ ID NO: 106-108, 110, 112, 114, 116, 118 or 120. SEQ ID NO: 116, 118 and 120 are identical to SEQ ID NO: 110, 112 and 114, respectively, except for the sole difference that a signal peptide is present at the N-terminus of SEQ ID NO: 116, 118 and 120 (a signal peptide is not present at the N-terminus of SEQ ID NO: 110, 112 and 114).

In an embodiment of the above-identified aspect, a nucleic acid is provided that does not consist or that does not essentially consist of a nucleic acid molecule encoding a sequence consisting of anyone of SEQ ID NO: 106-108, 110, 112, 114, 116, 118 or 120. SEQ ID NO: 116, 118 and 120 are identical to SEQ ID NO: 110, 112 and 114, respectively, except for the sole difference that a signal peptide is present at the N-terminus of SEQ ID NO: 116, 118 and 120 (a signal peptide is not present at the N-terminus of SEQ ID NO: 110, 112 and 114).

In an embodiment, a variant or part of a dT-cell (oryT-ccll) receptor chain described herein is a soluble polypeptide. Such a soluble polypeptide may also be called a binding unit. Such a soluble polypeptide can include various forms to binding entities such as a TCR, antibody, scFv, BCR, or any combination thereof. In some cases, at least a portion of a TCR, such as a Vy9V02 can be generated and utilized in a composition, preferably a pharmaceutical composition as described herein. For example, TCR-antibody chimeras can be generated and tested before arriving at a desired chimera. For example, gd-variable domains can replace heavy and light chain variable domains of an antibody. In addition to enhanced binding, an Fc domain of an antibody can mediate cytotoxicity through Fcy-receptor positive immune cells and/or a complementary system. In some cases, TCR-antibody chimeras can be generated using HEK293 cells and subsequently purified using protein An affinity chromatography followed by size exclusion chromatography. A proper folding of chimeras can be probed using conformational-specific antibodies that can target y and d variable domains. Chimeras can be used in antibody dependent cell mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC) assays to determine functional efficacy. After performing in vitro assays, functional efficacy of TCR-antibody chimeras can be tested in vitro and/or in vivo.

A preferred y5TCR disclosed at the amino acid and nucleic acid levels

In an aspect there is provided a ybTCR, preferably a y952TCR comprising a y chain of a gdT C R (preferably a y9 chain of a y95TCR) and/or a d chain of a ybTCR (preferably a d2 chain of a yb2TCR) as defined above in each of the sections entitled“A preferred y chain of a ybTCR disclosed at the amino acid and nucleic acid levels” and“A preferred d chain of a ybTCR disclosed at the amino acid and nucleic acid levels”. Each of these sequences has already been defined in table 3 and/or could be generated from table 4.

There is therefore provided a ybTCR comprising:

a dT-cell receptor chain, or part thereof, comprising a CDR3 region, and/or a gT-cell receptor chain, or part thereof, comprising a CDR3 region, said each of dT-cell receptor chain (or part thereof) and gT-cell receptor chain (or part thereof), having been as identified earlier herein.

More preferably and as defined in tables 3 and 4, there is therefore provided a y962TCR comprising:

a b2T-cell receptor chain, or part thereof, comprising a CDR3 region, and/or a y9T-cell receptor chain, or part thereof, comprising a CDR3 region, said each of dT-cell receptor chain (or part thereof) and gT-cell receptor chain (or part thereof), having been as identified earlier herein.

In an even more preferred embodiment, there is therefore provided a ybTCR (preferably a y962TCR) comprising:

a dT-cell (preferably a d2T -eel 1 ) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 86-101, and preferably

a gT-cell (preferably a a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:74-84.

In another preferred embodiment, there is provided a nucleic acid molecule encoding a ydTCR (preferably a y952TCR), said nucleic acid molecule being represented by a nucleotide sequence comprising:

a dT-cell receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being encoded by a sequence having at least 40% sequence identity or similarity with a sequence generated from:

primers SEQ ID NO: 38 and 54 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:86,

primers SEQ ID NO: 39 and 55 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO: 87,

primers SEQ ID NO: 40 and 56 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:88,

primers SEQ ID NO: 41 and 57 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO: 89,

primers SEQ ID NO: 42 and 58 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:90,

primers SEQ ID NO: 43 and 59 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:9l,

primers SEQ ID NO: 44 and 60 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:92,

primers SEQ ID NO: 45 and 61 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:93,

primers SEQ ID NO: 46 and 62 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:94,

primers SEQ ID NO: 47 and 63 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:95,

primers SEQ ID NO: 48 and 64 for the d (preferably d2) chain comprising the CDR3 with SEQ ID NO:96, primers SEQ ID NO: 49 and 65 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:97,

primers SEQ ID NO: 50 and 66 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO:98,

primers SEQ ID NO: 51 and 67 for the 5 (preferably 52) chain comprising the CDR3 with SEQ ID NO:99,

primers SEQ ID NO:52 and 68 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 100,

primers SEQ ID NO: 53 and 69 for the d (preferably 52) chain comprising the CDR3 with SEQ ID NO: 101

and preferably

a gT-cell (a y9T-ccll) receptor chain, or part thereof comprising a CDR3 region, said gT-cell receptor chain or part thereof being encoded by a sequence having at least 40% sequence identity or similarity with a sequence generated from: primers SEQ ID NO: 16 and 27 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:74,

primers SEQ ID NO: 17 and 28 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:75,

primers SEQ ID NO: 18 and 29 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:76,

primers SEQ ID NO: 19 and 30 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:77,

primers SEQ ID NO: 20 and 31 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:78,

primers SEQ ID NO: 21 and 32 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:79,

primers SEQ ID NO: 22 and 33 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO: 80,

primers SEQ ID NO: 23 and 34 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO:8l,

primers SEQ ID NO: 24 and 35 for the g (preferably the g9) chain comprising the CDR3 with SEQ ID NO: 82,

primers SEQ ID NO: 25 and 36 for the y (preferably the y9) chain comprising the CDR3 with SEQ ID NO: 83,

primers SEQ ID NO: 26 and 37 for the y9 chain comprising the CDR3 with SEQ ID NO:84.

Preferably, the identity is of at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%,

49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%,

64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%,

79%, 80%, 81%, 82%, 83% ,84%, 85%, 86%, 87%, 88%, 89% 90%,

91% ,92% ,93% ,94%, 95%, 96%, 97%, 98%, 99% or 100%. More preferably, the identity is of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a ydTCR (preferably a y952TCR) called TCR(A) and comprising:

a dT-cell (preferably a 52T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 86 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 38 and 54

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:74 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 16 and 27.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R (preferably a y962TCR) called TCR(B) and comprising:

a dT-cell (preferably a 62T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 87 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 39 and 55

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:75 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 17 and 28.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a ydTCR

(preferably a y952TCR) called TCR(C) and comprising:

a dT-cell (preferably a 52T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:88 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 40 and 56

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain, or part thereof, being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:75 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 17 and 28.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y962TCR) called TCR(D) and comprising:

a dT-cell (preferably a 62T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 89 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 41 and 57

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:76 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 18 and 29.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a ydTCR

(preferably a y952TCR) called TCR(E) and comprising:

a dT-cell (preferably a 52T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:90 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 42 and 58

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:77 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 19 and 30.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a ydTCR

(preferably a y9d2TCR) called TCR(F) and comprising:

a dT-cell (preferably a d2T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:9l and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 43 and 59

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:78 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 20 and 31.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y952TCR) called TCR(G) and comprising:

a dT-cell (preferably a d2T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:92 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 44 and 60

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:79 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 21 and 32.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y962TCR) called TCR(H) and comprising:

a dT-cell (preferably a 62T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:93 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 45 and 61

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 80 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 22 and 33.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y952TCR) called TCR(I) and comprising:

a dT-cell (preferably a 62T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:94 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 46 and 62

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:8l and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 23 and 34.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y962TCR) called TCR(J) and comprising:

a dT-cell (preferably a 62T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:95 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 47 and 63

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:79 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 21 and 32.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y952TCR) called TCR(K) and comprising:

a dT-cell (preferably a 62T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:96 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 48 and 64

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:79 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 21 and 32.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y962TCR) called TCR(L) and comprising:

a dT-cell (preferably a 62T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:97 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 49 and 65

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 82 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 24 and 35.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y952TCR) called TCR(M) and comprising:

a dT-cell (preferably a 62T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:98 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 50 and 66

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 83 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 25 and 36.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y962TCR) called TCR(N) and comprising:

a dT-cell (preferably a 62T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:99 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 51 and 67

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:75 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 17 and 28.

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y952TCR) called TCR(O) and comprising:

a dT-cell (preferably a 62T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 100 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 52 and 68

and preferably

a gT-cell (preferably a y9T-cell) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 84 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 26 and 37

In a preferred embodiment and as defined in tables 3 and 4, there is provided a gdT C R

(preferably a y962TCR) called TCR(P) and comprising:

a dT-cell (preferably a 62T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO: 101 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ ID NO: 53 and 69

and preferably

a gT-cell (preferably a y9T-ccll) receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by an amino acid sequence, said amino acid sequence comprising at least 40% sequence identity or similarity with amino acid sequence SEQ ID NO:79 and/or has at least 40% sequence identity or similarity with a sequence generated from primers SEQ

ID NO: 21 and 32.

Preferably, the identity of each of the seqeucnes referred to in ydTCR(A) to ydTCR(P) is of at least 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%,

53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%,

68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,

83% ,84%, 85%, 86%, 87%, 88%, 89% 90%, 91% ,92% ,93% ,94%, 95%, 96%, 97%,

98%, 99% or 100%. More preferably, the identity is of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more.

In an embodiment, a ydTCR of the invention is not clone 3. The ydTCR of the invention does not consist of or does not essentially consist of:

a y chain consisting of SEQ ID NO: 111 or 117, and

a d chain consisting of SEQ ID NO: 112 or 118.

In an embodiment, a nucleic acid molecule as disclosed herein does not consist of or does not essentially consist of a nucleic acid molecule encoding a ydTCR consisting of or essentially consisting of:

a y chain consisting of SEQ ID NO: 111 or 117, and

a d chain consisting of SEQ ID NO: 112 or 118.

In an embodiment, a ydTCR of the invention is not clone 5. The ydTCR of the invention does not consist of or does not essentially consist of: a y chain consisting of SEQ ID NO: 113 or 119, and

a d chain consisting of SEQ ID NO:l 14 or 120.

In an embodiment, a nucleic acid molecule as disclosed herein does not consist of or does not essentially consist of a nucleic acid molecule encoding a ydTCR consisting of or essentially consisting of:

a g chain consisting of SEQ ID NO: 113 or 119, and

a d chain consisting of SEQ ID NO:l 14 or 120.

In an embodiment, a ydTCR of the invention is not Gl 15. The ydTCR of the invention does not consist of or does not essentially consist of:

a y chain consisting of SEQ ID NO: 109 or 115, and

a d chain consisting of SEQ ID NO: 110 or 116.

In an embodiment, a nucleic acid molecule as disclosed herein does not consist of or does not essentially consist of a nucleic acid molecule encoding a ydTCR consisting of or essentially consisting of:

a y chain consisting of SEQ ID NO: 109 or 115, and

a d chain consisting of SEQ ID NO: 110 or 116.

Each of the preferred dT-cell receptor chains or parts thereof defined above in the section entitled“Preferred d chains of a TCR disclosed at the amino acid and nucleic acid levels” is preferably considered to be able to bind a tumour cell of a subject and/or exhibit an anti-tumour activity in said cells of said subject when said dT-cell TCR chain is expressed in a T cell already expressing a gT-cell receptor chain as assessed herein. The same holds for preferred gT-cell receptor chains or parts thereof defined above in the section entitled “Preferred y chains of a TCR disclosed at the amino acid and nucleic aicd levels”, the T cell already expressing a dT cell receptor. The same also holds for gdT C R or parts thereof as defined above in the section entitled“Preferred ydTCR disclosed at the amino acid and nucleic aicd levels”

A gdT C R as defined herein in the section entitled“Preferred ydTCR disclosed at the amino acid and nucleic aicd levels” or formed by a y chain of a TCR form the section entitled“Preferred y chain of a TCR disclosed at the amino acid and nucleic acid levels” in combination with a d chain of a ybTCR (or formed by a d chain of a ybTCR form the section entitled“Preferred d chain of a TCR disclosed at the amino acid and nucleic acid levels” in combination with a y chain of a ybTCR) preferably directly or indirectly binds CD277 on a target cell when said CD277 is in a J-configuration as further explained herein. More preferably, said conformational change of CD277 to the J-configuration of CD277 is induced by interaction of CD277 with a RhoB GTPase upon transmigration of RhoB -GTPase to the cell membrane as further explained herein.

Preferably an anti-tumour response comprises the ability to lyse a tumour cell and/or induce production of IFNy, IL-2 and/or TNFa as later defined herein.

In a further aspect, a conjugate is provided comprising (a part of) the dT-cell (or yT-cell) receptor chain or part thereof or a ybTRCR (preferably TCR(A) to TCR(P)) to as defined above (in sections entitled“Preferred y chain of a TCR disclosed at the amino acid and nucleic acid levels”, Preferred d chains of a TCR disclosed at the amino acid and nucleic acid levels”, and“Preferred ybTCR disclosed at the amino acid and nucleic acid levels”) which is linked to an agent. The type of agent used depends from the type of applications envisaged. Such conjugates may be linked to substrates (e.g. chemicals, nanoparticles) and may be used e.g. to deliver chemotherapy to a target of interest. In addition, in diagnostics expression of defined ligands may be tested by taking advantage of the soluble TCRs linked to fluorochromes which are then used as staining tool or for the biochemical isolation of the ligand. In an embodiment, the agent is selected from the group consisting of a diagnostic agent, a therapeutic agent, an anti-cancer agent, a chemical, a nanoparticle, a chemotherapeutic agent or a fluorochrome.

In a further aspect, a nucleic acid construct is provided comprising a nucleic acid molecule as defined above and/or comprising a nucleic acid molecule encoding the the dT-cell (and/or yT-cell) receptor chain or a part thereof or the ybTCR represented by an amino acid sequence as identified their respective section (“Preferred y chain of a TCR disclosed at the amino acid and nucleic acid levels”, Preferred d chains of a TCR disclosed at the amino acid and nucleic acid levels”, and“Preferred ybTCR disclosed at the amino acid and nucleic acid levels”)

In a further aspect, there is provided a vector comprising the nucleic acid construct defined above. A preferred vector is a retroviral vector or a lentiviral vector.

In some embodiments, a gd TCR or any portion thereof as provided herein can be utilized as part of a chimeric antigen receptor (CAR). For example, a gd TCR or any portion there as provided herein can be utilized as part of a binding domain, transmembrane domain, or intracellular signaling domain of a CAR. In some cases, a gd TCR or any portion thereof as provided herein can be utilized as part of a bispecific binding construct. For example, gd TCR or any portion thereof as provided herein can be fused to an antibody variable region, antibody constant region, or any combination thereof.

A preferred cell comprising and/or expressing a d chain of a TCR, a g chain of a TCR, and/or a y5TCR each being defined at the amino acid or nucleic acid levels in their respective sections

In a further aspect, there is provided a cell comprising the nucleic acid construct or the vector as defined above. This cell is preferably a T cell and/or preferably an engineered T cell and/or preferably an abT cell. A preferred cell is an engineered an abT cell. A preferred T cell is derived from a human subject or patient. A T cell may also be a progenitor cell, preferably a blood progenitor cell such as a thymocyte or a blood stem cell, which after it has been provided with the right stimuli can develop into T cells.

A preferred T cell comprises and more preferably expresses a dT-cell (or gT-cell) receptor chain or a part thereof or a gdT C R identified herein in each of their respective sections (i.e.“Preferred d chain of a gdT C R disclosed at the amino acid and nucleic acid levels”, “Preferred g chain of a ybTCR at the amino acid and nucleic acid levels”and“Preferred gdT C R at the amino acid and nucleic acid levels”).

A preferred T cell comprises and preferably expresses:

a dT-cell (preferably a 62T-cell) receptor chain, or part thereof, comprising a CDR3 region, said dT-cell receptor chain or part thereof being represented by a sequence comprising a CDR3 sequence that has at least 40% identity with SEQ ID NO: 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101 and/or comprising at least 40% identity to a sequence generated from:

primers SEQ ID NO: 38 and 54 for the d chain (preferably d2 chain) comprising the CDR3 with SEQ ID NO: 86, primers SEQ ID NO: 39 and 55 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO: 87,

primers SEQ ID NO: 40 and 56 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:88,

primers SEQ ID NO: 41 and 57 for the 5 chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO: 89,

primers SEQ ID NO: 42 and 58 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:90,

primers SEQ ID NO: 43 and 59 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:9l,

primers SEQ ID NO: 44 and 60 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:92,

primers SEQ ID NO: 45 and 61 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:93,

primers SEQ ID NO: 46 and 62 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:94,

primers SEQ ID NO: 47 and 63 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:95,

primers SEQ ID NO: 48 and 64 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:96,

primers SEQ ID NO: 49 and 65 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:97,

primers SEQ ID NO: 50 and 66 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:98,

primers SEQ ID NO: 51 and 67 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO:99,

primers SEQ ID NO:52 and 68 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO: 100,

primers SEQ ID NO: 53 and 69 for the d chain (preferably 52 chain) comprising the CDR3 with SEQ ID NO: 101, and/or

a gT-cell receptor chain, or part thereof, comprising a CDR3 region, said gT-cell receptor chain or part thereof being represented by a sequencecomprising a CDR3 sequence that has at least 40% identity with SEQ ID NO: 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84 and/or comprising at least 40% identity to a sequence generated from:

primers SEQ ID NO: 16 and 27 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:74,

primers SEQ ID NO: 17 and 28 for g chain (preferably the g9 chain) the comprising the CDR3 with SEQ ID NO:75,

primers SEQ ID NO: 18 and 29 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:76,

primers SEQ ID NO: 19 and 30 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:77,

primers SEQ ID NO: 20 and 31 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:78,

primers SEQ ID NO: 21 and 32 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:79,

primers SEQ ID NO: 22 and 33 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO: 80,

primers SEQ ID NO: 23 and 34 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:8l,

primers SEQ ID NO: 24 and 35 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO: 82,

primers SEQ ID NO: 25 and 36 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO: 83,

primers SEQ ID NO: 26 and 37 for the g chain (preferably the g9 chain) comprising the CDR3 with SEQ ID NO:84.

A preferred T cell comprises and more preferably expresses one of the y6TCR (A) to (P) as earlier defined herein. In certain embodiments, the T cell is an abT cell engineered to express a ydTCR provided herein. In specific embodiments, the y6TCR can be introduced at a predetermined genomic site in aT cell, such as an ab T cell. In certain embodiments, the abT cell has a knock out or knock down of an endogenous T cell receptor (TCR) receptor. The knock out or knock down can be at the genomic level, protein level, extracellular receptor level, or any combination thereof. In some embodiments the gόT C R can be introduced at one or more of a T Cell Receptor Alpha Constant (TRAC) or T Cell Receptor Beta Locus (TCB) encoding sequences. The knock down or knock out can be performed utilizing known methods, such as gene-editing technology comprising the use of gene-editing nucleases.

In a further aspect, there is provided a population of cells, wherein at least 50%, 60%, 70%, 80%, 90% or 100% of said cells is according to the cells as defined herein. The cell comprising and preferably expressing a y chain of the TCR or a d chain of the TCR or a ybTCR as defined herein in each of the respective section may be identified using immunohistochemistry and/or RTPCR.

In an embodiment of the above-identified aspect, the gdT C R comprised or expressed in a T cell or a population of T cells of the invention is not clone 3. It means that the gdT C R comprised or expressed in a T cell or a population of T cells of the invention does not consist of or does not essentially consist of:

a g chain consisting of SEQ ID NO: 111 or 117, and

a d chain consisting of SEQ ID NO: 112 or 118.

In an embodiment, the ybTCR comprised or expressed in a T cell or a population of T cell of the invention is not encoded by a nucleic acid sequence that encodes a sequence consisting of or essentially consisting of:

a y chain consisting of SEQ ID NO: 111 or 117, and

a d chain consisting of SEQ ID NO: 112 or 118.

In an embodiment of the above-identified aspect, the ybTCR comprised or expressed in a T cell or a population of T cells of the invention is not clone 5. It means that the ybTCR comprised or expressed in a T cell or a population of T cells of the invention does not consist of or does not essentially consist of:

a y chain consisting of SEQ ID NO: 113 or 119, and

a d chain consisting of SEQ ID NO: l 14 or 120.

In an embodiment, the ybTCR comprised or expressed in a T cell or a population of T cells of the invention is not encoded by a nucleic acid sequence that encodes a sequence consisting of or essentially consisting of: a y chain consisting of SEQ ID NO: 113 or 119, and

a d chain consisting of SEQ ID NO:l 14 or 120.

In an embodiment of the above-identified aspect, the ydTCR comprised or expressed in a T cell or a population of T cells of the invention is not Gl 15. It means that the ydTCR comprised or expressed in a T cell or a population of T cells of the invention does not consist of or does not essentially consist of

a y chain consisting of SEQ ID NO: 109 or 115, and

a d chain consisting of SEQ ID NO: 110 or 116.

In an embodiment, the ydTCR comprised or expressed in a T cell or a population of T cell of the invention is not encoded by a nucleic acid sequence that encodes a sequence consisting of or essentially consisting of:

a y chain consisting of SEQ ID NO: 109 or 115, and

a d chain consisting of SEQ ID NO: 110 or 116.

Each of the dT-cell receptor chains or a part thereof, each of the gT-cell receptor chains, or a part thereof, and each of the gdT C R or a nucleic acid molecule, or a conjugate, or a nucleic acid construct or a vector or a cell or a population of cells or a composition disclosed herein are expected to be biologically relevant for designing a medicament for preventing, treating, regressing, curing and/or delaying cancer since each of these compounds is able to bind a tumour cell and/or exhibit or mediate or induce an anti tumour activity or response as defined herein.

Each of the dT-cell receptor chains or a part thereof, each of the gT-cell receptor chains, or a part thereof, each of the ydTCR or a nucleic acid molecule, or a conjugate, or a nucleic acid construct or a vector or a cell or a population of cells or a composition disclosed herein are preferably for use as a medicament. The medicament is preferably for the prevention, suppression, treatment, regression, curing and/or delay of cancer.

In a further aspect, there is provided a method for preventing, treating, regressing, suppressing, curing and/or delaying cancer in a subject wherein a dT-cell receptor chain or a part thereof, a gT-cell receptor chain, or a part thereof, a gdT C R or a nucleic acid molecule, or a conjugate, or a nucleic acid construct or a vector or a cell or a population of cells or a composition disclosed herein are administered to said subject. A preferred subject is a human being.

In a further aspect, there is provided a use of a dT-cell receptor chain or a part thereof, a gT-cell receptor chain, or a part thereof, a gdT C R or a nucleic acid molecule, or a conjugate, or a nucleic acid construct or a vector or a cell or a population of cells or a composition disclosed herein for the manufacture of a medicament for preventing, treating, regressing, curing and/or delaying cancer in a subject. A preferred subject is a human being.

In an aspect, comparison of ydTCR repertoire diversity between naive cord blood-derived gd T cells and gd T cells isolated from peripheral blood of adult healthy individuals can show preferential expansion of selected clonotypes. In an aspect, the skewing of the repertoire towards few dominant clonotypes may imply a certain functional benefit. In an aspect, there may not be a correlation between clonotype frequency and antitumor functional potential of the respective clone. In an aspect a repertoire focusing, occurring in parallel with acquisition of distinct phenotypic profiles can be a reflection of T cell antigenic stimulation history of an individual, rather than in vitro potency of a selected clone. In an aspect, other receptors than the y902TCR might be involved in the induction of tolerance of g9d2T cell clones.

In an aspect, a y902TCR taken outside of the environment of its parental clone, can be used to target very efficiently malignant diseases. In an aspect, a y902TCR affinity can be a determinant of an activation potential of o.pTCRs when expressed on the same background. In an aspect, there may be intrinsic differences in activation potential, as measured by y902TCR- mediated functional avidity which may not be correlated to the intrinsic ability of the parental gdT cell clone.

In an aspect, an affinity of a g9d2 TCR can be in a range even lower than that of o 3TCRs. For instance, by achieving detectable TCR binding only with increasing valency of y902TCR multimers to a size of a YG-bead with more than 104 y902TCRs at a bead surface. In an aspect, once having achieved sufficient interaction avidity, the difference in binding affinity between individual y902TCRs can be significant. In an aspect, a direct interaction between extracellular CD277 domains and y902TCR can occur. In an aspect, CD277 may undergo spatial and conformational changes. In an aspect, a y902TCR may be involved in fluid cell membrane interactions with CD277 that may create higher local densities and stabilize the cell-cell interaction. In an aspect, a pamidronate stimulation of a cancer cell can lead to an upregulation of an adhesion molecule on the cancer cell increasing cell-cell contact as well as stabilizing the synapse and consequently avidity. In an aspect a CDR3 region of a y902TCR may be involved in recruitment to the synapse of a CD277 expressing cancer cell. In an aspect, an agent provide herein can induce special and conformational changes in CD277 directly or indirectly.

In an aspect, there can be an increase in cluster size of BTN3A1 as well as a reduction in cluster density. In an aspect, a change in cluster density creates most space for additional proteins within BTN3A clusters. In an aspect, about 10%, 20%, 30%, 40%, 50%, 60%, or more of a cluster surface can be occupied by BTN3A dimers. In an aspect, there can be involvement of an additional factor that moves into the CD277 synapse as well as conformational changes in CD277 orchestrated through RhoB.

In an aspect, there can be functional diversity and“repertoire focusing” of g9d2 T cells. Vector

Polynucleotides encoding a polypeptide construct that selectively binds J-configuration of CD277 directly, or indirectly thru one or more additional biological agents can be incorporated in a nucleic acid construct or a vector described herein. A“nucleic acid construct” or an“expression vector” or“vector” is any genetic element, e.g., a plasmid, chromosome, virus, transposon, behaving either as an autonomous unit of polynucleotide replication within a cell. (i.e. capable of replication under its own control) or being rendered capable of replication by insertion into a cell chromosome, having attached to it another polynucleotide segment, so as to bring about the replication and/or expression of the attached segment. Suitable vectors include, but are not limited to, plasmids, transposons, bacteriophages and cosmids. Vectors can contain polynucleotide sequences which are necessary to effect ligation or insertion of the vector into a desired host cell and to effect the expression of the attached segment. Such sequences differ depending on the host organism; they include promoter sequences to effect transcription, enhancer sequences to increase transcription, ribosomal binding site sequences and transcription and translation termination sequences. Alternatively, expression vectors can be capable of directly expressing nucleic acid sequence products encoded therein without ligation or integration of the vector into host cell DNA sequences.

Vector also can comprise a“selectable marker gene.” The term“selectable marker gene,” as used herein, refers to a nucleic acid sequence that allows cells expressing the nucleic acid sequence to be specifically selected for or against, in the presence of a corresponding selective agent. Suitable selectable marker genes are known in the art and described in, e.g., International Patent Application Publications WO 1992/08796 and WO 1994/28143; Wigler et ah, Proc. Natl. Acad. Sci. USA, 77: 3567 (1980); O’Hare et ah, Proc. Natl.

Acad. Sci. USA, 78: 1527 (1981); Mulligan & Berg, Proc. Natl. Acad. Sci. USA, 78:

2072 (1981); Colberre-Garapin et al, J. Mol. Biol., 150:1 (1981); Santerre et ah, Gene,

30: 147 (1984); Kent et al, Science, 237: 901-903 (1987); Wigler et al, Cell, 11 : 223 (1977); Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA, 48: 2026 (1962); Lowy et al, Cell, 22: 817 (1980); and U.S. Pat. Nos. 5,122,464 and 5,770,359.

In some embodiments, the vector is an“episomal expression vector” or“episome,” which is able to replicate in a host cell, and persists as an extrachromosomal segment of DNA within the host cell in the presence of appropriate selective pressure (see, e.g., Conese et al, Gene Therapy, 11 :1735-1742 (2004)). Representative commercially available episomal expression vectors include, but are not limited to, episomal plasmids that utilize Epstein Barr Nuclear Antigen 1 (EBNA1) and the Epstein Barr Virus (EBV) origin of replication (oriP). The vectors pREP4, pCEP4, pREP7, and pcDNA3.l from Invitrogen (Carlsbad, Calif.) and pBK-CMV from Stratagene (La Jolla, Calif.) represent non-limiting examples of an episomal vector that uses T-antigen and the SV40 origin of replication in lieu ofEBNAl and oriP.

Viral vector

A viral vector or a gene therapy vector is a vector that comprises an expression construct as defined above.

A viral vector or a gene therapy vector is a vector that is suitable for gene therapy. Vectors that are suitable for gene therapy are described in Anderson 1998, Nature 392: 25-30; Walther and Stein, 2000, Drugs 60: 249-71; Kay et al, 2001, Nat. Med. 7: 33-40; Russell, 2000, J. Gen. Virol. 8U 2573-604; Amado and Chen, 1999, Science 285: 674-6; Federico, 1999, Curr. Opin. Biotechno 1.10: 448-53; Vigna and Naldini, 2000, J. Gene Med. 2: 308- 16; Marin et al, 1997, Mol. Med. Today 3: 396-403; Peng and Russell, 1999, Curr. Opin. Biotechnol. 10: 454-7; Sommerfelt, 1999, J. Gen. Virol. 80: 3049-64; Reiser, 2000, Gene Ther. 7: 910-3; and references cited therein.

