PROFILING

RELATED APPLICATIONS

[01] This application claims the benefit of provisional application USSN 62/556,725, filed September 11, 2017 and USSN 62/564,382, filed September 28, 2017, the contents of each of which are herein incorporated by reference in their entirety.

INCORPORATION OF SEQUENCE LISTING

[02] The contents of the text file named "DNWR-002 00 lWO_SeqList.txt," which was created on September 11, 2018 and is 46.3 KB in size, are hereby incorporated by reference in their entirety.

FIELD OF THE DISCLOSURE

[03] The disclosure provides compositions and methods for the selection of specific biomolecule sensors and detection of many small specific biomolecules in complex biological fluids.

BACKGROUND

[04] Understanding the composition of biological fluids in terms of constituent molecules is essential for many modern applications. For example, the variability of metabolite levels present in biological fluids can indicate profound states of health in humans. The present molecular diagnostics market is currently poorly served by existing small molecule detection technology, which utilizes instrumentation that is too expensive for personal use and technology with detection capabilities that are too slow and limited for point-of-care applicability. The present disclosure provides compositions and methods for the selection of specific biomolecule sensors and detection of many small specific biomolecules, which provides a solution to the unmet need in the art for an inexpensive method to identify and quantify the full range of metabolites and other specific biomolecules in any given biological fluid. SUMMARY

[05] The disclosure provides compositions and methods for the selection of specific biomolecule sensors and detection of many small specific biomolecules in complex biological solutions. The compositions and methods allow for the identification of a host of nucleic acid biosensors (NABs), identification of their cognate specific biomolecules, previously either known or unknown, and the arraying or multiplexing of several or many thousands of NABs to simultaneously detect and quantify many specific biomolecules within an analyte composition. In the disclosure, a plurality of analytes are free in solution, not affixed to a solid support prior to contact.

[06] The disclosure provides a composition comprising a plurality of inactive nucleic acid biosensors (NABs), wherein each of the plurality of NABs comprises: (a) at least one variable region, wherein the variable region comprises at least one biomolecule binding domain and (b) at least one constant region, wherein the plurality of inactive NABs, (c) recognizes two or more distinct biomolecules; (d) recognizes two or more distinct sites on at least one biomolecule; (f) positively selects at least one biomolecule and negatively selects at least one biomolecule; or (g) recognizes at least one specific biomolecule with high affinity at a low concentration and the same specific biomolecule with a relatively lower affinity at a relatively higher concentration.

[07] The disclosure provides a composition comprising a plurality of inactive nucleic acid biosensors (NABs), wherein each of the plurality of NABs comprises: (a) at least one variable region, which comprises at least one biomolecule binding domain (b) at least one constant region, or (c) at least one alternating pair of a variable region and a constant region, wherein the variable region comprises at least one biomolecule binding domain, wherein the plurality of inactive NABs, (d) recognizes two or more distinct biomolecules; (e) recognizes two or more distinct sites on at least one biomolecule; (f) positively selects at least one biomolecule and negatively selects at least one biomolecule; or (g) recognizes at least one specific biomolecule with high affinity at a low concentration and the same specific biomolecule with a relatively lower affinity at a relatively higher concentration. In certain embodiments, the at least one constant region comprises at least one reporter construct.

[08] The disclosure provides a composition comprising a plurality of inactive nucleic acid biosensors (NABs), wherein each of the plurality of NABs comprises: (a) at least one variable region, which comprises at least one biomolecule binding domain (b) at least one constant region, wherein the constant region comprises at least one reporter construct, or (c) at least one alternating pair of a variable region and a constant region, wherein the variable region comprises at least one biomolecule binding domain and wherein the constant region comprises at least one reporter construct, wherein the plurality of inactive NABs, (d) recognizes two or more distinct biomolecules; (e) recognizes two or more distinct sites on at least one biomolecule; (f) positively selects at least one biomolecule and negatively selects at least one biomolecule; or (g) recognizes at least one specific biomolecule with high affinity at a low concentration and the same specific biomolecule with a relatively lower affinity at a relatively higher concentration.

[09] In certain embodiments of the compositions of the disclosure, including those wherein each of the plurality of NABs comprises at least one alternating pair of a variable region and a constant region, the at least one alternating pair comprising the variable region and the constant region of (a) comprises a secondary structure. In certain embodiments, the at least one alternating pair comprising the variable region and the constant region of (a) comprises a tertiary structure. In certain embodiments, the at least one alternating pair comprising the variable region and the constant region of (a) comprises a quaternary structure. In certain embodiments, the at least one alternating pair comprising the variable region and the constant region of (a) comprises a stem-loop structure. In certain embodiments, the stem-loop structure comprises two stems. In certain embodiments, including those wherein the the stem-loop structure comprises two stems, the stem-loop structure comprises a nucleotide sequence comprising

ACTGNNNNATACNNNNNNNGTATNNNNCAGT (SEQ ID NO: 159). In certain

embodiments, the stem-loop structure comprises three stems. In certain embodiments, the at least one alternating pair comprising the variable region and the constant region of (a) forms a quadraplex structure. In certain embodiments, the quadraplex structure is a G-quadraplex. In certain embodiments, the G-quadraplex comprises a nucleotide sequence comprising

NNNGGNNNGGNNNGGNNNGGNNN (SEQ ID NO: 160).

[010] In certain embodiments of the compositions of the disclosure, the constant region comprises a reporter construct. In certain embodiments, the constant region or the reporter construct comprises one or more of an affinity reagent, a ligand-binding region, an enzymatic domain and an attachment to another molecule. In certain embodiments, the variable domain and/or the constant domain further comprises an affinity reagent. In certain embodiments, the affinity reagent comprises a receptor, an antibody, a peptide, a deoxyribonucleic acid, a ribonucleic acid, a small molecule or a combination thereof. In certain embodiments of the compositions of the disclosure, the enzymatic domain cleaves an RNA sequence or a DNA sequence of the NAB. In certain embodiments of the compositions of the disclosure, the enzymatic domain cleaves an RNA sequence or a DNA sequence in the at least one variable region or the at least one constant region of the NAB. In certain embodiments of the

compositions of the disclosure, the enzymatic domain cleaves an RNA sequence or a DNA sequence in the at least one alternative pair comprising the variable region and the constant region of the NAB. In certain embodiments, the enzymatic domain cleaves an RNA, wherein the enzymatic domain comprises a ribozyme. In certain embodiments, the ribozyme is self-cleaving. In certain embodiments, the self-cleaving ribozyme comprises a Hammerhead ribozyme (HHR) or a riboswitch. In certain embodiments, the enzymatic domain cleaves a DNA sequence, wherein the enzymatic domain comprises a deoxyribozyme. In certain embodiments, the deoxyribozyme is self-cleaving.

[Oil] In certain embodiments of the compositions of the disclosure, activation of the enzymatic domain results in cleaving of the RNA sequence or the DNA sequence of the NAB. In certain embodiments, the variable region or the constant region comprises a double-stranded DNA (dsDNA) sequence and the dsDNA comprises a target site for a restriction endonuclease. In certain embodiments, the enzymatic domain cleaves a DNA sequence and wherein the enzymatic domain comprises an endonuclease. In certain embodiments, the endonuclease is a restriction endonuclease. In certain embodiments, restriction at the dsDNA target site results in cleaving of the variable region from the constant region or vice versa. In certain embodiments, restriction at the nucleic acid target site results in cleaving within the constant region. In certain embodiments, restriction at the nucleic acid target site results in cleaving within the variable region.

[012] In certain embodiments of the compositions of the disclosure, each NAB of the plurality of inactive NABs further comprises one or more attachment sites for operably-linking to a surface. In certain embodiments, the surface comprises a liquid surface, a solid surface, a biological surface or a combination thereof. In certain embodiments, the solid surface comprises a solid support, a solid-phase substrate, a bead, a polymer, a composite, a carbon composite, a plastic, a glass, a substantially planar surface, a lateral-flow strip, a multiplexed array, or a combination thereof. [013] In certain embodiments of the compositions of the disclosure, the liquid surface comprises a droplet. In certain embodiments, the droplet is formulated for flowing through a microfluidic channel. In certain embodiments, the droplet comprises one or more reagents to facilitate contact with the contents of a second droplet, producing a product droplet. In certain embodiments, the contents of a second droplet comprise an analyte composition.

[014] In certain embodiments of the compositions of the disclosure, the surface comprises a liquid surface and a solid surface. In certain embodiments, the surface comprises a liquid droplet comprising a solid substrate. In certain embodiments, the droplet is formulated for flowing through a microfluidic channel. In certain embodiments, the droplet comprises one or more reagents to facilitate contact with the contents of a second droplet or the contents thereof, producing a product droplet. In certain embodiments, the second droplet comprise an analyte composition.

[015] In certain embodiments of the compositions of the disclosure, the droplet comprises a liquid volume and a solid surface. In certain embodiments, the surface comprises a liquid droplet containing a solid substrate. In certain embodiments, the droplet is formulated for flowing through a microfluidic channel. In certain embodiments, the droplet comprises one or more reagents to facilitate contact with the contents of a second droplet or the contents thereof, producing a product droplet. In certain embodiments, the second droplet comprise an analyte composition.

[016] In certain embodiments of the compositions of the disclosure, a droplet is solely liquid phase. In certain embodiments, the droplet comprises a solid-phase substrate. In certain embodiments, the droplet is formulated for flowing through a microfluidic channel. In certain embodiments, the droplet comprises one or more reagents to facilitate contact with the contents of a second droplet or the contents thereof, producing a product droplet. In certain embodiments, the second droplet comprise an analyte composition.

[017] In certain embodiments of the compositions of the disclosure, the biological surface comprises a cell surface or a cell membrane surface. In certain embodiments, the biological surface is isolated from a cell or derived from a cell.

[018] In certain embodiments of the compositions of the disclosure, the biological surface is synthetic. In certain embodiments, the biological surface recapitulates one or more components of a transcriptome, secretome, proteome, microenvironment, stem cell, differentiated cell, tissue or system. In certain embodiments, the biological surface is comprised on a microchip.

[019] In certain embodiments of the compositions of the disclosure, the surface further comprises a selection-ligand. In certain embodiments, the selection ligand binds to an affinity reagent, a ligand binding region, or a combination thereof, within the constant region. In certain embodiments, the selection ligand binds to an affinity reagent and/or a ligand binding region within the variable region.

[020] In certain embodiments of the compositions of the disclosure, at least one NAB of the plurality of inactive NABs further comprises a biomolecule bound to at least one biomolecule binding domain, thereby producing at least one activated NAB. In certain embodiments, a portion of the plurality of inactive NABs further comprise a biomolecule bound to at least one biomolecule binding domain, thereby producing a plurality of activated NABs. In certain embodiments, the portion of the plurality of inactive NABs further comprising a biomolecule (the portion comprising active NABs) is at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between, of the plurality of inactive NABs. In certain embodiments, the portion of the plurality of inactive NABs further comprising a biomolecule bound to at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or any percentage in between, of all biomolecule binding domains. In certain embodiments, each of the plurality of inactive NABs further comprise a biomolecule bound to at least one biomolecule binding domain, thereby producing a plurality of activated NABs.

[021] In certain embodiments of the compositions of the disclosure, binding of a biomolecule to the at least one biomolecule binding domain induces a conformational change in each activated NAB of the plurality of activated NABs.

[022] In certain embodiments of the compositions of the disclosure, the conformational change increases an affinity of the ligand binding region for a selection ligand. This embodiment is referred to as the "induced affinity" mode.

[023] In certain embodiments of the compositions of the disclosure, the conformational change induces an activity of the enzymatic domain, releasing the activated NAB from a surface. This embodiment is referred to as the "induced activity" mode. In certain embodiments, the activity of the enzymatic domain is self-cleavage. In certain embodiments, the activity of the enzymatic domain cleaves a dsDNA of variable region or a constant region.

[024] In certain embodiments of the compositions of the disclosure, the variable region or the constant region further comprises a reporter construct. In certain embodiments, the reporter construct comprises a fluorophore or a chromophore. In certain embodiments, the reporter construct modifies a fluorophore or a chromophore. In certain embodiments, the active reporter construct enhances the fluorescence of a chromophore or fluorophore. In certain embodiments, the chromophore or fluorophore comprises Malachite Green, (5Z)-5-[(3,5-Difluoro-4- hydroxyphenyl)methylene]-3,5-dihydro-2,3-dimethyl- 4H-Imidazol-4-one, (Z)-4-(3,5-Difluoro- 4-hydroxybenzylidene)-l,2-dimethyl-lH-imidazol-5(4H)-one (DFHBI), or Spinach Aptamer bound to DFHBI. In certain embodiments, the chromophore comprises a conjugated pi-bond system or a metal complex.

[025] In certain embodiments of the compositions of the disclosure, the variable region or the constant region further comprises a quencher construct. In certain embodiments, an inactivated NAB comprises a reporter construct and a quencher construct positioned such that the quencher construct suppresses a signal of the reporter construct. In certain embodiments, an activated NAB comprises a reporter construct and a quencher construct positioned such that the quencher construct cannot suppress a signal of the reporter construct, thereby producing a detectable signal from the reporter construct of the activated NAB. In certain embodiments, the reporter construct and the quencher construct are separate molecules.

[026] In certain embodiments of the compositions of the disclosure, each inactive or active NAB of a plurality of NABs further comprises a second variable region, wherein the second variable region comprises a biomolecule binding domain and wherein the constant region is positioned between a first variable region and the second variable region. This embodiment is referred to as "hybrid disruption." In certain embodiments, the second variable region further comprises an attachment site for operably-linking to a surface. In certain embodiments, one or more of the first variable region, the constant region and the second variable region comprises a reporter construct. In certain embodiments, the constant region comprises a reporter construct. In certain embodiments, the reporter construct comprises two or more separate domains. In certain embodiments, the reporter construct comprises a fluorophore, chromophore, a quencher, a chromophore-binding domain, or a combination thereof [027] In certain embodiments of the compositions of the disclosure, the constant region of each inactive NAB comprises a first hybridization sequence having sufficient complementarity to a sequence in the constant region of a second nucleic acid to form a relatively stable hybrid. In certain embodiments, the second nucleic acid comprises a constant region. In certain

embodiments, the constant region comprises a second hybridization sequence having at least sufficient complementarity to a sequence in the constant region of each NAB of the plurality of inactive NABs to form a relatively stable hybrid. In certain embodiments, sufficient

complementarity to form a relatively stable hybrid is at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of complementarity. In certain embodiments, sufficient complementarity to form a relatively stable hybrid is 100% complementarity. In certain embodiments, a relatively stable hybrid is stable at temperatures between ambient room temperature and body temperature, or from between about 23 °C and about 37°C, inclusive of the endpoints. In certain embodiments, each inactive NAB of a plurality of NABs hybridizes to the second nucleic acid through formation of a double-stranded region comprising the first hybridization sequence and the second hybridization sequence. In certain embodiments, the constant region of the second nucleic acid further comprises an attachment site for operably-linking to a surface. In certain embodiments, the constant region of the second nucleic acid further comprises a quencher construct. In certain embodiments, the quencher construct suppresses a signal from the reporter construct of the inactive NAB.

[028] In certain embodiments of the compositions of the disclosure, the second variable region further comprises a linker. In certain embodiments, the linker comprises a flexible linker, a rigid linker, or a cleavable linker. In certain embodiments, the linker comprises a biological or synthetic polymer. In certain embodiments, the linker comprises a DNA, RNA, poly ethylene glycol (PEG), peptide chain, amino acid or any combination thereof.

[029] In certain embodiments of the compositions of the disclosure, the inactivated NAB further comprises a biomolecule bound to the first biomolecule binding domain and/or the second biomolecule binding domain, thereby generating an activated NAB. In certain

embodiments, binding of the biomolecule to the first biomolecule binding domain and/or the second biomolecule binding domain induces a conformational change in each activated NAB of the plurality of activated NABs. In certain embodiments, the conformational change disrupts hybridization of the double-stranded region comprising the first hybridization sequence and the second hybridization sequence. In certain embodiments, the conformational change introduces a hairpin structure into the constant region of each active NAB. In certain embodiments, the binding of the biomolecule to the first biomolecule binding domain and/or the second biomolecule binding domain separates the reporter construct of the active NAB from the quencher construct of the second nucleic acid, thereby releasing a detectable signal from the reporter construct.

[030] In certain embodiments of the compositions of the disclosure, binding of a biomolecule to a biomolecule binding domain induces a conformational change in the variable domain and wherein the conformational change produces a binding site for a ligand. In certain embodiments, the ligand comprises an attachment site for a surface. In certain embodiments, the ligand is operably-linked to the surface.

[031] In certain embodiments of the compositions of the disclosure, each inactive NAB or each active NAB of the plurality of NAB s comprises a DNA sequence, an RNA sequence, an XNA sequence, a peptide sequence, or a hybrid molecule. In certain embodiments, the DNA sequence comprises a L-DNA. In certain embodiments, the RNA sequence comprises a 2'-NH2-RNA, a L-RNA or a 2'F-RNA.

[032] In certain embodiments of the compositions of the disclosure, the biomolecule comprises a small molecule. In certain embodiments, the small molecule comprises a primary metabolite, a central metabolite, a secondary metabolite, an ion, a nucleic acid, or an amino acid. In certain embodiments, the small molecule is equal to or less than 500 kilo Daltons (kDa).

[033] In certain embodiments, the compositions of the disclosure further comprises an analyte composition. In certain embodiments, the analyte composition comprises a plurality of metabolites. In certain embodiments, the plurality of metabolites are not bound to a surface. In certain embodiments, the analyte composition comprises a liquid. In certain embodiments, the analyte composition is derived from a biological fluid or a biological solid. In certain

embodiments, the biological fluid is an unprocessed or a raw biological fluid. In certain embodiments, the biological fluid is a processed biological fluid. In certain embodiments, the processed biological fluid is derived from a biological solid. In certain embodiments, the biological fluid is filtered. In certain embodiments, the filtering comprises size-exclusion chromatography or gel filtration. [034] In certain embodiments of the compositions of the disclosure, the analyte composition further comprises a plurality of reactive small molecules. In certain embodiments, at least one reactive small molecule of the plurality of reactive small molecules modifies one or more of an amine, a thiol, an alcohol, an aldehyde, a ketone, an amino acid, a reducing sugar, a steroid, a carboxylic acid, a carboxamide, a lipid molecule and an organic molecule. In certain

embodiments, a portion of the plurality of reactive small molecules modifies one or more of an amine, a thiol, an alcohol, an aldehyde, a ketone, an amino acid, a reducing sugar, a steroid, a carboxylic acid, a carboxamide and an organic molecule. In certain embodiments, the portion of the plurality of reactive small molecules comprises at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of the plurality of reactive small molecules. In certain embodiments, each reactive small molecule of the plurality of reactive small molecules modifies one or more of an amine, a thiol, an alcohol, an aldehyde, a ketone, an amino acid, a reducing sugar, a steroid, a carboxylic acid, a carboxamide and an organic molecule.

[035] In certain embodiments of the compositions of the disclosure, including those wherein the analyte composition comprises a plurality of reactive small molecules, at least one reactive small molecule of the plurality of reactive small molecules is operably linked to a surface. In certain embodiments, a portion of the plurality of reactive small molecules is operably linked to a surface. In certain embodiments, the portion of the plurality of reactive small molecules comprises at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of the plurality of reactive small molecules. In certain embodiments, each reactive small molecule of the plurality of reactive small molecules is operably linked to a surface.

[036] In certain embodiments of the compositions of the disclosure, at least one inactive or active NAB of the plurality of NABs comprises a first portion of the NAB and a second portion of the NAB. In certain embodiments, the first portion of the NAB and the second portion of the NAB are separate. In certain embodiments, the first portion of the NAB and the second portion of the NAB are connected or reconnected. In certain embodiments, first portion of the NAB and the second portion of the NAB are connected or reconnected by a click chemistry reaction. In certain embodiments, the first portion of the NAB and the second portion of the NAB are connected or reconnected by ligation. [037] In certain embodiments of the compositions of the disclosure, each inactive or active NAB comprises a first portion of the NAB and a second portion of the NAB. In certain embodiments, the first portion of the NAB and the second portion of the NAB are separate. In certain embodiments, the first portion of the NAB and the second portion of the NAB are connected or reconnected. In certain embodiments, first portion of the NAB and the second portion of the NAB are connected or reconnected by a click chemistry reaction. In certain embodiments, the first portion of the NAB and the second portion of the NAB are connected or reconnected by ligation.

[038] In certain embodiments of the compositions of the disclosure, the biological fluid comprises a bodily fluid. In certain embodiments, the bodily fluid comprises urine, blood, whole blood, blood serum, blood plasma, peripheral blood, saliva, tears, breast milk, sebum, semen, cerumen, fecal matter, synovial fluid, lymph fluid, interstitial fluid, sweat, cerebrospinal fluid (CSF), an amniotic fluid, plural effusion or a pericardial effusion.

[039] In certain embodiments of the compositions of the disclosure, the biological fluid comprises a synthetic fluid. In certain embodiments, synthetic fluid comprises a consumer biological. In certain embodiments, the consumer biological comprises a beverage, a food, a cosmetic, a perfume, or a dietary supplement. In certain embodiments, the dietary supplement comprises a vitamin, a multivitamin, a mineral, a metal, a metabolite, an oil or a combination thereof. For dietary supplements, the embodiments comprise those whose sales or marketing is not regulated by any government agency. In certain embodiments, the biological fluid comprises a drug, a prodrug, a drug intermediate, a drug product or a combination thereof. In certain embodiments, the drug product comprises an intermediate metabolite of a pathway induced by a drug. In certain embodiments, the drug product comprises a nucleic acid transcript, a transcript variant, a component of a transcriptome, a protein, a protein complex, a secreted protein, a component of a secretome, a signaling molecule or a combination thereof.

[040] In certain embodiments of the compositions of the disclosure, a first portion of each inactive or active NAB comprises a first portion of the split protein, wherein a second portion of each inactive or active NAB comprises a second portion of a split protein, wherein an inactive NAB or active NAB comprising the first portion of the NAB and the second portion of the NAB comprises an intact protein, and wherein an inactive NAB or active NAB comprising the first portion of the NAB without the second portion of the NAB or the second portion of the NAB without the first portion of the NAB does not comprise an intact protein.

[041] In certain embodiments of the compositions of the disclosure, a first portion of each inactive or active NAB comprises a first portion of the split protein, wherein a second portion of each inactive or active NAB comprises a second portion of a split protein, wherein an inactive NAB or active NAB comprising the first portion of the NAB and the second portion of the NAB comprises an intact protein, and wherein an inactive NAB or active NAB comprising the first portion of the NAB without the second portion of the NAB or the second portion of the NAB without the first portion of the NAB does not comprise an intact protein. In certain embodiments, the intact protein comprises an enzyme, wherein the enzyme is active as an intact protein and wherein the enzyme is inactive as a split protein. In certain embodiments, the intact protein comprises a beta-lactamase, a dihydrofolate reductase (DHFR), a focal adhesion kinase (FAK), a yeast transcription factor, a fluorescent protein, a horseradish peroxidase, a beta-galactosidase (LacZ), a Tobacco etch virus protease (TEV) or a ubiquitin. In certain embodiments, the yeast transcription factor comprises Gal4. In certain embodiments, the fluorescent protein comprises a green fluorescent protein (GFP), an infrared fluorescent protein (IFP1.4), a luciferase, or a recombinase enhanced bimolecular luciferase (ReBiL). In certain embodiments, the split protein may be a single domain such as a split ubiquitin domain, a split ShK toxin domain or a split CCP domain.

[042] In certain embodiments of the compositions of the disclosure, the constant domain comprises a reporter construct. In certain embodiments, the reporter construct comprises a first portion and a second portion. In certain embodiments, the first portion of the reporter construct comprises a first attachment to a first portion of a split protein and the second portion of the reporter construct comprises a second attachment to a second portion of a split protein. In certain embodiments, the intact protein comprises the first portion of the split protein and the second portion of the split protein. In certain embodiments, the intact protein comprises an enzyme, wherein the enzyme is active as an intact protein and wherein the enzyme is inactive as a split protein. In certain embodiments, the intact protein comprises a beta-lactamase, a dihydrofolate reductase (DHFR), a focal adhesion kinase (FAK), a yeast transcription factor, a fluorescent protein, a horseradish peroxidase, a beta-galactosidase (LacZ), a Tobacco etch virus protease (TEV) or a ubiquitin. In certain embodiments, the yeast transcription factor comprises Gal4. In certain embodiments, the fluorescent protein comprises a green fluorescent protein (GFP), an infrared fluorescent protein (IFP1.4), a luciferase, or a recombinase enhanced bimolecular luciferase (ReBiL).

[043] In certain embodiments of the compositions of the disclosure, a first portion of each inactive or active NAB comprises a first portion of a split nucleic acid binding site, wherein a second portion of each inactive or active NAB comprises a second portion of a split nucleic acid binding site, wherein an inactive NAB or active NAB comprising a first portion of the NAB and a second portion of the NAB comprises an intact nucleic acid binding site, and wherein an inactive NAB or active NAB comprising the first portion of the NAB without the second portion of the NAB and the second portion of the NAB without the first portion of the NAB does not comprise an intact nucleic acid binding site.