A particularly suitable gene therapy vector includes an Adenoviral and Adeno-associated virus (AAV) vector. These vectors infect a wide number of dividing and non-dividing cell types including synovial cells and liver cells. The episomal nature of the adenoviral and AAV vectors after cell entry makes these vectors suited for therapeutic applications. (Russell, 2000, J. Gen. Virol. 81 : 2573-2604; Goncalves, 2005, Virol J. 2(l):43) as indicated above. AAV vectors are even more preferred since they are known to result in very stable long term expression of transgene expression (up to 9 years in dog (Niemeyer et al, Blood. 2009 Jan 22; 113(4):797-806) and ~ 2 years in human (Nathwani et al, N Engl J Med. 2011 Dec 22;365(25):2357-65, Simonelli et al, Mol Ther. 2010 Mar;l8(3):643-50. Epub 2009 Dec 1.)). Preferred adenoviral vectors are modified to reduce the host response as reviewed by Russell (2000, supra). Method for gene therapy using AAV vectors are described by Wang et al, 2005, J Gene Med. March 9 (Epub ahead of print), Mandel et al, 2004, Curr Opin Mol Ther. 6(5):482-90, and Martin et al, 2004, Eye 18(11): 1049-55, Nathwani et al, N Engl J Med. 2011 Dec 22;365(25):2357-65, Apparailly et al, Hum Gene Ther. 2005 Apr;l6(4):426-34.

Another suitable gene therapy vector includes a retroviral vector. A preferred retroviral vector for application herein is a lentiviral based expression construct. Lentiviral vectors have the ability to infect and to stably integrate into the genome of dividing and non-dividing cells (Amado and Chen, 1999 Science 285: 674-6). Methods for the construction and use of lentiviral based expression constructs are described in U.S. Patent No.'s 6,165,782, 6,207,455, 6,218,181, 6,277,633 and 6,323,031 and in Federico (1999, Curr Opin Biotechnol 10: 448-53) and Vigna et al. (2000, J Gene Med 2000; 2: 308-16).

Other suitable gene therapy vectors include a herpes virus vector, a polyoma virus vector or a vaccinia virus vector.

A gene therapy vector comprises a nucleic acid sequence encoding a 5TCR chain (and/or yTCR), whereby each of said sequence is operably linked to the appropriate regulatory sequences. Such regulatory sequence will at least comprise a promoter sequence. Suitable promoters for expression of such a nucleotide sequence from gene therapy vectors include e.g. cytomegalovirus (CMV) intermediate early promoter, viral long terminal repeat promoters (LTRs), such as those from murine moloney leukaemia virus (MMLV) rous sarcoma virus, or HTLV-l, the simian virus 40 (SV 40) early promoter and the herpes simplex virus thymidine kinase promoter. Transposon or other non-viral delivery systems may also be used in this context. All systems can be used in vitro or in vivo.

A gene therapy vector may optionally comprise a further nucleic acid sequence coding for a further polypeptide. A further polypeptide may be a (selectable) marker polypeptide that allows for the identification, selection and/or screening for cells containing the expression construct. Suitable marker proteins for this purpose are e.g. the fluorescent protein GFP, and the selectable marker genes HSV thymidine kinase (for selection on HAT medium), bacterial hygromycin B phosphotransferase (for selection on hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection on G418), and dihydro folate reductase (DHFR) (for selection on methotrexate), CD20, the low affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for their use are provided in Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3 ^rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York.

A gene therapy vector is preferably formulated in a pharmaceutical composition as defined herein. In this context, a pharmaceutical composition may comprise a suitable pharmaceutical carrier as earlier defined herein.

Transgene

A "transgene" is herein defined as a gene or a nucleic acid molecule (i.e. a molecule encoding a dT C R and/or a yTCR chain) that has been newly introduced into a cell, i.e. a gene that may be present but may normally not be expressed or expressed at an insufficient level in a cell. The transgene may comprise sequences that are native to the cell, sequences that naturally do not occur in the cell and it may comprise combinations of both. A transgene may contain sequences coding for a 5TCR (and/or a yTCR) chain and comprising the polypeptide as identified and/or additional proteins as earlier identified herein that may be operably linked to appropriate regulatory sequences for expression of the sequences coding for a dT C R (and/or a yTCR) chain. Preferably, the transgene is not integrated into the host cell’s genome.

Transduction

“Transduction” refers to the delivery of a dT C R (and/or a yTCR) chain or parts thereof or gdT C R into a recipient host cell by a viral vector. For example, transduction of a target cell by a retroviral or lentiviral vector of the invention leads to transfer of the genome contained in that vector into the transduced cell. A preferred transduced cell is a T cell as defined herein.

“Host cell” or“target cell” refers to the cell into which the DNA delivery takes place or a cell that has been transduced. A cell that has been transduced may also be called an engineered cell.

Vector modifications

A polynucleotide vector useful for the methods and compositions described herein can be a good manufacturing practices (GMP) compatible vector. For example, a GMP vector can be purer than a non-GMP vector. In some cases, purity can be measured by bioburden. For example, bioburden can be the presence or absence of aerobes, anaerobes, sporeformers, fungi, or combinations thereof in a vector composition. In some cases, a pure vector can be endotoxin low or endotoxin free. Purity can also be measured by double-stranded primer-walking sequencing. Plasmid identity can be a source of determining purity of a vector. A GMP vector of the invention can be from 10% to 99% more pure than a non-GMP vector. A GMP vector can be from 10%, 15%, 20%, 25%,

30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,

97%, 98%, or 99% more pure than a non-GMP vector as measured by the presence of bioburden, endotoxin, sequencing, or combinations thereof.

In some cases, a terminator sequence at the end of the first gene program is used. A terminator sequence can ensure that a transcript is terminating prior to initiating a second gene program. For example, an expression vectors can contain sequences necessary for the termination of transcription and for stabilizing an mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions can contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA. Cells comprising the expression vector are grown under conditions that provide for expression of the desired polypeptide, either in vivo or in vitro.

In some cases, a spacer sequence can be used at the end of a first polypeptide encoded by a polynucleotide in a vector. In other cases, a spacer sequence can be used at the end of a second gene in a vector. A spacer sequence can also be used following a first gene and a second gene in a vector. These vectors can be used to express a polypeptide encoded by a gene, or portion of a gene of interest. A gene of portion or a gene can be inserted by using any method, viral or non-viral. For example; a method can be a non- viral based technique.

Linkers

In some embodiments, a polynucleotide linker can be utilized in a polynucleotide encoding a polypeptide construct described herein. A polynucleotide linker can be a double-stranded segment of DNA containing desired restriction sites that can be added to create end structures that are compatible with a vector comprising a polynucleotide described herein. In some cases, a polynucleotide linker can be useful for modifying vectors comprising polynucleotides described herein. For example, a vector modification comprising a polynucleotide linker can be a change in a multiple cloning site, or the addition of a poly-histidine tail. Polynucleotide linkers can also be used to adapt the ends of blunt insert DNA for cloning into a vector cleaved with a restriction enzyme with cohesive end termini. The use of polynucleotide linkers can be more efficient than a blunt ligation into a vector and can provide a method of releasing an insert from a vector in downstream applications. In some cases an insert can be a polynucleotide sequence encoding polypeptides useful for therapeutic applications.

A polynucleotide linker can be an oligomer. A polynucleotide linker can be a DNA double strand, single strand, or a combination thereof. In some cases, a linker can be RNA. A polynucleotide linker can be ligated into a vector comprising a polynucleotide described herein by a T4 ligase in some cases. To facilitate a ligation an excess of polynucleotide linkers can be added to a composition comprising an insert and a vector.

In some cases, an insert and vector are pre-treated before a linker is introduced. For example, pre-treatment with a methylase can prevent unwanted cleavage of insert DNA. In some embodiments, a linker can be utilized in a polynucleotide described herein. A linker can be a flexible linker, a rigid linker, an in vivo cleavable linker, or any combination thereof. In some cases, a linker can link functional domains together (as in flexible and rigid linkers) or releasing free functional domain in vivo as in in vivo cleavable linkers.

Linkers can improve biological activity, increase expression yield, and achieving desirable pharmacokinetic profiles. A linker can also comprise hydrazone, peptide, disulfide, or thioesther. In some cases, a linker sequence described herein can include a flexible linker. Flexible linkers can be applied when a joined domain requires a certain degree of movement or interaction. Flexible linkers can be composed of small, non-polar (e.g., Gly) or polar (e.g., Ser or Thr) amino acids. A flexible linker can have sequences consisting primarily of stretches of Gly and Ser residues (“GS” linker). An example of a flexible linker can have the sequence of (Gly-Gly-Gly-Gly-Ser)n (SEQ ID NO: 1). By adjusting the copy number “n”, the length of this exemplary GS linker can be optimized to achieve appropriate separation of functional domains, or to maintain necessary inter-domain interactions. Besides GS linkers, other flexible linkers can be utilized for recombinant fusion proteins. In some cases, flexible linkers can also be rich in small or polar amino acids such as Gly and Ser, but can contain additional amino acids such as Thr and Ala to maintain flexibility. In other cases, polar amino acids such as Lys and Glu can be used to improve solubility.

J-configuration of CD277

Herein“CD277” refers to the membrane-expressed protein butyrophilin BTN3A1, a key molecule in phosphoantigen-induced activation of engineered cells described herein. The CD277 protein is a cell-surface protein that can assume multiple configurations, as shown for example in FIG. 11 herein. The J-configuration or J-confirmation of CD277 is facilitated when GTP-bound RhoB facilitates spatial redistribution of CD277 by promoting cytoskeletal trapping in the plasma membrane binding to the B30.2 domain proximal connector region of CD277. Dissociation of GTP-bound RhoB and

corresponding binding of intracellular phosphoantigen (pAG) to the B30.2 domain of CD277 triggers a conformational change of the extracellular region of CD277, referred to herein as the J-configuration of CD277. The J-configuration is characteristically observed in tumor cells and other distressed cells, wherein metabolic changes can cause expression of certain stress molecules and resulting in the transmigration of RhoB within the tumor cell or distressed cell in a manner that eventually results in the formation of the J- configuration of CD277. Herein, as well as in any related patents and/or patent applications, the terms“J-configuration”,“J-conformation”, and“J-confirmation” are used interchangeably.

Provided herein in certain embodiments, are methods and compositions that comprise polypeptide constructs that specifically bind the J-configuration of CD277 on the surface of such tumor cells and distressed cells. In certain embodiments, the polypeptide constructs described herein comprise gamma delta TCRs or fragments thereof. In certain embodiments are polynucleotides encoding polypeptide constructs described herein, and vectors encoding said polynucleotides. In some cases are provided engineered cells encoding polypeptide constructs described herein.

Polypeptide Constructs

Provided herein, in some aspects, are pharmaceutical compositions that comprise a polypeptide construct, wherein the polypeptide construct specifically interacts with the J- configuration of CD277 on a target cell. The g chain of a TCR disclosed at the amino acid level in the corresponding section, the d chain of a TCR disclosed at the amino acid level in the corresponding section and the ydTCR disclosed at the amino acid level in the corresponding section may also be denominated polypeptide constructs and each and every feature in this section polypeptide constructs may also be combined with the g chain of a TCR disclosed at the amino acid level in the corresponding section, the d chain of a TCR disclosed at the amino acid level in the corresponding section and the y TCR disclosed at the amino acid level in the corresponding section.

In certain embodiments, the polypeptide construct is expressed on an engineered cell. In some embodiments, the CD277 is a human CD277. In some cases the polypeptide construct binds said J-configuration of CD277 with at least 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% more selectivity than other configurations of CD277. In some cases, the polypeptide construct binds J- configuration of CD277 with at least two fold, three fold, four fold, five fold, six fold, seven fold or eight fold affinity as compared to other configurations of CD277. In some embodiments, the polypeptide construct binds to CD277 upon a conformational change of CD277 to the J-configuration of CD277, which conformational change is induced by interaction of CD277 with a RhoB GTPase upon transmigration of RhoB-GTPase to the cell membrane. In some embodiments, the polypeptide construct binds to CD277 after CD277 interacts with a RhoB GTPase. In some embodiments, the polypeptide construct binds to CD277 when CD277 is interacting with a phosphoantigen. In some

embodiments, the polypeptide construct binds to CD277 when CD277 is interacting with a phosphoantigen, and after CD277 interacts with a RhoB GTPase. In some

embodiments, the polypeptide construct binds to CD277 when RhoB GTPase localizes to the cell membrane of the target cell. In some embodiments, the polypeptide construct binds to CD277 when RhoB GTPase localizes away from the nucleus of the target cell. The selectivity or affinity of a polypeptide construct described herein for the J- configuration of CD277 can be determined by any method known to the person skilled in the art. For example, a ligand binding assay can be used to detect the presence of CD277- polypeptide construct complex formation, as well as the extent or strength of binding of the polypeptide construct to the J-configuration of CD277. In some embodiments, Fluorescence Resonance Energy Transfer (FRET) is employed to determine the affinity of binding between the polypeptide construct and the J-configuration of CD277. FRET is capable of detecting and measuring energy transfer between a pair of light sensitive molecules (e.g., fluorophore) typically placed in close proximity. One of the light sensitive molecules, the donor molecule (e.g., donor fluorophore), is initially present in an electron excited state and is capable of transferring energy to the other light sensitive molecule, the acceptor molecule (e.g., acceptor fluorophore). Energy transfer from the donor to the acceptor can be for example by dipole-dipole coupling. Measurement of the energy transferred from the acceptor molecule to the donor molecule can be used to estimate the distance between the acceptor and donor on the basis that the efficiency of energy transfer (i.e. FRET efficiency) is inversely proportional to the sixth power of the distance between donor and acceptor. Measurement of FRET can be for example by a fluorescence-detecting microscope (e.g., confocal microscope) or by fluorescent-sensitive cell sorting (e.g., flow cytometry, fluorescent-activated cell sorting). Quantification of fluorescence using FRET can be by any one or more of a number of techniques, including sensitized emission, acceptor photobleaching, fluorescence-lifetime imaging microscopy (FLIM) FRET, spectral imaging, and/or Homo-FRET and polarization anisotropy imaging. In some embodiments, FRET is employed using a donor and acceptor fluorophore. In some embodiments, FRET is employed using one or more fluorescently labeled antibodies specific for an antigen on the cell surface. In some embodiments,

FRET is employed using one or more fluorescently labeled dyes which are hydrophobic and are capable of binding to hydrophobic cellular components such as the plasma membrane. In some embodiments, a combination of one or more fluorescently labeled antibodies and one or more hydrophobic fluorescent dyes are used to carry out FRET. In some embodiments, the fluorescent lipid conjugate BODIPY FL is used in combination with a fluorescent ly labeled antibody specific for an epitope on the CD277 protein. In some embodiments, other ligand-binding assays are used either alone or in combination with FRET to detect the selectivity of a polypeptide construct described herein for CD277. Non- limiting examples of ligand-binding assays contemplated herein include other fluorescence-based methods such as fluorescence polarization, detection of changes in the angle of light reflection from cell surface components using surface plasmon resonance, radioactive-based ligand assays, and immunoprecipitation of antibody-labeled cell surface components followed by structure analysis.

In some embodiments, polypeptide constructs disclosed herein are expressed in a cell. In some embodiments, said polypeptide construct is expressed on the cell membrane of the cell. In some embodiments, the polypeptide construct can interact with a cell. In some embodiments, the polypeptide construct is capable of being bound by a cell surface protein of the cell. In some embodiments, the cell is a cytotoxic cell. Non-limiting examples of cytotoxic cells include T cells, cell expressing at least a functional portion ( e.g ., conveys immune activity) of a T cell receptor, and natural killer cells. In some embodiments, the cell expresses a T cell receptor. In some embodiments, the cell expresses at least a portion of a T cell receptor, wherein the portion has a T cell function (e.g., immune regulation). In some embodiments, the cell is engineered or genetically modified to express at least one chain of a T cell receptor. The at least one chain can be a g-T-cell receptor chain. The at least one chain can be a d-T-cell receptor chain or fragment thereof. The at least one chain can be a yO-T-ccll receptor chain or fragment thereof. The at least one chain can be a 02-T-ccll receptor chain or fragment thereof. In some embodiments, the polypeptide construct is thus a TCR having at least one chain or fragment thereof (e.g. a g-T-cell receptor chain or fragment thereof; d-T-cell receptor chain or fragment thereof; yO-T-ccll receptor chain or fragment thereof; or 02-T-ccll receptor chain or fragment thereof). In some embodiments, the polypeptide construct can be a TCR having more than one chain (e.g. a homodimer or heterodimer). In some embodiments, the g chain of a TCR disclosed at the amino acid and nucleic acid levels in the corresponding section, the d chain of a TCR disclosed at the amino acid and nucleic acid levels in the corresponding section and preferably the ybTCR disclosed at the amino acid and nuceic acid levels in the corresponding section may be comprised and/or expressed by the cell defined in this section. In some embodiments, polypeptide constructs disclosed herein are not expressed by a cell. In some embodiments, the polypeptide construct is synthetic ( e.g ., not produced by a cell). In some embodiments, the polypeptide construct is produced in vitro. In some embodiments, the polypeptide construct is capable of binding a target cell and a cytotoxic cell disclosed herein. In some embodiments, the polypeptide construct is capable of binding a target cell and a cytotoxic cell disclosed herein, thereby bringing the target cell into a proximity of the cytotoxic cell sufficient for the cytotoxic cell to be cytotoxic to the target cell. In some embodiment, a ybTCR as defined in the corresponding section or as defined in the section polypeptide construct is able to bind a tumour cell and/or able to exhibit an anti-tumour response or activity. Exibiting an anti-tumour response may be the induction of the production of IFNy, TNFa and/or IL-2.

Polypeptides and proteins disclosed herein (including functional portions and functional variants thereof) can comprise synthetic amino acids in place of one or more naturally- occurring amino acids. Such synthetic amino acids are known in the art, and include, for example, aminocyclohexane carboxylic acid, norleucine, a-amino n-decanoic acid, homoserine, S-acetylaminomethyl-cysteine, trans-3- and trans-4-hydroxyproline, 4- aminophenylalanine, 4-nitrophenylalanine, 4-chlorophenylalanine, 4- carboxyphenylalanine, b-phenylserine b-hydroxyphenylalanine, phenylglycine, a- naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, l,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N’-benzyl-N’-methyl-lysine, N’,N’-dibcnzyl- lysine, 6-hydroxylysine, ornithine, a-aminocyclopentane carboxylic acid, a-aminocyclohexane carboxylic acid, a- aminocycloheptane carboxylic acid, a-(2-amino-2-norbomane)-carboxylic acid, a,g- diaminobutyric acid, a,b-diaminopropionic acid, homophenylalanine, and a-tert- butylglycine.

“Antibody” as used herein refers to monoclonal or polyclonal antibodies. A whole antibody typically consists of four polypeptides: two identical copies of a heavy (H) chain polypeptide and two identical copies of a light (L) chain polypeptide. Each of the heavy chains contains one N-terminal variable (VH) region and three C-terminal constant (CH1, CH2 and CH3) regions, and each light chain contains one N-terminal variable (VL) region and one C-terminal constant (CL) region. The variable regions of each pair of light and heavy chains form the antigen binding site of an antibody. The VH and VL regions have a similar general structure, with each region comprising four framework regions, whose sequences are relatively conserved. The framework regions are connected by three complementarity determining regions (CDRs). The three CDRs, known as CDR1, CDR2, and CDR3, form the“hypervariable region” of an antibody, which is responsible for antigen binding.

“Antigen recognition moiety or domain” refers to a molecule or portion of a molecule that specifically binds to an antigen. In one embodiment, the antigen recognition moiety is an antibody, antibody like molecule or fragment thereof and the antigen is a tumor antigen. “Antibody like molecules” can be for example proteins that are members of the Ig- superfamily which are able to selectively bind a partner. MHC molecules and T cell receptors are such molecules. In one embodiment the antibody-like molecule is a TCR.

The terms“fragment of an antibody,”“antibody fragment,”“functional fragment of an antibody,” and“antigen-binding portion” are used interchangeably herein to mean one or more fragments or portions of an antibody that retain the ability to specifically bind to an antigen (see, generally, Holliger et ah, Nat. Biotech., 23(9): 1126-1129 (2005)). The antibody fragment desirably comprises, for example, one or more CDRs, the variable region (or portions thereof), the constant region (or portions thereof), or combinations thereof. Examples of antibody fragments include, but are not limited to, (i) a Fab fragment, which is a monovalent fragment consisting of the VL, VH, CL, and CH1 domains; (ii) a F(ab’)2 fragment, which is a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the stalk region; (iii) a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; (iv) a single chain Fv (scFv), which is a monovalent molecule consisting of the two domains of the Fv fragment (i.e., VL and VH) joined by a synthetic linker which enables the two domains to be synthesized as a single polypeptide chain (see, e.g., Bird et al, Science, 242: 423-426 (1988); Huston et al, Proc. Natl. Acad. Sci. USA, 85: 5879-5883 (1988); and Osbourn et al., Nat.

Biotechnol, 16: 778 (1998)) and (v) a diabody, which is a dimer of polypeptide chains, wherein each polypeptide chain comprises a VH connected to a VL by a peptide linker that is too short to allow pairing between the VH and VL on the same polypeptide chain, thereby driving the pairing between the complementary domains on different VH-VL polypeptide chains to generate a dimeric molecule having two functional antigen binding sites. Antibody fragments are known in the art and are described in more detail in, e.g., U.S. Pat. No. 8,603,950.

Engineered T-cell Receptor (TCR)

In some embodiments, a polypeptide construct that selectively binds the J-configuration of CD277, comprises a T-cell receptor (TCR), an engineered TCR, or fragment thereof. In some embodiments, the T cell receptor (TCR) is composed of two chains (ab or gd) that pair on the surface of the T cell to form a heterodimeric receptor. The ab TCR is expressed on most T cells in the body and is known to be involved in the recognition of specific MHC-restricted antigens. Each a and b chain are composed of two domains: a constant domain (C) which anchors the protein to the cell membrane and is associated with invariant subunits of the CD3 signaling apparatus; and a variable domain (V) that confers antigen recognition through six loops, referred to as complementarity determining regions (CDRs). Each of the V domains comprises three CDRs; e.g., CDR1, CDR2 and CDR3 with CDR3 as the hypervariable region. These CDRs interact with a complex formed between an antigenic peptide bound to a protein encoded by the major histocompatibility complex (pepMHC) (e.g., HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRA, or HLA-DRB 1 complex). In some instances, the constant domain further comprises a joining region that connects the constant domain to the variable domain. In some cases, the beta chain further comprises a short diversity region which makes up part of the joining region.

In some cases, such TCR are reactive to specific tumor antigen, e.g. NY-ESO, Mage A3, Titin. In other cases, such TCR are reactive to specific neoantigens expressed within a patient’s tumor (i.e. patient-specific, somatic, non- synonymous mutations expressed by tumors). In some cases, engineered TCRs can be affinity-enhanced.

In some embodiments, a TCR is described using the International Immunogenetics (IMGT) TCR nomenclature, and links to the IMGT public database of TCR sequences. For example, there can be several types of alpha chain variable (Va) regions and several types of beta chain variable (nb) regions distinguished by their framework, CDR1,

CDR2, and CDR3 sequences. As such, a Va type can be referred to in IMGT

nomenclature by a unique TRAV number. For example,“TRAV21” defines a TCR Va region having unique framework and CDR1 and CDR2 sequences, and a CDR3 sequence which is partly defined by an amino acid sequence which is preserved from TCR to TCR but which also includes an amino acid sequence which varies from TCR to TCR.

Similarly,“TRBV5-1” defines a TCR nb region having unique framework and CDR1 and CDR2 sequences, but with only a partly defined CDR3 sequence.

In some cases, the beta chain diversity region is referred to in IMGT nomenclature by the abbreviation TRBD.

In some instances, the unique sequences defined by the IMGT nomenclature are widely known and accessible to those working in the TCR field. For example, they can be found in the IMGT public database and in“T cell Receptor Factsbook”, (2001) LeFranc and LeFranc, Academic Press, ISBN 0-12-441352-8.

In some embodiments, an ab heterodimeric TCR is, for example, transfected as full length chains having both cytoplasmic and transmembrane domains. In some cases, the TCRs contain an introduced disulfide bond between residues of the respective constant domains, as described, for example, in WO 2006/000830.

In some instances, TCRs described herein are in single chain format, for example see WO 2004/033685. Single chain formats include ab TCR polypeptides of the Va-L-nb, nb-L- Va, Va-Ca-L-nb, na-T-nb-Ob, na-Oa-T-nb-Ob types, whereinVa andnb are TCR a and b variable regions respectively, Ca and Cb are TCR a and b constant regions respectively, and L is a linker sequence. In certain embodiments single chain TCRs of the present disclosure can have an introduced disulfide bond between residues of the respective constant domains, as described in WO 2004/033685.

In contrast to an ab TCR, the gd TCR is composed of one g chain and one d chain.

Although much less abundant in the body than ab Tcells, gd T cells combine potent anti tumor effector functions with the recognition of broadly expressed tumor-associated molecules, and therefore are strong candidates for clinical application in cancer immunotherapy. The majority of gd T cells are activated in an MHC-independent manner and do not require antigen processing, which is in contrast to MHC-restricted ab T cells. Instead, gd T cells rely on cell-cell contact with antigen-presenting cells and directly recognize antigens in the form of intact proteins or non-peptidic compounds. For this interaction, the CDR3 domains of the variable region is of particular importance. For this interaction, the CDR3 domains of the variable region is of particular importance. The orientation of the variable (V) and constant (C) regions of the gd TCR is unique in comparison to ab TCRs or antibodies, and results from a small angle between the Vy and Cy domains. Although the gd TCR V domains are similar in structure to those of ab TCRs, gd TCR C domains are markedly different. Structural differences in Cy and C5, including the location of the disulphide bond between them, may enable gd TCRs to form different recognition/signalling complexes than ab TCRs (Allison et al,“Structure of a human gd T-cell antigen receptor,” Nature, 411 : 820-824). Activation of gd T cells by TCR-mediated antigen recognition on a target cell can lead to production of cytokines and chemokines as well as cytoloysis of the target cell (e.g., tumor cell).

Vy9Vd2 T cells, the major gd T cell subset in human peripheral blood, express gd TCRs composed of Vy9 and V02 chains, and are specifically activated by intermediates of the mammalian mevalonate pathway such as isopentenyl pyrophosphate (IPP) or the microbial 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway. Intracellular

phosphoantigen (pAg) levels accumulate in tumor cells due to dysregulation of the mevalonate pathway or upon microbial infection, allowing the targeting of transformed or infected cells by Vy9Vd2 cells. Similarly, intracellular pAg levels can be

pharmaceutically increased by treating cells with mevalonate pathway inhibitors such as aminobisphosphonates (ABPs), thereby sensitizing cells toward recognition by Vy9Vd2 T cells.

In some embodiments, a TCR endogenously expressed by Vy9Vd2 T cells can be expressed in ab T cells engineered to express one or more Vy9Vd2 TCRs, thereby reprogramming the ab T cells. For example, CD4 ⁺ ab T cells engineered to express one defined Vy9Vd2 TCR can be used to functionally screen tumor cells for proteins important for T cell recognition, in order to eliminate fluctuations in recognition by a diverse gd TCR repertoire.

In some embodiments, a Vy9Vd2 TCR described herein recognizes a CD277 (BTN3A1) protein expressed by a target cell (e.g., tumor cell). In some embodiments, a Vy9Vd2 TCR described herein recognizes an epitope that includes the J configuration of the CD277 protein expressed on the surface of a target cell. In some embodiments, a Vy9Vd2 TCR described herein recognizes an epitope that is limited to the J configuration of the CD277 protein expressed on the surface of a target cell.

Each and every feature in this section entitled“engineered TCR” may be combined with each feature disclosed in the section dealing with the g chain of a TCR disclosed at the amino acid level, the d chain of a TCR disclosed at the amino acid level and the gdT C R disclosed at the amino acid level.

In some embodiments, a pharmaceutical composition described herein comprises a polypeptide construct which includes a Vy9V62 TCR comprising at least one of a g-TCR amino acid sequence or a d-TCR amino acid sequence capable of recognizing a CD277 protein on a cell surface of a target cell (e.g. tumor cell). In some embodiments, the composition, preferably pharmaceutical composition comprises a y chain of a TCR as disclosed at the amino acid level in the corresponding section, a d chain of a TCR as disclosed at the amino acid level in the corresponding section and a y TCR as disclosed at the amino acid level in the corresponding section.

In some embodiments, the polypeptide construct comprises a variant or a fragment of at least one of a g-TCR amino acid sequence or a d-TCR amino acid sequence capable of recognizing a CD277 protein on a cell surface of a target cell. The present disclosure contemplates polypeptide constructs comprising any portion or fragment or variation of a ydTCR capable of recognizing a target cell (e.g. tumor cell) via a CD277 cell surface molecule. In some embodiments, the polypeptide construct comprises at least a portion of a Cy or Cd region and at least a portion of a Vy or a V5 region of a ydTCR. In some embodiments, the polypeptide construct comprises at least a portion of a Cy or C5 region and at least a CDR3 domain of either a Vy or a V5 domain of a ydTCR. In some embodiments, the polypeptide construct comprises all CDR regions of the Vy9V52 TCR, and all of the CDR regions can be involved in binding to a cell surface molecule (e.g. CD277 molecule) on the surface of a target cell (e.g., see Wang et al,

“V {gamma} 2 V {delta} 2 T cell receptor recognition of prenyl pyrophosphates is dependent on all CDRs,” J Immunol, 184,6209-6222 (2010)).