[044] In certain embodiments of the compositions of the disclosure, a first portion of each inactive or active NAB comprises a first portion of a split nucleic acid binding site, wherein a second portion of each inactive or active NAB comprises a second portion of a split nucleic acid binding site, wherein an inactive NAB or active NAB comprising a first portion of the NAB and a second portion of the NAB comprises an intact nucleic acid binding site, and wherein an inactive NAB or active NAB comprising the first portion of the NAB without the second portion of the NAB and the second portion of the NAB without the first portion of the NAB does not comprise an intact nucleic acid binding site. In certain embodiments, an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition comprises a continuous or contiguous sequence comprising the first portion of a split nucleic acid binding site and the second portion of a split nucleic acid binding site. In certain embodiments, an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition comprises a discontinuous sequence comprising the first portion of a split nucleic acid binding site and the second portion of a split nucleic acid binding site. In certain embodiments, an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition comprises a sequence comprising sufficient identity to a known or functional nucleic acid binding site to retain binding function without 100% identity to the known or functional nucleic acid binding site. [045] In certain embodiments of the compositions of the disclosure, a first portion of the NAB comprises a first portion of a split nucleic acid binding site, a second portion of the NAB comprises a second portion of a split nucleic acid binding site, wherein an active NAB comprises an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition and wherein an inactive NAB does not comprise an intact nucleic acid binding site, the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site being separated. In certain embodiments, an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition comprises a continuous or contiguous sequence comprising the first portion of a split nucleic acid binding site and the second portion of a split nucleic acid binding site. In certain

embodiments, an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition comprises a discontinuous sequence comprising the first portion of a split nucleic acid binding site and the second portion of a split nucleic acid binding site. In certain embodiments, an intact nucleic acid binding site comprising the first portion of a split nucleic acid binding site and second portion of a split nucleic acid binding site in close apposition comprises a sequence comprising sufficient identity to a known or functional nucleic acid binding site to retain binding function without 100% identity to the known or functional nucleic acid binding site.

[046] In certain embodiments of the compositions of the disclosure, a first portion of the NAB comprises a first portion of a split protein binding site, a second portion of the NAB comprises a second portion of a split protein binding site, wherein an active NAB comprises an intact protein binding site comprising the first portion of a split protein binding site and second portion of a split protein binding site in close apposition and wherein an inactive NAB does not comprise an intact protein binding site, the first portion of a split protein binding site and second portion of a split protein binding site being separated. In certain embodiments, an intact protein binding site comprising the first portion of a split protein binding site and second portion of a split protein binding site in close apposition comprises a continuous or contiguous sequence comprising the first portion of a split protein binding site and the second portion of a split protein binding site. In certain embodiments, an intact protein binding site comprising the first portion of a split protein binding site and second portion of a split protein binding site in close apposition comprises a discontinuous sequence comprising the first portion of a split protein binding site and the second portion of a split protein binding site. In certain embodiments, an intact protein binding site comprising the first portion of a split protein binding site and second portion of a split protein binding site in close apposition comprises a sequence comprising sufficient identity to a known or functional protein binding site to retain binding function without 100% identity to the known or functional protein binding site.

[047] In certain embodiments, the intact nucleic acid and/or protein binding site(s) permit(s) binding of an enzyme, wherein the enzyme binds to an intact nucleic acid and/or protein binding site and wherein the enzyme does not bind to a split nucleic acid and/or protein binding site. In certain embodiments, the nucleic acid binding site is a DNA binding site or an RNA binding site. In certain embodiments, the nucleic acid and/or protein binding site is a DNA binding site and wherein the DNA is double-stranded DNA (dsDNA). In certain embodiments, the intact dsDNA and/or protein binding site permits binding of a transcriptional activator. In certain embodiments, the intact dsDNA and/or protein binding site comprises a UAS sequence and wherein the intact dsDNA and/or protein binding site permits binding of Gal4. In certain embodiments, the intact dsDNA and/or protein binding site permits binding of a transcriptional repressor. In certain embodiments, the transcriptional repressor comprises a lambda repressor.

[048] The disclosure provides a method of detecting at least one biomolecule in a biological fluid. In certain embodiments of the method, steps include: (1) processing the biological fluid to retain the at least one biomolecule and to remove one or more components other than the at least one biomolecule to produce an analyte composition; (2) contacting an analyte composition and a NAB composition of any of the compositions of the disclosure under conditions suitable to allow at least one biomolecule of the analyte composition to bind to at least one inactivated NAB of the NAB composition to produce a reaction composition, thereby producing at least one activated NAB in the reaction composition and; (3) detecting the at least one activated NAB in the reaction composition, thereby detecting the at least one biomolecule bound to the at least one activated NAB.

[049] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, steps include: (1) processing the biological fluid to retain the at least one biomolecule and to remove one or more components other than the at least one biomolecule to produce an analyte composition; (2) contacting an analyte composition and a NAB composition of any one of the compositions of the disclosure under conditions suitable to allow at least one biomolecule of the analyte composition to bind to at least one inactivated NAB of the NAB composition to produce a reaction composition, thereby producing at least one activated NAB in the reaction composition, and; (3) detecting the at least one activated NAB in the reaction composition, thereby detecting the at least one biomolecule bound to the at least one activated NAB.

[050] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, steps include: (1) processing the biological fluid to retain the at least one biomolecule and to remove one or more components other than the at least one biomolecule to produce an analyte composition; (2) contacting an analyte composition and a NAB composition of certain embodiments of the compositions of the disclosure under conditions suitable to allow at least one biomolecule of the analyte composition to bind to at least one inactivated NAB of the NAB composition to produce a reaction composition, thereby producing at least one activated NAB in the reaction composition, and; (3) detecting the at least one activated NAB in the reaction composition, thereby detecting the at least one biomolecule bound to the at least one activated NAB.

[051] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the analyte composition comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number of biomolecules.

[052] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the method detects at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number of biomolecules in between in the reaction composition.

[053] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the method detects at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of biomolecules in between in the reaction composition. In certain embodiments, the analyte composition comprises at least two distinct biomolecules. In certain embodiments, each biomolecule of the analyte composition is a distinct biomolecule.

[054] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, prior to contacting the analyte composition, the NAB composition comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number of distinct inactive NABs in between in the NAB composition.

[055] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, after contacting the analyte composition, the NAB composition comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number of activated NABs in between in the reaction composition.

[056] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, after contacting the analyte composition, the NAB composition comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number of activated NABs in between in the reaction composition.

[057] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, after to contacting the analyte composition, the NAB composition comprises at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of activated NABs in the reaction composition. In certain embodiments, after to contacting the analyte composition, the method detects at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of activated NABs in the reaction composition.

In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the method comprises contacting the reaction composition and a surface. In certain

embodiments, the surface comprises a liquid surface, a solid surface, a biological surface or a combination thereof. In certain embodiments, wherein the solid surface comprises a solid support, a solid-phase substrate, a bead, a polymer, a composite, a carbon composite, a plastic, a glass, a substantially planar surface, a lateral-flow strip, a multiplexed array, or a combination thereof. In certain embodiments, the liquid surface comprises a droplet. In certain embodiments, the droplet comprises a liquid volume and a solid surface. In certain embodiments, the surface comprises a liquid droplet containing a solid substrate. In certain embodiments, the droplet comprises one or more reagents to reduce sheering forces and/or facilitate movement of the droplet through the microfluidic channel. In certain embodiments, the droplet comprises one or more reagents to facilitate contact with a second droplet, producing a product droplet. In certain embodiments, the second droplet comprises an analyte composition. In certain embodiments, the biological surface comprises a cell surface or a cell membrane surface. In certain embodiments, the biological surface is isolated from a cell or derived from a cell. In certain embodiments, the biological surface is synthetic. In certain embodiments, the biological surface recapitulates one or more components of a transcriptome, secretome, proteome, microenvironment, stem cell, differentiated cell, tissue or system. In certain embodiments, the biological surface is comprised on a microchip.

[058] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the selection ligand binds to an affinity reagent and/or a ligand binding region within the constant region. In certain embodiments, the selection ligand binds to an affinity reagent and/or a ligand binding region within the constant region. In certain embodiments, the selection ligand binds to an affinity reagent and/or a ligand binding region within the variable region. In certain embodiments, the surface is a lateral flow strip. In certain embodiments, the surface further comprises a positive detection control and a negative detection control.

[059] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the at least one activated NAB binds to a first selective ligand operably-linked to the surface and wherein inactive NABs bind to a second selective ligand operably-linked to the surface. In certain embodiments, the first selective ligand comprises a first detectable label and the second selective ligand comprises a second detectable label. In certain embodiments, the first detectable label and the second detectable label are distinct. In certain embodiments, the first detectable label or the second detectable label release a signal upon binding an activated NAB or an inactive NAB, respectively.

[060] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, prior to the contacting step, a first droplet comprises the analyte composition and a second droplet comprises the NAB composition. In certain embodiments, contacting the first droplet and the second droplet produces a reaction droplet comprising the reaction composition. In certain embodiments, prior to the contacting step, the first droplet flows through a first microfluidic channel. In certain embodiments, prior to the contacting step, the second droplet flows through a second microfluidic channel. In certain embodiments, a flow rate in the first microfluidic channel and a flow rate in the second microfluidic channel are coordinated such that, upon entering a third microfluidic channel, the first droplet and the second droplet collide to produce the reaction droplet. In certain embodiments, the at least one activated NAB in the reaction droplet releases a detectable signal. In certain embodiments, the signal is detected while the reaction droplet is in the third microfluidic channel.

[061] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, the NAB composition comprises a surface. In certain embodiments, the surface is an array. In certain embodiments, the array comprises a plurality of nanoapertures. In certain embodiments, each nanoaperture of the plurality of nanoapertures is surrounded by a plurality of gold particles. In certain embodiments, the plurality of gold particles comprises a layer of gold particles in contact with a top surface of the array and a boundary of each nanoaperture of the plurality of nanoapertures. In certain embodiments, binding of a biomolecule to at least one biomolecule binding domain of an inactive NAB produces an activated NAB and wherein the activated NAB contacts at least one gold particle of the plurality of gold particles, resulting in the generation of an event in at least one nanoaperture of the plurality of nanoapertures.

[062] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, binding of a biomolecule to at least one biomolecule binding domain of an inactive NAB produces an activated NAB and wherein the activated NAB contacts at least one gold particle of the plurality of gold particles, resulting in the generation of an event in only one nanoaperture of the plurality of nanoapertures. In certain embodiments, the event comprises the formation of a plasmon. In certain embodiments, a beam of light radiation is focused at least one nanoaperture of the plurality of nanoapertures. In certain embodiments, a beam of light radiation is focused at each nanoaperture of the plurality of nanoapertures. In certain embodiments, the generation of an event at a nanoaperture detects the capture of activated NAB. In certain embodiments, the generation of an event at a nanoaperture detects the release of an activated NAB. In certain embodiments, the generation of an event comprises the formation of a plasmon.

[063] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, each nanoaperture of the plurality of nanoapertures has a diameter of about 20 nanometers. In certain embodiments, the array comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number in between of nanoapertures. In certain embodiments, the array comprises a number of nanoapertures equal to or greater than the number of inactive NABs in the NAB composition. In certain embodiments, the array comprises a number of nanoapertures equal to or greater than the number of inactive NABs in the NAB composition. In certain embodiments, the array comprises a number of nanoapertures equal to or greater than the number of activated NABs in the reaction composition.

[064] In certain embodiments of the method of detecting at least one biomolecule in a biological fluid, an identity of the at least one biomolecule of the biological fluid is unknown. In certain embodiments, an identity of each of a plurality of biomolecules of the biological fluid is unknown. In certain embodiments, an identity of each of a plurality of biomolecules of the biological fluid is unknown. In certain embodiments, an identity of each biomolecule of the biological fluid is unknown. In certain embodiments, an identity of the biological fluid is unknown. In certain embodiments, a sequence of the at least one biomolecule binding domain of each variable region of each inactive NAB of the NAB composition is known. In certain embodiments, a sequence of each variable region of each inactive NAB of the NAB composition is known.

[065] The disclosure provides a method of making a NAB library. In certain embodiments of the method of making a NAB library, the steps include; (1) contacting an analyte composition and a NAB composition of any one of the compositions in the disclosure under conditions suitable to allow at least one biomolecule of the analyte composition to bind to at least one inactivated NAB of the NAB composition to produce a reaction composition, thereby producing at least one activated NAB in the reaction composition, wherein an identity of the at least one biomolecule is known and a sequence of the at least one biomolecule binding domain of a variable region of each NAB of the NAB composition is unknown; (2) detecting the at least one activated NAB in the reaction composition or the biomolecule bound to the activate NAB, and; (3) determining the sequence of the at least one biomolecule binding domain of the variable region of the activated NAB, thereby identifying at least one activated NAB that specifically binds to the at least one biomolecule.

[066] In certain embodiments of the method of making a NAB library, the analyte composition comprises at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number in between of biomolecules.

[067] In certain embodiments of the method of making a NAB library, the method detects at least 2, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, at least 950, at least 1000, at least 2000, at least 3000, at least 4000, at least 5000, at least 6000, at least 7000, at least 8000, at least 9000, at least 10,000 or at least any number in between of activated NABs in the reaction composition. In certain embodiments, the method detects at least 1%, 2%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 99% or any percentage in between of activated NABs in the reaction composition.

[068] In certain embodiments of the method of making a NAB library, the reaction composition comprises at least two distinct activated NABs. In certain embodiments, the reaction

composition comprises a plurality of distinct activated NABs. In certain embodiments, the reaction composition comprises a plurality of distinct activated NABs. In certain embodiments, each activated NAB of the reaction composition is a distinct activated NAB. In certain embodiments, an inactive or an activated NAB is identified according to the method of any one of the methods disclosed for a method of making a NAB library.

BRIEF DESCRIPTION OF THE DRAWINGS

[069] The patent or application file contains at least one drawing executed in color.

Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[070] Fig. 1 is a schematic diagram depicting SELEX compared to an embodiment of Complex Unbiased Solution Profiling (CUSP), referred to herein as an "induced affinity method" (also shown in Fig. 8 and 9). According to the SELEX method, a SELEX analyte (a specific known biomolecule or mixture of biomolecules) is affixed to a solid support (for example, including, a column or a cell) prior to contacting a SELEX aptamer library. The SELEX analyte remains affixed to the solid support during a selection step through which each aptamer of the SELEX aptamer library binds to the SELEX analyte. According to the SELEX method, an additional detection step is required to attach a label to the SELEX analyte/SELEX aptamer complex to enable detection of the complex, and, consequently, isolation of the SELEX analyte. Although this figure depicts one embodiment of CUSP, the induced affinity embodiment, in all

embodiments of CUSP, the plurality of known or unknown analytes contacted by the

compositions comprising a plurality of NABs of the disclosure is not affixed to a solid support prior to contacting the compositions comprising a plurality of NABs. For example, as shown in this figure, the plurality of analytes are comprised free in solution. In this embodiment of CUSP, a composition comprising a plurality of nucleic acid biosensors (NABs) of the disclosure is not first fixed to a solid support. In this embodiment of CUSP, a composition comprising a plurality of NABs is free in solution. In this embodiment of CUSP, the selection and detection of activated NABs (those NABs bound to biomolecules of the analyte solution) is simultaneous, as the binding of the NAB to the biomolecule induces a conformational change that permits binding of the activated NAB to a reporter ligand (octagons shown in bottom, right). In this embodiment of CUSP, upon binding of an activated NAB to a reporter ligand, the ligand self-cleaves, releasing the NAB and activating the reporter to generate a detectable signal.

[071] Fig. 2 is a schematic depicting CUSP applicability to any biological fluid and a variety of industries (e.g. consumer biologies, bioindustry, personal diagnostics, and pharmaceuticals).

[072] Fig. 3 is a schematic diagram of an embodiment for generating a plurality of NABs, herein referred to as "induced activity mode" (also shown in Fig. 4). In this embodiment, the plurality of NABs comprise a self-cleaving ribozyme domain within the signaling domain, which is capable of attaching to a solid support. In this embodiment, each one of the NABs in the plurality of NABs comprises two affinity reagents (pentagon and circle, middle panel of figure) and a variable region (wandering line between the two affinity reagents) for example. In this embodiment, interaction of a NAB with a specific biomolecule (Y, right panel of figure) results in a conformational change that causes the NABs or NAB fragments to be released from the solid support though activation of the self-cleaving ribozyme.

[073] Fig. 4 is a schematic diagram depicting an embodiment for selection of any one of a plurality of NABs generated using the induced activity mode embodiment (also shown in Fig. 3). The plurality of NABs are initially attached to a solid support, for example, and combined with an analyte solution comprising a mixture of known or unknown biomolecules (star and sun shapes, upper left). Activated NABs are cleaved (star and sun surrounded by NAB variable region, left of center panel) and inactivated NABs remain attached (right of center panel).

Activated NABs are then captured on a secondary solid support, for example, by binding of the second affinity reagent (small circle).

[074] Fig. 5 is a schematic diagram of an embodiment of producing a plurality of NABs, herein referred to as "induced hybrid disruption mode" (also shown in Fig. 6 and 7). In this

embodiment, each NAB of the plurality of NABs comprises a first variable region comprising a first biomolecule-binding domain, a constant region, a second variable region comprising a second biomolecule-binding domain and, optionally, an attachment site for operably linking to a solid support (circle). In this embodiment, the constant region of the NAB comprises a sequence having sufficient complementarity to hybridize to a constant region of a second nucleic acid comprising an attachment site for operably linking to a solid support (square). Optionally, the constant region of the NAB may comprise a fluorophore construct (small circle, right panel), the signal from which, in the absence of binding to a biomolecule, the hybridization of the constant region of NABs and the second nucleic acid is disrupted, releasing the activated NAB from the solid substrate and, optionally, separating the fluorophore and the quencher to produce a detectable signal.

[075] Fig. 6 is a detailed schematic depicting an embodiment for the selection of any of the plurality of NABs generated from the induced hybrid disruption mode (also shown in Fig. 5). For example, interactions with specific biomolecules (hexagon, which represent a single known or unknown biomolecule in a mixture) produce conformational changes that disrupt the hybrid and release the NAB from the solid support.

[076] Fig. 7 is a detailed schematic depicting an embodiment for detection of activated NABs generated from the induced hybrid disruption mode. During the detection step, for example, the signaling domain contains a fluorophore and quencher pair (small and large circles). When a NAB is activated by specific biomolecule binding (hexagon), the quencher and fluorophore become separated and the NAB becomes fluorescent. While shown as two steps for clarity, the binding of a biomolecule to a NAB according to this embodiment, simultaneously releases the NAB from the solid support and induces the production of a detectable signal.

[077] Fig. 8 is a schematic diagram depicting an embodiment for generating a plurality of NABs, herein referred to as "induced affinity mode." In this embodiment, high affinity selection-ligands (X within hexagon) are, for example, attached to a solid support. In this embodiment, any one of the plurality of NABs comprises a signaling domain that is capable of binding to the section-ligand (A in center panel - "constant region"). Binding of a specific biomolecule (Y within star) results in binding of the NAB to the selection-ligand.

[078] Fig. 9 is a detailed schematic depicting an embodiment for the selection of NABs generated from the induced affinity mode. In this embodiment, the analyte solution comprising a mixture of known or unknown biomolecules (star and sun shapes) is combined with the plurality of NABs (bottom of left panel). Activated NABs bind to the selection-ligands (X within hexagon) that are, for example, bound to a solid support (left side of right panel). Inactive NABs remain unattached (right side of right panel). As shown in Fig. 1, in some embodiments, binding of an activated NAB to a selection ligand induces a conformational change in a signal transduction domain (B of center panel of Fig. 8) and induces a self-cleaving of the selection ligand/activated NAB complex from the solid substrate.

[079] Fig. 10 is a schematic diagram depicting an embodiment of a CUSP structural NAB library for the discovery of sensors for the molecular identification of biomolecules that specifically bind known analytes of an analyte composition of the disclosure (and, in particular, an analyte composition comprising unknown or unidentified analytes). Unknown analyte specific biomolecules (depicted by blue stars and purple asterisks) are mixed with a library of inactive NABs, comprised of a ligand binding domain (green) and a specific biomolecule binding domain, comprising at least one pair of short constant regions (that confer secondary or tertiary structure, including but not limited to, stem-loops, G-quadruplexes, i-Motifs or Holliday Junctions) and short variable regions. Selection of active NABs occurs by induced affinity of the ligand binding domain with its ligand fixed to a solid support.

[080] Fig. 11 is a schematic diagram depicting an embodiment of a binary CUSP structural NAB library for the discovery of sensors for molecular identification of biomolecules that specifically bind known analytes of an analyte composition of the disclosure (and, in particular, an analyte composition comprising unknown or unidentified analytes). Unknown analyte specific biomolecules (depicted by blue stars and purple asterisks) are mixed with a library of inactive NABs, comprised of a ligand binding domain (green) and a specific biomolecule binding domain, comprising at least one pair of short constant regions (that confer secondary or tertiary structure, including but not limited to, stem-loops, G-quadruplexes, i-Motifs or Holliday Junctions) and short variable regions. The library comprises two separate structural CUSP libraries that have partial or complete complementarity with each other. The interactions of active NABs and their cognate specific biomolecules are stabilized by covalent linkage.

Selection of active NABs occurs by induced affinity of the ligand binding domain with its ligand fixed to a solid support.

[081] Fig. 12 is a schematic diagram depicting a variety of chemical groups in an exemplary analyte composition that can be specifically modified by covalent crosslinking reagents.

Different cross-linking reagents, each separately attached to solid supports, target different chemical moieties of classes of analytes within a complex composition. These chemical moieties include, but are not limited to, amines, thiols, ketones, aldehydes, reducing sugars, steroid, carboxylic acids and carboxamides. The attached derived analytes serve as targets for selection by CUSP libraries.

[082] Fig. 13 is a schematic diagram depicting an exemplary embodiment of the cross-linking of an amine reactive modified fluorescein with a complex analyte composition. The amine reactive modified fluorescein is first attached to solid supports by reversible linkage, which are brought into contact with a complex analyte composition. After reaction, remaining unreacted analytes are rinsed away. After rinsing, purified modified analytes are collected. This is one example of a general method for crosslinking different chemical moieties of classes of analyte within a complex composition. The different chemical moieties include, but are not limited to, amines, thiols, ketones, aldehydes, reducing sugars, steroid, carboxylic acids and carboxamides.

[083] Fig. 14 is a schematic diagram depicting an exemplary embodiment of the crosslinking of an amine reactive modified fluorescein with a complex analyte composition. The amine reactive modified fluorescein is first attached to solid supports by reversible linkage, which are brought into contact with a complex analyte composition. After reaction, remaining unreacted analytes are rinsed away and inactive NAB libraries are brought into contact with the modified analytes on the solid support.

[084] Fig. 15 is a schematic diagram depicting an exemplary embodiment of the detection of modified analytes (as described in Fig. 13) using NABs selected using the method described in Fig. 14. Modified-analyte specific NABs are arrayed on solid supports that allow interrogation each different specific NAB. [085] Fig. 16 is a schematic diagram depicting an exemplary embodiment of a use of NABs as affinity reagents for molecular identification. Unknown biomolecules in an analyte composition are mixed with unbound specific NABs containing, for example, an affinity tag. Unknown biomolecules that have bound a specific NAB are isolated (stars) and enriched via affinity purification before analysis by, for example, mass spectroscopy or other methods of biochemical analysis.

[086] Fig. 17 is a schematic diagram depicting an exemplary embodiment of the discovery of concentration sensitive NABs within a plurality of NABs. For example, high affinity NABs detach from a solid support at low specific biomolecule concentration (left panel). Lower affinity NABs detach from the solid support at higher specific biomolecule concentrations (right panel). This function of the NABs of the disclosure enables the quantification of specific biomolecules within an analyte solution.

[087] Fig. 18 is a schematic diagram depicting an exemplary embodiment of a lateral-flow strip detection of activated NABs. In this embodiment, the analyte composition is contacted with inactive NABs. Upon metabolite binding to an inactive NAB, for example, a conformational change occurs that allows for operably-binding the activated NABs to a ligand attached to a lateral-flow strip. The NAB composition and the analyte composition are applied to the lateral- flow strip, for example, where the combined composition travels the length of the lateral-strip. When an activated NAB binds to the ligand at the positive detection region (upper purple stripe, + strip, left side), for example, a positive signal is generated. Inactivated NABs that have not bound the ligand travel the remaining length of the lateral-flow strip, and subsequently, are washed out from the lateral-flow strip. A negative control second capture reagent fixed to the substrate is included, for example, to indicate that the composition of NABs/metabolites has traveled the length of the strip and capture inactive NABs (lower purple stripe present in both left and right strips).

[088] Fig. 19 is a detailed schematic diagram depicting an exemplary embodiment of a lateral- flow strip detection of specific activated NABs. The analyte composition comes into contact with a specific NAB comprising, for example, a biomolecule-binding domain (squiggle line between the circle and the triangle), a ligand-binding domain (activated NABs are represented by a change in shape of squiggle line, two arches, second panel), a secondary ligand-binding domain (diamond), and a colorimetric enzyme (circle). In this embodiment, binding of an analyte (pentagon) with a specific NAB biomolecule-binding domain, for example, produces a conformational shift (squiggle line, second panel). The conformational shift, for example, allows binding to a ligand (crescent) which is bound to a solid support. Binding of the activated NAB to the ligand produces, for example, a positive signal on the lateral flow strip (see also Figs. 18 and 19). In this embodiment, inactive NABs, which have not bound an analyte (unbound) are captured further down the lateral-flow strip by the secondary ligand-binding domain (diamond bound to tilted L-shape), for example, producing a signal in the negative control region (see also Figs. 18 and 19).

[089] Fig. 20 is a graphic diagram depicting an exemplary embodiment of a 2D nanopillar microarray for detection of activated NABs. In this embodiment, glass nanopillars are cut to ~20nm in diameter and baked at 200°C, for example, and arranged in a lattice array, for example. In this embodiment, liquid gold is poured between the nanopillars, for example, creating a gold coating on the array (right, center panel). Nanopillars are then reduced to the height of the liquid gold, for example, creating a nano-aperture array (right, bottom panel; side and top views).