A TCR described herein can be associated with a detectable label, a therapeutic agent or a PK modifying moiety.

Exemplary detectable labels for diagnostic purposes include, but are not limited to, fluorescent labels, radiolabels, enzymes, nucleic acid probes and contrast reagents.

Effector Cells

Provided are effector cells modified to express one or more heterologous genes or genes encoding polypeptide constructs disclosed herein, wherein said polypeptide constructs selectively bind the J-configuration of CD277.

"abT cells" or "alpha beta T cells" may be defined with respect to the function of T lymphocytes that express an abTOT which recognises peptides bound to MHC molecules (major histocompatibility complex), which are expressed on the surface of various cells. MHCs present peptides derived from the proteins of a cell. When for example a cell is infected with a virus, the MHC will present viral peptides, and the interaction between the o.pTCR and the MHC-complex activates specific types of T-cells which initiate and immune responses to eliminate the infected cell. Hence, abT cells may be functionally defined as being cells capable of recognizing peptides bound to MHC molecules. abT- cells can be identified using an antibody specific for the ab T-cell receptor such as described below (e.g. the BW242 antibody that is specific for a human ab TCR). abT cells can be selected from peripheral blood for example via the CD3 antigen, as the large majority of T cells have the c 3TCR. Such a selection will also include gdT-cells. From such selected cells, the nucleic acid (or amino acid) sequence corresponding to the aT-cell receptor chain and the bT-cell receptor chain can be determined. Hence, abT-cells can also be defined as being cells comprising a nucleic acid (or amino acid) sequence corresponding to the aT-cell receptor chain and/or the bT-cell receptor chain.

"gdT cells" or "gamma delta T cells" represent a small subset of T cells for which the antigenic molecules that trigger their activation is largely unknown. Gamma delta T cells can be considered a component of adaptive immunity in that they rearrange TCR genes to produce junctional diversity and will develop a memory phenotype. However, various subsets can also be considered part of the innate immunity where a restricted TCR is used as a pattern recognition receptor. gdT-cells can be identified using an antibody specific for the gd T-cell receptor. Antibodies suitable for FACS are widely available. Conditions are selected, such as provided by the antibody manufacturer that allows the selection of negative and/or positive cells. Examples of antibodies that can be suitable are available from BD Pharmingen (BD, 1 Becton Drive, Franklin Lakes, NJ USA), TCR-APC (clone Bl , #555718) or as available from Beckman Coulter, pan-TCR-PE (clone I MMU510, #1 M1418U). Also, from such selected cells, the nucleic acid (or amino acid sequence) sequence corresponding to the gT cell receptor chain and/or the dT cell receptor chain can be determined. Hence, gdT cells can also be defined as being cells comprising a nucleic acid (or amino acid) sequence corresponding to a gT-cell receptor chain.

In an aspect, compositions disclosed herein can utilize cells. Cells can be primary cells. Cells can be recombinant cells. Cells can be obtained from a number of non-limiting sources, including peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumors. For example, any T cell lines can be used. Alternatively, the cell can be derived from a healthy donor, from a patient diagnosed with cancer, or from a patient diagnosed with an infection. In another embodiment, the cell can be part of a mixed population of cells which present different phenotypic characteristics. A cell can also be obtained from a cell therapy bank. Disrupted cells resistant to an immunosuppressive treatment can be obtained. A desirable cell population can also be selected prior to modification. A selection can include at least one of: magnetic separation, flow cytometric selection, antibiotic selection. The one or more cells can be any blood cells, such as peripheral blood mononuclear cell (PBMC), lymphocytes, monocytes or macrophages. The one or more cells can be any immune cells such as lymphocytes, B cells, or T cells. Cells can also be obtained from whole food, apheresis, or a tumor sample of a subject. A cell can be a tumor infiltrating lymphocytes (TIL). In some cases an apheresis can be a leukapheresis. Leukapheresis can be a procedure in which blood cells are isolated from blood. During a leukapheresis, blood can be removed from a needle in an arm of a subject, circulated through a machine that divides whole blood into red cells, plasma and lymphocytes, and then the plasma and red cells are returned to the subject through a needle in the other arm. In some cases, cells are isolated after an administration of a treatment regime and cellular therapy. For example, an apheresis can be performed in sequence or concurrent with a cellular administration. In some cases, an apheresis is performed prior to and up to about 6 weeks following administration of a cellular product. In some cases, an apheresis is performed -3 weeks, -2 weeks, -1 week, 0, 1 week, 2 weeks, 3 weeks, 4 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, 6 months, 7 months, 8 months, 9 months, 10 months, 11 months, 1 year, 2 years, 3 years, 4 years, 5 years, 6 years, 7 years, 8 years, 9 years, or up to about 10 years after an administration of a cellular product. In some cases, cells acquired by an apheresis can undergo testing for specific lysis, cytokine release, metabolomics studies, bioenergetics studies, intracellular FACs of cytokine production, ELISA-spot assays, and lymphocyte subset analysis. In some cases, samples of cellular products or apheresis products can be cryopreserved for retrospective analysis of infused cell phenotype and function.

In an aspect, a composition provided herein can comprise a TIL. A TIL can be isolated from an organ afflicted with a cancer. One or more cells can be isolated from an organ with a cancer that can be a brain, heart, lungs, eye, stomach, pancreas, kidneys, liver, intestines, uterus, bladder, skin, hair, nails, ears, glands, nose, mouth, lips, spleen, gums, teeth, tongue, salivary glands, tonsils, pharynx, esophagus, large intestine, small intestine, rectum, anus, thyroid gland, thymus gland, bones, cartilage, tendons, ligaments, suprarenal capsule, skeletal muscles, smooth muscles, blood vessels, blood, spinal cord, trachea, ureters, urethra, hypothalamus, pituitary, pylorus, adrenal glands, ovaries, oviducts, uterus, vagina, mammary glands, testes, seminal vesicles, penis, lymph, lymph nodes or lymph vessels. One or more TILs can be from a brain, heart, liver, skin, intestine, lung, kidney, eye, small bowel, or pancreas. TILs can be from a pancreas, kidney, eye, liver, small bowel, lung, or heart. TILs can be from a pancreas. The one or more cells can be pancreatic islet cells, for example, pancreatic b cells. In some cases, a TIL can be from a gastrointestinal cancer. A TIL culture can be prepared a number of ways. For example, a tumor can be trimmed from non-cancerous tissue or necrotic areas. A tumor can then be fragmented to about 2-3mm in length. In some cases, a tumor can be fragmented from about 0.5 mm to about 5 mm in size, from about 1 mm to about 2 mm, from about 2 mm to about 3 mm, from about 3mm to about 4mm, or from about 4mm to about 5 mm. Tumor fragments can then be cultured in vitro utilizing media and a cellular stimulating agent such as a cytokine. In some cases, IL-2 can be utilized to expand TILs from a tumor fragment.

In some embodiments, modified effector cells are modified immune cells that comprise T cells and/or natural killer cells which are modified to encode specific nucleic acid sequence(s) for expressing a polypeptide construct described herein.

Engineered T cells with exogenous immune receptors described herein are T cells that have been engineered such that they express an exogenous receptor, for instance a polypeptide construct that specifically binds to J-configuration of CD277. The exogenous receptor can be expressed from a transgene construct and not from endogenous loci. An exogenous receptor can be of a different origin, i.e. from another species, as compared to the origin of the T cells that were engineered to provide for the engineered T cells with exogenous receptors. An exogenous receptor can be of the same origin, i.e. from the same species, as compared to the origin of the T cells that were engineered to provide for the engineered T cells with exogenous receptors. An exogenous receptor can also be an engineered gd T cell receptor or an engineered ab T cell receptor, which are engineered to selectively bind to J-configuration of CD277.

In some cases, an engineered T cell receptor is a T cell receptor of which the amino acid sequence has been modified such that it has a different amino acid sequence as compared to the corresponding amino acid sequence of an endogenous T cell receptor. T helper cells (TH cells) assist other white blood cells in immunologic processes, including maturation of B cells into plasma cells and memory B cells, and activation of cytotoxic T cells and macrophages. In some instances, TH cells are known as CD4+ T cells due to expression of the CD4 glycoprotein on the cell surfaces. Helper T cells become activated when they are presented with peptide antigens by MHC class II molecules, which are expressed on the surface of antigen-presenting cells (APCs). Once activated, they divide rapidly and secrete small proteins called cytokines that regulate or assist in the active immune response. These cells can differentiate into one of several subtypes, including TH1, TH2, TH3, TH17, Th9, or TFH, which secrete different cytokines to facilitate different types of immune responses. Signaling from the APC directs T cells into particular subtypes.

Cytotoxic T cells (TC cells or CTLs) destroy virus-infected cells and tumor cells, and are also implicated in transplant rejection. These cells are also known as CD8+ T cells since they express the CD8 glycoprotein on their surfaces. These cells recognize their targets by binding to antigen associated with MHC class I molecules, which are present on the surface of all nucleated cells. Through IL-10, adenosine, and other molecules secreted by regulatory T cells, the CD8+ cells can be inactivated to an anergic state, which prevents autoimmune diseases.

Memory T cells are a subset of antigen-specific T cells that persist long-term after an infection has resolved. They quickly expand to large numbers of effector T cells upon re exposure to their cognate antigen, thus providing the immune system with“memory” against past infections. Memory T cells comprise subtypes: stem memory T cells (TSCM), central memory T cells (TCM cells) and two types of effector memory T cells (TEM cells and TEMRA cells). Memory cells can be either CD4 ⁺ or CD8 ⁺ . Memory T cells can express the cell surface proteins CD45RO, CD45RA and/or CCR7.

Regulatory T cells (Treg cells), formerly known as suppressor T cells, play a role in the maintenance of immunological tolerance. Their major role is to shut down T cell- mediated immunity toward the end of an immune reaction and to suppress autoreactive T cells that escaped the process of negative selection in the thymus.

Natural killer T cells (NKT cells) bridge the adaptive immune system with the innate immune system. Unlike conventional T cells that recognize peptide antigens presented by major histocompatibility complex (MHC) molecules, NKT cells recognize glyco lipid antigen presented by a molecule called CDld. Once activated, these cells can perform functions ascribed to both Th and Tc cells (i.e., cytokine production and release of cytolytic/cell killing molecules). They are also able to recognize and eliminate some tumor cells and cells infected with herpes viruses.

Natural killer (NK) cells are a type of cytotoxic lymphocyte of the innate immune system. In some instances, NK cells provide a first line defense against viral infections and/or tumor formation. NK cells can detect MHC presented on infected or cancerous cells, triggering cytokine release, and subsequently induce lysis and apoptosis. NK cells can further detect stressed cells in the absence of antibodies and/or MHC, thereby allowing a rapid immune response.

In some cases, a cell that can be utilized in a cellular therapy or a cell that can be used in a method provided herein can be positive or negative for a given factor. In some

embodiments, a cell may be a CD3+ cell, CD3- cell, a CD5+ cell, CD5- cell, a CD7+ cell, CD7- cell, a CD14+ cell, CD14- cell, CD8+ cell, a CD8- cell, a CD103+ cell, CD103- cell, CD1 lb+ cell, CD1 lb- cell, a BDCA1+ cell, a BDCA1- cell, an L-selectin+ cell, an L-selectin- cell, a CD25+, a CD25- cell, a CD27+, a CD27- cell, a CD28+ cell, CD28- cell, a CD44+ cell, a CD44- cell, a CD56+ cell, a CD56- cell, a CD57+ cell, a CD57- cell, a CD62L+ cell, a CD62L- cell, a CD69+ cell, a CD69- cell, a CD45RO+ cell, a

CD45RO- cell, a CD 127+ cell, a CD 127- cell, a CD 132+ cell, a CD 132- cell, an IL-7+ cell, an IL-7- cell, an IL-15+ cell, an IL-15- cell, a lectin-like receptor Gl positive cell, a lectin- like receptor Gl negative cell, or an differentiated or de-differentiated cell thereof. The examples of factors expressed by cells is not intended to be limiting, and a person having skill in the art will appreciate that a cell may be positive or negative for any factor known in the art. In some embodiments, a cell may be positive for two or more factors. For example, a cell may be CD4+ and CD8+. In some embodiments, a cell may be negative for two or more factors. For example, a cell may be CD25-, CD44-, and CD69-. In some embodiments, a cell may be positive for one or more factors, and negative for one or more factors. For example, a cell may be CD4+ and CD8-. The selected cells can then be infused into a subject. In some embodiments, the cells may be selected for having or not having one or more given factors ( e.g ., cells may be separated based on the presence or absence of one or more factors). In some embodiments, the selected cells can also be expanded in vitro. The selected cells can be expanded in vitro prior to infusion. It should be understood that cells used in any of the methods disclosed herein may be a mixture (e.g., two or more different cells) of any of the cells disclosed herein. For example, a method of the present disclosure may comprise cells, and the cells are a mixture of CD4+ cells and CD8+ cells. In another example, a method of the present disclosure may comprise cells, and the cells are a mixture of CD4+ cells and naive cells. In some cases, a cell can be a stem memory TSCM cell comprised of CD45RO (-),

CCR7(+), CD45RA (+), CD62L+ (L-selectin), CD27+, CD28+ and IL-7Ra+, stem memory cells can also express CD95, IL-2RP, CXCR3, and LFA-l, and show numerous functional attributes distinctive of stem memory cells. Engineered cells can also be central memory TCM cells comprising L-selectin and CCR7, where the central memory cells can secrete, for example, IL-2, but not IFNy or IL-4. Engineered cells can also be effector memory TEM cells comprising L-selectin or CCR7 and produce, for example, effector cytokines such as IFNy and IL-4. In some cases a population of cells can be introduced to a subject. Lor example, a population of cells can be a combination of T cells and NK cells. In other cases, a population can be a combination of naive cells and effector cells. A population of cells can be TILs.

In particular, T cell populations can be stimulated in vitro such as by contact with an anti- CD3 antibody or antigen-binding fragment thereof, or an anti-CD2 antibody immobilized on a surface, or by contact with a protein kinase C activator (e.g. , bryostatin) sometimes in conjunction with a calcium ionophore. Lor co-stimulation of an accessory molecule on the surface of the T cells, a ligand that binds the accessory molecule can be used. Lor example, a population of T cells can be contacted with an anti-CD3 antibody and an anti- CD28 antibody, under conditions that can stimulate proliferation of the T cells. In some cases, 4-1BB can be used to stimulate cells. Lor example, cells can be stimulated with 4- 1BB and IL-21 or another cytokine. To stimulate proliferation of either CD4 T cells or CD8 T cells, an anti-CD3 antibody and an anti-CD28 antibody can be used. Lor example, the agents providing a signal may be in solution or coupled to a surface. The ratio of particles to cells may depend on particle size relative to the target cell. In further embodiments, the cells, such as T cells, can be combined with agent-coated beads, where the beads and the cells can be subsequently separated, and optionally cultured. Each bead can be coated with either anti-CD3 antibody or an anti-CD28 antibody, or in some cases, a combination of the two. In an alternative embodiment, prior to culture, the agent-coated beads and cells are not separated but are cultured together. Cell surface proteins may be ligated by allowing paramagnetic beads to which anti-CD3 and anti-CD28 can be attached (3x28 beads) to contact the T cells. In some cases cells and beads (for example, DYNABEADS ^® M-450 CD3/CD28 T paramagnetic beads at a ratio of 1 : 1) are combined in a buffer, for example, phosphate buffered saline (PBS) (e.g., without divalent cations such as, calcium and magnesium). Any cell concentration may be used. The mixture may be cultured for or for about several hours (e.g., about 3 hours) to or to about 14 days or any hourly integer value in between. In another embodiment, the mixture may be cultured for or for about 21 days or for up to or for up to about 21 days. Conditions appropriate for T cell culture can include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 5, (Lonza)) that may contain factors necessary for proliferation and viability, including serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-g , IL-4, IL-7, GM-CSF, IL-10, IL-21, IL-15, TGF beta, and TNF alpha or any other additives for the growth of cells. Other additives for the growth of cells include, but are not limited to, surfactant, plasmanate, and reducing agents such as N-acetyl-cysteine and 2-mercaptoethanol. Media can include RPMI 1640, Al M- V, DMEM, MEM, a-MEM, F-12, X-Vivo 1 , and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum- free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T cells. In some cases, an 865mL bottle of RPMI may have lOOmL of human serum, 25mL of Hepes 1M, lOmL of Penicillin/streptomycin at lO,OOOU/mL and 10,000 pg/mL, and 0.2mLof gentamycin at 50mg/mL. After addition of additives an RPMI media may be filtered using a 0.2pm xlL filter and stored at 4°C. In some embodiments, antibiotics, e.g., penicillin and

streptomycin, are included only in experimental cultures but not in cultures of cells that are to be infused into a subject. In some cases, human serum can be thawed in a 37 °C water bath, and then heat inactivated (e.g., at 56 °C for 30 min for 100 mL bottle). The sera can be filtered through a 0.8pm and 0.45pm filter prior to addition of medium.

In an aspect, cells can be maintained under conditions necessary to support growth; for example, an appropriate temperature (e.g., 37° C) and atmosphere (e.g., air plus 5% C0 ₂ ). In some instances, T cells that have been exposed to varied stimulation times may exhibit different characteristics. In some cases, a soluble monospecific tetrameric antibody against human CD3, CD28, CD2, or any combination thereof may be used.

Modified Effector Cell Doses

Provided herein are cells comprising and/or expressing a d chain of a TCR, a g chain of a TCR, and/or a ydTCR each being defined at the amino acid or nucleic acid levels in their respective sections. Such cells are also called engineered cells, modified effector cells or engineered effector cells.

Provided herein are modified effector cells encoding a polypeptide construct that selectively binds the J-configuration of cell surface CD277. In some embodiments, an amount of modified effector cells is administered to a subject in need thereof and the amount is determined based on the efficacy and the potential of inducing a cytokine- associated toxicity. In some cases, an amount of modified effector cells comprises about 10 ³ to about 10 ¹⁰ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁴ to about 10 ⁸ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁵ to about 10 ⁷ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁶ to about 10 ⁹ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁶ to about 10 ⁸ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁷ to about 10 ⁸ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁵ to about 10 ⁶ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁶ to about 10 ⁷ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁷ to about 10 ⁸ modified effector cells/kg. In some cases, an amount of modified effector cells comprises about 10 ⁸ to about 10 ⁹ modified effector cells/kg. In some instances, an amount of modified effector cells comprises about 10 ⁹ modified effector cells/kg. In some instances, an amount of modified effector cells comprises about 10 ⁸ modified effector cells/kg. In some instances, an amount of modified effector cells comprises about 10 ⁷ modified effector cells/kg. In some instances, an amount of modified effector cells comprises about 10 ⁶ modified effector cells/kg. In some instances, an amount of modified effector cells comprises about 10 ⁵ modified effector cells/kg.

In some embodiments, the modified effector cells are modified T cells encoding gamma delta TCR of fragment thereof that selectively bind J-configuration of CD277. In some cases, an amount of engineered gamma delta TCR T- cells comprises about 10 ⁵ to about 10 ⁹ gamma delta TCR cells/kg. In some cases, an amount of engineered gamma delta TCR cells comprises about 10 ⁵ to about 10 ⁸ gamma delta TCR cells/kg. In some cases, an amount of engineered gamma delta TCR cells comprises about 10 ⁷ to about 10 ⁹ gamma delta TCR cells/kg. In some cases, an amount of engineered gamma delta TCR cells comprises about 10 ⁵ to about 10 ⁶ gamma delta TCR cells/kg.

Cytokines

Provided herein are polynucleotides encoding a polypeptide construct described herein and a cytokine, or variant or derivative thereof, and methods and systems incorporating the same. Cytokine is a category of small proteins between about 5-20 kDa that are involved in cell signaling. In some instances, cytokines include chemokines, interferons, interleukins, colony-stimulating factors or tumor necrosis factors. In some embodiments, chemokines play a role as a chemoattractant to guide the migration of cells, and is classified into four subfamilies: CXC, CC, CX3C, and XC. Exemplary chemokines include chemokines from the CC subfamily: CCL1, CCL2 (MCP-l), CCL3, CCL4, CCL5 (RANTES), CCL6, CCL7, CCL8, CCL9 (or CCL10), CCL11, CCL12, CCL13, CCL14, CCL15, CCL16, CCL17, CCL18, CCL19, CCL20, CCL21, CCL22, CCL23, CCL24, CCL25, CCL26, CCL27, and CCL28; the CXC subfamily: CXCL1, CXCL2, CXCL3, CXCL4, CXCL5, CXCL6, CXCL7, CXCL8, CXCL9, CXCL10, CXCL11, CXCL12, CXCL13, CXCL14, CXCL15, CXCL16, and CXCL17; the XC subfamily: XCL1 and XCL2; and the CX3C subfamily CX3CL1.

Interferons (IFNs) comprise interferon type I (e.g. IFN-a, IFN-b, IFN-e, IFN-k, and IFN- co), interferon type II (e.g. IFN-g), and interferon type III. In some embodiments, IFN-a is further classified into about 13 subtypes including IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21. Interleukins are expressed by leukocytes or white blood cells and they promote the development and differentiation of T and B lymphocytes and hematopoietic cells.

Exemplary interleukines include IF-l, IF-2, IF-3, IF-4, IF-5, IF-6, IF-7, IF-8 (CXCF8), IF-9, IF- 10, IF-l 1, IF-12, IF-13, IF-14, IF-15, IF-16, IF-17, IF-18, IF-19, IF-20, IF-21, IF-22, IF-23, IF-24, IF-25, IF-26, IF-27, IF-28, IF-29, IF-30, IF-31, IF-32, IF-33, IF-35, and IF-36.

Tumor necrosis factors (TNFs) are a group of cytokines that modulate apoptosis. In some instances, there are about 19 members within the TNF family, including, not limited to, TNFa, lymphotoxin-alpha (FT-alpha), lymphotoxin-beta (FT-beta), T cell antigen gp39 (CD40F), CD27F, CD30F, FASF, 4-1BBF, OX40F, and TNF-related apoptosis inducing ligand (TRAIF). Colony- stimulating factors (CSFs) are secreted glycoproteins that interact with receptor proteins on the surface of hemopoietic stem cells, which subsequently modulates cell proliferation and differentiation into specific kind of blood cells. In some instances, a CSF comprises macrophage colony- stimulating factor, granulocyte macrophage colony- stimulating factor (GM-CSF), granulocyte colony-stimulating factor (G-CSF) or promegapoietin.

In some embodiments, one or more methods described herein further comprise administration of a cytokine. In some instances, the cytokine comprises a chemokine, an interferon, an interleukin, a colony-stimulating factor or a tumor necrosis factor. In some instances, one or more methods described herein further comprise administration of a cytokine selected from a chemokine, an interferon, an interleukin, a colony-stimulating factor or a tumor necrosis factor.

Indications

In some embodiments, disclosed herein are methods of administering a modified effector cell encoding a polynucleotide described herein to a subject having a disorder, for instance a cancer. In some embodiments, the method is for preventing, treating, regressing, curing and/or delaying cancer in a subject. In some cases, the cancer is a metastatic cancer. In other cases, the cancer is a relapsed or refractory cancer.

In some cases, a cancer is a solid tumor or a hematologic malignancy. In some instances, the cancer is a solid tumor. In other instances, the cancer is a hematologic malignancy.

In some instances, the cancer is a solid tumor. In some instances, the solid tumor is lung cancer, breast cancer, colorectal cancer, prostate cancer, stomach cancer, liver cancer, oesophagus cancer, cervix cancer, thyroid cancer, bladder cancer, or any combinations thereof. Exemplary solid tumors include, but are not limited to, anal cancer; appendix cancer; bile duct cancer (i.e., cholangiocarcinoma); bladder cancer; brain tumor; breast cancer; cervical cancer; colon cancer; cancer of Unknown Primary (CUP); esophageal cancer; eye cancer; fallopian tube cancer; gastroenterological cancer; kidney cancer; liver cancer; lung cancer; medulloblastoma; melanoma; oral cancer; ovarian cancer; pancreatic cancer; parathyroid disease; penile cancer; pituitary tumor; prostate cancer; rectal cancer; skin cancer; stomach cancer; testicular cancer; throat cancer; thyroid cancer; uterine cancer; vaginal cancer; or vulvar cancer.

In some instances, the cancer is a hematologic malignancy. In some instances, the cancer is a hematological malignancy selected from: myltiple myeloma, acute myeloid leukemia (AML), myelogenous leukemia, or any combination thereof. In some cases, a

hematologic malignancy comprises a lymphoma, a leukemia, a myeloma, or a B-cell malignancy. In some cases, a hematologic malignancy comprises a lymphoma, a leukemia or a myeloma. In some instances, exemplary hematologic malignancies include chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL),

Waldenstrom’s macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt’s lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion lymphoma, or lymphomatoid granulomatosis. In some embodiments, the hematologic malignancy comprises a myeloid leukemia. In some embodiments, the hematologic malignancy comprises acute myeloid leukemia (AML) or chronic myeloid leukemia (CML).

In some instances, disclosed herein are methods of administering to a subject having a hematologic malignancy selected from chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), high risk CLL, non-CLL/SLL lymphoma, prolymphocytic leukemia (PLL), follicular lymphoma (FL), diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma (MCL), Waldenstrom’s macroglobulinemia, multiple myeloma, extranodal marginal zone B cell lymphoma, nodal marginal zone B cell lymphoma, Burkitt’s lymphoma, non-Burkitt high grade B cell lymphoma, primary mediastinal B-cell lymphoma (PMBL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma, B cell prolymphocytic leukemia, lymphoplasmacytic lymphoma, splenic marginal zone lymphoma, plasma cell myeloma, plasmacytoma, mediastinal (thymic) large B cell lymphoma, intravascular large B cell lymphoma, primary effusion

lymphoma, or lymphomatoid granulomatosis a modified effector cell described herein. In some instances, disclosed herein are methods of administering to a subject having a hematologic malignancy selected from AML or CML a modified effector cell to the subject. In some embodiments, compositions and methods provided herein can be used for preventing, treating, regressing, curing and/or delaying multiple myeloma, acute myeloid leukemia (AML), myelogenous leukemia, or any combination thereof in a subject.

Immune Effector Cell Sources

In certain aspects, the embodiments described herein include methods of making and/or expanding the immune effector cells (e.g., T-cells, NK-cell or NK T-cells) that comprises transfecting the cells with an expression vector containing a DNA (or RNA) construct encoding polypeptides that selectively binds the J-configuration of cell surface CD277, then, optionally, stimulating the cells with feeder cells, recombinant antigen, or an antibody to the receptor to cause the cells to proliferate. In certain aspects, the cell (or cell population) engineered to express polypeptides that selectively binds the J- configuration of cell surface CD277 is a stem cell, iPS cell, immune effector cell or a precursor of these cells.

Sources of immune effector cells can include both allogeneic and autologous sources. In some cases immune effector cells can be differentiated from stem cells or induced pluripotent stem cells (iPSCs). Thus, cell for engineering according to the embodiments can be isolated from umbilical cord blood, peripheral blood, human embryonic stem cells, or iPSCs. For example, allogeneic T cells can be modified to include a chimeric antigen receptor (and optionally, to lack functional TCR). In some aspects, the immune effector cells are primary human T cells such as T cells derived from human peripheral blood mononuclear cells (PBMC). PBMCs can be collected from the peripheral blood or after stimulation with G-CSF (Granulocyte colony stimulating factor) from the bone marrow, or umbilical cord blood. Following transfection or transduction (e.g., with a CAR expression construct), the cells can be immediately infused or can be cryo-preserved. In certain aspects, following transfection, the cells can be propagated for days, weeks, or months ex vivo as a bulk population within about 1, 2, 3, 4, 5 days or more following gene transfer into cells. In a further aspect, following transfection, the transfectants are cloned and a clone demonstrating presence of a single integrated or episomally maintained expression cassette or plasmid, and expression of the chimeric antigen receptor is expanded ex vivo. The clone selected for expansion demonstrates the capacity to specifically recognize and lyse antigen-expressing target cells. The recombinant T cells can be expanded by stimulation with IL-2, or other cytokines that bind the common gamma-chain (e.g., IL-7, IL-12, IL-15, IL-21, and others). The recombinant T cells can be expanded by stimulation with artificial antigen presenting cells. The recombinant T cells can be expanded on artificial antigen presenting cell or with an antibody, such as OKT3, which cross links CD3 on the T cell surface. Subsets of the recombinant T cells can be further selected with the use of magnetic bead based isolation methods and/or fluorescence activated cell sorting technology and further cultured with the AaPCs. In a further aspect, the genetically modified cells can be cryopreserved.

T cells can also be obtained from a number of sources, including peripheral blood, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion, spleen tissue, and tumor (tumor-infiltrating lymphocytes). In certain embodiments of the present disclosure, any number of T cell lines available in the art, can be used. In certain embodiments of the present disclosure, T cells can be obtained from a unit of blood collected from a subject using any number of techniques known to the skilled artisan, such as FICOLL® separation. In embodiments, cells from the circulating blood of an individual are obtained by apheresis. The apheresis product typically contains lymphocytes, including T cells, monocytes, granulocytes, B cells, other nucleated white blood cells, red blood cells, and platelets. In one embodiment, the cells collected by apheresis can be washed to remove the plasma fraction and to place the cells in an appropriate buffer or media for subsequent processing steps. In one embodiment of the present disclosure, the cells are washed with phosphate buffered saline (PBS). In an alternative embodiment, the wash solution lacks calcium and can lack magnesium or can lack many if not all divalent cations. Initial activation steps in the absence of calcium lead to magnified activation. As those of ordinary skill in the art would readily appreciate a washing step can be accomplished by methods known to those in the art, such as by using a semi-automated "flow-through" centrifuge (for example, the Cobe 2991 cell processor, the Baxter CytoMate, or the Haemonetics Cell Saver 5) according to the manufacturer's instructions. After washing, the cells can be resuspended in a variety of biocompatible buffers, such as, for example, Ca2+-free, Mg2+-ffee PBS, PlasmaLyte A, or other saline solution with or without buffer. Alternatively, the undesirable components of the apheresis sample can be removed and the cells directly resuspended in culture media.