[090] Fig. 21 is a diagram depicting an exemplary embodiment of a detection of activated NABs on a nano-aperture array. In this embodiment, the nano-aperture array is exposed, for example, to a Vertical-cavity surface-emitting laser (VCSEL; bottom). Activated NABs interact with the liquid gold, for example, creating a plasmon at the surface of the nanopillars. This interaction, or "event" as shown in the figure, allows for the VCSEL to pass through the gold layer (middle) and reach the detector (top), generating a positive signal, for example.

[091] Fig. 22 is a diagram depicting exemplary embodiments of microarray detection platforms. In this embodiment, interaction of a NAB with a biomolecule (activated NAB) facilitates the reaction with the liquid gold, creating a plasmon that facilitates transmission of the light signal, for example (see also Figs. 20 and 21). For example, a positive signal can be detected from binding of an activated NAB to a ligand ("platform one", left side) or an activated NAB which has been self-cleaved or separated from a quencher or fluorophore ("platform two", right side).

[092] Fig. 23 is a schematic diagram depicting on-array clone amplification and sequencing using structural NABs. In the leftmost panel a single CUSP NAB is captured by hybridization with covalently linked primer molecules on an unordered array glass slide. The second panel depicts the first round of synthesis using the original CUSP NAB as a template. The third panel depicts the 'polony' formation process on the solid support. The fourth panel depicts the resulting 'polony', which may be sequenced as depicted in the fifth panel.

[093] Fig. 24 is a schematic diagram depicting on-array contact of structural NABs and exonuclease ("exo"), refolding of the structural NABs, and screening of the structural NABs. The leftmost panel represents a single CUSP NAB 'polony'. The middle panel depicts a 5' specific exonuclease activity, which generates a 'polony' of single stranded DNA. The rightmost panel depicts the binding of a specific biomolecule from a complex analyte solution, which induces the binding of Malachite Green (MG) with detectable fluorescence.

[094] Fig. 25 is a schematic diagram depicting on-array ordered, spotted pre-sequenced clones of structural CUSP NABs. A library of CUSP NAB clones spotted onto a glass slide (solid support), which allows the detection of active NABs with solution reagents and the detection of fluorescence.

[095] Fig. 26 is a schematic diagram depicting on array unordered, amplified, sequenced clones of structural CUSP NABs. A library of CUSP NAB clones randomly attached to a glass slide allowing the production of 'polony' clones. The system allows the mixing of NABs with complex analyte solutions, fluorescence detection and sequencing of each 'polony' clone.

[096] Fig. 27 is a series of graphs showing the basal fluorescence signal of a mixed population of beads coated with a first NAB that binds to pentamethylcyclopentadienyl-rhodium(III) (CP*RH(III)) derivatized L-tryptophan and a second NAB that binds to CP*RH(III)) derivatized L-tyrosine when the beads are incubated in the absence of any amino acids.

[097] Fig. 28 is a series of graphs showing the fluorescence signal from a mixed population of beads coated with a first NAB that binds to pentamethylcyclopentadienyl-rhodium(III)

(CP*RH(III)) derivatized L-tryptophan and a second NAB that binds to CP*RH(III)) derivatized L-tyrosine when the beads are incubated in 0.1 mM derivatized L-tryptophan (left graph), 0.1 mM derivatized L-tyrosine (middle graph) and 0.1 mM derivatized L-tryptophan and 0.1 mM derivatized L-tyrosine (right graph).

[098] Fig. 29 is a schematic of the design of three structured libraries of a NAB with a stem- loop structure. A single NAB comprising a binding site for P*RH(III)-derivatized L-tryptophan was chosen as a starting scaffold for the libraries. The top of Fig. 29 shows the three stem loop structures that the starting scaffold can assume. The bottom of Fig. 29 show three different libraries (N12N6, NsNs andN?) and the variable nucleotide positions within each library. N corresponds to any nucleotide.

[099] Fig. 30 is a schematic of the design of two structured libraries of a NAB with a G- quadruplex structure structure. A single NAB comprising a binding site for P*RH(III)- derivatized L-tryptophan was chosen as a starting scaffold for the libraries. The top of Fig. 30 shows the two G-quadruplex structures that the starting scaffold can assume. The bottom of Fig. 30 show two different libraries (N21 and N17) and the variable nucleotide positions within each library. N corresponds to any nucleotide (A,T, C or G).

[0100] Fig. 31 is a schematic of the design of trimer-scanning libraries using a NAB with a stem-loop structure. A single NAB comprising a binding site for P*RH(III)-derivatized L- tryptophan was chosen as a starting scaffold for the libraries. The top of Fig. 31 shows the design of 9 different libraries. In each library, three consecutive nucleotide positions are chosen to be variable. N corresponds to any nucleotide. The bottom left of Fig. 31 shows a stem loop structure that the starting scaffold can assume and the position of the three nucleotides varied in the FT 165 library. The bottom right of Fig. 31 is a graph that compares the binding activity of the FT 165 library and the starting scaffold. In each set of bars, the left bar is the starting scaffold binding activity and the right bar is FT 165 binding activity.

[0101] Fig. 32 is a schematic of the design of trimer-scanning libraries using a NAB with a G- quadruplex structure. A single NAB comprising a binding site for P*RH(III)-derivatized L- tryptophan was chosen as a starting scaffold for the libraries. The top of Fig. 31 shows the design of 6 different libraries. In each library, three consecutive nucleotide positions are chosen to be variable. N corresponds to any nucleotide. The bottom left of Fig. 31 shows a G-quadruplex structure that the starting scaffold can assume and the position of the three nucleotides varied in the FT 159 library. The bottom right of Fig. 31 is a graph that compares the binding activity of the FT 159 library and the starting scaffold. In each set of bars, the left bar is the starting scaffold binding activity and the right bar is FT 159 binding activity.

[0102] Fig. 33 is a schematic of the design of a library that can be used with a microarray to screen for novel NABs that assume a stem-loop structure. The bottom left shows a stem-loop structure that the starting scaffold can assume. The upper panel of the Fig. 33 shows 64 different NAB sequences that can be screened on a microarray. For example, SEQ ID NO: 31 comprises the sequence of "GGAGACTCCTGGGACGACCGCAAAAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC GATGCTGCATACGTAA," wherein the underlined and bolded "AAA" represents one of the 64 possible combinations provided in this figure.

[0103] Fig. 34 is a schematic of the design of a library that can be used with a microarray to screen for novel NABs that assume a G-quadruplex structure. The bottom left shows a stem-loop structure that the starting scaffold can assume. The upper panel of the Fig. 34 shows 64 different NAB sequences that can be screened on a microarray.

DETAILED DESCRIPTION

[0104] Compositions and methods of the disclosure, also referred to as "Complex Unbiased Solution Profiling" (CUSP), detect and discover biomolecules within biological fluids, which are complex mixtures of many specific biomolecules, and/or analyte compositions (which for example, may comprise a buffer solution). Exemplary compositions may comprise a plurality of inactive nucleic acid biosensors (NABs), which comprise regions of random sequences for the identification, selection, and detection of a plurality of unknown biomolecules in a fluid. Unlike existing technologies, such as Systematic Evolution of Ligands by Exponential enrichment (SELEX), in certain embodiments of the compositions and methods of the disclosure, the analyte composition or at least one biomolecule thereof is not initially fixed to a solid support prior to contacting a NAB composition of the disclosure. For example, in some embodiments, including those wherein the analyte composition or at least one biomolecule thereof is not initially fixed to a solid support prior to contacting a NAB composition of the disclosure, the at least one biomolecule is free in solution. Compositions and methods of the disclosure may be used, for example, for the detection of any number of biomolecules in one or more analyte compositions of the disclosure, ranging from one to tens of thousands of biomolecules in a single procedure. In some embodiments, compositions and methods of the disclosure may be used, for example, for the quantification of any number of biomolecules in one or more analyte compositions of the disclosure, ranging from one to tens of thousands of biomolecules in a single procedure. In some embodiments, compositions and methods of the disclosure may be used, for example, for determining a concentration of any number of biomolecules in one or more analyte compositions or biological fluids of the disclosure, ranging from one to tens of thousands of biomolecules in a single procedure. [0105] Three exemplary applications of the compositions and methods of the disclosure include, but are not limited to, (1) compositions and methods for the discovery of one or more libraries of NABs; (2) compositions and methods for discovery/identification of the NAB cognate specific biomolecules in an analyte composition or from a biological fluid; and (3) compositions and methods for the arraying or multiplexing of, for example, tens of thousands of NABs to simultaneously detect and quantify tens of thousands of biomolecules in an analyte composition or from a biological fluid.

[0106] Compositions of the disclosure comprise a plurality of inactive NABs, wherein each of the plurality of NABs comprises at least one variable region, wherein the variable region comprises at least one biomolecule binding domain, and a constant region, wherein the plurality of inactive NABs recognizes two or more distinct biomolecules, recognizes two or more distinct sites on at least one biomolecule, positively selects at least one biomolecule and negatively selects at leave one biomolecule, and recognizes at least one biomolecule with high affinity on a first side of a threshold concentration but not on the second side of the threshold concentration.

[0107] Understanding the composition of biological fluids in terms of the constituent molecules is essential for many modern applications. For example, central to the practice of medicine is the measurement of small molecules in bodily fluids such as, for example, urine and blood. The disclosure provides compositions and methods for detecting, identifying, and/or quantifying biomolecules (including metabolites) from biological fluids, including a variety of complex bodily fluids. In certain embodiments, the compositions and methods of the disclosure may be applied to one or more bodily fluids including, but not limited to, urine, blood, serum, saliva, tears, breast milk, sebum, semen, cerumen, fecal matter, synovial fluid, lymph fluid, interstitial fluid, sweat, cerebrospinal fluid, amniotic fluid, plural effusion and pericardial effusion.

[0108] The current diagnostics market is poorly served by existing metabolite detection technology. Today, the most comprehensive analysis technology is mass spectrometry, which costs up to $1,000,000 per instrument. This current equipment is too expensive for personal use and the technology is too slow for point-of-care applicability. Consequently, this analysis is performed in centralized laboratories at a high cost, while more affordable current technologies can only detect a few well-characterized biomolecules. In certain embodiments, the disclosure provides NABs and NAB compositions for use as affinity reagents for the molecular

identification of biomolecules (including metabolites). In certain embodiments, unknown biomolecules in an analyte composition are mixed with unbound specific NABs containing, for example, an affinity tag. Unknown biomolecules that have bound a specific NAB are isolated and enriched via affinity tag purification before analysis by, for example, lateral flow strip as an inexpensive means of analysis or by array or by microfluidic detection for a high-throughput analysis (other methods of biochemical analysis may be used following the purification step).

[0109] Urinalysis is a telling example of how current metabolite (including small molecule) detection technology is inhibitory. Human urine contains 4000 known metabolites, but currently a routine urine test will subject a sample to just 26 superficial measurements and at only a single point in time. A long-felt need in the field is to query simply and affordably all metabolites in a urine sample, for example, and to do so easily over multiple time-points. The current disclosure could provide a dynamic view of a patient's health status rather than the single, cost-prohibitive, low-resolution analysis of current technology. The analysis provided by the current disclosure would provide a unique angle on understanding diseases, as human fluids contain the products of metabolism as well as those that come from diet, drugs and environmental exposures.

[0110] Metabolites are the products and intermediate molecules of cellular activity, generally comprising small organic molecules. In the context of this disclosure metabolites can, for example, be equated with the term "biomolecule" or "specific biomolecule". In certain embodiments, a biomolecule or a specific biomolecule includes, but is not limited to, a primary metabolite, a central metabolite, a secondary metabolite, an ion, a nucleic acid, or an amino acid.

[0111] The variability of metabolite levels can indicate profound states of health in humans. For example, after a meal blood levels of glucose and other related metabolites can vary enormously among otherwise healthy individuals. Currently, most measurements for the onset of diabetes are made from a small blood or serum sample that can be onerous to obtain. There is a long-felt need in the field to be able to measure the onset of Type I or Type II diabetes from much simpler to obtain and painless samples, for example, saliva rather than blood. The glucose related molecule 1,5 anhydroglucitol (1,5-AG), which has a long history as a good anti-correlated metabolite with glucose levels, can be measured in saliva. Existing tests for 1,5-AD, however, cannot distinguish adequately between 1,5-AG and galactose. A more selective and quantitative measure of biomolecules as is presented in the disclosure, more accurately quantitates biomolecules such as 1,5-AG and related compounds in saliva. The compositions and methods of the disclosure satisfy the long-felt need in the field for a better monitor of diabetes onset and general glycaemic state of individuals, for example.

[0112] An inexpensive method to detect and quantify specific biomolecules would satisfy a long- felt need in the field by providing quantitative measurements for the full range of metabolites in any given solution, including, for example, biological or bodily fluids. The compositions and methods of this disclosure provide a rapid, accurate and inexpensive means for the highly multiplexed analysis of the biomolecule composition of a fluid, thus increasing, for example, the accuracy of diagnosis, analysis of food and beverages, and routine detection of environmental toxins.