In another embodiment, T cells are isolated from peripheral blood lymphocytes by lysing the red blood cells and depleting the monocytes, for example, by centrifugation through a PERCOLL® gradient or by counterflow centrifugal elutriation. A specific subpopulation of T cells, such as CD3+, CD28+, CD4+, CD8+, CD45RA+, and CD45RO+ T cells, can be further isolated by positive or negative selection techniques.

Enrichment of a T cell population by negative selection can be accomplished with a combination of antibodies directed to surface markers unique to the negatively selected cells. One method is cell sorting and/or selection via negative magnetic

immunoadherence or flow cytometry that uses a cocktail of monoclonal antibodies directed to cell surface markers present on the cells negatively selected. For example, to enrich for CD4+ cells by negative selection, a monoclonal antibody cocktail typically includes antibodies to CD14, CD20, CD1 lb, CD16, HLA-DR, and CD8. In certain embodiments, it can be desirable to enrich for or positively select for regulatory T cells which typically express CD4+, CD25+, CD62Lhi, GITR+, and FoxP3+. Alternatively, in certain embodiments, T regulatory cells are depleted by anti-CD25 conjugated beads or other similar method of selection.

For isolation of a desired population of cells by positive or negative selection, the concentration of cells and surface (e.g., particles such as beads) can be varied. In certain embodiments, it can be desirable to significantly decrease the volume in which beads and cells are mixed together (i.e., increase the concentration of cells), to ensure maximum contact of cells and beads. For example, in one embodiment, a concentration of 2 billion cells/ml is used. In one embodiment, a concentration of 1 billion cells/ml is used. In a further embodiment, greater than 100 million cells/ml is used. In a further embodiment, a concentration of cells of 10, 15, 20, 25, 30, 35, 40, 45, or 50 million cells/ml is used. In yet another embodiment, a concentration of cells from 75, 80, 85, 90, 95, or 100 million cells/ml is used. In further embodiments, concentrations of 125 or 150 million cells/ml can be used. Using high concentrations can result in increased cell yield, cell activation, and cell expansion. Further, use of high cell concentrations allows more efficient capture of cells that can weakly express target antigens of interest, such as CD28-negative T cells, or from samples where there are many tumor cells present (i.e., leukemic blood, tumor tissue, etc.). Such populations of cells can have therapeutic value and would be desirable to obtain. For example, using high concentration of cells allows more efficient selection of CD8+ T cells that normally have weaker CD28 expression.

In a related embodiment, it may be desirable to use lower concentrations of cells. By significantly diluting the mixture of T cells and surface (e.g., particles such as beads), interactions between the particles and cells is minimized. This selects for cells that express high amounts of desired antigens to be bound to the particles. For example, CD4+ T cells express higher levels of CD28 and are more efficiently captured than CD8+ T cells in dilute concentrations. In one embodiment, the concentration of cells used is 5x106/ml. In other embodiments, the concentration used can be from about lxl 05/ml to lxl06/ml, and any integer value in between.

In other embodiments, the cells can be incubated on a rotator for varying lengths of time at varying speeds at either 2-10° C or at room temperature.

T cells for stimulation can also be frozen after a washing step. After the washing step that removes plasma and platelets, the cells can be suspended in a freezing solution. While many freezing solutions and parameters are known in the art and will be useful in this context, one method involves using PBS containing 20% DMSO and 8% human serum albumin, or culture media containing 10% Dextran 40 and 5% Dextrose, 20% Human Serum Albumin and 7.5% DMSO, or 31.25% Plasmalyte-A, 31.25% Dextrose 5%, 0.45% NaCl, 10% Dextran 40 and 5% Dextrose, 20% Human Serum Albumin, and 7.5% DMSO or other suitable cell freezing media containing for example, Hespan and PlasmaLyte A, the cells then are frozen to -80° C at a rate of lo per minute and stored in the vapor phase of a liquid nitrogen storage tank. Other methods of controlled freezing can be used as well as uncontrolled freezing immediately at -20° C or in liquid nitrogen.

In certain embodiments, cryopreserved cells are thawed and washed as described herein and allowed to rest for one hour at room temperature prior to activation using the methods of the present disclosure.

Also contemplated in the context of the present disclosure is the collection of blood samples or apheresis product from a subject at a time period prior to when the expanded cells as described herein might be needed. As such, the source of the cells to be expanded can be collected at any time point necessary, and desired cells, such as T cells, isolated and frozen for later use in T cell therapy for any number of diseases or conditions that would benefit from T cell therapy, such as those described herein. In one embodiment a blood sample or an apheresis is taken from a generally healthy subject. In certain embodiments, a blood sample or an apheresis is taken from a generally healthy subject who is at risk of developing a disease, but who has not yet developed a disease, and the cells of interest are isolated and frozen for later use. In certain embodiments, the T cells can be expanded, frozen, and used at a later time. In certain embodiments, samples are collected from a patient shortly after diagnosis of a particular disease as described herein but prior to any treatments. In a further embodiment, the cells are isolated from a blood sample or an apheresis from a subject prior to any number of relevant treatment modalities, including but not limited to treatment with agents such as natalizumab, efalizumab, antiviral agents, chemotherapy, radiation, immunosuppressive agents, such as cyclosporin, azathioprine, methotrexate, mycophenolate, and FK506, antibodies, or other immunoablative agents such as CAMPATH, anti-CD3 antibodies, cytoxan, fludarabine, cyclosporin, FK506, rapamycin, mycophenolic acid, steroids, FR901228, and irradiation. These drugs inhibit either the calcium dependent phosphatase calcineurin (cyclosporine and FK506) or inhibit the p70S6 kinase that is important for growth factor induced signaling (rapamycin) (Liu et al., Cell 66:807-815, (1991); Henderson et al., Immun 73:316-321, (1991); Bierer et al., Curr. Opin. Immun 5:763-773, (1993)). In a further embodiment, the cells are isolated for a patient and frozen for later use in conjunction with (e.g., before, simultaneously or following) bone marrow or stem cell transplantation, T cell ablative therapy using either chemotherapy agents such as, fludarabine, external- beam radiation therapy (XRT), cyclophosphamide, or antibodies such as OKT3 or CAMPATH. In another embodiment, the cells are isolated prior to and can be frozen for later use for treatment following B-cell ablative therapy such as agents that react with CD20, e.g., Rituxan.

In a further embodiment of the present disclosure, T cells are obtained from a patient directly following treatment. In this regard, it has been observed that following certain cancer treatments, in particular treatments with drugs that damage the immune system, shortly after treatment during the period when patients would normally be recovering from the treatment, the quality of T cells obtained can be optimal or improved for their ability to expand ex vivo. Likewise, following ex vivo manipulation using the methods described herein, these cells can be in a preferred state for enhanced engraftment and in vivo expansion. Thus, it is contemplated within the context of the present disclosure to collect blood cells, including T cells, dendritic cells, or other cells of the hematopoietic lineage, during this recovery phase. Further, in certain embodiments, mobilization (for example, mobilization with GM-CSF) and conditioning regimens can be used to create a condition in a subject wherein repopulation, recirculation, regeneration, and/or expansion of particular cell types is favored, especially during a defined window of time following therapy. Illustrative cell types include T cells, B cells, dendritic cells, and other cells of the immune system. Activation and Expansion of T Cells

In certain embodiments are T cells comprising polynucleotides encoding polypeptide constructs described herein that selectively bind the J-configuration of CD277. Whether prior to or after genetic modification of the T cells to express the desired polypeptide construct, the T cells can be activated and expanded generally using methods as described, for example, in U.S. Pat. Nos. 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; 6,867,041; and U.S. Patent Application Publication No. 20060121005.

“Adoptive T cell transfer” refers to the isolation and ex vivo expansion of tumor specific T cells to achieve greater number of T cells than what could be obtained by vaccination alone or the patient’s natural tumor response. With regard to the current disclosure, tumor specific T cells can be obtained, for instance, by engineering T cells to express a polypeptide construct described herein that selectively binds the J-configuration of cell surface CD277. The tumor specific T cells can then be infused into patients with cancer in an attempt to give their immune system the ability to overwhelm remaining tumor via T cells which can attack and kill cancer. There are many forms of adoptive T cell therapy being used for cancer treatment; culturing tumor infiltrating lymphocytes or TIL, isolating and expanding one particular T cell or clone, and even using T cells that have been engineered to potently recognize and attack tumors.

Pharmaceutical Compositions and Dosage Forms

In some embodiments, disclosed herein are compositions comprising a polypeptide construct disclosed herein, a polynucleotide encoding the same, or an engineered cell expressing the same, for administration in a subject. In some embodiments, the composition, preferably pharmaceutical composition comprises a y chain of a TCR as disclosed at the amino acid level in the corresponding section, a d chain of a TCR as disclosed at the amino acid level in the corresponding section, a ybTCR as disclosed at the amino acid level in the corresponding section or a cell comprising said g chain, d chain or ybTCR at the amino acid level in the corresponding section.

In some instances, are modified effector cell compositions encoding a polynucleotide or polypeptide disclosed herein, and optionally containing a cytokine and/or an additional therapeutic agent such as an intermediate of the mammalian mevalonate pathway, such as isopentenyl pyrophosphate (IPP), and the microbial 2- C-methyl-D-erythiitol 4-phosphate (MEP) pathway. In some embodiments, the pharmaceutical composition can comprise an agent that increases activity of a RhoB GTPase in a target cell (e.g. cancer cell) of a subject. In some embodiments, the agent can increases translocation of the RhoB GTPase to a cell membrane of the cancer cell. In some embodiments, the agent can maintain RhoB GTPase at a cell membrane of the cancer cell. In some embodiments, the agent can increase translocation of the RhoB GTPase away from a nucleus of the cancer cell. In some embodiments, the agent can increase expression of a gene or transcript encoding the RhoB GTPase. In some embodiments, the agent can increase stability of the RhoB

GTPase. In some embodiments, the agent can increase an interaction between the RhoB GTPase and a BNT3 protein. In some embodiments, the agent can activate RhoB GTPase. In some embodiments, the agent can increase an interaction between the RhoB GTPase and GTP. In some embodiments, the agent can reduce an interaction between the RhoB GTPase and GDP. In some embodiments, the agent can increase an amount of GTP in the cancer cell. In some embodiments, the agent can increase availability of GTP in the cancer cell. In some embodiments, the agent can be conjugated to a moiety that binds a cell surface molecule on the cancer cell, thereby targeting the agent to the cancer cell. In some embodiments, the moiety comprises a small molecule compound, a peptide, or an antibody or antigen binding fragment. In an aspect, an agent that increases activity of a RhoB GTPase does so indirectly by binding to secondary factors that in turn stimulate activity of RhoB GTPase. A secondary factor can be involved in a RhoB GTPase activation cascade. In an aspect, a secondary factor may be involved in signaling, structural changes, conformational changes, configurational changes, and the like. In an aspect, an agent that increases activity of a RhoB GTPase may increase activity at any point upstream of a stimulatory pathway of RhoB GTPase. For example, an agent can be “A” which in turn stimulates“B” which in turn stimulates“C” which in turn stimulates RhoB GTPase. In an aspect, an agent directly stimulates RhoB GTPase without involvement of any secondary factors. An agent can increase activity of RhoB GTPase by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or up to about 100% as compared to a comparable method or composition absent the RhoB GTPase stimulatory agent.

In some embodiments, the agent can increase an amount of an intracellular phosphoantigen in the cancer cell. In some embodiments, the additional agent is a mevalonate pathway inhibitor. An inhibitor of the mevalonate pathway can inhibit a factor involved in the generation of mevalonate. In an aspect, an inhibitor of the mevalonate pathway can inhibit a reaction involved in the mevalonate pathway. In an aspect, a mevalonate inhibitor can inhibit an enzyme such as: acetoacetyl-CoA, 3- hydroxy-3-methylglutaryl-CoA (HMG-CoA), HMG-CoA reductase, mevalonate-5- phosphate, famesyl pyrophosphate synthase (FPPS), mevalonate-5 -kinase, mevalonate-3- phosphate-5 -kinase, phosphomevalonate kinase, mevalonate-5 -pyrophosphate decarboxylase, isopentenyl pyrophosphate isomerase, ATP, and combinations thereof. In some embodiments, the mevalonate pathway inhibitor is an aminobisphosphonate. In an aspect, an agent can be hydrogen sulfide (H ₂ S). In an aspect, an agent can be DM-22. In some embodiments, the aminobisphosphonate is zoledronate. In an aspect, an agent can be a statin. In an aspect, a statin can inhibit a mevalonate pathway. In an aspect, an agent can be used to treat bone disease, multiple myeloma, or a combination thereof. In an aspect, an agent that increases activity of a phosphoantigen can bind phosphoantigen directly to stimulate its activity. In an aspect, an agent that increases activity of a phosphoantigen does so indirectly by binding to secondary factors that in turn stimulate activity or accumulation of phosphoantigen in a cytoplasm of a tumor cell. A secondary factor can be involved in a phosphoantigen production cascade. In an aspect, a secondary factor may be involved in translation, signaling, structural changes, conformational changes, configurational changes, and the like. In an aspect, an agent that increases activity of a phosphoantigen may increase activity at any point upstream of a pathway of phosphoantigen. For example, an agent can be“A” which in turn stimulates“B” which in turn stimulates“C” which in turn stimulates phosphoantigen to accumulate in a cytoplasm. In an aspect, an agent directly stimulates phosphoantigen accumulation without involvement of any secondary factors. An agent can increase activity of phosphoantigen, such as phosphoantigena accumulation, by about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or up to about 100% as compared to a comparable method or composition absent the phosphoantigen stimulatory agent.

In an aspect, provided herein can be a synergistic method for tumor cytotoxicity. In some embodiment, said method is for preventing, treating, regressing, curing and/or delaying cancer in a subject. In an aspect, a method of treatment may comprise administering one or more agents that bolster expression of CD277 on a surface of a cell. Agents that can bolster expression of CD277 can act by increasing activity of RhoB GTPase and/or phosphoantigen in a cytoplasm of a tumor cell. In an aspect, cytotoxicity of a tumor can be increased from about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or up to about 100% as compared to a comparable method or composition absent the

phosphoantigen stimulatory agent, absent the RhoGTPase stimulatory agent, or their combination.

In an aspect, provided can be a method of bolstering expression of CD277 on a tumor cell surface comprising increasing activity of intracellular agents that bind an interior portion of CD277.

In some embodiments, different pharmaceutically active ingredients described herein can be administered to a subject in need thereof in the same pharmaceutical composition. For example, an agent that increases activity of a RhoB GTPase in a target cell can administered in the same pharmaceutical composition as a polypeptide construct, a polynucleotide encoding the same, or an engineered cell expressing the same.

Accordingly, in such pharmaceutical compositions containing multiple pharmaceutically active ingredients, the multiple pharmaceutically active ingredients are administered to a subject in need thereof simultaneously. In other embodiments, different pharmaceutically active ingredients described herein can be administered to a subject in need thereof in different pharmaceutical compositions. For example, an agent that increases activity of a RhoB GTPase in a target cell can be administered in a different pharmaceutical composition as a polypeptide construct, a polynucleotide encoding the same, or an engineered cell expressing the same. In such compositions, a first composition comprising a first pharmaceutically active ingredient can be administered prior to, subsequent to, or simultaneously with a second composition comprising a second pharmaceutically active ingredient. For example, in some embodiments, a first composition comprising a polypeptide construct, a polynucleotide construct encoding the same, or an engineered cell expressing the same is administered to a subject in need thereof prior to

administration of a second composition comprising an agent that increases activity of a RhoB GTPase in a target cell. In some embodiments, a first composition comprising a polypeptide construct, a polynucleotide construct encoding the same, or an engineered cell expressing the same is administered to a subject in need thereof subsequent to administration of a second composition comprising an agent that increases activity of a RhoB GTPase in a target cell. In some embodiments, a first composition comprising a polypeptide construct, a polynucleotide construct encoding the same, or an engineered cell expressing the same is administered to a subject in need thereof simultaneously with a second composition comprising an agent that increases activity of a RhoB GTPase in a target cell. In some instances, a first composition comprising a first pharmaceutically active ingredient can be administered at a predetermined time interval with regard to a second composition comprising a second pharmaceutically active ingredient. In some instances a first composition comprising a polypeptide construct, a polynucleotide construct encoding the same, or an engineered cell expressing the same is administered to a subject in a single dose once a day and a second composition comprising an agent that increases activity of a RhoB GTPase in a target cell is delivered in multiple doses at various times during the day. In some instances, a composition comprising an agent that increases activity of a RhoB GTPase in a target cell is delivered as a controlled release formulation for sustained release over a predetermined period of time, and a second composition comprising a polypeptide construct described herein, a polynucleotide construct encoding the same, or an engineered cell is delivered at various intervals during said predetermined period of time.

In an aspect, a composition comprising a cell can include a dosage form of a cell. With the instant application in hand, the skilled worker can determine a therapeutically effective amount of cells for administration. In some cases, about 5xl0 ¹⁰ cells are administered to a subject. In some cases, about 5xl0 ¹⁰ cells represent the median amount of cells administered to a subject. In some embodiments, about 5xl0 ¹⁰ cells can be introduced to a subject. In some embodiments, at least about at least about lxlO ⁶ cells, at least about 2xl0 ⁶ cells, at least about 3xl0 ⁶ cells, at least about 4xl0 ⁶ cells, at least about 5xl0 ⁶ cells, at least about 6xl0 ⁶ cells, at least about 6xl0 ⁶ cells, at least about 8xl0 ⁶ cells, at least about 9xl0 ⁶ cells, lxl 0 ⁷ cells, at least about 2xl0 ⁷ cells, at least about 3xl0 ⁷ cells, at least about 4xl0 ⁷ cells, at least about 5xl0 ⁷ cells, at least about 6xl0 ⁷ cells, at least about 6xl0 ⁷ cells, at least about 8xl0 ⁷ cells, at least about 9xl0 ⁷ cells, at least about lxl 0 ⁸ cells, at least about 2xl0 ⁸ cells, at least about 3xl0 ⁸ cells, at least about 4xl0 ⁸ cells, at least about 5xl0 ⁸ cells, at least about 6xl0 ⁸ cells, at least about 6xl0 ⁸ cells, at least about 8xl0 ⁸ cells, at least about 9xl0 ⁸ cells, at least about lxlO ⁹ cells, at least about 2xl0 ⁹ cells, at least about 3xl0 ⁹ cells, at least about 4xl0 ⁹ cells, at least about 5xl0 ⁹ cells, at least about 6xl0 ⁹ cells, at least about 6xl0 ⁹ cells, at least about 8xl0 ⁹ cells, at least about 9xl0 ⁹ cells, at least about lxlO ¹⁰ cells, at least about 2xl0 ¹⁰ cells, at least about 3xl0 ¹⁰ cells, at least about 4xl0 ¹⁰ cells, at least about 5xl0 ¹⁰ cells, at least about 6xl0 ¹⁰ cells, at least about 6xl0 ¹⁰ cells, at least about 8xl0 ¹⁰ cells, at least about 9xl0 ¹⁰ cells, at least about lxlO ¹¹ cells, at least about 2xlO ⁿ cells, at least about 3xl0 ⁿ cells, at least about 4xlO ⁿ cells, at least about 5xlO ⁿ cells, at least about 6xlO ⁿ cells, at least about 6xlO ⁿ cells, at least about 8xl0 ⁿ cells, at least about 9xlO ⁿ cells, or at least about lxl 0 ¹² cells are administered to a subject.

In an aspect, a subject may receive additional treatments or therapeutics. The disclosed compositions and methods herein can comprise administration of other agents. For example additional agents can include cytotoxic/antineoplastic agents and anti-angiogenic agents. Cytotoxic/anti-neoplastic agents can be defined as agents who attack and kill cancer cells. Some cytotoxic/anti-neoplastic agents can be alkylating agents, which alkylate the genetic material in tumor cells, e.g., cis-platin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacabazine. Other cytotoxic/anti-neoplastic agents can be antimetabolites for tumor cells, e.g., cytosine arabinoside, fluorouracil, methotrexate, mercaptopuirine, azathioprime, and procarbazine. Other cytotoxic/anti-neoplastic agents can be antibiotics, e.g., doxorubicin, bleomycin, dactinomycin, daunorubicin,

mithramycin, mitomycin, mytomycin C, and daunomycin. There are numerous liposomal formulations commercially available for these compounds. Still other cytotoxic/anti neoplastic agents can be mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine and etoposide. Miscellaneous cytotoxic/anti-neoplastic agents include taxol and its derivatives, L-asparaginase, anti-tumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine.

In some cases, an agent may comprise an immunostimulant. An immunostimulant can be specific or non-specific. A specific immunostimulant can provide antigenic specificity such as a vaccine or an antigen. A non-specific immunostimulant can augment an immune response or stimulate an immune response. A non-specific immunostimulant can be an adjuvant. Immunostimulants can be vaccines, colony stimulating agents, interferons, interleukins, viruses, antigens, co-stimulatory agents, immunogenicity agents, immunomodulators, or immunotherapeutic agents. An immunostimulant can be a cytokine such as an interleukin. One or more cytokines can be introduced with cells of the invention. Cytokines can be utilized to boost cytotoxic T lymphocytes (including adoptively transferred tumor-specific cytotoxic T lymphocytes) to expand within a tumor microenvironment. In some cases, IL-2 can be used to facilitate expansion of the cells described herein. Cytokines such as IL-15 can also be employed. Other relevant cytokines in the field of immunotherapy can also be utilized, such as IL-2, IL-7, IL-12, IL-15, IL-21, or any combination thereof. In some cases, IL-2, IL-7, and IL-15 are used to culture cells of the invention. An interleukin can be IL-2, or aldeskeukin. Aldesleukin can be administered in low dose or high dose. A high dose aldesleukin regimen can involve administering aldesleukin intravenously every 8 hours, as tolerated, for up to about 14 doses at about 0.037 mg/kg (600,000 IU/kg). An immunostimulant (e.g., aldesleukin) can be administered within 24 hours after a cellular administration. An immunostimulant (e.g., aldesleukin) can be administered in as an infusion over about 15 minutes about every 8 hours for up to about 4 days after a cellular infusion. An immunostimulant (e.g., aldesleukin) can be administered at a dose from about 100,000 IU/kg, 200,000 IU/kg, 300,000 IU/kg, 400,000 IU/kg, 500,000 IU/kg, 600,000 IU/kg, 700,000 IU/kg, 800,000 IU/kg, 900,000 IU/kg, or up to about 1,000,000 IU/kg. In some cases, aldesleukin can be administered at a dose from about 100,000 IU/kg to 300,000 IU/kg, from 300,000 IU/kg to 500,000 IU/kg, from 500,000 IU/kg to 700,000 IU/kg, from 700,000 IU/kg to about 1,000,000 IU/kg. An immunostimulant (e.g., aldesleukin) can be administered from 1 dose to about 14 doses.

In some cases, an additional agent may comprise an immunosuppressive agent as part of a therapy regime. An immunosuppressive agent can refer to a radiotherapeutic, a biologic, or a chemical agent. In some cases, an immunosuppressive agent can include a chemical agent. For example, a chemical agent can comprise at least one member from the group consisting of: cyclophosphamide, mechlorethamine, chlorambucil, melphalan, ifosfamide, thiotepa, hexamethylmelamine, busulfan, fludarabine, nitrosoureas, platinum,

methotrexate, azathioprine, mercaptopurine, procarbazine, dacarbazine, temozolomide, carmustine, lomustine, streptozocin, fluorouracil, dactinomycin, anthracycline, mitomycin C, bleomycin, and mithramycin. A chemical agent can be cyclophosphamide or fludarabine.

Additionally, immunosuppressive agents can include glucocorticoids, cytostatic, antibodies, anti-immunophilins, or any derivatives thereof. A glucocorticoid can suppress an allergic response, inflammation, and autoimmune conditions. Glucocorticoids can be prednisone, dexamethasone, and hydrocortisone. Immunosuppressive therapy can comprise any treatment that suppresses the immune system. Immunosuppressive therapy can help to alleviate, minimize, or eliminate transplant rejection in a recipient. For example, immunosuppressive therapy can comprise immuno-suppressive drugs.

Immunosuppressive drugs that can be used before, during and/or after transplant, but are not limited to, MMF (mycophenolate mofetil (Cellcept)), ATG (anti-thymocyte globulin), anti-CD 154 (CD40L), anti-CD40 (2C10, ASKP1240, CCFZ533X2201), alemtuzumab (Campath), anti-CD20 (rituximab), anti-IL-6R antibody (tocilizumab, Actemra), anti-IL-6 antibody (sarilumab, olokizumab), CTLA4-Ig (Abatacept/Orencia), belatacept

(LEA29Y), sirolimus (Rapimune), everolimus, tacrolimus (Prograf), daclizumab (Ze- napax), basiliximab (Simulect), infliximab (Remicade), cyclosporin, deoxyspergualin, soluble complement receptor 1, cobra venom factor, compstatin, anti C5 antibody (eculizumab/Soliris), methylprednisolone, FTY720, everolimus, leflunomide, anti-IL-2R- Ab, rapamycin, anti-CXCR3 antibody, anti-ICOS antibody, anti-OX40 antibody, and anti-CD 122 antibody. Furthermore, one or more than one immunosuppressive

agents/drugs can be used together or sequentially. One or more than one

immunosuppressive agents/drugs can be used for induction therapy or for maintenance therapy. The same or different drugs can be used during induction and maintenance stages. In some cases, daclizumab (Zenapax) can be used for induction therapy and tacrolimus (Prograf) and sirolimus (Rapimune) can be used for maintenance therapy. Daclizumab (Zenapax) can also be used for induction therapy and low dose tacrolimus (Prograf) and low dose sirolimus (Rapimune) can be used for maintenance therapy.

Immunosuppression can also be achieved using non-drug regimens including, but not limited to, whole body irradiation, thymic irradiation, and full and/or partial splenectomy. In some instances, pharmaceutical compositions are formulated in a conventional manner using one or more physiologically acceptable carriers including excipients and auxiliaries which facilitate processing of the active compounds into preparations which can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen. A summary of pharmaceutical compositions described herein is found, for example, in Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and

Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y., 1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed.

(Lippincott Williams & Wilkins 1999). Pharmaceutical compositions are optionally manufactured in a conventional manner, such as, by way of example only, by means of conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping or compression processes.

In certain embodiments, compositions can also include one or more pH adjusting agents or buffering agents, including acids such as acetic, boric, citric, lactic, phosphoric and hydrochloric acids; bases such as sodium hydroxide, sodium phosphate, sodium borate, sodium citrate, sodium acetate, sodium lactate and tris-hydroxymethylaminomethane; and buffers such as citrate/dextrose, sodium bicarbonate and ammonium chloride. Such acids, bases and buffers are included in an amount required to maintain pH of the composition in an acceptable range.

In other embodiments, compositions can also include one or more salts in an amount required to bring osmolality of the composition into an acceptable range. Such salts include those having sodium, potassium or ammonium cations and chloride, citrate, ascorbate, borate, phosphate, bicarbonate, sulfate, thiosulfate or bisulfite anions; suitable salts include sodium chloride, potassium chloride, sodium thiosulfate, sodium bisulfite and ammonium sulfate.

The pharmaceutical compositions described herein are administered by any suitable administration route, including but not limited to, oral, parenteral (e.g., intravenous, subcutaneous, intramuscular, intracerebral, intracerebroventricular, intra-articular, intraperitoneal, or intracranial), intranasal, buccal, sublingual, or rectal administration routes. In some instances, the pharmaceutical composition is formulated for parenteral (e.g., intravenous, subcutaneous, intramuscular, intracerebral, intracerebroventricular, intra-articular, intraperitoneal, or intracranial) administration.

The pharmaceutical compositions described herein are formulated into any suitable dosage form, including but not limited to, aqueous oral dispersions, liquids, gels, syrups, elixirs, slurries, suspensions and the like, for oral ingestion by an individual to be treated, solid oral dosage forms, aerosols, controlled release formulations, fast melt formulations, effervescent formulations, lyophilized formulations, tablets, powders, pills, dragees, capsules, delayed release formulations, extended release formulations, pulsatile release formulations, multiparticulate formulations, and mixed immediate release and controlled release formulations. In some embodiments, the pharmaceutical compositions are formulated into capsules. In some embodiments, the pharmaceutical compositions are -HO- fbrmulated into solutions (for example, for IV administration). In some cases, the pharmaceutical composition is formulated as an infusion. In some cases, the

pharmaceutical composition is formulated as an injection.

The pharmaceutical solid dosage forms described herein optionally include a compound described herein and one or more pharmaceutically acceptable additives such as a compatible carrier, binder, filling agent, suspending agent, flavoring agent, sweetening agent, disintegrating agent, dispersing agent, surfactant, lubricant, colorant, diluent, solubilizer, moistening agent, plasticizer, stabilizer, penetration enhancer, wetting agent, anti- foaming agent, antioxidant, preservative, or one or more combination thereof.