Identification of Unknown Metabolites

[0113] The compositions and methods of the disclosure provide for the identification of unknown metabolites in solution.

[0114] In previous methods, such as SELEX, known metabolites are fixed to a solid support and aptamers are identified which selectively bind these known target metabolites. These sequences are then subjected to several rounds of amplification and re-selection, after which a small number of high-affinity interactors will typically be identified for the target metabolite. The main difficulty, is that only one, known target at a time can be employed using such previous technologies.

In contrast to previous methods, including SELEX, the compositions and methods of the disclosure may be used to identify any biomolecule in any fluid, without any prior knowledge of the identity of the biomolecule or the identity of the fluid. According to these embodiments, the sequence of the variable region of each NAB, while random and therefore able to bind a nearly infinite number of possible biomolecules, are also known as having demonstrated ability to specifically bind to certain biomolecules. Thus, without any prior knowledge of the biological fluid or the biomolecules contained therein, the NAB compositions of the disclosure, following contact with the biological fluid or an analyte composition derived therefrom, can bind any and all biomolecules present in the biological fluid or corresponding analyte composition. Upon selection of the activated NABs having a known sequence and a known binding specificity, the biomolecule bound to each activated NAB can subsequently be identified. [0115] Unknown metabolites are likely to include several known classes of organic molecule. Thus, by transient interaction with reactive other molecules, which result in the covalent bonding of analytes, either in solution or with reactive molecules affixed to solid supports, new derived versions of unknown analyte species can be generated. Exemplary reactive molecules include among others those capable of covalently modifying amines, thiols, alcohols, ketones, aldehydes, carboxylic acids, and carboxamides. These derived versions of analytes are targets of NAB discovery and detection.

[0116] Exemplary biological fluids of the disclosure include, but are not limited to, a liquid, a semi-liquid, and a liquid or semi-liquid derived from a solid. Semi-liquids of the disclosure include, but are not limited to, pastes, ointments, non-neutonian liquids (e.g. blood), plasma, serum, puss, gels, emulsions, lotions, and creams. Exemplary biological fluids of the disclosure include, but are not limited to, a mixture of one or more biological fluids.

[0117] Exemplary biological fluids of the disclosure include, but are not limited to, an unknown biological fluid, a known biological fluid, or a mixture thereof. These biological fluids can be obtained from one or more samples from the same individual, one or more samples from distinct individuals, or a mixture thereof. Exemplary bodily fluids include, but are not limited to, urine, blood, whole blood, blood serum, blood plasma, peripheral blood, saliva, tears, breast milk, sebum, semen, cerumen, fecal matter, synovial fluid, lymph fluid, interstitial fluid, sweat, cerebrospinal fluid (CSF), an amniotic fluid, plural effusion or a pericardial effusion. Exemplary biological fluids of the disclosure include, but are not limited to, a synthetic fluid. Synthetic fluids of the disclosure include, but are not limited to, consumer biologicals. Exemplary consumer biologicals of the disclosure include, but are not limited to, beverages, food, cosmetics, perfumes, or dietary supplements. Consumer biologicals can also include drugs, prodrugs, drug

intermediates, drug products, or combinations thereof.

[0118] Exemplary biological fluids of the disclosure include, but are not limited to, raw or unprocessed biological fluids, processed biological fluids or a mixture thereof. Biological fluids of the disclosure may be processed to generate, for example, an analyte composition of the disclosure. In some embodiments, the method of detecting at least one biomolecule in a biological fluid comprises processing the biological fluid to retain the at least one biomolecule and to remove one or more components other than the at least one biomolecule to produce an analyte composition. Analyte compositions of the disclosure may comprise each and every metabolite comprised by the biological fluid from which they are derived. The analyte composition can, for example, comprise a plurality of metabolites which can be identified and quantified using the compositions and methods of the disclosure.

Highly Multiplexed Reactions

[0119] The compositions and methods of the disclosure satisfy a long-felt need in the field for the highly multiplexed detection of unknown biomolecules in a complex biological fluid. The multiplexed nature of the compositions and methods of the disclosure provide a snapshot of an individual's health measured, for example, by the identification and quantification of each and every metabolite present in a blood sample of the individual's peripheral circulating blood. By conventional methods, a similar test, referred to as the "SMAC 80" uses about four vials of blood, multiple test centers and over a week of time to provide readings on the levels of 80

measurements in an individual's blood. In sharp contrast, the compositions and methods of the disclosure could identify tens of thousands of metabolites, including each measurement provided by the existing technology, with tens of thousands of additional biomolecules as well as measure a concentration of each biomolecule in less than a vial of the individual's blood in less than one day.

[0120] The compositions and methods of the disclosure provide a similarly powerful analytical capacity even when the fluid is unknown or the fluid is a mixture of fluids.

[0121] The compositions and methods of the disclosure provide a particular advantage for diagnosis or monitoring of treatment efficacy as the identity of the biomolecule does not need to be known prior to contacting the fluid with a NAB composition of the disclosure. Powerful diagnostic panels may be discovered wherein the panel identified using the compositions and methods of the disclosure can include tens of thousands of biomarkers, providing a far more sophisticated and complete diagnostic and statistical tool than any existing technology.

[0122] The multiplexed reactions of the disclosure may be used for the discovery of novel NABs and for generating diverse NAB libraries. Moreover, because the process of NAB discovery is much faster and less expensive using the compositions and methods of the disclosure, specific libraries may be produced for example, for evaluating particular biological fluids, for evaluating particular disease states, for detecting the presence of contamination in a consumer biological, and for screening participants in clinical trials or determining an individual's responsiveness or resistance to a particular therapy.

[0123] Multiplexed analyses begin, for example, by contacting a biological fluid or an analyte composition with a NAB composition of the disclosure to produce a reaction composition. The reaction composition may be analyzed by any high-throughput screening method, including array detection. When the biological fluid or analyte composition, NAB composition, and reaction composition are formulated as droplets, the contacting and detection steps may be performed, for example, on a microfluidic device, including a microfluidic chip.

Measurement of Biomolecule Concentration

[0124] The compositions and methods of the disclosure comprise discovering concentration sensitive NABs within the plurality of NABs. A group of NABs, each recognizing the same specific biomolecule, can have different affinities of interaction. This allows for the

quantification of specific biomolecules within an analyte composition. For example, high affinity NABs detach from a solid support at lower specific biomolecule concentrations, whereas, lower affinity NABs detach from a solid support at higher specific biomolecule concentrations.

Nucleic Acid Biosensors (NABs)

[0125] The compositions and methods of the disclosure comprise modular NABs. Exemplary NABs of the disclosure may comprise variable regions and constant regions. A variable region of each NAB of the disclosure may comprise at least one biomolecule binding domain.

Alternatively, a group of paired, short variable and constant regions may comprise at least one biomolecule binding domain. A constant region of each NAB of the disclosure may comprise one or more of an affinity reagent, a ligand-binding region an enzymatic domain, attachment points for split proteins or a binding site for enzymes. In some embodiments, the constant region of each NAB of the disclosure comprises an affinity reagent. In some embodiments, the variable region of each NAB of the disclosure comprises an affinity reagent. NABs may comprise two separate molecules, which may be linked by ligation or by chemical covalent cross-linking.

[0126] With respect to modularity, the variable region of each NAB may bind the at least one biomolecule while the constant region of each NAB may bind a selection ligand or hybridize with a sequence operably-linked to a surface, either prior to contacting a biomolecule and transforming into an activated NAB or after contacting a biomolecule and transforming into an activated NAB.

[0127] NABs of the disclosure may comprise a reporter construct and, optionally, a quencher construct. Reporter constructs may comprise a detectable label or a releasable signal. Quencher constructs may prevent the detection of a label or suppress the release of a signal while the quencher construct is in close proximity to the reporter construct. For example, the quencher construct may prevent the detection of a label or suppress the release of a signal while the quencher construct is operably liked to the reporter construct or operably-linked to a site nearby the reporter construct such that the quencher construct inhibits an activity of the reporter construct or sterically hinders the reporter construct.

[0128] Reporter constructs may comprise a fluorophore, a chromophore or a combination thereof. NABs of the disclosure may enhance the fluorescence of chromophores. For example, when bound to specific nucleic acid sequences that bind biomolecules, the dye Malachite Green exhibits enhanced fluorescence. Likewise, the core chromophore of Green Fluorescent Protein (GFP) can be coordinated by a nucleic acid that binds a biomolecule called Spinach, which enhances the chromophore fluorescence by over 2000-fold.

[0129] The compositions and methods of the disclosure comprise NABs that further comprise a DNA sequence, an RNA sequence, an XNA sequence, a peptide sequence, or a hybrid molecule. A variety of non-naturally occurring nucleotides, possessing non-natural bases, backbones, or a combination thereof, may be used in the compositions and methods of the disclosure.

[0130] Exemplary non-naturally-occurring nucleotides comprising a non-natural base include, but are not limited to, dBTP, dKTP, dPTP, dXTP and dZTP. Exemplary non-naturally-occurring nucleotides comprising a non-natural base, but are not limited to, dlnDTP, d5FITP, dAITP, dNITP, dCHITP, dCEITP, d5PhITP, d5NapITP and d5AnITP. Exemplary non-naturally- occurring nucleotides comprising a non-natural backbone, but are not limited to, CeNA

(cyclohexenyl nucleic acids), ANA (arabinonucleic acids), FANA (2'-fluoro-arabinonucleic acid), TNA (a-L-threofuranosyl nucleic acids) and LNA (2'-0, 4'-C-methylene-P-D-ribonucleic acids; locked nucleic acids).

[0131] NABs of the disclosure may also comprise two affinity reagents and a variable region, for example. The variable region can further comprise a biomolecule binding domain, a constant region, a second variable region wherein the variable region contains a biomolecule binding domain, and at least one attachment site for operably-linking to a solid support. The constant region further comprises a self-cleaving ribozyme (e.g. Hammerhead ribozyme) or

deoxyribozyme, for example. The plurality of NAB s can be attached to a solid support via a first attachment site or affinity reagent. The affinity reagent can further comprise an antibody, a peptide, a nucleic acid, a small molecule that specifically binds a target molecule, or a combination thereof.

[0132] Each NAB of the plurality of NABs may also comprise a first variable region comprising a first biomolecule-binding domain, a constant region, a second variable region comprising a second biomolecule-binding domain and, optionally, an attachment site for operably linking to a solid support. The constant region of the NAB, for example, comprises a sequence having sufficient complementarity to hybridize to a constant region of a second nucleic acid comprising an attachment site for operably linking to a solid support. Optionally, the constant region of the NAB may comprise a fluorophore construct, the signal from which, in the absence of binding to a biomolecule, the hybridization of the constant region of NABs and the second nucleic acid is disrupted, releasing the activated NAB from the solid substrate and, optionally, separating the fluorophore and the quencher to produce a detectable signal.

[0133] NABs of the disclosure may comprise a ligand-binding domain that is capable of binding to a selection ligand. Binding of a biomolecule may result in binding of the resultant activated NAB to the selection-ligand.

[0134] In some embodiments of the NABs of the disclosure, a NAB comprises a variable region that may bind at least one biomolecule. Upon binding of the biomolecule to the variable region, the NAB switches from an inactivated NAB to an activated NAB. The activated NAB can then be detected, thereby allowing for the detection of the biomolecule within a biological fluid of interest.

[0135] In some embodiments of the NABs of the disclosure, a NAB can comprise an enzymatic domain, wherein the switch from an inactivated NAB to an activated NAB upon binding of a biomolecule induces the activity of the enzymatic domain. Following the activity of the enzymatic domain, the activated NABs can be detected using methods known in the art. This embodiment is referred to as the "induced activity" mode. In a non-limiting example, upon the binding of a biomolecule to an inactivated NAB comprising an enzymatic domain, the activity of the enzymatic domain is induced such that the NAB self-cleaves. This self-cleavage can result in a release from a surface. The released, activated NABS can then be detected using methods known in the art. In some embodiments, the enzymatic domain can be a ribozyme. In some embodiments, the ribozyme can be self-cleaving. Examples of the induced activity mode are shown in Figs. 3 and 4.

[0136] In some embodiments of the NABs of the disclosure, a NAB can comprise a first variable region comprising a first biomolecule-binding domain, a constant region, a optional second variable region comprising a second biomolecule-binding domain and, an optional attachment site for operably linking to a first solid support. In this embodiment, the constant region of the NAB comprises a sequence having sufficient complementarity to hybridize to a constant region of a second nucleic acid comprising an attachment site for operably linking to a second solid support. Upon binding of a biomolecule to the first variable region and/or the second optional variable region, the hybridization of the constant region of the NAB and the second nucleic acid is disrupted, releasing the activated NAB from the second solid substrate. This embodiment is referred to as the "induced hybrid disruption" mode.