In still other aspects, using standard coating procedures, such as those described in Remington's Pharmaceutical Sciences, 20th Edition (2000), a film coating is provided around the compositions. In some embodiments, the compositions are formulated into particles (for example for administration by capsule) and some or all of the particles are coated. In some embodiments, the compositions are formulated into particles (for example for administration by capsule) and some or all of the particles are

microencapsulated. In some embodiments, the compositions are formulated into particles (for example for administration by capsule) and some or all of the particles are not microencapsulated and are uncoated.

In certain embodiments, compositions provided herein can also include one or more preservatives to inhibit microbial activity. Suitable preservatives include mercury- containing substances such as merfen and thiomersal; stabilized chlorine dioxide; and quaternary ammonium compounds such as benzalkonium chloride,

cetyltrimethylammonium bromide and cetylpyridinium chloride.

“Proliferative disease” as referred to herein means a unifying concept that excessive proliferation of cells and turnover of cellular matrix contribute significantly to the pathogenesis of several diseases, including cancer is presented.

“Subject” or“Patient” as used herein refers to a mammalian subject diagnosed with or suspected of having or developing a physiological condition, for instance a cancer or an autoimmune condition or an infection. In some embodiments, the term“patient” or “subject” refers to a mammalian subject with a higher than average likelihood of developing cancer. Exemplary patients can be humans, apes, dogs, pigs, cattle, cats, horses, goats, sheep, rodents and other mammalians that can benefit from the therapies disclosed herein. Exemplary human subjects can be male and/or female. “ Administering” is referred to herein as providing the compositions of the present disclosure to a patient. By way of example and not limitation, composition

administration, e.g., injection, can be performed by intravenous (i.v.) injection, sub cutaneous (s.c.) injection, intradermal (i.d.) injection, intraperitoneal (i.p.) injection, or intramuscular (i.m.) injection. One or more such routes can be employed. Parenteral administration can be, for example, by bolus injection or by gradual perfusion over time. Alternatively, or concurrently, administration can be by the oral route. Additionally, administration can also be by surgical deposition of a bolus or pellet of cells, or positioning of a medical device.

“A subject in need thereof’ or“a patient in need thereof’ is referred to herein as a subject or patient diagnosed with or suspected of having a disease or disorder, for instance, but not restricted to a proliferative disorder such as cancer. In one embodiment, the subject or patient has or is likely to develop solid tumors or leukemia. In some embodiments leukemia can be, for instance, acute lymphoblastic leukemia (ALL), acute myeloid leukemia (AML), chronic lymphocytic leukemia (CLL) and chronic myeloid leukemia (CML).

The compositions of the present disclosure can comprise engineered cells expressing nucleic acid sequences encoding polypeptide constructs that bind J-configuration of CD277, or a vector comprising the nucleic acid sequence, in an amount that is effective to treat or prevent proliferative disorders. As used herein, the terms“treatment,”“treating,” and the like refer to obtaining a desired pharmacologic and/or physiologic effect. In embodiments, the effect is therapeutic, i.e., the effect partially or completely cures a disease and/or adverse symptom attributable to the disease. To this end, the inventive method comprises administering a“therapeutically effective amount” of the composition comprising the host cells expressing the inventive nucleic acid sequence, or a vector comprising the inventive nucleic acid sequences.

A“therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result. The therapeutically effective amount can vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the inventive nucleic acid sequences to elicit a desired response in the individual.

Alternatively, the pharmacologic and/or physiologic effect can be“prophylactic,” i.e., the effect completely or partially prevents a disease or symptom thereof. A“prophylactically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired prophylactic result (e.g., prevention of disease onset).

“Antifoaming agents” reduce foaming during processing which can result in coagulation of aqueous dispersions, bubbles in the finished film, or generally impair processing. Exemplary anti-foaming agents include silicon emulsions or sorbitan sesquoleate.

“Antioxidants” include, for example, butylated hydroxytoluene (BHT), sodium ascorbate, ascorbic acid, sodium metabisulfite and tocopherol. In certain embodiments, antioxidants enhance chemical stability where required.

Formulations described herein may benefit from antioxidants, metal chelating agents, thiol containing compounds and other general stabilizing agents. Examples of such stabilizing agents, include, but are not limited to: (a) about 0.5% to about 2% w/v glycerol, (b) about 0.1% to about 1% w/v methionine, (c) about 0.1% to about 2% w/v monothioglycerol, (d) about 1 mM to about 10 mM EDTA, (e) about 0.01% to about 2% w/v ascorbic acid, (f) 0.003% to about 0.02% w/v polysorbate 80, (g) 0.001% to about 0.05% w/v. polysorbate 20, (h) arginine, (i) heparin, (j) dextran sulfate, (k) cyclodextrins, (1) pentosan polysulfate and other heparinoids, (m) divalent cations such as magnesium and zinc; or (n) combinations thereof.

“Binders” impart cohesive qualities and include, e.g., alginic acid and salts thereof;

cellulose derivatives such as carboxymethylcellulose, methylcellulose (e.g.,

METHOCEL®), hydroxypropylmethylcellulose, hydroxyethylcellulose,

hydroxypropylcellulose (e.g., KLUCEL®), ethylcellulose (e.g., ETHOCEL®), and microcrystalline cellulose (e.g., AVICEL®); microcrystalline dextrose; amylose;

magnesium aluminum silicate; polysaccharide acids; bentonites; gelatin;

polyvinylpyrrolidone/vinyl acetate copolymer; crospovidone; povidone; starch;

pregelatinized starch; tragacanth, dextrin, a sugar, such as sucrose (e.g., DIP AC®), glucose, dextrose, molasses, mannitol, sorbitol, xylitol (e.g., XYLITAB®), and lactose; a natural or synthetic gum such as acacia, tragacanth, ghatti gum, mucilage of isapol husks, polyvinylpyrrolidone (e.g., POLYVIDONE® CL, KOLLIDON® CL,

POLYPLASDONE® XL- 10), larch arabogalactan, VEEGUM®, polyethylene glycol, waxes, sodium alginate, and the like.

A“carrier” or“carrier materials” include any commonly used excipients in pharmaceutics and should be selected on the basis of compatibility with compounds disclosed herein, such as, compounds of ibrutinib and An anticancer agent, and the release profile properties of the desired dosage form. Exemplary carrier materials include, e.g., binders, suspending agents, disintegration agents, filling agents, surfactants, solubilizers, stabilizers, lubricants, wetting agents, diluents, and the like.“Pharmaceutically

compatible carrier materials” can include, but are not limited to, acacia, gelatin, colloidal silicon dioxide, calcium glycerophosphate, calcium lactate, maltodextrin, glycerine, magnesium silicate, polyvinylpyrrollidone (PVP), cholesterol, cholesterol esters, sodium caseinate, soy lecithin, taurocholic acid, phosphotidylcholine, sodium chloride, tricalcium phosphate, dipotassium phosphate, cellulose and cellulose conjugates, sugars sodium stearoyl lactylate, carrageenan, monoglyceride, diglyceride, pregelatinized starch, and the like. See, e.g., Remington: The Science and Practice of Pharmacy, Nineteenth Ed (Easton, Pa.: Mack Publishing Company, 1995); Hoover, John E., Remington’s Pharmaceutical Sciences, Mack Publishing Co., Easton, Pennsylvania 1975; Liberman, H.A. and

Lachman, L., Eds., Pharmaceutical Dosage Forms, Marcel Decker, New York, N.Y.,

1980; and Pharmaceutical Dosage Forms and Drug Delivery Systems, Seventh Ed.

(Lippincott Williams & Wilkins 1999).

“Dispersing agents,” and/or“viscosity modulating agents” include materials that control the diffusion and homogeneity of a drug through liquid media or a granulation method or blend method. In some embodiments, these agents also facilitate the effectiveness of a coating or eroding matrix. Exemplary diffusion facilitators/dispersing agents include, e.g., hydrophilic polymers, electrolytes, TWEEN ® 60 or 80, PEG, polyvinylpyrrolidone (PVP; commercially known as PLASDONE®), and the carbohydrate-based dispersing agents such as, for example, hydroxypropyl celluloses (e.g., HPC, HPC-SL, and HPC-L), hydroxypropyl methylcelluloses (e.g., HPMC K100, HPMC K4M, HPMC K15M, and HPMC K100M), carboxymethylcellulose sodium, methylcellulose,

hydroxyethylcellulose, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, hydroxypropylmethylcellulose acetate stearate (HPMCAS), noncrystalline cellulose, magnesium aluminum silicate, triethanolamine, polyvinyl alcohol (PVA), vinyl pyrrolidone/vinyl acetate copolymer (S630), 4-(l,l,3,3-tetramethylbutyl)-phenol polymer with ethylene oxide and formaldehyde (also known as tyloxapol), poloxamers (e.g., Pluronics F68®, F88®, and F108®, which are block copolymers of ethylene oxide and propylene oxide); and poloxamines (e.g., TETRONIC 908®, also known as

POLOXAMINE 908®, which is a tetrafunctional block copolymer derived from sequential addition of propylene oxide and ethylene oxide to ethylenediamine (BASF Corporation, Parsippany, N.J.)), polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, polyvinylpyrrolidone/vinyl acetate copolymer (S-630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, polysorbate-80, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone, carbomers, polyvinyl alcohol (PVA), alginates, chitosans and combinations thereof. Plasticizers such as cellulose or triethyl cellulose can also be used as dispersing agents. Dispersing agents particularly useful in liposomal dispersions and self-emulsifying dispersions are dimyristoyl phosphatidyl choline, natural phosphatidyl choline from eggs, natural phosphatidyl glycerol from eggs, cholesterol and isopropyl myristate.

Combinations of one or more erosion facilitator with one or more diffusion facilitator can also be used in the present compositions.

The term“diluent” refers to chemical compounds that are used to dilute the compound of interest prior to delivery. Diluents can also be used to stabilize compounds because they can provide a more stable environment. Salts dissolved in buffered solutions (which also can provide pH control or maintenance) are utilized as diluents in the art, including, but not limited to a phosphate buffered saline solution. In certain embodiments, diluents increase bulk of the composition to facilitate compression or create sufficient bulk for homogenous blend for capsule filling. Such compounds include e.g., lactose, starch, mannitol, sorbitol, dextrose, microcrystalline cellulose such as AVICEL®; dibasic calcium phosphate, dicalcium phosphate dihydrate; tricalcium phosphate, calcium phosphate; anhydrous lactose, spray-dried lactose; pregelatinized starch, compressible sugar, such as DI-PAC® (Amstar); mannitol, hydroxypropylmethylcellulose,

hydroxypropylmethylcellulose acetate stearate, sucrose-based diluents, confectioner’s sugar; monobasic calcium sulfate monohydrate, calcium sulfate dihydrate; calcium lactate trihydrate, dextrates; hydrolyzed cereal solids, amylose; powdered cellulose, calcium carbonate; glycine, kaolin; mannitol, sodium chloride; inositol, bentonite, and the like. “Filling agents” include compounds such as lactose, calcium carbonate, calcium phosphate, dibasic calcium phosphate, calcium sulfate, microcrystalline cellulose, cellulose powder, dextrose, dextrates, dextran, starches, pregelatinized starch, sucrose, xylitol, lactitol, mannitol, sorbitol, sodium chloride, polyethylene glycol, and the like. “Lubricants” and“glidants” are compounds that prevent, reduce or inhibit adhesion or friction of materials. Exemplary lubricants include, e.g., stearic acid, calcium hydroxide, talc, sodium stearyl fumerate, a hydrocarbon such as mineral oil, or hydrogenated vegetable oil such as hydrogenated soybean oil (STEROTEX®), higher fatty acids and their alkali-metal and alkaline earth metal salts, such as aluminum, calcium, magnesium, zinc, stearic acid, sodium stearates, glycerol, talc, waxes, STEAROWET®, boric acid, sodium benzoate, sodium acetate, sodium chloride, leucine, a polyethylene glycol (e.g., PEG-4000) or a methoxypoly ethylene glycol such as CARBOWAX™, sodium oleate, sodium benzoate, glyceryl behenate, polyethylene glycol, magnesium or sodium lauryl sulfate, colloidal silica such as SYLOID™, CAB-O-SIL®, a starch such as com starch, silicone oil, a surfactant, and the like.

“Plasticizers” are compounds used to soften the microencapsulation material or film coatings to make them less brittle. Suitable plasticizers include, e.g., polyethylene glycols such as PEG 300, PEG 400, PEG 600, PEG 1450, PEG 3350, and PEG 800, stearic acid, propylene glycol, oleic acid, triethyl cellulose and triacetin. In some embodiments, plasticizers can also function as dispersing agents or wetting agents.

“Solubilizers” include compounds such as triacetin, triethylcitrate, ethyl oleate, ethyl caprylate, sodium lauryl sulfate, sodium doccusate, vitamin E TPGS, dimethylacetamide, N-methylpyrrolidone, N-hydroxyethylpyrrolidone, polyvinylpyrrolidone,

hydroxypropylmethyl cellulose, hydroxypropyl cyclodextrins, ethanol, n-butanol, isopropyl alcohol, cholesterol, bile salts, polyethylene glycol 200-600, glycofurol, transcutol, propylene glycol, and dimethyl isosorbide and the like.

“Stabilizers” include compounds such as any antioxidation agents, buffers, acids, preservatives and the like.

“Suspending agents” include compounds such as polyvinylpyrrolidone, e.g.,

polyvinylpyrrolidone K12, polyvinylpyrrolidone K17, polyvinylpyrrolidone K25, or polyvinylpyrrolidone K30, vinyl pyrrolidone/vinyl acetate copolymer (S630), polyethylene glycol, e.g., the polyethylene glycol can have a molecular weight of about 300 to about 6000, or about 3350 to about 4000, or about 7000 to about 5400, sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethylcellulose, hydroxymethylcellulose acetate stearate, polysorbate-80, hydroxyethylcellulose, sodium alginate, gums, such as, e.g., gum tragacanth and gum acacia, guar gum, xanthans, including xanthan gum, sugars, cellulosics, such as, e.g., sodium carboxymethylcellulose, methylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, hydroxyethylcellulose, polysorbate-80, sodium alginate, polyethoxylated sorbitan monolaurate, polyethoxylated sorbitan monolaurate, povidone and the like.

“Surfactants” include compounds such as sodium lauryl sulfate, sodium docusate, Tween 60 or 80, triacetin, vitamin E TPGS, sorbitan monooleate, polyoxyethylene sorbitan monooleate, polysorbates, polaxomers, bile salts, glyceryl monostearate, copolymers of ethylene oxide and propylene oxide, e.g., PLURONIC® (BASF), and the like. Some other surfactants include polyoxyethylene fatty acid glycerides and vegetable oils, e.g., polyoxyethylene (60) hydrogenated castor oil; and polyoxyethylene alkylethers and alkylphenyl ethers, e.g., octoxynol 10, octoxynol 40. In some embodiments, surfactants can be included to enhance physical stability or for other purposes.

“Viscosity enhancing agents” include, e.g., methyl cellulose, xanthan gum,

carboxymethyl cellulose, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, hydroxypropylmethyl cellulose acetate stearate, hydroxypropylmethyl cellulose phthalate, carbomer, polyvinyl alcohol, alginates, acacia, chitosans and combinations thereof.

“Wetting agents” include compounds such as oleic acid, glyceryl monostearate, sorbitan monooleate, sorbitan monolaurate, triethanolamine oleate, polyoxyethylene sorbitan monooleate, polyoxyethylene sorbitan monolaurate, sodium docusate, sodium oleate, sodium lauryl sulfate, sodium doccusate, triacetin, Tween 80, vitamin E TPGS, ammonium salts and the like.

Kits/ Article of Manufacture

Disclosed herein, in certain embodiments, are kits and articles of manufacture for use with one or more methods described herein. Such kits include a carrier, package, or container that is compartmentalized to receive one or more containers such as vials, tubes, and the like, each of the container(s) comprising one of the separate elements to be used in a method described herein. Suitable containers include, for example, bottles, vials, syringes, and test tubes. In one embodiment, the containers are formed from a variety of materials such as glass or plastic.

The articles of manufacture provided herein contain packaging materials. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, bags, containers, bottles, and any packaging material suitable for a selected formulation and intended mode of administration and treatment.

For example, the container(s) include engineered cells expressing polypeptide construct that selectively binds J-configuration of CD277, and optionally in addition with cytokines and/or chemotherapeutic agents and/or additional agents disclosed herein, for instance an intermediate of the mammalian mevalonate pathway, such as isopentenyl pyrophosphate (IPP), and the microbial 2- C-methyl-D-erythiitol 4-phosphate (MEP) pathway. Such kits optionally include an identifying description or label or instructions relating to its use in the methods described herein.

A kit typically includes labels listing contents and/or instructions for use, and package inserts with instructions for use. A set of instructions will also typically be included.

In some embodiments, a label is on or associated with the container. In one embodiment, a label is on a container when letters, numbers or other characters forming the label are attached, molded or etched into the container itself; a label is associated with a container when it is present within a receptacle or carrier that also holds the container, e.g., as a package insert. In one embodiment, a label is used to indicate that the contents are to be used for a specific therapeutic application. The label also indicates directions for use of the contents, such as in the methods described herein.

Recognition Phenotypes

In certain embodiments provided herein a polypeptide construct, a nucleotide encoding the same, and/or an engineered cell harboring the same can recognize a target cell (e.g. tumor cell). In some embodiments, an engineered T cell can express a Vy9V02 TCR specific for a particular antigen (e.g. CD277) expressed on the surface of a target cell. Described herein are methods for identifying one or more T cells capable of recognizing a particular antigen on a target cell. A T cell or population of T cells capable of recognizing a particular antigen can be identified by assaying for a recognition phenotype that occurs as a result of a physical interaction between a TCR (e.g. Vy9V02 TCR) of the T cell and a protein, antigen, ligand or cell surface molecule (e.g. CD277) expressed on the surface of the target cell. In some embodiments, the recognition phenotype can be a change in cellular state that occurs in the T cell as a result of the recognition of the target cell by the Ug9Ud2 TCR. In some embodiments, the recognition phenotype can be the binding to a tumour cell of a subject and/or the exhibition an anti-tumour activity or response in said cells of said subject as defined herein. Preferably an anti-tumour response comprises the ability to lyse a tumour cell and/or induce the production of IFNy, IL-2 and/or TNFa. More, preferably, an anti-tumour response comprises the ability to lyse a tumour cell and/or induce the secretion of IFNy, IL-2 and/or TNFa. For example, a change in cellular state can include a change in the levels of interferon (IFN)-y production resulting from Vy9Vd2 TCR-mediated activation of the T cell, which is detectable by methods known in the art (e.g. IFN-g ELISPOT analysis). In other examples, a change in cellular state indicative of a recognition phenotype can involve molecular changes including qualitative or quantitative changes in gene expression (e.g. identified via qRT-PCR or microarray analysis) and/or protein expression (e.g. identified via Western blot or immunocytochemistry assays) resulting from Vy9V52 TCR-mediated recognition of a target cell. In other embodiments, a recognition phenotype can include physical manifestations of an interaction between a TCR of the T cell and a cell surface protein, ligand or antigen of the target cell. For example, a recognition phenotype can involve the physical binding of a Vy9V52 TCR of a T cell with a cell surface protein, ligand or antigen of a target cell. In certain embodiments, the recognition phenotype involves the formation of a physical complex comprising a Vy9V52 TCR and a J-configuration of a CD277 molecule on the surface of a target cell. Where the recognition phenotype involves formation of a complex comprising a receptor and a ligand, the phenotype can be identified by known methods, including immunoprecipitation, cell sorting, or

immunocytochemistry.

In embodiments described herein, the recognition phenotypes can vary between different subjects and/or between cells obtained from different subjects. For example, in some embodiments, target cells obtained from different subjects can vary in the extent to which a Vy9Vb2 TCR expressed in an engineered cell recognizes the target cell (e.g. via a CD277 expressed on the surface of the target cell). Surface molecules of target cells obtained from some subjects can be recognized with high affinity by a Vy9V52 TCR expressed in an engineered cell. For target cells obtained from other subjects, surface molecules of the target cells can be recognized with low affinity or not recognized at all. The variation in recognition by a Vy9V52 TCR between target cells of different subjects can be manifested in variations in recognition phenotypes expressed by those cells. For example, following exposure to T cells expressing a Vy9V52 TCR, target cells of different subjects can vary in the amount of production of IFN-g, gene or protein expression levels or patterns, and/or the extent of physical interaction between the a Vy9V52 TCR of the T cell and a cell surface protein (e.g. CD277) of the target cell.

The polypeptide constructs, polynucleotides encoding the same and engineered cells harboring the same described herein can have varying therapeutic effects when used to treat subjects in need thereof. Disclosed herein are methods comprising the stratification of a patient population (e.g. cancer patient population) into multiple therapy groups based on the strength of a particular phenotype exhibited by the patients or by cells of the patients. In some embodiments, the phenotype used to stratify patients into therapy groups is a recognition phenotype. For example, a patient population can be stratified into groups based on the presence, absence or extent of a recognition phenotype in target cells obtained from the patients following exposure to T cells expressing a Vy9V02 TCR, including the level of production of IFN-g or the quantitative or qualitative pattern of gene expression. In some embodiments, the phenotype used to stratify patients into therapy groups is not a recognition phenotype that is based on the extent of recognition between a T cell expressing a Vy9V52 TCR and a target cell. Instead, the phenotype used as a basis for stratification can be a marker (i.e. biomarker) present in the target cells prior to exposure to a T cell. For example, the presence or absence of a J-configuration in the cell surface-expressed CD277 molecule can be a phenotype that varies between target cells (e.g. tumor cells) of patients and that can accordingly be used as a basis to separate or stratify patients into different groups having different probabilities of treatment success when administered the polypeptide constructs described herein.

In some embodiments, patients are stratified into at least two therapy groups including a stratification group with a positive treatment prognosis and a stratification group with a poor treatment prognosis. In some embodiments, patients classified into a positive treatment prognosis stratification group have target cells exhibiting recognition phenotypes such as IFN-g production and physical interactions between a Vy9V52 TCR and a CD277 molecule of a target cell (e.g. in the form of a complex including both the TCR and the CD277 molecule). In some embodiments, patients classified into a positive treatment prognosis stratification group have target cells exhibiting CD277 cell surface molecules having a J-configuration prior to contact with Vy9V52 T cells. In some embodiments, patients classified into a poor treatment prognosis stratification group have target cells lacking or having reduced expression of one or more recognition phenotypes (e.g. IFN-g production) or that fail to exhibit CD277 cell surface molecules having a J- configuration.

Polymorphic Variation and Genetic Association

The terms“nucleotide polymorphism”,“genetic polymorphism” and nucleotide sequence polymorphism” are used interchangeably herein and refer to variation in nucleotide sequence at a specific position of the genome (i.e. a“locus”) in a single individual or between individuals. In some cases, a genetic polymorphism exists at a locus within a cell or cells of an individual (i.e. the individual is heterozygous at a genetic locus for a particular nucleotide sequence). In other cases, the nucleotide sequence at a particular locus of an individual is invariant (i.e. the individual is homozygous for the nucleotide sequence at the particular locus), but the nucleotide sequence at the locus is polymorphic when compared to the DNA of a second individual. In certain embodiments, the nucleotide polymorphism includes variation at a single nucleotide at a locus. In such cases the nucleotide polymorphism is referred to as a single nucleotide polymorphism, or SNP. In other embodiments, the nucleotide polymorphism could include other types of DNA variation instead of or in addition to a SNP. Herein the term“polymorphism” contemplates any form of DNA variation, including single nucleotide polymorphisms and structural variations such as insertions, deletions, inversions and duplications.

In certain embodiments, a nucleotide polymorphism (e.g. SNP) can be a functional variation that causes a phenotypic difference between cells, tissues or organisms harboring different forms of the polymorphism. For example, a SNP can be located in the open reading frame of a gene and thereby directly impact the sequence of amino acids incorporated into a protein encoded by the gene. In other non-limiting examples, a polymorphism can produce phenotypic differences between individuals by altering splicing of mRNA transcribed from a gene (e.g. where a SNP is positioned at a splice site), altering the level of expression of a gene (e.g. where a SNP is positioned in the promoter of a gene), or impacting post-translational modifications of a protein (e.g. where a SNP affects the expression or function of a factor responsible for post-translationally modifying another protein. In certain other embodiments, a nucleotide polymorphism can be a non- function or neutral variation that does not directly lead to phenotypic differences between individuals harboring the different forms of the polymorphism.

In certain embodiments, a genetic polymorphism (either functional or non- functional) can be identified in association studies as being associated with a particular trait (e.g. cellular, tissue or organismal phenotype). Herein a“genetic association” exists where one or more genotypes within a population of individuals or a population of cells derived from different individuals co-occurs with a phenotypic trait more often than would be expected by chance. In some embodiments, the phenotypic trait can include a recognition phenotype manifesting as a result of the recognition of a target cell (e.g. tumor cell) by a T cell expressing a Vy9V62 TCR. In some embodiments, the phenotypic trait can include the conformation of one or more cell surface molecules of a target cell. In some embodiments, the phenotypic trait can include the presence or absence of a J- configuration in a cell-surface CD277 molecule of a target cell. In some embodiments, the phenotypic trait can include the zygosity of a particular individual at a particular genetic locus. In some embodiments, the phenotypic trait can include an activity of RhoB in a target cell (e.g. tumor cell). Herein the term“activity” when used with reference to a protein (e.g. RhoB) refers to the cellular function of the protein. The activity of a protein is influenced by many cellular events and factors, including the nucleotide sequence of the gene encoding the protein (e.g. where the gene is mutated), the level and timing of transcription of the gene, the pattern of splicing of the transcribed mRNA, post- translational modifications of the protein, the pattern of translocation of the protein or mRNA encoding the protein in the cell and the proper interaction of the protein with cellular factors influencing its function by for example changing its conformation and/or activity or positioning the protein at a proper location (e.g. cell surface) of the cell to perform its function. Accordingly, changing the activity of a protein (e.g. increasing or decreasing protein activity) contemplates any cellular mechanism that could result in alterations to a protein’s function carried out in the cell. For example, with respect to RhoB, in some embodiments activity can be changed by affecting translocation of the RhoB GTPase to a cell membrane of the cancer cell. In some embodiments, activity can be changed by affecting whether the RhoB GTPase is maintained at a cell membrane of the cancer cell. In some embodiments, activity can be changed by effecting an increase or decrease of translocation of the RhoB GTPase away from a nucleus of the cancer cell. In some embodiments, activity can be changed by increasing or decreasing expression of a gene or transcript encoding the RhoB GTPase. In some embodiments, activity can be changed by altering the modification of a transcript (e.g. alternative splicing). In some embodiments, activity can be changed by increasing or decreasing stability of the RhoB GTPase in the cell. In some embodiments, activity can be changed by increasing or decreasing an interaction between the RhoB GTPase and a second protein (e.g. BNT3 protein). In some embodiments, activity can be changed by activating or deactivating RhoB GTPase. In some embodiments, activity can be changed by increasing or decreasing an interaction between the RhoB GTPase and a non-protein small molecule (e.g. GTP).

In some embodiments, the presence or absence of one or more nucleotide sequence polymorphisms is used to stratify patients into therapy groups, which may differ in their therapeutic response to a treatment with a polypeptide construct disclosed herein. For example, the presence of a particular form of a SNP may be found to be associated with a phenotypic trait (e.g. the presence/absence of a J configuration or a relatively high or low activity of RhoB) that is known to predict therapeutic success. Based on the identified genetic association, patients who are candidates for receiving a particular therapy disclosed herein may be screened (i.e. genotyped) for the presence or absence of the polymorphism correlating with the phenotypic trait. The screened patients can then be categorized into multiple patient populations or groups based on the presence or absence of the polymorphism. Each patient population can represent a stratification group which can be representative of the probability that a particular patient in the stratification group will respond to a particular therapeutic intervention with a positive response or poor response (i.e. patients in different stratification groups are assigned different likelihoods of responding positively to a therapeutic treatment). Herein the term“positive” when used with reference to a therapeutic response or stratification group refers to a result of treatment which accomplishes or partially accomplishes the purpose for which the treatment was applied. For example, in some embodiments, a positive patient response to treatment involves the clearing of at least some cancer cells by exposure to the compositions described herein. Herein a“positive” response is used relatively to a“poor” response, which in some embodiments is a response to treatment of a stratification group which is lesser than a response of a second stratification group exhibiting a positive response. In some embodiments, patients can be stratified into at least two patient groups where a first patient group is predicted to exhibit a positive response to treatment (i.e. positive treatment prognosis stratification group), whereas a second patient group is predicted to exhibit a relatively poor therapeutic response (i.e. poor treatment prognosis stratification group). It will be understood from the above description that certain phenotypic traits (e.g. J- configuration of CD277, RhoB activity) and/or nucleotide sequence polymorphisms of target cells of a patient can be representative of one or more biomarkers which are predictive or prognostic of a therapeutic response of the patient to a treatment involving administration of the compositions disclosed herein. In some embodiments, patients can be stratified into different stratification groups based on the presence or absence of the biomarker in target cells of the patients. In some embodiments, the biomarker is a nucleotide sequence polymorphism (e.g. SNP) or epigenetic modification and patients having the nucleotide sequence polymorphism or epigenetic modification are stratified into a positive stratification group whereas patients lacking the nucleotide sequence polymorphism or epigenetic modification are stratified into a poor stratification group. In some embodiments, the biomarker is a nucleotide sequence polymorphism (e.g. SNP) or epigenetic modification and patients lacking the nucleotide sequence polymorphism or epigenetic modification are stratified into a positive stratification group whereas patients having the nucleotide sequence polymorphism or epigenetic modification are stratified into a poor stratification group. In some embodiments, as described above, the bio marker is a recognition phenotype (e.g. production of IFN-g) or a target cell phenotype (e.g. presence of a J configuration in a cell surface CD277 molecule) which is associated with a poor or positive therapeutic response. In some embodiments, one biomarker is used to stratify patients into different stratification groups. In other embodiments, multiple bio markers are used to stratify patients. For example, patients can be stratified into a positive stratification group where target cells of the patient exhibit both a particular nucleotide sequence polymorphism or epigenetic modification and a particular recognition phenotype or target cell phenotype.

The present disclosure contemplates the use of data collections which archive genomic information including nucleotide sequences, the presence and identity of polymorphisms, and zygosity at particular loci. An example of a data collection is the library of cell lines from the Centre d’Etude du Polymorphisms Huain (CEPH), which contains a large collection of Epstein Barr Virus (EBV)-transformed B cell lines (EBV-LCLs) obtained from several family pedigrees and genotyped for millions of SNPs. Another example of a data collection is the haplotype map generated by the International HapMap project. In some embodiments, the data collections can archive hypothetical or predicted genomic parameters. For example, hypothetical zygosities for candidate genetic loci can be deduced using classical Mendelian inheritance patterns from within family pedigrees. Further disclosed herein are methods for identifying genetic and epigenetic variations in the target cells of a subject which are predictive or prognostic of a particular therapeutic response. For example, target cells (e.g. tumor cells) of a patient can be screened by contacting the cells with a composition comprising an engineered cell (e.g. T cell) expressing a T cell receptor and then detecting a recognition phenotype such as a level of immune activation of the cell (e.g. level or activity of IFN-g) as a result of exposure to the composition. In some embodiment, a ydTCR as defined in the section entitled

“Engineered TCR” or“Preferred ydTCR disclosed at the amino acid and nucleic acid level” section“Polypeptide construct” is able to bind a tumour cell and/or able to exhibit an anti-tumour response or activity. Exibiting an anti-tumour response may be the induction or production of IFNy, TNFa and/or IL-2.

Depending on the response of the target cells to exposure to the composition, the subject can be categorized into a particular (e.g. positive) stratification group. For example, where exposure of the target cells to the composition invokes immune activation in the T cells, the patient can be classified into a positive stratification group. In some

embodiments, the presence or absence of immune activation in a target cell can be associated with a genetic and/or epigenetic variation in the target cell. In some embodiments, genotypic or epigenetic information about the target cell is obtained (e.g. from a data collection) in order to associate a particular phenotypic trait (e.g. recognition phenotype) of the target cells with a genetic or epigenetic variant. The present disclosure contemplates any method for identifying genetic or epigenetic variation in target cells of a patient relative to cells of another patient in order to associate the genetic or epigenetic variation with a particular recognition phenotype and/or predicted therapeutic response. For example, a genome-wide association study (GWAS) can be carried out to determine if a particular genetic variant (e.g. SNP) is associated with a phenotypic trait (e.g.

recognition phenotype) of the target cells. In other cases, epigenetic data (e.g. methylation status) of DNA from target cells of different subjects can be compared to identify candidate epigenetic marks which may be associated with a recognition phenotype and/or therapeutic response. In still other examples, zygosity at particular loci can be

hypothesized using data from family pedigrees to identify candidate loci which may be associated with a particular phenotypic trait.

In certain embodiments, predicted zygosities at multiple loci correlate with SNP genotypes of CEPH individuals and can be calculated with a software tool such as ssSNPer. For example, proxy SNPs within 500 kb of SNPs produced y ssSNPer can be collected by querying the SNP Annotation and Proxy Search (SNAP) tool using r ² = 0.8 as a threshold for linkage disequilibrium. eQTL analysis of ssSNPer SNPs and their proxies can be performed using the Genevar (GENe Expression VARiation) tool.

Anti-tumour response

Each of the sequences (i.e. gT-cell receptor chain or part thereof, dT-cell receptor chain or part thereof, gdT-cell receptor or part thereof) identified herein is expected to exhibit an anti-tumour response under appropriate conditions. The assessment of the anti-tumour response of these molecules could be determined when expressed in a cell or per se as a soluble molecule. It is clear that the assessment of the anti-tumour response of a dT-cell (respectively gT-cell) receptor chain or part thereof may be carried out in a cell

(preferably a T cell) transduced with the corresponding dT-cell (respectively gT-cell) receptor chain or part thereof. The same holds for the assessment of the ant-tumour response of a ybTCR, the cell (preferably a T cell) being transduced with the ybTCR. In an embodiment, an anti-tumour response of such sequence is assessed in a T-cell that does not endogenously express a gamma or delta chain of the TCR. Such a cell may be an ab-T cell or a NK cell.

The nucleic acid sequences encoding the dT-cell receptor chain may be introduced into T- cells to provide an engineered T-cell as explained herein.

It is clear to a skilled person that the T cells used should also express a yT cell receptor chain in order to assess the biological relevance of a dT cell receptor chain (and vice versa). In a preferred embodiment, the nucleic acid molecule encoding the dT-cell (or yT- cell) receptor chain or part thereof is provided in an expression vector or in a retroviral or lentiviral vector in a T cell. This has been extensively explained herein.

T cells may be expanded before or after the transfer of the nucleic acids encoding the dT- and/or yT- cell receptor chain. Preferably, the expansion is after the transfer such that the amount of nucleic acids that needs to be transferred is as low as possible. This expansion of T cells may be performed by stimulation with anti-CD3/CD28 Dynabeads in the presence of IL-2. The expanded cells comprising the engineered gd T-cell receptor, may be selected e.g. via a selectable marker and may be further selected for the presence of the CD4 antigen and the CD8 antigen, e.g. using the MACS separating system as described in the examples. The engineered T-cells may be subsequently further expanded using the REP protocol as described by Riddel and Greenberg, 1990 J Immunol Methods. 128(2): 189-201, which is incorporated herein by reference, or using similar further expansion methods thereto. Briefly, the expansion method involves using antibodies directed against T cell activation molecules, such as TCR, CD3 and CD28 and/or feeder cells and/or stimulating cytokines.

The anti-tumour response of the provided T-cell expressing a dT-cell (or gT-cell) receptor chain or a gdT C R as identified herein may be assessed using any technique known to the skilled person.

In one embodiment, the step of determining an anti-tumour response or reactivity or activity comprises contacting the T cells with tumour cells. The step of determining anti tumour reactivity may include any assay in which an anti-tumour effect may be determined, such as having an effect on tumour cell division rate, i.e. the speed with which the tumour cells divide, cell death, binding to the tumour cells, induction of the production, preferably induce the secretion of a cytokine such as IFNy, IL-2 or TNFa . Tumour cells may be any kind of tumour cells. For example, primary tumour cells from a patient. The tumour cells may be tumour cells from cell lines, such as the cell lines listed in the examples named Daudi, RPMI8226/S, OPM2, LME1 , K562, Saos2, MZ1851 RC, SCC9, Fadu, MDA-MB231 , MCF7, BT549, SW480, Caki-2, SK-CO-l, HT-29 which are well known in the art. Tumour cell lines may easily be obtained from the American Type Culture Collection (ATCC, Manassas, Virginia) and the like. The anti-tumour response or reactivity or activity of a provided T-cell expressing a dT-cell (or gT-cell) receptor chain or a gdT C R as identified herein towards tumour cells can be compared with their response or reactivity or activity towards non-tumour cells, which can be derived from cell lines such as MCF-12F (human breast epithelial cells) as can be obtained from the ATCC and the like.

In a preferred embodiment, determining the anti-tumour responses includes contacting the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or gT-cell) receptor chain or a y TCR identified herein with a tumour cell and measuring its ability to lyse the tumour cell and/or induce the production, preferably secretion of a cytokine such as IFN-g, IL-2 or TNFa. This contacting, culturing or incubation step may have a duration from 10 hours to 1, 2, 3, 4, 5 days. The ability to lyse the tumour cells include providing a fixed amount of tumour cells with which T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or gT-cell) receptor chain or a gdT C R as identified herein is contacted and after an incubation period the number of viable tumour cells is counted. A particular suitable assay to quantify the ability of a T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or gT-cell) receptor chain or a gdT C R identified herein to lyse the tumour cells is the xCELLigence system (xCELLigence RTCA MP device/e-Plates, ACEA Biosciences) wich uses the principle of noninvasive electrical impedance monitoring to quantify cell proliferation, morphology change, and attachment quality in a label- free and real-time manner.

An anti-tumour response may have been identified or determined when the number of viable tumor cells at the end of the incubation step is less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10% of the number of initial tumour cells at the onset of the incubation step.

Alternatively, an anti-tumour response may have been identified or determined when the number of viable tumour cells at the end of the incubation step with the engineered T cells is lower than the number of tumour cells at the end of a similar incubation step with control T cells not engineered with sequences identified as shared. Lower in this context may mean at least 10% lower, at least 20% lower, at least 30% lower, at least 40% lower, at least 50% lower, at least 60% lower, at least 70% lower, at least 80% lower, at least 90% lower. Optionally, the number of viable tumour cells at the end of the incubation step with the engineered T cells may be compared with the number of viable tumour cells at the end of incubating an identical or similar amount of tumour cells with a detergent that completely disrupts the tumour cells. In this context,“completely” means that at least 80%, 85%, 90%, 95%, 99%, 100% of the cells have been disrupted. Disruption or lysis of cells may be assessed using techniques known to the skilled person. Such detergents are well-known to the skilled person for examle Triton X-100. Such a control sample hence represents the highest anti-tumour response, i.e. highest amount of tumour cells that can be killed. The use of such a control sample is for example particular useful in the xCELLigence assay. It is hence preferred that an anti-tumour response has been identified or determined when the number of viable tumour cells at the end of the incubation step with the engineered T cells is not more than the number of viable tumour cells in the control sample wherein tumour cells are treated with said detergent.“Not more” in this context may mean not more than 40%, 30%, 20%, 10% or 5% compared to the detergent control sample. Alternatively, the engineered T cells according to the invention are able to lyse tumour cells to an extent that is at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95% or at least 97% of the tumour cell lysis obtained when incubating the same or similar amount of tumrour cells with said detergent.

In an embodiment, the antitumor response of the sequences (i.e. gT-cell receptor chain or part thereof, dT-cell receptor chain or part thereof, gdT-cell receptor or part thereof) identified herein is comparable or stronger than the one elicited by corresponding control sequences known in the art as clone 3, clone 5 or Gl 15 as disclosed in WO 2013/147606, WO 2017/212074 and also disclosed herein and assessed under the same conditions. In this context,“comparable” means an antitumour response which at least 80% of the one elicited by the control sequence under the same conditions. Preferably the antitumour response is at least 85%, at least 90%, at least 95% or at least 97% or at least 98% or at least 99%, or at least 100% or at least 105% or at least 110% or at least 115% or at lesat 120%, or at least 125%, or at least 130% measured under the same conditions.

In addition or as alternative to the counting of the number of viable tumour cells at the end of the incubation step, one may also perform a ⁵ 'Chromium-release assay which is known to the skilled person. The amount of ⁵ 'Chromium release is a measure of the number of cells that have been lysed.

Similarly, the production of a cytokine such as IFN-g, IL-2 or TNFa or the secretion or the expression of activation markers may also be determined, e.g. via antibody staining, EFISA and/or quantitative PCR for the expressed mRNA. Assays for determining the production of a cytokine such as IFN-g, IF-2 or TNFa are commercially widely available. When the production of a cytokine such as IL-2, TNFa or IFNy is detected at the end of the contacting step, the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or gT-cell) receptor chain or gdT C R identified herein is said to exhibit an anti-tumour response. Alternatively and preferably, when the amount of IFNy, IL-2 or TNFa produced at the end of the contacting step with engineered T cells is higher (preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more) than the amount of IFNy, IL-2 or TNFa produced when tumour cells are contacted with control T cells, the T cells is said to exhibit an anti-tumour response. Control T cells do not express a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or yT-cell) receptor chain or gdT C R as identified herein.

An anti-tumour response may also be determined by assessing the binding of the engineered T cells to the tumour cell at the end of the incubation step. When binding of the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or yT-cell) receptor chain or ydTCR identified herein to the tumour cell is detected at the end of the contacting step, the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or yT-cell) receptor chain or gdT C R identified herein is said to exhibit an anti-tumour response. Alternatively and preferably, when the binding of the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or yT-cell) receptor chain or ydTCR identified herein is higher (preferably at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 100% or more) than the binding of control T cells (see earlier definition) to the same tumour cell, the T cells is said to exhibit an anti-tumour response.

The contacting step may be carried out in the presence of a phosphoantigen, such as pamidronate.

In a preferred method the step of confirming the anti- tumour response comprises contacting the T cell expressing a defined nucleic acid molecule encoding an amino acid comprising a dT-cell (or yT-cell) receptor chain or gdT C R identified herein with a tumour - O- cell and measuring its ability to lyse the tumour cell and/or induce the production of a cytokine such as IFN-g, IL-2 or TNFa.

In an embodiment, an anti-tumour response may be exhibited in any cancer. Preferred tumours in this context are solid tumour, liquid tumour. A solid tumour is preferably linked with or indicative of breast cancer. A liquid tumour is preferably linked with of indicative of a hematopoietic cancer. Preferred cancers have been identified in the section entitled“Indications”.

Method of treatment/ product for use/ use for the manufacture of a medicament

In therapeutic applications, an effective amount of a dT C R (and/or yTCR) chain or parts thereof or gdT C R or nucleic acid construct or viral vector or cell expressing these molecules as defined herein is administered to a subject.

The term "effective amount" as used herein is defined as the amount of the molecules of the present invention that are necessary to result in the desired physiological change in the cell or tissue to which it is administered. The term "therapeutically effective amount" as used herein is defined as the amount of the molecules of the present invention that achieves a desired effect with respect to cancer. In this context, a“desired effect” is synonymous with“an anti-tumour activity” as earlier defined herein. A skilled artisan readily recognizes that in many cases the molecules may not provide a cure but may provide a partial benefit, such as a regression, alleviation or improvement of at least one symptom or parameter. In some embodiments, a physiological change having some benefit is also considered therapeutically beneficial. Thus, in some embodiments, an amount of molecules that provides a physiological change is considered an "effective amount" or a "therapeutically effective amount."

SAPPHIRE

Disclosed herein is a method of identifying genetic loci associated with receptor mediated target cell recognition using a technique referred to as SNP-associated computational pathway hunt including shRNA evaluation (SAPPHIRE). For example, differences in the genetic backgrounds of tumor cells can affect recognition of these cells by Vy9Vb2 TCR engineered T cells, for instance cells described herein. In some embodiments, a library of cell lines can be used, which contains a large collection of EBV-trans formed B cell lines (EBV-LCLs) obtained from several family pedigrees and genotyped for millions of SNPs (Dausset et al., Centre d’ etude dupolymorphisme humain (CEPH): collaborative genetic mapping of the human genome. Genomics. 1990;6:575-7; INTERNATIONAL

HAPMAP, C. The International HapMap Project. Nature. 2003;426:789-96). The recognition phenotypes of EBV-LCLs by Vy9V62 TCR T cells can be assessed by means oflFNy production. Using either CD4 ⁺ or CD8 ⁺ Vy9V62 T cells one can either reduce or increase the effect of NK like receptors on the phenotypic analysis. CD4 ⁺ T cells express low amount of NK like receptors resulting in ease of analysis. Hypothetical zygosities for candidate genetic loci can be deduced using classical Mendelian inheritance patterns within CEPH family trios, where the influence of candidate alleles on receptor mediated recognition, for instance Vy9V62 TCR-mediated recognition can be assumed to be dominant. In one embodiment, the recognition phenotypes of EBV-LCLs by Vy9V62 TCR T cells assessed by means of IFNy production can show an activating phenotype for a subset of EBV-LCLs and a non-activating phenotype for another subset of EBV-LCLs. Zygosities of activating and non-activating EBV-LCL subsets can then be predicted using recognition phenotypes combined with family pedigrees of the CEPH cell lines.

Hypothetical loci zygosities can then be correlated with available genotype information of SNPs with the study’s population, resulting in identification of SNPs whose genotypes have a strong correlation with predicted zygosities. Herein,“strong correlation” can refer in some embodiments to greater than 80%, greater than 85%, greater than 90%, greater than 95%, or greater than 99%.

In some embodiments, identified SNPs can be located on a chromosome proximal to a corresponding gene which is capable of impacting (e.g. via upregulation or

downregulation of the gene) the immune activation of a cell expressing a T-cell receptor (e.g. Vy9V62 TCR T cells). In some embodiments,“proximal” refers to greater than 10,000 bp, greater than 50,000 bp, greater than 100,000 bp, greater than 200,000 bp, greater than 300,000 bp, greater than 500,000 bp or greater than lMbp. In other embodiments, an identified SNP can be located on a different chromosome than a corresponding gene capable of impacting (e.g. via upregulation or downregulation of the gene) the immune activation of a cell expressing a T-cell receptor (e.g. Vy9V62 TCR T cells).

The description and examples illustrate embodiments of the invention in detail. It is to be understood that this invention is not limited to the particular embodiments described herein and as such can vary. Those of skill in the art will recognize that there are numerous variations and modifications of this invention, which are encompassed within its scope. EXAMPLES

These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein.

Example 1. Identification of genetic loci associated with Vy9V62 TCR-mediated target cell recognition by SNP-Associated computational Pathway Hunt Including shRNA Evaluation (SAPPHIRE)

Differences in the genetic backgrounds of tumor cells affect recognition of these tumor cells by Vy9V52 TCR engineered T cells. Therefore, the library of cell lines from the Centre d'Etude du Polymorphisme Humain (CEPH) was utilized which contains a large collection of EBV-trans formed B cell lines (EBV-LCLs) obtained from several family pedigrees (Dausset et al., 1990) and genotyped for millions of SNPs (International

HapMap, 2003). CD4+ apT cells engineered to express one defined Vy9V52 TCR were utilized for the functional screening in order to eliminate fluctuations in recognition by a diverse ydTCR repertoire and varying expression of NK receptors. The recognition phenotypes of EBV-LCLs by Vy9V52 TCR T cells were assessed by means of IFNy production and showed an activating phenotype for 33 EBV-LCLs, while 7 were non activating (FIG. 1A and IB). A zygocity analysis revealed EBV-LCLs with a non activating phenotype represent more power than those with an activating phenotype as analyzed with SAPPHIRE. Hypothetical zygosities for candidate genetic loci were deduced using classical Mendelian inheritance patterns within CEPH family trios, where the influence of candidate alleles on Vy9V52. TCR-mediated recognition was assumed to be dominant. The resulting recognition phenotypes combined with family pedigrees of the CEPH cell lines overcame the need to screen large numbers of LCL lines, and allowed the precise prediction of zygosities of candidate loci for 12 CEPH individuals (FIG. 2 A. The hypothetical loci zygosities were then correlated with available genotype information of SNPs within the study's population, resulting in the identification of 17 SNPs whose genotypes correlated perfectly (100%) with predicted zygosities (FIG. 2B). Since none of these 17 SNPs, nor their proxy SNPs within high linkage disequilibrium (r ² > 0.8), directly affected genes by causing changes in protein coding sequences, it was speculated that rather than playing direct roles, the SNPs identified could represent surrogate markers for genetic regions associated with susceptibility to Vy9V02 TCR+ T cell recognition. In addition, the genomic vicinity of the 17 SNPs were queried for neighboring candidate genes (FIG. 2C).

To test the relevance of these genes for Vy9V52 TCR+ T cell-mediated target recognition, we knocked down all 17 SNP-adjacent genes in the Vy9V52 TCR+ T cell-activating EBV-LCL line 48. We then assessed the effect of knockdown on activation of Vy9V52 TCR+ T cells by measuring IKNg production, which was reduced upon the knockdown of three genes (RAB4A, RHOB and UBE3C) (FIG. 2B). To ensure that potential knockdown effects pointed to genes that selectively affect Vy9V52 TCR-dependent activation, the three knockdown variants of EBV-LCL line 48 were pulsed with Wilm's tumor 1 (WT1) peptide and tested for recognition with T cells engineered to express the cognate WT1 -specific aPTCR (Kuban et ah, 2007). The selective knockdown of the small GTPase RhoB significantly affected the activation of Vy9V02 TCR— but not aPTCR- engineered T cells (FIG. 2B). Similar data were observed after partial knock down of RhoB in the prototypic Vy9V52 T cell target cell line Daudi (FIG. 3B), as well as after CRISPR/Cas-mediated partial RhoB knock out in the renal carcinoma cell line

MZ1851RC (FIG. 4A). Interestingly, even complete knock out of RhoB in 293 HEK cells resulted only in partial depletion of target cell mediated Vy9V52 TCR T cell activation (FIG. 3A). In addition, knock out of either RhoA or RhoC genes in 293 HEK cells did not significantly influence their ability to activate Vy9V52 TCR+ T cells (FIG. 4B and FIG. 3C), emphasizing that RhoB modulates the recognition of tumor cells by a defined Vy9V52 TCR in a non-redundant role.

Example 2. Recognition of J-configuration of CD277 on target cell by polypeptide constructs described herein depends on Rho GTPase activity

The impact of RhoB GTPase activity on Vy9V52 TCR+ T cell activation was assessed by preheating different tumor cell lines with either the Rho GTPase activator calpeptin or inhibitor C3 transferase. Pretreatment with calpeptin significantly sensitized EBV-LCL 93 cells for recognition by Vy9Vd2 TCR+ T cells while, conversely, inhibition of Rho GTPase with C3 transferase resulted in significantly reduced activation of Vy9V52 TCR+ T cells by LCL 48 cells (FIG. 4D). Modulation of Rho GTPase activity did not affect the recognition of WT1 peptide-pulsed EBV-LCL 48 cells by WT1 aPTCR-transduced T cells. To specify that enzymatic activity of RhoB regulates tumor cell recognition by Vy9V52 TCR+ T cells, we transfected HEK 293 cells with wildtype or dominant negative form corresponding to the GDP-bound state (RhoB-DN), or with the constitutively active form corresponding to the GTP-bound form (RhoB-CA) of RhoB (Kamon et al, 2006) and used them as target cells for Vy9V52 TCR+ T cells (FIG. 4E). HEK cells overexpressing RhoB-CA mutants were able to trigger significantly stronger Vy9V52 TCR-specifie responses than cells expressing wild type RhoB, while RhoB-DN- transfected HEK cells showed a significantly reduced ability to stimulate Vy9V52 TCR+ T cells compared to cells expressing wildtype RhoB. These results suggest that modulating the biochemical activity of RhoB GTPases in cancer cells can be useful for the recognition of those cancer cells by engineered cells expressing a polypeptide that selectively binds the J-configuration or J-confirmation of CD277, for instance, Vy9V52 TCR+ T cells.

Example 3. Recognition of J-configuration of CD277 on target cell depends on intracellular distribution of RhoB

RhoB was selectively excluded from nuclear areas in cells that are able to activate Vy9V52 TCR+ T cells (FIG. 5A, FIG. 5B, FIG. 6A and FIG. 6D). Re-localization of RhoB from the nucleus, or from the nuclear membrane to extranuclear sites was induced by ABP as well as by soluble phosphoantigen IPP in cell lines (FIG. 5C and FIG. 5D), emphasizing that this process is dependent on accumulation of intracellular

phosphoantigen. The homogenous intracellular distribution of other GTPases such as RhoA did not change upon ABP treatment (FIG. 6B), supporting the observation that RhoA knock down did not impact Vy9V52 TCR-mediated recognition (FIG. 4B). RhoB was excluded from the nucleus in human, but not in mouse dendritic cells selectively treated with ABP, even though RhoB protein sequences are identical in both species (FIG. 5E and FIG. 6C). In order to test whether redistribution of RhoB occurs upon ABP treatment in leukemic cancer stem cells also, leukemic blasts, cancer stem cells and healthy stem cells were sorted from the very same donor based on flow markers and distribution of RhoB was quantified. Indeed, in primary blasts from an acute myeloid leukemia patient donor, RhoB localization correlated with the recognition by Vy9V52 TCR-engineered T cells (FIG. 5B and FIG. 6 A) including leukemic stem cells, but not healthy stem cells from the same donor (FIG. 5F). Taken together, these results suggest modulating intracellular distribution of the small GTPase RhoB (e.g., exclusion of RhoB from the nucleus) in tumor cells would increase their susceptibility to targeting by Vy9V52 TCR+ T cells.

Example 4. RhoB regulates membrane mobility of CD277, and the formation of J- configuration of CD277 on cancer cells

The impact of ABP and RhoB, an important player in the cytoskeletal reorganization and formation of actin stress fibers, on mobility of CD277 was tested. Treating 293 HEK cells with the ABP zoledronate resulted in decreased CD277 membrane mobility. Strikingly, treatment with calpeptin induced immobilization of CD277 to similar levels as those of ABP treatment alone, while C3 -transferase counteracted this ABP-effect (FIG. 7A). This points to the possibility that Rho GTPase activity acts on CD277 membrane

immobilization upstream of the mevalonate pathway. Selective depletion of RhoB by CRISPR/Cas inhibited the ABP-induced immobilization of CD277 to levels comparable to those of medium controls, suggesting that ABP-mediated changes in CD277 mobility depend on RhoB.

To next assess a role for RhoB-induced cytoskeletal rearrangements in mediating the observed changes in CD277 mobility, and J-configuration formation, the relation between CD277 molecules and F-actin was investigated by tantalization experiments. HEK 293 cells were stained with fluorescently labeled anti-CD277 and phalloidin, and tantalization coefficients were determined in response to treatment with ABP and calpeptin. In cells in a culture medium, a variable but considerable colocalization between CD277 and F-actin was observed, and was markedly reduced by ABP treatment (FIG. 7B). Strikingly, and similar to its effect on CD277 membrane mobility, calpeptin reduced tantalization between CD277 and F-actin to comparable levels observed with ABP treatment. This reduction suggests that both phosphoantigen accumulation and Rho activation can induce the formation of membrane domains surrounded by cytoskeleton, where CD277 molecules could be trapped and immobilized to form the J-configuration of CD277. Importantly, C3 -transferase prevented ABP-induced CD277-actin segregation, indicating again the crucial involvement of active Rho in this process. Together, these data suggest that modulating CD277 membrane mobility through cytoskeletal rearrangements and forming the J-configuration of CD277 contributes to target recognition by engineered cells that express polypeptides that specifically bind the J-configuration, such as Ug9Ud2 TCR+ T cells.

Example 5. RhoB interacts with CD277 homodimers in cancer cells recognized by polypeptide constructs described herein, for instance Vy9V62 TCRs

Given the strong requirement for RhoB activity in the membrane immobilization of CD277 to form the J-configuration, whether or not regulation of CD277 involves direct interactions with RhoB was tested. Using in sin/proximity ligation assay (PLA), RhoB and CD277 were observed to be in close proximity in recognized EBV-LCL 48 cells only when pretreated with the ABP (FIG. 8A Figure 5A). Importantly, PLA signals were typically excluded from the nuclear area and distributed close to the plasma membrane, in line with our data that RhoB is involved in Vy9V52 TCR+ T cell recognition by regulating formation of J-configuration of membrane-expressed CD277.

To determine whether CD277 exists as a homodimer when expressed in a cellular context, and to study RhoB-CD277 interactions at even higher resolution, close interactions by utilizing fluorescence resonance energy transfer (FRET) were examined. Flow cytometry FRET measurements were performed on ABP-sensitive HEK 293 cells, by either overexpressing FRET compatible fusion proteins or labeling endogenous proteins with antibodies coupled to FRET-compatible fluorochromes. These experiments showed that CD277 molecules are expressed as homodimers on the cell surface of cancer cells (FIG. 8B), however the pairing of CD277 molecules was insensitive to ABP- induced phosphoantigen accumulation. Close association between RhoB and CD277 was undetectable in ABP-untreated HEK cells, but increased markedly after treating cells with the ABP (FIG. 8C). Bio layer Interferometry (BLI) was used to formally define a possible docking site for RhoB on the intracellular domain of CD277. RhoB binding was detected with recombinant full length BTN3A1 intracellular domain (BFI) (FIG. 8D; left panel and Table 1), yet was significantly reduced when using a recombinant CD277 B30.2 domain, lacking the N terminal region connector to the transmembrane domain (FIG. 8E; left panel). These data indicate an important role for the membrane proximal region of the CD277 intracellular domain in binding to RhoB GTPase. Interestingly, RhoB binding to BFI was almost completely abolished in the presence of soluble phosphoantigen cHDMAPP (FIG. 8D; right panel). When in the same experiment, the physiologically more relevant, but much lower affinity pAg IPP was applied, BLI was unable to resolve pAg-induced dissociation of RhoB from BFI (FIG. 9C), very likely due to the technical limitation of the assay. In summary, these data indicate that methods and compositions designed to promote close interaction of RhoB and CD277 molecules at the surface membrane would promote formation of the J-configuration and recognition thereof by Vy9V52 TCRs.