[0137] In some embodiments of the compositions and methods of the disclosure, including those wherein the method comprises a induced hybrid disruption mode, a NAB can comprise a first variable region comprising a first biomolecule-binding domain, a constant region, an optional second variable region comprising a second biomolecule-binding domain, an optional attachment site for operably linking to a first solid support and a detectable label. In some embodiments, the constant region of the NAB comprises a sequence having sufficient complementarity to hybridize to a constant region of a second nucleic acid comprising a quencher molecule. The second nucleic acid comprising the quencher molecule can be operably linked to the NAB. In the inactivated state, the constant region of the NAB and the second nucleic acid comprising the quencher molecule are hybridized such that the signal from the detectable label is quenched. Upon binding of a biomolecule to the first variable region and/or the second optional variable region, the hybridization of the constant region of the NAB and the second nucleic acid is disrupted, releasing the quencher molecule, resulting in a the generation of a signal from the detectable label. Examples of the induced hybrid disruption mode are shown in Figs. 5-7.

[0138] In some embodiments of the NABs of the disclosure, a NAB can comprise a variable region comprising a first biomolecule-binding site, a transducer domain, and a constant region comprising a selection ligand-binding site. In the inactivated form, the constant region exhibits low affinity binding to the selection ligand. Upon binding of a first biomolecule to the variable region, the NAB becomes activated, resulting in a conformational change that dramatically increases the affinity of the constant region for the selection ligand, allowing for activated NABs to be captured via the selection ligand. This embodiment is referred to as the "induced affinity" mode. Examples of the induced affinity mode are shown in Figs. 9-11.

Biomolecules

[0139] The compositions and methods of the disclosure identify, select and quantify at least one biomolecule within a complex biological fluid or an analyte composition. Alternatively, or in addition, the compositions and methods of the disclosure identify, select and quantify tens of thousands of biomolecules within a complex biological fluid or an analyte composition.

[0140] Exemplary biomolecules of the disclosure comprise metabolites. Metabolites of the disclosure include, but are not limited to, products of cellular activity and intermediates of cellular signaling cascades. Metabolites of the disclosure include, but are not limited to, intracellular and extracellular molecules. Metabolites of the disclosure include, but are not limited to, components of catabolic and anabolic reactions for synthesizing biological molecules as intracellular or extracellular pathways. Metabolites of the disclosure include, but are not limited to, breakdown products of drugs, prodrugs, supplements and dietary supplements.

Metabolites of the disclosure include, but are not limited to, breakdown products of food.

Metabolites of the disclosure include, but are not limited to, components of the endocrine and neuroendocrine systems. Metabolites of the disclosure include, but are not limited to,

intercellular and intracellular signaling molecules. Metabolites of the disclosure include, but are not limited to, salts, sugars, proteins, electrolytes or any combination thereof. Metabolites of the disclosure include, but are not limited to, one or more self or foreign antigens that may stimulate an individual's immune system.

[0141] The variability of metabolite levels can indicate various states of health, food and beverage quality, and environmental toxicity. Exemplary biomolecules of the disclosure include, but are not limited to, small organic molecules, primary metabolites, central metabolites, secondary metabolites, ions, nucleic acids, and amino acids. In certain embodiments of the biomolecules of the disclosure, the biomolecules or metabolites selectively bound by one or more NABs of the disclosure are equal to or less than 500 kilo Daltons (kDa).

Biological Fluids

[0142] The compositions and methods of the disclosure can identify, select and quantify biomolecules within a complex biological fluid. A biological fluid can reference any bio-organic fluid produced by an organism. In the context of the disclosure, biological fluids comprise a solid or a semi-solid that has been converted into a liquid, a liquid, or a combination thereof.

[0143] Biological fluid in the disclosure can be processed, unprocessed or raw. The biological fluid can, for example, be processed to produce an analyte composition containing metabolites. Such processing can include filtration by standard methods, for example, by size-exclusion chromatography or gel filtration. The analyte composition can contain one or many different metabolites. The analyte composition can also contain one or many of the same metabolites.

[0144] A biological fluid in the disclosure can be any bodily fluid. These biological fluids can be obtained from patients or any number of subjects. Such bodily fluids comprise urine, blood, whole blood, blood serum, blood plasma, peripheral blood, saliva, tears, breast milk, sebum, semen, cerumen, fecal matter, synovial fluid, lymph fluid, interstitial fluid, sweat, cerebrospinal fluid (CSF), an amniotic fluid, plural effusion or a pericardial effusion.

[0145] A biological fluid can also be a synthetic fluid, such as a consumer biological. For example, consumer biologicals can include beverages, food, cosmetics, perfumes, or dietary supplements. Consumer biologicals can also include drugs, prodrugs, drug intermediates, drug products, or combinations thereof. The compositions and methods of the disclosure can detect unknown metabolites in complex biological fluids or mixtures thereof, of known or unknown identify or origin.

Analyte Compositions

[0146] Biological fluids of the disclosure can be processed or unprocessed/raw. The biological fluid can, for example, be processed to produce an analyte composition containing metabolites. Such processing can include filtration by standard methods, for example, by size-exclusion chromatography or gel filtration. The analyte composition can contain one or many different metabolites. The analyte composition can also contain one or many of the same metabolites. Surfaces

[0147] Compositions and methods of the disclosure enable the selection and detection of at least one NAB or biomolecule by, for example, binding a selection ligand or hybridizing to a nucleic acid sequence containing an attachment site to operably-link the NAB or the biomolecule to a surface. The surface can be a liquid surface, a solid surface, a biological surface, or a

combination thereof.

[0148] For example, a solid surface can include a solid support, a solid-phase substrate, a bead, a polymer, a composite, a carbon composite, a plastic, a glass, a substantially planar surface, a lateral-flow strip, a multiplexed array, or a combination thereof.

[0149] The liquid surface can include a droplet, for example, those generated for microfluidic detection protocols. The droplet is formulated for flowing through a microfluidic channel. The droplet can also comprise one or more reagents to reduce sheering forces and/or facilitate movement of the droplet through the microfluidic channel. The droplet further comprises one or more reagents to facilitate contact with a second droplet, producing a product or reaction droplet. The second droplet can comprise an analyte composition.

[0150] Support surfaces can also include biological surfaces such as a cell surface or a cell membrane surface. The biological surface can be isolated from a cell or derived from a cell. The biological surface can also be synthetic. For example, the biological surface can recapitulate one or more components of a transcriptome, secretome, proteome, microenvironment, stem cell, differentiated cell, tissue or system. Such biological surface can be comprised on a microchip.

[0151] The support surfaces can further comprise selection ligands, wherein the selection ligand binds to an affinity reagent and/or a ligand binding region within the constant region. The selection ligand can also bind to an affinity reagent and/or a ligand binding region within the variable region.

[0152] The support surface can also comprise a lateral flow strip. Binding of an activated NAB to the ligand produces, for example, a positive signal on the lateral flow strip. On this support, inactive NABs which have not bound an analyte are captured further down the lateral-flow strip by the secondary ligand-binding domain, for example, producing a signal in the negative control region. The later flow strip comprises a positive detection control and a negative detection control. [0153] In some embodiments of the compositions and methods of the disclosure, at least two different types of NABs can be multiplexed on an individual lateral flow strip to allow for distinct fingerprint measurements of at least two biomolecules. An individual lateral flow strip can be designed such that the NABs that are multiplexed on the strip correspond to biomolecules typically found in a particularly type of biological fluid. In a non-limiting example, a lateral -flow strip can be designed to test for water purity. A lateral-flow strip designed to test for water purity can comprise NABs that bind to and recognize Legionella, cellular products from dangerous amoeba, and/or known water-borne toxins. In another non-limiting example, a lateral-flow strip can be designed to test for illegal recreational drugs. A lateral-flow strip designed to test for illegal recreational drugs can comprise NABs that bind to and recognize the illegal drug molecules and/or the various metabolites associated with the metabolism of the illegal drugs. In another non-limiting example, a lateral-flow strip can be designed to monitor diabetes. A lateral- flow strip designed to monitor diabetes can comprise NABs that bind to and recognize metabolites that are present in a variety of biological fluids (e.g. saliva, blood, serum, urine) that are associated with diabetes.

Arrays

[0154] Exemplary arrays of the disclosure comprise a plurality of apertures. In some

embodiments of the arrays of the disclosure, the apertures are nanoapertures.

[0155] In some embodiments of the arrays of the disclosure, the array comprises at least 5, at least 10, at least 50, at least 100, at least 200, at least 500, at least 1000, at least 2500, at least

5000, at least 7500, at least 10,000, at least 20,000, at least 50,000 or any number in between of nanoapertures.

[0156] In some embodiments of the arrays of the disclosure, each nano aperture of the plurality of nanoapertures has a diameter of about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45 or about 50 nanometers. In some embodiments of the arrays of the disclosure, each nanoaperture of the plurality of nanoapertures has a diameter of about 20 nanometers. In some embodiments of the arrays of the disclosure, each nanoaperture of the plurality of nanoapertures has a diameter of 20 nanometers.

[0157] In some embodiments of the arrays of the disclosure, the array is comprised of glass. In some embodiments, the glass is derived from a silicone composition subjected to heat until the glass formed. In some embodiments, the plurality of nanoapertures are derived from nanopillars or were formed initially as nanopillars that are truncated or broken off to form nanoapertures. In some embodiments, the plurality of nanoapertures are derived from nanopillars or were formed initially as nanopillars that are each surrounded by a layer of gold particles prior to truncation of the nanopillars to form nanoapertures.

[0158] In some embodiments of the arrays of the disclosure, the array is positioned between a VCSEL (Vertical Cavity Surface Emitting Lasers) or a microlaser array and a detector.

Alternatively, in some embodiments of the arrays of the disclosure, the array is positioned between an array of light emitting diodes (LEDs) and a detector. In some embodiments, each microlaser or LED aligns with an aperture or a nanoaperture of the array of the disclosure. In some embodiments, an interaction of a gold particle with an activated NAB within at least one aperture or nanoaperture produces a plasmon. In some embodiments, the plasmon enables transmission of the light form the microlaser or the LED through the aperture or the

nanoaperture where it is detected by the detector positioned above the array of the disclosure. Using this method, between one and tens of thousands of activated NABs can be detected simultaneously.

NAB libraries

[0159] The disclosure provides a composition comprising a structured library of a NAB comprising the nucleic acid sequence

CTCTCGGGACGACCGCGGTAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC (SEQ ID NO: 3). In some embodiments, the NAB binds to CP*RH(III)-derivatized L-tryptophan and can assume three different stem-loop structures. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising the nucleic acid sequence

CTCTCGGGACGACCNNNNNNNNNNNNACCTAAAGCGGNNNNNNGTCGTCCC (SEQ ID NO: 5), wherein N is any nucleotide. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising the nucleic acid sequence

CTCTCGGGACGACCNNNNNNNNCTTAACCTAAAGNNNNNNNNGGTCGTCCC (SEQ ID NO: 6), wherein N is any nucleotide. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising the nucleic acid sequence CTCTCGGGACGACCGCGGTAGTCTTAACCTAAAGCGNNNNNNNGTCGTCCC (SEQ ID NO: 7), wherein N is any nucleotide.

[0160] The disclosure provides a composition comprising a structured library of a NAB comprising the nucleic acid sequence

CTCTCGGGACGACGGGGTCACAGGGGTCCGGGTGTGGGTGGTTGTCGTCCC (SEQ ID NO: 4). In some embodiments, the NAB binds to CP*RH(III)-derivatized L-tryptophan and can assume two different G-quadruplex structures. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising the nucleic acid sequence

CTCTCGGGACGACGGGNNNNNNGGGNNNNGGGNNNNNNNNNNNGTCGTCCC (SEQ ID NO: 10), wherein N is any nucleotide. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising the nucleic acid sequence

CTCTCGGGACGACGGGGNNNNNGGGNNNNGGGNNNGGGNNNNNGTCGTCCC (SEQ ID NO: 11), wherein N is any nucleotide.

[0161] The disclosure provides a method of designing a structured library of NABs. In some embodiments, the method comprises selecting a NAB as a starting scaffold. In some

embodiments, the NAB can comprise a variable region that binds to a biomolecule. Optionally, in some embodiments, the method of designing a structured library comprises using secondary structure prediction programs to identify potential ligand binding domains in the starting scaffold. In some preferred embodiments, the starting scaffold can assume a stem-loop structure or a G-quadruplex structure. In some embodiments, the method further comprises selecting at least one nucleotide position within the starting scaffold to replace with a random nucleotide. In some embodiments, at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotide positions within the starting scaffold can be replaced with a random nucleotide. In some embodiments, a structured library of NABs can be used to identify new NABs with improved characteristics, such as, but not limited to, increased binding affinity, increased binding specificity or increased stability.