Table 1. Rate and affinity constants for binding interactions between RhoB GTPase and BFI or B30.2 domains, in the presence or absence of pAg

Example 6. Phosphoantigen accumulation associates with conformational changes of CD277 dimers to the J-configuration

To study CD277 conformational changes to J-configuration in response to increased phosphoantigen levels, surface membranes of either unstimulated or ABP-stimulated HEK 293 cells were labeled with the fluorescent lipid conjugate BODIPY FL (donor), and subsequently stained with acceptor dye-labeled BTN3-specific antibodies on ice, in order to prevent conformational changes that could be driven by these antibodies under physiological circumstances. Without ABP stimulation, potent FRET efficiencies between stained membrane and both antibodies were observed (FIG. 10B), suggesting that the CD277 Ig-V domain is in close proximity to the cell membrane. Strikingly however, treatment of cells with ABP resulted in a marked reduction in FRET signals (FIG. 10B), demonstrating that intracellular phosphoantigen accumulation associates with a conformational change of BTN3 molecules. This change involves a pronounced distancing of the Ig-V domain from the cell membrane. Importantly, Rho-inhibitor C3- transferase treatment (FIG. 3F) of cells did not prevent ABP-driven conformational changes of the CD277 homodimer (FIG. 10B) indicating that this conformational change is independent of the enzymatic activity of RhoB. These data indicate that methods and compositions promoting CD277 dimerization act as, or contribute to a molecular signature recognized by Ug9Ud2 TCRs, namely the J-configuration of CD277. FIG. 11 shows a model of Vy9V52 TCR T cell activation based on data presented herein. During the non-activating phase, there is no accumulation of phosphoantigens (pAg, yellow stars, which retains GDP-bound RhoB (circles+GDP) from extranuclear areas. During activating phase component I, accumulation of phosphoantigens is followed by more GTP-bound RhoB formation (circles+GTP). GTP-bound RhoB undergoes subcellular re-compartmentalization (black arrows) accumulating at extranuclear areas and facilitates spatial redistribution of CD277 to J-configuration by promoting

cytoskeletal trapping (lines extending from membrane) in the plasma membrane binding to the B30.2 domain proximal connector region (CR) of CD277 (blue hexagon). During the activating phase component II, GTP-bound RhoB dissociates (black arrow) from while pAg binds to the B30.2 domain of CD277, which triggers a conformational change of the extracellular legion (ER) of CD277 resulting in the formation of the J-configuration of CD277 and leading to Vy9V02 TCR T cell activation.

Example 7. Identified SNPs not only predict recognition of LCL lines but also other tumor cell lines including solid tumor cell lines.

The positive predictive value of the SNP A/G or G/G is stronger than the negative predictive value of A/A and depends on TCR affinity (see Table 2). In Table 2, clone 5 encodes a g9d2 TCR which has a higher affinity than the g9d2 TCR encoded by clone 115 (Marcu-Mallna et al,“Redirecting ab T cells against cancer cells by transfer of a broadly tumor-reactive gd T-cell receptor,” Blood, 118: 50-59 (2011)). Therefore, based on this data, the higher the TCR affinity:

1.) the better is the positive predictive value (i.e. an included patient has a high chance of being a responder)

2.) the worse is the negative predictive value (i.e. patients who are responders may be excluded).

With respect to the data in Table 2, the genotype of different tumor cells was assessed by sequencing. Recognition of tumor cells was assessed by IFNy-ELIspot assay or ELISA, in which indicated tumor cell lines were used as targets against Vy9V02TCR+ T cells expressing Gl 15 or clone 5 chains. 0 indicates no recognition; 1 indicates significant recognition. Calculated are false negative and correct positive recognition for indicated SNPs.

These data indicate that RhoB is an important modulator of recognition of tumor cells by T cells engineered to express a defined gd TCR (i.e.“TEG cells”), and, that an increased affinity of a y952TCR can partially overcome this mechanism. In addition, stress like irradiation neither induces the mechanism (relocation of RhoB to the proximity of the cell membrane) nor induces recognition (see Figure 12).

Table 2. Prediction of susceptibility of tumor cells to T cells engineered to express a defined TCR depends on the SNP genotype of the tumor as well as affinity of the y952TCR.

Example 8. SNPs located outside Rho-GTPase may influence Rho-GTPase

In some cases, a defined SNP located within a gene of interest will directly influence expression or function of the protein encoded by the gene. However, in some cases identified SNPs may not be directly located within these regions, and splice variants may not be detected.

One hypothesis is that SNPs located outside Rho-GTPase may influence Rho-GTPase activity. Databases used for a SAPPHIRE strategy may not be complete, and thus may not cover all SNPs. To further identify genetic variations that correlate with the genotype of marker SNPs, extended genomic sequencing focusing primarily on the promoter region of Rho-GTPase will be performed. Rho-GTPase promoter regions differ between mice and humans, though the sequence of Rho-GTPase itself is identical. This observation could potentially explain why no gd2 T cells are observed in mice. In addition, the recently released next generation database of SAPPHIRE will be used, which will allow a more profound SNP analysis to detect SNPs that are located within the genomic region of Rho- GTPase. A refined 2.0-version of SAPPHIRE will be developed by including proxy SNPs (i.e. SNPs in high LD with SNP hits, www.broadinstitute.org/mpg/snap/ldsearch.php) as well as predicting functionality of (proxy) SNPs (e.g. missense, promoter, regulatory region, etc, e.g. http://fastsnp.ibms.sinica.edu.tw/). In addition, SNPs will be correlated to differential gene expression using expression quantitative trait loci (eQTL) analysis (http://www.sanger.ac.uk/resources/software/genevar/), and common cellular processes or pathways among candidate genes will be deduced via NCBI Gene Ontology (GO) terms. In particular, genes encoding for Rho regulating proteins will be targeted, including some 130 genes that belong to GEF (Guanine nucleotide exchange factors), GAP (GTPase activating proteins) and GDI (Guanine nucleotide exchange inhibitors) molecular families. As such, genes are frequently located at the same chromosomal region as the Rho-GTPase, thus are also close to the marker SNPs. Such genes will be targeted for further computational and sequence analysis.

Predicted Outcome: SNPs e.g. within the promoter region or regulatory genes of Rho- GTPase which are linked to the marker SNPs may be identified. Follow up research can include either promoter studies to provide functional data on differential regulation of Rho-GTPase by defined SNPs, or studies overexpressing or inhibiting regulatory proteins of Rho-GTPase.

Example 9. Experimental Procedures

Cells and Reagents

Cells and reagents CEPH EBV-LCL lines (CEU population panel) were a kind gift from Tuna Mutis (UMC Utrecht, The Netherlands). Daudi, K562, SW480, HEK 293, HEK 293FT and Phoenix- Ampho cell lines were obtained from ATCC. LCL-TM (an EBV- LCL line separate from the CEPH panel) was kindly provided by Phil Greenberg (Seattle, U.S.A.). MZ1851RC was kindly provided by Barbara Seliger (University of Halle, Germany). Hek 293, Phoenix-Ampho, SW480, MZ1851RC cells were cultured in DMEM supplemented with 1% Pen/Strep (Invitrogen) and 10% FCS (Bodinco), all other cell lines in RPMI with 1% Pen/Strep and 10% FCS. Primary fresh PBMCs were isolated by Ficoll- Paque (GE Healthcare) from huffy coats supplied by Sanquin Blood Bank (Amsterdam, The Netherlands). Frozen primary acute myeloid leukemia (AMF) samples were kindly provided by Matthias Theobald (Mainz, Germany) and were collected in compliance with GCP and Helsinki regulations.

The following reagents were used: pamidronate (Calbiochem), zoledronic acid

monohydrate (zolidronate, Sigma- Aldrich), isopentenyl pyrophosphate (IPP) (Sigma- Aldrich), calpeptin (Rho activator II CN03, Cytoskeleton Inc), C3 transferase (Rho Inhibitor I CT04, Cytoskeleton Inc), the famesyl transferase inhibitor (FTI) (Sigma- Aldrich), and the geranylgeranyltransferase inhibitor (GGTI) (Sigma- Aldrich).

Flow Cytometry

Antibodies used for flow cytometry included: pan-ydTCR-PE (clone IMMU510,

Beckman Coulter), CD4-FITC (eBioscience), CD8-APC (BD), unconjugated rabbit polyclonal RhoB (AbCam), goat-anti-rabiit Alexa Fluor 488 (Jackson ImmunoResearch). Mouse a-CD277 mAh (clone #20.1 and 103.2) were kindly provided by D. Oliver (INSERM U891, Marseille, France). Samples were processed with FACSCalibur and FACSCanto-II flow cytometers (BD) and analyzed with FACSDiva software (BD).

Primary leukemic stem cells and healthy progenitor cells were sorted according to phenotypic markers as previously described (Terwijn et ah, 2014).

Cells were sorted using a FACS Aria SORP (with red, blue, and violet solid-state lasers; BD Biosciences). Cells were kept on ice during the whole procedure. Cells were labelled with AntiCD45RA Alexa Fluor 700, Anti-CD38APC, Anti-CD34 Horizon BV421, Anti- CD45 Horizon V500, all BD Biosciences, San Jose, CA, USA. CD34+CD38- stem cells were sorted based on CD45RA expression: CD45RA positive cells are neoplastic and CD45RA negative cells are normal hematopoietic stem cells. Above that, CD34+CD38+ progenitors were sorted. Retroviral transduction ofTCRs

Retroviral transduction ofTCRs The Vy9V52-TCR clone Gl 15 (Allison et al., 2001) and a HLA-A* 0201 -restricted WT1126-134- specific o.pTCR (Kuball et al., 2007) were transduced into abT cells as described (Marcu-Malina et al, 2011, Stanislawski et al, 2001). In brief, Phoenix-Ampho packaging cells were transfected with gag-pol (pHIT60), env (pCOLT-GALV) and pBullet retroviral constructs containing TCRy/p-chain-IRES- neomycine or TCRd/a-chain-IRES-puromycin, using Fugene6 (Promega). PBMCs preactivated with aCD3 (30ng/ml) (clone OKT3, Janssen-Cilag) and IL-2 (50U/ml) were transduced twice with viral supernatant within 48 hours in the presence of 50U/ml IL-2 and 4pg/ml polybrene (Sigma- Aldrich). Transduced T cells were expanded by stimulation with aCD3/CD28 Dynabeads (0.5x106 beads/l06 cells) (Invitrogen) and IL-2 (50U/ml) and selected with SOOpg/ml geneticin (Gibco) and 5pg/ml puromycin (Sigma- Aldrich) for one week. CD4+ TCR-transduced T cells were isolated by MACS-sorting using CD4- microbeads (Miltenyi Biotec).

Following transduction, transduced T cells were stimulated biweekly with lpg/ml PHA-L (Sigma- Aldrich), 50U/ml IL-2 (Novartis Pharma), 5ng/ml IL-15 (R&D Systems), and irradiated allogeneic PBMCs, Daudi and LCL-TM cells. Fresh IL-2 was added twice a week. Transgenic TCR expression and purity of CD4+ populations was routinely assessed by flow cytometry.

Functional T cell assays

FNy ELISPOT was performed as previously described (Scheper et al., 2013, Marcu- Malina et al., 2011). Briefly, 15,000 Vy9V62 TCR-transduced or mock-transduced T cells and 50,000 target cells (ratio 0.3:1) were cocultured for 24 hrs in nitrocellulose-bottomed 96-well plates (Millipore) precoated with anti-IFNy antibody (clone 1-D1K) (Mabtech). Plates were washed and incubated with a second biotinylated anti-IFNy antibody (clone 7-B6-1) (Mabtech) followed by streptavidin-HRP (Mabtech). IFNy spots were visualized with TMB substrate (Sanquin) and the number of spots was quantified using ELISPOT Analysis Software (Aelvis).

Alternatively, Vy9V62 TCR-transduced T cells and target cells were cocultured as above in round-bottom 96-well plates, and IFNy levels in supernatants were measured by

ELISA. Where indicated, target cells were pretreated with pamidronate (100 mM), IPP (15 mM), FTI (10 mM), GGTI (50 mM), calpeptin (2 pg/ml) or C3 transferase (20 pg/ml) prior to coincubation. For testing stimulation of WT1 o.pTCR-transduccd T cells, the HLA-A2+ cell lines EBV-LCL 48 and MZ1851RC were pulsed with 10 mM WTl - peptide.

Zygositv/SNP correlation analysis

Recognition of CEPH EBV-LCL lines (pretreated with either medium, pamidronate (100 mM) or IPP (15 mM) by Vy9V02 TCR-transduced CD4+ T cells was determined by ELISPOT. Mocktransduced T cells were included as effector controls, and any EBV-LCL line that elicited IENg production by mock-transduced cells were excluded from the analysis. Recognition of EBV-LCL lines by Vy9Vd2 TCR+ T cells in a single assay was defined as an at least two-fold increase in IENg spots compared to those produced in response healthy control target cells, irrespective of EBV-LCL pretreatment (i.e. medium, pamidronate or IPP). EBV-LCL line was defined as activating when recognized in at least three out of five independent experiments. Hypothetical zygosities for candidate genetic loci were deduced using classical Mendelian inheritance patterns within CEPH family pedigrees, where the influence of candidate alleles on Vy9Vd2 TCR-mediated recognition was assumed to be dominant. Correlations of predicted zygosities with Hapmap SNP genotypes of CEPH individuals were subsequently calculated with the software tool ssSNPer, as previously described (Spaapen et al, 2008). Proxy SNPs within 500 kb of SNPs produced by ssSNPer were collected by querying the SNP Annotation and Proxy Search (SNAP) tool (Johnson et al., 2008), using r ² = 0.8 as a threshold for linkage disequilibrium. eQTL analysis of ssSNPer SNP and their proxies was performed using the Genevar (GENe Expression VARiation) tool (Yang et al, 2010).

shRNA and CRISPR/Cas genome editing

HEK 293FT cells were transfected using Fugene 6 (Promega) with lentiviral constructs containing shRNAs (Sigma- Aldrich) together with lentiviral helper constructs VSVG and pspax2, against candidate genes of interest. EBV-LCL 48 cells were transduced with viral supernatants four days prior to functional T cell assays. Knockdown of targeted genes was confirmed using real-time Q-PCR, or in the case of RhoB, by flow cytometry.

We employed the CRISPR/Cas9 system (van de Weijer et al., 2014) to knock out RHOA, RHOB, or RHOC from MZ1851RC cells. For this, we used lentiviral CRISPR/Cas9 vectors (Ref Weijer et al) co-expressing S. pyogenes Cas9, PuroR and a human U6 promoter driving expression of anti RHOA guideRNAs (gRNA). The gene-specific regions of the gRNA sequences were designed by the CRISPR design tool from the Zhang lab (http://crispr.mit.edu/) and their sequences were GAACTATGTGGCAGATATCG (RHOA) (SEQ ID NO: 2),

GTGGTGGGCGACGGCGCGTG (RHOB) (SEQ ID NO: 3), and

G AAAG A AGCT GGT G ATCGT (RHOC) (SEQ ID NO: 4). As control gRNA, we targeted the eGFP gene with GTGAACCGCATCGAGCTGAA (SEQ ID NO: 5).

Lentiviruses were generated using standard 3 ^rd generation packaging vectors in 293T cells. MZ1851RC cells were transduced with indicated CRISPR/Cas9 lentiviruses, and cells were selected with 2 pg ml-l puromycin. The efficiency of RhoB knockout was assessed using flow cytometry.

Western blot analysis

EBV-LCL lines 22, 48, 91 and 93 were treated with pamidronate overnight, and were lysed by lysis buffer containing NP-40. Lysates were centrifuged to remove cell debris and supernatants were separated by SDS-PAGE. Protein content was transferred to PVDF membranes (Millipore), blocked for 1 hr in blocking buffer (5% milk) and incubated overnight with rabbit polyclonal antibodies directed against RhoB (LifeSpan Biosciences) or b-tubulin (clone DM1A) (Sigma). Blots were subsequently incubated with HRP- conjugated secondary antibodies, and bands were visualized using Pierce ECL substrate (Thermpo Scientific).

Confocal microscopy and data analysis

For intracellular immunofluorescence staining of RhoB, cells were treated with pamidronate overnight (where indicated) and were allowed to atach onto coverslips precoated with poly-Llysine (Sigma- Aldrich). Cells were subsequently permeabilized with Permeabilizing solution 2 (BD), blocked with blocking serum (50% pooled normal human serum in PBS), and stained with a rabbit polyclonal anti-RhoB antibody (AbCam) followed by a secondary Goat anti-Rabbit IgG Alexa Fluor 488-conjugated antibody (Jackson ImmunoResearch). Cells were washed with blocking serum, fixed with 4% paraformaldehyde, stained with DAPI (where indicated), and mounted onto microscopy slides using Mowiol. Images were acquired using a Zeiss confocal laser scanning microscope LSM 700. Ratios between nuclear and extranuclear signal of RhoB was determined using Volocity software (PerkinElmer) or Image J software, where DAPI staining was used, when available, to mark nuclei.

To determine colocalization between BTN3 molecules and the actin cytoskeleton, HEK 293 cells were grown onto poly-L-lysin-coated coverslips and pretreated with either calpeptin (2 pg/ml) or C3 transferase (20 pg/ml) prior to treating samples with pamidronate Cells were fixed, permeabilized and BTN3 and F-actin were stained with DyLight 680-conjugated BTN3 antibody (clone BT3.1, Novus Biologicals) and

Fluorescein-coupled phalloidin (Sigma), respectively. The correlation coefficient between BTN3 and F-actin signal was determined as a measure of colocalization using Volocity software.

FRAP microscopy

FRAP analysis was performed as previously described (Harly et al., 2012, Sandstrom et al, 2014). In brief, HEK293FT cells expressing either EmGFP-fused CD277 were laid on m-slides (Ibidi) and analyzed using a Nikon Al RS confocal microscope (60xNA 1.40 oil immersion objective). Selected rectangular areas were photobleached for 500 ms by using full power of laser intensity (> 90% of loss of fluorescence). Images were collected every 5 s, before (30 s) and after (120 s) bleaching using low laser intensity. Images were analyzed with Metamorph 7.5 (Molecular Devices, Universal Imaging) and NIS (Nikon) imaging software.The resulting curves were fitted using one-phase exponential equations. Flow cytometry FRET

To study association of RhoB and BTN3 molecules, cells were permeabilized by using Permeabilization solution 2 (BD), then blocked with PBS containing 50% Human serum and labeled with rabbit polyclonal anti-RhoB antibody (AbCam). After washing with PBS, samples were labeled with Alexa594-conjugated Goat anti-Rabbit IgG (acceptor) (Jackson ImmunoResearch) and CD277-PE (donor) (BT3.1, Biollegend), respectively. The donor fluorescence was measured using a FACS Canto-II flow cytometer (BD) where donor fluorescence of the double-labeled samples was compared with that of samples labeled only with donor antibody. FRET efficiency was calculated from the fractional decrease of the donor fluorescence in the presence of the acceptor.

In order to determine homodimerization of CD277 molecules, cells were co-stained with equal amount of PE-conjugated anti-CD277 (donor) and Dyligth680-conjugated anti- CD277 (acceptor) and samples were measured using a FACS Canto-II flow cytometer (BD). FRET efficiency was calculated with equations according to Sebestyen and colleagues (Sebestyen et al, 2002) where donor fluorescence was excited at 488 nm and detected at 576 ± 26 nm, acceptor fluorescence was excited at 635 nm and detected at 780 ± 60 nm, whereas FRET intensity was excited at 488 nm and detected at 780 ± 60 nm. Correction factors for the spectral overlap between the different fluorescence channels were obtained from data measured on unlabeled and single-labeled cells. Conformational change of BTN3 molecule was determined similarly as described in (Gaspar et al., 2001). Cells were labeled with 5ug/ml BODIPY-FL DPHE (donor) (Life Technologies) for 10 minutes on ice and then 10 minutes at 37C, then washed extensively with ice-cold PBS. Cells were subsequently labeled with mouse anti-CD277 mAbs (either clone #20.1 or #103.2) and Alexa594-conjugated Goat anti-Mouse Fab fragments (Jackson ImmunoResearch). After washing, cells were resuspended in ice cold PBS and measured immediately using a FACS Canto-II flowcytometer (BD). FRET efficiency was calculated from the fractional decrease of the donor fluorescence in the presence of the acceptor.

Proximity lieation assay

HEK 293FT cells were grown onto poly-L-lysine coated coverslips and pre-treated with lOOuM pamidronate overnight prior to being fixed and permeabilized with

Permeabilization buffer 2 (BD) for 15 minutes. Subsequently, cells were washed three times with PBS and blocked for 30 minutes at 22°C in PBS containing 50% human serum. After blocking, cells were incubated for 60 min at 22°C with rabbit anti-RhoB (AbCam) and mouse anti-CD277 (Novus Biologicals) in PBS containing 50% human serum. Cells were washed three times with PBST (0.05% Tween) and incubated with the secondary mouse PLUS and rabbit MINUS antibodies for 1.5 hours at 37°C in the dark. Cells were washed three times in PBST before detection of the probe with the in situ PLA detection kit (Abnova). Cells were analyzed with a 63 ^x objective on a Zeiss LSM 710 fluorescence microscope.

In vitro protein expression and purification

The full length RhoB protein was cloned into the pET 28a vector with an C-terminal six- HIS tag (SEQ ID NO: 6) followed by a thrombin cleavage site using restriction enzyme sites Ndel and Xhol (5’ primer: CGCCATATGATGGCCGCCATCCG (SEQ ID NO: 7); 3’ primer: CGC CTC G AGTT AGC AGC AGTT GAT GC AGC (SEQ ID NO: 8)). The C- terminal CKVL (SEQ ID NO: 9) motif of RhoB was deleted to prevent improper prenylation in Escherichia coli. The construct was expressed in BL21 strain Escherichia coli. Cells were grown in Terrific Broth (TB) at 37 °C to OD600=0.6 and then transferred to room temperature (25°C). After l5min of recovery, the cells were induced with lml 1M Isopropyl b-D-l-thiogalactopyranoside (IPTG) per liter of culture for 12-16 hours. Protein was harvested and purified using Ni-NTA (Qiagen) IMAC chromatography in 20mM Tris pH8.0, 400mM NaCl, 20mM Imidazole, 5mM MgCk and 4mM 2- mercaptoethanol (BME), washed first with lmM ATP supplemented in the buffer mentioned above to dissociate potential chaperones from RhoB and then the buffer without ATP, and finally eluted with 20mM Tris pH8.0, 400mM NaCl, 250mM

Imidazole, 5mM MgCh and 4mM BME. The eluted fractions was desalted into lOmM Hepes 7.2, l50mM NaCl, 0.02% azide, 5mM MgCh and 4mM BME using an Econo-Pac 10DG column (Biorad). Protein was further purified by gel filtration over a Superdex 200 column (GE healthcare) in lOmM Hepes pH7.2, l50mM NaCl, 0.02% azide, 5mM MgCh and 4mM BME. Protein concentration was measured by both BCA test and measuring A280 signal using ND-1000 spectrophotometer (NanoDrop Technologies, Inc.) using the theoretical extinction coefficient. The BTN3A1 B30.2 domain was expressed and purified as previously described (Sandstrom et al., 2014). The BTN3A1 full-length intracellular domain was cloned into pET28a with a 3C protease site followed by a carboxyl-terminus six-HIS tag (SEQ ID NO: 6) using restriction enzyme sites Ncol and Xhol (5’primer: GCGCC AT GGGGC AAC AGC AGGAGGAAAAA (SEQ ID NO: 10); 3’primer:

CGCTCGAGGGGCCCCTGGAACAGAACTTCCAGACCACCAGACGCTGGACAAA TAGTC (SEQ ID NO: 11)). The construct was expressed in BL21 strain Escherichia coli. Cells were grown to OD600=0.6 in Lysogeny Broth (LB) at 37 °C and induced with lml 1M IPTG per liter of culture for four hours at room temperature. Protein was harvested and purified using Ni-NTA (Qiagen) IMAC chromatography in 20mM Tris pH8.0, 400mM NaCl, 20mM Imidazole, 4mM BME, and eluted with 20mM Tris pH8.0, 400mM NaCl, 250mM Imidazole, 4mM BME and desalted into lOmM Hepes pH7.2, l50mM NaCl, 0.02% azide, 4mM BME using an Econo-Pac 10DG column (Biorad). Protein was cleaved overnight using 3C protease at 4°C. Protein concentration was measured as mentioned above (Figure S4A and S4B).

Biolayer Interferometry (BLI)

The interactions between RhoB and BTN3A1 full-length intracellular domain (BFI) or BTN3A1 B30.2 domain were measured using Biolayer interferometry (BLItz, ForteBio). The BLI buffer used in baseline equilibration and the dissociation step was prepared with lOmM Hepes pH7.2, l50mM NaCl, 0.02% azide, 5mM MgCh, 4mM BME. RhoB, at a concentration of 2 mg/ml, was immobilized on the Ni-NTA biosensor hydrated with the BLI buffer using the basic kinetics method with the following parameters: 30s for baseline, 300s for association and 300s for dissociation. The RhoB-mounted biosensor was then blocked by lmg/ml BSA and equilibrated with the BLI buffer using a similar method with the following parameters: 30s for baseline, l20s for association and l20s for dissociation. The buffer run served as a reference for the subsequent experiments. The interaction between RhoB and different concentrations of BFI (6.25, 12.5, 25, 50 and lOOuM) or B30.2 domain (12.5, 25, 50, 100 and 200uM) were measured using the same method as mentioned above. The interaction between RhoB and different concentrations of BFI (3.75, 7.5, 15, 30 and 60uM) or B30.2 domain (3.75, 7.5, 15, 30 and 60uM) in the presence of (2E)-l-hydroxy-2-methylpent-2-enyl-pyrophosphonate (cHDAMPP) were also measured using the same method as mentioned above. The ratio between cHDMAPP and BFI or B30.2 domain was kept at 1 : 1 for these measurements. The rate and affinity constants for binding interactions were analyzed by Biaevulation (Biacore Life Sciences). The data was truncated to 180s and the k„ and 1 ¾ were fitted simultaneously using 1 : 1 binding with drift baseline model.

G-Lisa analysis

RhoA activity was assayed using a G-LISA RhoA Activation Assay Biochem kit (cat. no. BK124; Cytoskeleton, Inc., Denver, CO, USA), according to the manufacturer's instructions. Briefly, cell were lysed in ice-cold lysis buffer with a protease-inhibitor cocktail, and then centrifuged at 10000 ^x g at 4°C for 1 min. The supernatants were harvested and protein concentrations were measured using the Precision Red Advanced Protein Assay Reagent and were finally equalised with ice-cold lysis buffer to 1.0 mg/ml. Equalised protein extractions were transferred to a Rho-GTP-binding protein pre-coated plate. The plate was placed on an orbital microplate shaker at 0.72 x g for 30 min at 4°C, and then incubated with monoclonal mouse anti-human anti-RhoA primary antibody (cat. no. GL01A; 1 :250; Cytoskeleton, Inc.), followed by a polyclonal goat anti-mouse horseradish-conjugated secondary antibody (cat. no. GL02; 1 :62.5; Cytoskeleton, Inc.), on an orbital microplate shaker (SSM1; Bibby Scientific Limited Group) at 0.72 x g at room temperature, for 45 min each. The plate was then incubated with the HRP detection reagent at 37°C for 15 min. Subsequent to the addition of HRP stop buffer, absorbance was read at 490 nm using a microplate reader.

Statistical Analysis

All experiments were independently repeated at least three times unless otherwise indicated. All data were shown as mean ± SEM. Statistical significance was analysed by either Mann- Whitney or Kruskal- Wallis test and Dunn’s multiple comparison test.

While preferred embodiments of the present disclosure have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the present disclosure. It should be understood that various alternatives to the embodiments described herein, or

combinations of one or more of these embodiments or aspects described therein may be employed in practicing the present disclosure. It is intended that the following claims define the scope of the present disclosure and that methods and structures within the scope of these claims and their equivalents be covered thereby.

Example 10: Experimental methods

Cell lines

The cell lines Daudi, LCL-TM, ML-l, JurMA and Jurkat-76 were cultured in RPMI (Gibco) supplemented with 10% FCS and 1% pen/strep (Gibco). HEK293FT cell line was cultured in DMEM (Gibco) supplemented with l0%FCS and 1% pen/strep. Human primary T cell clones were cultured in RPMI supplemented with 10% pooled human serum and 1% pen/strep. Human bulk primary T cells used for retroviral transductions were cultured in RPMI, supplemented with 2,5% pooled human serum and 1% pen/strep. All human primary T cells were cultured following the 2-week rapid expansion protocol (REP, including irradiated feeder cells (Daudi, LCL-TM and allogeneic PBMC)

+PH A+IL- 15 +IL-2.

Generation, expansion and functional testing of g9d2 T cells clones

PBMCs were stained with monoclonal antibody (mAb) to V52 (V02-FITC clone B6). The mAb-positive fraction was either sorted in bulk, expanded on REP, and thereafter cloned by limiting dilution (donor A) or single cell-sorted using FACS sort with collection of single cells in 96 well plates (donors B, C). All FACS sorts were performed on ARIAII (BD). Eight to twelve rounds of expansion on REP preceded functional testing. As soon as the cells expanded to sufficient numbers functional testing was performed: 5*10 ^L 4 T cells were incubated overnight together with target cells at 1 :1 E:T ratio in DMEM supplemented with l0%FCS and 1% pen/strep, without or in the presence of 100 mM Pamidronate Disodium salt (Calbiochem Cat#506600), supernatants were harvested the day after, and IFNy concentration was measured using ELISA (eBioscience Ready-Set- Go! ELISA kit, Invitrogen Cat# 88731688). TCR sequencing and vector generation

RNA was isolated from the primary T cell clones using the Qiagen RNeasy Minikit following the manufacturer’s instructions. cDNA was synthesized with SUPERSCRIPT® II Reverse Transcriptase (Thermo fisher), using a specific primer at the 3’ constant region (TRDCRev TT C AC C AG AC AAGCG AC A (SEQ ID NO: 12)). cDNA was purified using a NucleoSpin Gel and PCR Clean-UP (Machery-Nagel). cDNA was amplified in a PCR amplification with the same reverse primer at constant region (TRDCRev

TTCACCAGACAAGCGACA (SEQ ID NO: 12)), and specific V52 forward primer (TRDV2Fw TCTCTTCTGGGCAGGAGTC (SEQ ID NO: 13)), using Q5® High Fidelity DNA polymerase (New England Bio labs) on a T100 Thermal Cycler (Biorad) and the following cycling parameters:

TCR gamma and delta chains were sequenced using primers specific for the variable and constant gene segments (TRDV2Fw TCTCTTCTGGGCAGGAGTC (SEQ ID NO: 13), TRDCRev TTCACCAGACAAGCGACA (SEQ ID NO: 12), TRGV9Fw

TCCTTGGGGCTCTGTGTGT (SEQ ID NO : 14), TRGCRev

GGGGAAACATCTGCATCA (SEQ ID NO: 15)). Sanger sequencing was performed at Macrogen.

The TCRd and TCRy chains of a selection of the identified gd T cell clones were reconstructed in retroviral expression vectors using overlap extension PCR to introduce the new CDR3 sequences. In brief, a set of primers was created based on the invariant sequences flanking the CDR3 region of a codon optimized construct encoding either the g or d chain of Gl 15, the primers were extended with clone-specific nucleotides. A stretch of 15-20 bp within the overhang was designed to be reverse complement to its pair primer (see table 3):

Table 3: Primer sequences for the generation of TCR Gamma and Delta sequences

454-

In PCR”Rl” the V-(D)-J part (the variable domain and part of the CDR3 region) was amplified, using forward primers binding to the template chains d and g TCRG115 cloned into the retroviral pBullet vector and including the restriction sites (Gl l55Fwd:

5 CT GCC AT GG AGC GG AT C AGC (SEQ ID NO: 70), Gl l5yFwd:

GCCATGGTGTCCCTGCTG (SEQ ID NO: 71), Ncol restriction site in italic), and the clone-specific reverse primer Rev Rl (Table 3). Similarly, in PCR”R2”, the (D)-J-C part of the TCR chain was amplified using a constant reverse primer (Gl l55Rev:

ATGCGGATCCTCACAGG (SEQ ID NO: 72), Gl lSyRev:

0 TAGTGGATCCTCAGCTCTTCTC (SEQ ID NO: 73), BamHI restriction site in italic) and the clone-specific forward primer Fwd R2. After the gel-based size selection and purification with NucleoSpin Gel and PCR Clean-UP kit (Machery-Nagel), two of the PCR products (Rl and R2) were fused and amplified in PCR“R3” using G 1 155Fwd/

Gl l55Rev and G 1 15yFwd/G 1 15yRcv primer pairs to obtain TCR chains bearing the clone-specific CDR3 regions. All reactions were performed using Phusion High-Fidelity DNA polymerase (Thermo Fisher Scientific) on a T100 Thermal Cycler (Biorad) and the following parameters for R1-R2: l20s at 98°C, 30 cycles of 20 s at 98°C, 20 s at 59°C, and 25 s at 72°C, followed by 600 s at 72°C; for R3: l20s at 98°C, 30 cycles of 20 s at 98°C, 20 s at 56°C, and 40 s at 72°C, followed by 600 s at 72°C.

After another gel-based size selection step, the newly synthetized TCR chains were purified and cloned into the retroviral pBullet vectors using Ncol and BamHI cloning sites. The TCR6 genes were cloned into pBullet-IRES-puromycin, the TCRy genes were cloned into pBullet-IRES-neo. Sequence identity was confirmed with Sanger sequencing (Macrogen).

Retroviral transduction o f plasmids

Vector pairs bearing the TCR chains of interest were transduced into the primary human T cells. Functional testing of the TCRs in the TEG format was performed in the same fashion as functional testing of the primary clones.

High throughput sequencing o fTCRd chain

RNA was isolated using the Qiagen RNeasy Microkit following the manufacturer’s instructions. cDNA was synthesized with SUPERSCRIPT® II Reverse Transcriptase (Thermo fisher), using a specific primer at the 3’ constant region (TRDCRev

TTCACCAGACAAGCGACA (SEQ ID NO: 12)). cDNA was purified using a

NucleoSpin Gel and PCR Clean-UP (Machery-Nagel). cDNA was amplified in a PCR amplification with the same reverse primer at constant region (TRDCRev

TTCACCAGACAAGCGACA (SEQ ID NO: 12)), and specific V62 forward primer (TRDV2Fw TCTCTTCTGGGCAGGAGTC (SEQ ID NO: 13)), using Q5® High Fidelity DNA polymerase (New England Bio labs) on a T100 Thermal Cycler (Biorad) and the following cycling parameters: 300 s at 92°C, 30 cycles of 30 s at 92°C, 30 s at 63°C, and 45 s at 72°C, followed by 420 s at 72°C. After purification with NucleoSpin Gel and PCR Clean-UP, library preparation for HTS was done with HTSgo-LibrX kit with HTSgo- IndX indices from Gendx as recommended by the manufacturer. Cleanup of the samples was performed with HighPrep PCR beads from GC Biotech. High-throughput sequencing was performed on an Illumina MiSeq system 500 (2x250 bp) (Illumina). TCR sequence alignment, assembly and clonotype extraction were performed using the MiXCR (version-v2. l .l) program. In house R scripts were used for TCR6 repertoire analysis, data were filtered to exclude clonotypes with frequency of 1 read/clonotype.

Cloning, expression, and purification of soluble TCRs

The extracellular domains of the TCR chains were amplified from synthetic DNA encoding the full length TCRs. The domain boundaries were based on ones published before for Vy9V52 TCR Gl 15. The TCR5 chains were ligated in to a modified pBullet vector containing a m-phosphatase signal peptide at the 5’ end and fos zipper at the 3’ end of the construct. The T C Ry chains were ligated in a modified pBullet vector containing a m-phosphatase signal peptide at the 5’end and at the 3’ a jun zipper followed by a biotin acceptor peptide and a poly-histidine tag. Synthetic DNA encoding for the bacterial biotin ligase BirA was also ligated in a pBullet vector containing a signal peptide. The expression of soluble ydTCRs was done in Freestyle 293-F cells (ThermoFisher). In short, plasmids containing TCR5, TCRy and BirA were mixed into a 45:45: 10 ratio, combined with polyethylenimine (PEI) in a 2:3 ratio and incubated for 15’ at room temperature. The DNA:PEI mix was added to the cells at a concentration of 1-1.5 pg plasmid/lO ^A 6 cells and after 6 h the media was supplemented with Pen/Strep (Gibco) and 100 mM biotin. 5 days after transfection the media was harvested, supplemented with phosphate buffer pH 7.5 and NaCl, at a final concentration of 20 and 300 mM respectively, and loaded on a 1 ml HisTrap Excel column (GE healthcare). A multi-step gradient, increasing the concentration of imidazole, was used to wash and elute the soluble TCR from the column. The eluted soluble TCR was loaded on a 1 ml HiTrapQ column (GE healthcare) in 20 mM Tris pH 8.2 and 20 mM NaCl. A linear gradient was used to elute the soluble TCR. Fractions containing the soluble TCR were pooled and concentrated. Tetramers and dextramers were prepared. Briefly, tetramers were prepared from monomers by adding one equivalent of SA-PE (1 mM) to six equivalents of sTCR (6 mM) in four steps over 20 min. Dextramers were prepared by preincubating SA-PE and sTCR in a molar ratio 1 :3 for 15 min, and then doping the formed trimers with biotinylated dextran (MW 500 kDa, NanoCS) at a molar ratio 1 :8 (dextran: SA-PE). For beads preparation, the biotinylated soluble TCRs were mixed with streptavidin conjugated fluorescent Yellow-Green microspheres (6 pm; Polysciences, Inc.) in excess to ensure fully coated beads, 10 pg sTCR/mg microspheres.

sTCR multimer-cell conjugation assay

For tetramer and dextramer staining, 1.0* 10 ^L 5 cells were incubated with 30 ul tetramer or dextramer solution (100 nM with respect to SA-PE) for 30 minutes at R.T. For beads staining, 7.5* 10 ⁴ cells were incubated with 20 mΐ sTCR-YG-beads (0.33 mg beads/ml) for 30. Cells were subsequently stained with fixable viability dye eFluor780 (eBiosciences) for an additional 30’. For inhibition assay with anti-CD277 antibodies, either 20.1 or 103.2 (kind gift of Daniel Olive, Marseille, France), Daudi cells were pre-incubated with the antibodies at R.T. for 15’ before the sTCR-YG-beads were added. The mixtures were fixed by adding 40 mΐ 2% formaldehyde for 15’. Samples were washed once with 1% formaldehyde and analyzed on a BD FACSCanto II (BD).

gόT C R enrichment to synapse and conjugate formation

HEK293FT cells were seeded in m-slide poly-F-lysine pre coated chamber (Ibidi) to adhere overnight. Next day cells were treated with 100mM PAM for one hour at 37°C. TEGs were added onto HEK293FT cells and incubated at 37°C for 30-120 minutes. After co-incubation chambers were immediately placed onto ice and fixed with 4% PFA for 30 minutes. Samples were blocked with 1% BSA/FCS and labeled with CD3e-Alexa Fluor 647 (BD Biosciences) at 2pg/mL for two hours at room temperature, and finally fixed with 1% PFA+DAPI. Samples were imaged with Zeiss FSM-710 and analyzed with Volocity software (PerkinElmer). In order to quantify the number of conjugates between HEK293FT and TEG cells we calculated the ratio between CD3e positive objects and DAPI positive objects on each image taken. To analyse gamma delta TCR enrichment into the immunological synapse, we calculated the ratio of CD3e signal enrichment inside the contact area versus outside of contact area of the target and effector cell on 63x magnified images.

Super-resolution imaging

HEK293FT cells were plated in eight-well Fab-Tek chambers to adhere and treated with lOOuM pamidronate overnight. For super-resolution imaging, cells were labeled with AF647-CD277 at RT. After labeling, cells were washed with PBS and fixed with 4% PFA and 0.2% gluteraldehyde for 1-2 h. Prior to super-resolution imaging, 200 mR of fresh SRB (Super-resolution buffer: 50 mM Tris, 10 mM NaCl, 10% glucose, 168.8 U/mF glucose oxidase, 1404 U/mF catalase, 10 mM cysteamine hydrochloride, pH 8.0) was added to the well. dSTORM imaging was performed using an inverted microscope (1X71; Olympus America) equipped with an oil-immersion objective 1.45-NA total internal reflection fluorescence objective (U-APO l50x; Olympus America). A 637-nm diode laser (HF63133DG; Thorlabs) was used for AF647 excitation. A quad-band dichroic and emission filter set (LF405/488/561/635-A; Semrock) was used for sample illumination and emission. Emission light was separated onto different quadrants of an Andorlxon 897 electron-multiplying charge-coupled device (EM CCD) camera (Andor Technologies, South Windsor, CT), using a custom built 2-channel splitter with a 585 nm dichroic (Semrock) and additional emission filters (692/40 nm and 600/37). The sample chamber of the inverted microscope (1X71; Olympus America, Center Valley, PA) was mounted in a three-dimensional piezostage (Nano-LPS; Mad City Labs, Madison, WI) with a resolution along the xyz-axes of 0.2 nm. Sample drift was corrected for throughout the imaging procedure using a custom-built stage stabilization routine. Images were acquired at 57 frames/s in TIRF and between 10,000-20,000 frames were collected for each image reconstruction.

Super-resolution image reconstruction and data analysis

dSTORM images were analyzed and reconstructed with custom-built MATLAB functions as described previously (Smith et al 2010, Nat Methods: Huang et al 2011, Biomed Opt Express). For each image frame, subregions were selected based on local maximum intensity. Each subregion was then fitted to a pixelated Gaussian intensity distribution using a maximum likelihood estimator. Fitted results were rejected based on log- likelihood ratio and the fit precision, which was estimated using the Cramer-Rao lower bound values for each parameter, as well as intensity and background cut-offs. Analysis of dSTORM CD277 cluster data was performed using the density-based DBSCAN algorithm as part of a package of local clustering tools (http://stmc.health.unm.edu). Parameters chosen were a maximal distance between neighboring cluster points of epsilon = 50 nm and a minimal cluster size of 6 observations. Cluster boundaries were produced with the MATLAB "boundary" function, using a default methodology that produced contours halfway between a convex huh and a maximally compact surface enclosing the points. The cluster areas within these boundaries were then converted into the radii of circles of equivalent area for a more intuitive interpretation. Regions of interest (ROIs) of size 2 pm x 2 pm were selected from the set of images from which statistics for the equivalent radii were collected per ROI.

Example 11: Functional profiling of g9d2T cells

In order to assess on a broader range the impact of individual y962TCR on the functional activity of individual g92dT cell clones gd T cell clones were isolated by limiting dilution or FACS sorting. In vitro antitumor activity was determined by IFNy production against the tumor cell line Daudi. Substantial antitumor functional heterogeneity was observed among the g9d2T cell clones (N=57) isolated from 4 healthy donors, with approximately 60% of the clones being reactive to the tumor cell line Daudi (FIG.13 A), when choosing a cut-off of 30 pg/ml for reliable measurement of IFNy concentration. Bisphopshonates such as pamidronate (PAM) can enhance activity of g9d2T cells through induction of CD277J, facilitated by RhoB and sensed by the y902TCR. In the presence of 100 mM PAM the reactivity of investigated g9d2T cell clones was on average lO-fold enhanced (range 0,7 - 37,3; median 8,1) with >95% of the clones showing reactivity above the threshold when PAM was added (FIG. 13A). In order to assess whether activity profiles where exclusively observed for Daudi cells or also valid for other targets, the cell line HEK293FT, an additional well-characterized gdT cell target, was co-incubated with the isolated gdT cell clones. HEK293FT cell line elicited much lower cytokine secretion in the absence of PAM with only approximately 30% of g9d2T cell clones secreting IFNy above cut-off (FIG.13B). However, in the presence of PAM the reactivity of individual clones was comparable to their reactivity to Daudi, as evidenced by a strong correlation of IFNy secretion when the very same clone was tested either against Daudi or HEK293FT (Spearman’s r=0,893, pO.OOOl (n=54), FIG.13B and FIG.13C). Table 4: CDR3 Clones

Table 5: full length of the sequences of the control chains referred herein

Example 12: Clonal Frequency of g9d2T cells

To further study the role of the y952TCR in the in vitro antitumor activity of individual g9d2T cell clones 20 out of 57 clones for y952TCR sequencing were chosen, these clones covered the full range of clonal activities as depicted in FIG. 13A. Several clone pairs (B2 and B5, C4 and Cl 4, C7 and Cl 1) were found to express the same TCR, ending with a total of 17 unique clonotypes. Among the individual clonotypes all d chains were unique, whereas there existed some overlap in the g chain in terms of CDR3 region sequence, both within and between donors (FIG. 14A).

High throughput sequencing (HTS) of the complete y902TCR repertoire of the same donors as used for single cell sorting was performed. Prevalence of a certain clonotype within the repertoire of a donor did not correlate with functional activity of the respective clone against Daudi or HEK293FT, as demonstrated on the example of the donor C: most prevalent clone C6 belonged to one of the most reactive g9d2T cell clones isolated from this donor, while three other prevalent clonotypes (C2, C4, Cl 1) showed reactivity in the lower range (FIG. 14B), though we cannot exclude that the depicted d chain, if combined with other g chains, shows higher activity. Vice versa, very active g9d2T cell clones from donor A were not prevalent in the original donor. Therefore, clonal frequency did not correlate with functional activity of the individual g9d2T cells.

Example 13: Functional activity of parental g9d2T cells

A selection of sequenced g and d TCR genes were synthetized, cloned into the retroviral pBullet vector and expressed in primary abT cells, allowing analysis of individual ydTCRs in the absence of other co-receptors of gdT cells. First, it was assessed whether variations within the CDR3 region impact TCR surface expression (FIG. 14A). As demonstrated in FIG. 14B, all generated TEGs expressed similar levels of ydTCRs as exemplified by the TCRs clone Al to A6 and in clone 13 (013), Gl 15, clone 3 (03) and clone 5 (05). As demonstrated in FIG. 14C, substantial differences in activity could be observed between TEGs engineered with weak TCRs such as the artificially designed CTE-C13 and strong TCRs such as CTE-C15. Similarly, y902TCRs from the natural repertoire differed substantially in their ability to induce IFNy secretion in the TEG format. However, functional activity did not correlate with the functional activity of the parental clone, as demonstrated by a highly reactive clone A4, A5 and 013 whose TCR was poorly activating in the TEG format (FIG. 14C), suggesting that other factors such as additional co-receptors or epigenetic regulations contribute to the functional response of a g9d2 T cell clone. Example 14: y962TCR target interaction

Tetramers and dextramers were engineered that comprised g9 and 52TCR chains of gόT C R clone 5 and the non- functional length mutant LM1. In line with the low affinity interactions of y952TCR with its ligand which are used to sense CD277J-configuration, neither y952TCR tetramers nor dextramers did bind to the classical target Daudi (FIG. 15A and FIG. 15B). Next, the number of ydTCRs on a multimer was increased in order to reach a higher interaction avidity. The extracellular domains of the non- functional length mutant LM1, as well as ydTCRs CTE-C13 and CTE-C15, which mediate low and high functional avidity in the TEG format, were coupled to streptavidin conjugated Yellow- Green fluorescent beads (referred herein as YG-beads), which allowed at least 10 ⁴ ydTCR to be attached to the surface of a YG-bead. YG-beads expressing the y952TCRs were used to stain the known negative target cell line ML1, and the positive target cell line Daudi. No YG-bead conjugation to ML1 cells could be observed in case of any of the TCR-coated beads (FIG. 18C-FIG. 18D), whereas the amount of YG-bead conjugation to Daudi cells was dependent on the TCR used for coating the beads (FIG.15C and FIG. 18D). The non- functional y952TCR, LM1, showed little conjugation to Daudi cells (FIG 18D). The high functional avidity y952TCR, CTE-C15, showed markedly higher conjugation to Daudi cells, indicating that the functional avidity of y952TCRs is indeed linked to the y952TCR- ligand affinity. Interestingly YG-beads did bind only to a fraction of tumor cells (FIG19), most likely rather reflecting technical limitations of bead to cell ratios than the heterogeneity of the ligand within the target population itself. The y902TCR senses CD277J-configuration.

The binding of CTE-C15 YG-beads to Daudi cells allowed the assessment of whether CD277J is directly interacting with the y952TCR. CTE-C15 YG-beads were co-incubated with Daudi cells in the presence of two commonly used monoclonal antibodies against CD277, namely 20.1 and 103.2. The conjugation of CTE-C15 YG-beads with Daudi was inhibited by both monoclonal antibodies, indicating that CD277 is directly interacting with Vy9V02 TCRs (FIG. 15D). It was also determined whether static YG-beads can also sense CD277J induced by PAM. Adding PAM did not change intensity of TCR-YG-bead conjugation to Daudi cells (FIG. 15C), indicating that static TCR-YG-beads can capture different affinities of y952TCRs to CD277 but not fully mimic the mode of action of a y902TCR expressed within a cell membrane. Example 15: Dynamic interaction of a y962TCR with its counterpart

To further assess whether distinct functional avidity of y952TCRs when expressed in the TEG format is regulated by their ability to mediate binding of TEGs to tumor cell targets a more dynamic model was utilized. Therefore, Jurma cells expressing comparable levels of various ydTCRs were co-incubated with HEK293FT tumor cells. Utilizing the adherent HEK293FT cells enabled discarding of TEGs not bound to tumor cells within 120 minutes after incubation by washing and was followed by staining with DAPI and anti- CD3 antibodies. The number of tumor cell-T cell conjugates was assessed. In contrast to YG-bead staining, not only the conjugate formation correlated with affinity of the used y902TCR in the absence of PAM, but PAM treatment also increased the number of conjugates, in particular in the case of the low affinity y952TCR as well as surprisingly also in the case of the non- functional mutant LM1. (FIG.16). This finding suggests that physical binding of a distinct y952TCR to a defined protein expressed on tumor cells facilitates consecutive conjugate formation between a T cell expressing a y952TCR and the tumor cell. However, the conjugate formation can be independent of the CDR3 regions of the y952TCR.Thus, PAM can induce a y952TCR dependent but CDR3 independent conjugate formation, which is however not sufficient to fully activate a T cell. Additional steps must be involved in inducing full T cell activation.

An additional step reported to be essential for activation of T cells expressing a y952TCR can be the CD277J-configuration at the cell membrane of the tumor cell. In order to investigate whether CD277J also associates with an increased clustering of y952TCR at the T cell side and whether such processes depend on the CDR3 region of the y952TCR, spatial changes in the plasma membrane in the context of distinct ydTCR affinities was analyzed. Confocal imaging of the late immunological synapses formed between Jurma T cells engineered to express non- functional TCR LM1, low affinity CTE-C13 and high affinity CTE-C15 was determined. The amount of ydTCRs that accumulated to the contact area between tumor targets and T cells, relative to T cell membrane areas distant from the immunological synapse is shown in FIG. 17A and FIG. 17B. Synapse enrichment of the ydTCR was significantly higher for CTE-C15 when compared to CTE-C13 and LM1 TCRs towards PAM-untreated tumor cells (at low phosphoantigen levels) (FIG. 17B). Even though T cells expressing a non-active TCR LM1 showed significant tumor cell binding (FIG. 16), LM1 TCR did not recruit to the immunological synapse even at high phosphoantigen levels when tumor cells were pre-treated with PAM (FIG. 17B). Neither did PAM pre-treatment affect the recruitment of the high affinity CTE-C15 TCR to the immune synapse. However, it significantly increased accumulation of the low affinity of CTE-C13 TCR in the synapse, suggesting that CDR3 region of the y902TCR has no impact on creating close vicinity between tumor cells and T cells, while it is instrumental for supporting recruitment of the y902TCR with lower affinities to the synapse. This finding implies that the affinity of the y902TCR dictates its recruitment to the

immunological synapse and that complete synapse formation can be further enhanced by PAM.

Finally, in order to understand whether the enhanced recruitment of low affinity CTE-C13 TCR in the synapse was a result of changes in CD277 clustering due to the PAM treatment, direct stochastic optical reconstruction microscopy (dSTORM), a localization- based super-resolution imaging technique that provides ~20 nm resolution was performed. BTN3A molecules were labelled with AF647-CD277 antibody and super resolution images were acquired at the basal membrane of HEK293FT cells. To quantify the images, a density-based spatial clustering application (DBSCAN) was utilized.

DBSCAN classifies localizations into clusters based on their relative local spatial density. Individual clusters were identified and comparisons between the distributions of clusters across different conditions were made. Treatment with PAM did not dramatically change localization cluster size, density or number (FIG. 17C, FIG. 17D, FIG. 17E, and FIG. 17F). Results were similar when using either Getis-G or Hierarchal cluster analysis methods. Choosing maximal distance between neighboring cluster points to an epsilon of 30, 40 or 50 nm gave similar BTN3A nano-clustering results.

Example 16: reactivity and potency ofy952 TEG-A1, -A3, -A6 and -C13 compared to g9d2 TEG-C15

Generation ofy96' 2 TEG-A1, -A3, -A6, -C13 and -Cl5 TEG cell cultures

g9d2 TEG-A1, -A3, -A6, -C13 and -C15 TEG cell cultures were obtained in a production process which starts with fresh or cryopreserved a.pTCR positive cells, followed by activation of T cells with anti-CD3/CD28 activation reagent TransAct (Miltenyi Biotec 130-111-160; diluted 1 : 100). Lentiviral transduction (using a pLenti-6.3 vector) is performed at day 1 (24hr) after activation of the cells and at day 2 the culture is transferred to fresh culture medium for the expansion phase. Culture medium refreshment is performed at day 5, 7 and 9 and at day 12 the culture is terminated. The complete process is performed using TexMACS medium supplemented with 50 IU - 50 pg/mL Penicillin-Streptomycin (PS) and the cytokines human IL-7 (1700 U/mL), human IL-15 (150 U/mL), and 2.5% heat inactivated human serum. TEGs expressing the gd T cell receptor (TCR) of interest are thawed 4 days prior to the functional assays (such as xCELLigence and ELISA assays) and cultured at 37°C in 5% C0 ₂ incubator in the same medium used for their production. One day before the functional assays, TEGs are phenotyped by flow cytometry (abTOE ydTCR, CD4, and CD8) to determine the percentage of transduction efficiency and the CD4/CD8 subpopulations.

Target cell lines

In order to analyze the reactivity and potency of g9d2 TEG-A1, -A3, -A6, and TEG-C13 (i.e. TEG-Clone 3) in comparison with TEG-C15 (i.e. TEG-Clone 5) a plethora of tumor and healthy cell lines are used as target cells in the functional assays.

In particular, the following cell lines are used:

Table 6: cell lines used

Cells are cultured at 37°C in 5% C0 ₂ incubator following ATCC/UMCU instructions and used in the functional assays at passage number < 10. xCELLigence cytotoxicity assay

The xCELLigence system (xCELLigence RTCA MP device/e-Plates, ACEA Biosciences) works via the principle of noninvasive electrical impedance monitoring to quantify cell proliferation, morphology change, and attachment quality in a label-free and real-time manner. It is a valid method to quantify the killing of adherent cells by TEGs. One day before the experiment, target cells are plated and grown overnight in 96 wells xCELLigence plate (E-Plate 96 PET) at 37°C in a 5% C02 incubator. The day after, TEG cells are added to the target cells at Effector/Target ratio 1 :l. As a positive control of complete cytolysis, medium containing a final 0.5% Triton-X-lOO is added to several wells of target cells. Co culture is then run in the presence or absence of IOmM Pamidronate, in the presence or absence of CD277 blocking antibody 103.2 (2 pg/mL), and in the presence or absence of CD277 activating antibody 20.1 (1 pg/mL) for 24-48-72 hours. At the end of the assay, supernatants are collected to measure IFN-g production and TEG-specific cytolysis of target cells is calculated relative to the complete cytolysis (100%) measured in the Triton- X- lOO-treated wells. !FN-y ELISA

The ELISA assay is used to quantify IFN-g secretion by the TEGs as a readout of their reactivity towards target cells. Briefly, supernatants from TEG/target tumor cell co-cultures are harvested after 24-48-72 hours and IFN-g secretion is measured using the Human IFN- gamma DuoSet ELISA kit (R&D, cat. Nr. DY285B), according to the manufacturer instructions. Briefly, a 96 wells plate is coated overnight with a capture antibody (R&D systems DY285B, partnummer 844586). After washing, the empty spots in the wells are blocked by a 1% BSA solution. This blocking step is followed by another washing step. Hereafter, the supernatants of the co-cultures and a detection antibody (R&D systems DY285B, partnummer 844587) are added to the well for 2 hours. The supernatants of the co-cultures can be added in various dilutions to stay within the detection limits of the assay as understood by the skilled person. Also, standard samples are added to the plate to generate a standard curve later. Hereafter, another washing step is performed followed by incubation with streptavidin- horseradish peroxidase for 30 minutes. After a final washing step, TMB substrate is added for 5 minutes and a stop solution is added to stop the enzymatic reaction. OD values are measured at 450nm. The standard curve is used to calculate the IFN-g concentration for each sample.

Results

The ability of TEG-A1 and TEG- A3 to lyse target cells was assessed by a xCELLIgence assay (FIG. 20-22). Target cells included MZ1851RC MCF-12F, Caki-2, MDA-MB-231, SK-CO-l, and HT-29. In general, TEG-A1 (FIG. 20A-F) behaves like the positive control, i.e. TEG-C15 (also referred to as TEG-Clone 5). For the renal cancer cell line MZ1851RC there is low killing of target cells without PAM but a high percentage of cell lysis with PAM. TEG-A1 does not kill the healthy cell line control MCF-12F. For kidney cancer cell line Caki-2 using 10mM PAM, TEG-A1 shows the same killing efficiency as TEG-C15 using 10mM PAM. However, when using the CD277 activating antibody 20.1 or the CD277 blocking antibody, less target cells are killed by TEG-A1 compared to TEG-C15. For the breast cancer cell line MDA-MB-231 and the colorectal carcinoma cell lines SK-CO-l and HT-29 Al shows the same killing levels as TEG-C15. IFN-g production was assessed after

72 hours of co-culturing and in general comparable levels of IFN-g are produced for TEG- Al and TEG-C15 (Fig. 23A-F). However, for colorectal cancer cell lines SK-CO-l and HT- 29 TEG-C15 produces more IFN-g in the presence of anti-CD277 activating antibody 20.3. For all cancer cell lines, but not for the healthy cell line (MCF-12F), similar levels of killing cells were observed for TEG- A3 and TEG-C15 in the conditions without PAM and with 10 mM PAM. However, adding the CD277 activating antibody 20.1 to the 10 mM PAM condition gives higher percentages of cell lysis for TEG-A3 in the Caki-2 and the MDA- MB0231 cell lines (FIG. 21A-F). This difference is not reflected in the IFN-g levels produced by TEG-A3 and Teg-Cl5 (FIG. 24A-F).

In a co-culture with Daudi cells and 10 mM pamidronate (PAM), TEG-A1 shows after 24 hours an IFN-g production at a higher level than untransduced cells, but at a lower level than the positive control TEG-C15 (Fig. 25A). In a co-culture with Daudi cells and 10mM pamidronate (PAM), TEG-A6 shows after 24 hours an INF-g production at a similar level as the positive control TEG-C15 and at a much higher level than untransduced cells (Fig. 25B).