[0162] The disclosure provides a composition comprising a trimer scanning library of a NAB comprising the nucleic acid sequence GGAGACTCCTGGGACGACCGCGGTAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC GATGCTGCATACGTAA (SEQ ID NO: 12). In some embodiments, the NAB binds to CP*RH(III)-derivatized L-tryptophan and can assume a stem-loop structure. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising any of the nucleic acid sequences presented in Table 1. In Table 1, N corresponds to any nucleotide.

[0163] Table 1. Trimer Scanning Library Sequences for a stem-loop NAB

[0164] The disclosure provides a composition comprising a trimer scanning library of a NAB comprising the nucleic acid sequence

GGAGACTCCTGGGACGACGGGGTCACAGGGGTCCGGGTGTGGGTGGTTGTCGTCCC GATGCTGCATACGTAA (SEQ ID NO: 22). In some embodiments, the NAB binds to CP*RH(III)-derivatized L-tryptophan and can assume a G-quadruplex structure. In some embodiments, the library comprises a plurality of nucleic acid molecules comprising any of the nucleic acid sequences presented in Table 2. In Table 2, N corresponds to any nucleotide.

[0165] Table 2. Trimer Scanning Library Sequences for a G-quadruplex NAB

SEQ ID

Sequence

NO:

GGAGACTCCTGGGACGACGGGGN NCAGGGGTCCGGGTGTGGGTGGTTGTCGTCCC

23 GATGCTGCATACGTAA

GGAGACTCCTGGGACGACGGGGTCNNNGGGGTCCGGGTGTGGGTGGTTGTCGTCCC

24 GATGCTGCATACGTAA

GGAGACTCCTGGGACGACGGGGTCACAGGGGN NGGGTGTGGGTGGTTGTCGTCCC 25 GATGCTGCATACGTAA

GGAGACTCCTGGGACGACGGGGTCACAGGGGTCCGGGN NGGGTGGTTGTCGTCCC

26 GATGCTGCATACGTAA

GGAGACTCCTGGGACGACGGGGTCACAGGGGTCCGGGTGTGGGN NTTGTCGTCCC

27 GATGCTGCATACGTAA

GGAGACTCCTGGGACGACGGGGTCACAGGGGTCCGGGTGTGGGTGN NGTCGTCCC

28 GATGCTGCATACGTAA

[0166] The disclosure provides a method of designing a trimer scanning library of a NAB. In some embodiments, the method comprises selecting a NAB as a starting scaffold. In some embodiments, the NAB can comprise a variable region that binds to a biomolecule. Optionally, in some embodiments, the method of designing a trimer scanning library comprises using secondary structure prediction programs to identify potential ligand binding domains in the starting scaffold. In some preferred embodiments, the starting scaffold can assume a stem-loop structure or a G-quadruplex structure. In some embodiments, the method further comprises selecting three nucleotide positions within the starting scaffold to replace with a random nucleotide. Since each library has 3 variable position, and each position can be 1 of 4

nucleotides, each library contains a total of 64 different NABs (4 x 4 x 4 =64). In other words, each library is said to have a degeneracy of 64. In some embodiments, a trimer scanning library of a NAB can be used to identify new NABs with improved characteristics, such as, but not limited to, increased binding affinity, increased binding specificity or increased stability.

[0167] The disclosure provides a method of screening for novel NABs using a microarray-based library. . In some embodiments, the e method comprises selecting a NAB as a starting scaffold. . In some embodiments, the NAB can comprise a variable region that binds to a biomolecule. In some preferred embodiments, the starting scaffold can assume a stem-loop structure or a G- quadruplex structure. . In some embodiments, the method further comprises selecting at least one, at least two, at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29 or at least 30 nucleotide positions within the starting scaffold to be replaced with a random nucleotide. In a non-limiting example in which 10 positions are selected to be replaced with random nucleotides, given there are 4 different nucleotides, the number of possible NABS within the library is 1,048,576 (4 ¹⁰ ). . In some embodiments, the NAB sequences within the library can be coupled to a solid support such as an ordered microarray, to allow for exhaustive screening of analytic binding using techniques known in the art, such as a fluorescence microarray reader. In a non-limiting example, a biotin- labeled NAB library can be coupled to a solid support coated with streptavidin. . In some embodiments using a printed microarray, since every spot on a commercial microarray has roughly the same number of printed nucleic acid molecules, quantification of NAB affinity can be achieved by directly comparing fluorescent signals obtained from each spot.

NAB-coated beads

[0168] The disclosure provides a composition comprising a plurality of beads coated with a plurality of an inactive NAB. In some embodiments, the inactive NAB can be linked to the beads via the constant region of the NAB. In a non-limiting example, the constant region of the NAB can comprise an affinity reagent that binds to a capture reagent present on the plurality of beads. In a non-limiting example, the affinity reagent can be a polynucleotide that hybridizes to a complementary sequence that is operably linked to the plurality of beads. In another non-limiting example, the constant region of the NAB can comprise biotin and the plurality of beads can comprise streptavidin.

[0169] The disclosure provides a method of identifying the presence of a biomolecule in a biological fluid comprising incubating a plurality of beads coated with a plurality of an inactive NAB in the biological fluid. In some embodiments, the inactive NAB can comprise a constant region that links the inactive NAB to the plurality of beads. The inactive NAB can also comprise a variable region that binds a biomolecule. In some embodiments, upon binding of the biomolecule to the variable region, the inactive NAB is transformed into an active NAB which can be detected to determine the presence of the biomolecule in the biological fluid.

[0170] In some embodiments of the compositions and methods of the disclosure, a first plurality of beads coated with a plurality of a first NAB can be mixed with at least a second plurality of beads coated with a plurality of at least a second NAB, thereby creating a mixed population of beads. In some embodiments, the first NAB and the at least second NAB can specifically bind to different biomolecules. Any number (e.g. 1, 2, 3, 4, 5, 6, 7 8, 9, 10, 100, 200, 500, 1000, 10,000, 100,000, or 1,000,000) of pluralities of beads coated with a NAB can be mixed together to create a mixed population of beads. In some embodiments, each plurality can be coated with a NAB that binds to a different biomolecule. [0171] The disclosure provides a method of identifying the presence of at least two biomolecules in a biological fluid comprising incubating a mixed population of beads in the biological fluid, wherein the mixed population of beads comprises at least two pluralities of beads, wherein each plurality of beads is coated with a plurality of an inactive NAB. In some embodiments, an inactive NAB can comprise a constant region that links the inactive NAB to the plurality of beads. In some embodiments, an inactive NAB can also comprise a variable region that binds a biomolecule. In some embodiments, upon binding of the biomolecule to the variable region, the inactive NAB is transformed into an active NAB which can be detected to determine the presence of a biomolecule in the biological fluid. In some embodiments, within the mixed population of beads, different active NABs that comprise a variable region that bind to different biomolecules can be detected distinctly to identify the presence of at least two biomolecules in the biological fluid.

[0172] The disclosure provides a composition comprising a plurality of beads coated with a first plurality of an inactive NAB and an at least second plurality of an inactive NAB, wherein the first plurality of an inactive NAB and the at least second plurality of an inactive NAB bind to different biomolecules.

[0173] The disclosure provides a NAB comprising the nucleic acid sequence

CTCTCGGGACGACCGCCCTAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC (SEQ ID NO: 1) with an ATTO 488 fluorophore attached to the 5' end. In some embodiments, the NAB binds to pentamethylcyclopentadienyl-rhodium(III) (CP*RH(III)) derivatized L-tryptophan. In some embodiments, the NAB can also bind a quencher-bearing oligonucleotide (QBO). In some embodiments, when the QBO is bound to the first NAB, the QBO quenches the ATTO 488 fluorophore that is attached to the NAB. However, when the first NAB binds to derivatized L- tryptophan, the QBO is displaced, resulting in the generation of a fluorescent signal due to the dequenching of the ATTO 488 fluorescence. The disclosure also provides a plurality of beads coated with the preceding NAB.

[0174] The disclosure provides a NAB comprising the nucleic acid sequence acid sequence CTCTCGGGACGACGGCCCGATCTCAGAGTAGTCGTCCC (SEQ ID NO: 2) with an ATTO 565 fluorophore attached to the 5' end. In some embodiments, the NAB binds to

pentamethylcyclopentadienyl-rhodium(III) (CP*RH(III)) derivatized L-tyrosine. In some embodiments, the NAB can also bind a quencher-bearing oligonucleotide (QBO). In some embodiments, when the QBO is bound to the NAB, the QBO quenches the ATTO 565 fluorophore that is attached to the NAB. However, when the NAB binds to derivatized L- tyrosine the QBO is displaced, resulting in the generation of a fluorescent signal due to the dequenching of the ATTO 565 fluorescence. The disclosure also provides a plurality of beads coated with the preceding NAB.

CUSP detector systems

[0175] The disclosure provides a CUSP detector system comprising a plurality of NABs that detect and/or quantify a plurality of biomolecules in a biological fluid.

[0176] In some embodiments of the detector systems of the disclosure, a CUSP detector system comprises a particular set of NABs specific to the type of biological fluid to be analyzed. In some embodiments, these sets of NABs can be generated using a selection process in which a particular biological fluid is first chemically separated to yield sub-samples with reduced number of analytes. In some embodiments, the sub-samples can then be passed over a collection of structured NAB arrays and NABs that bind to analytes within these sub-samples can be collected. In some embodiments,the NABs that are collected can then be matched to the biomolecule to which they bind through affinity purification using the NAB or further separation chemistry confirmed by MS. In some embodiments, for each biological fluid, one could recover a number of different NABs, each with a different binding characteristic. In some embodiments, with a variety of NABs for a given biomolecule, the detection system can more accurately quantify the concentration of the biomolecule. In some embodiments, the response of different sets of NABs to particular biological fluid samples can be quantitatively analyzed to correlate with specific properties. In a non-limiting example, a set of NABs that reacts to a biological fluid derived from especially productive antibody generating tissue culture cells will be distinct from the set of NABs that react to a biological fluid derived from cell lines that are less productive.

[0177] In some embodiments of the detector systems of the disclosure, a CUSP detector system is laboratory-based. In some embodiments, the CUSP detector system can have built-in capacity for the routine (minutes to hours intervals) measurement of a fairly large number of distinct biomolecules (e.g. 10, 100, 1000, 10,000, 100,000 distinct biomolecules). In some embodiments, there can be built-in capacity for the measurement of many (e.g. 24, 48, 96, 384 or 1536 wells) samples simultaneously. In some embodiments, a laboratory-based CUSP detector system can comprise at least one aperture array, wherein an aperture array comprises an ordered array of at least one cluster of NABs, wherein each cluster of NABs within the ordered array can be independently imaged such that the activation of NAB clusters allows for the quantitative measurement of biomolecules. The imaging and image processing can be handled by an onboard computer.

[0178] In some embodiments of the detector systems of the disclosure, a laboratory-based CUSP detector can read and process a wide variety of ordered NABs on aperture arrays. In a non- limiting example, for an application designed for the production of clinical biologicals, such as monoclonal antibodies, the aperture arrays would bear NABs recognizing amino acids, vitamins and a wide variety of tissue culture cell products, known to be important to the health of the cells in the context of antibody production.

[0179] In some embodiments of the detector systems of the disclosure, including those wherein the detector system is a laboratory-based CUSP detector, there can be a distinct ordered NAB aperture array for many different biological fluids, including, but not limited to, urine, blood, saliva, tears, sweat, drinking water, and a wide range of relevant biological fluids in a commercial, diagnostic or environmental setting. In some embodiments, the distinct ordered NAB aperture arrays would comprise NAB collections most relevant for the measurement of the particular biological fluid.

[0180] In some embodiments of the detector systems of the disclosure, a CUSP detector system is a portable platform. In some embodiments, a portable CUSP detector system is of a size that can be conveniently transported from place to place, preferably by a single operator. . In some embodiments, a portable CUSP detector system may be used in a hand-held fashion. . In some embodiments, a portable CUSP detector can be self-contained. . In some embodiments, a portable CUSP detector system can carry its own power supply.

[0181] In some embodiments of the detector systems of the disclosure, a portable CUSP detector system can comprise all of the features of a laboratory-based CUSP detector system. In some embodiments, a portable CUSP detector system can comprise at least one aperture array, wherein the aperture array comprises an ordered array of NABS of at least one cluster of NABs, wherein each cluster of NABs within the ordered array can be independently imaged such that the activation of NAB clusters allows for the quantitative measurement of biomolecules. The imaging and image processing can be handled by an on-board computer. [0182] In some preferred embodiments of the detector systems of the disclosure, to reduce size, a portable CUSP detector can have a single sample input. In some embodiments, after the analysis of one sample, the detector system can be flushed to regenerate the ordered NAB array and return the array to an inactive state to allow for subsequent analysis of other samples. In some preferred embodiments, a portable CUSP detector system comprises NABs with an induced-affinity mode of activity.

[0183] In some preferred embodiments of the detector systems of the disclosure, a CUSP detector system is wearable. Preferably, a wearable CUSP detector system is portable enough to be worn on a subject for an extended period of time. Preferably, a wearable CUSP detector system can be self-contained. In some embodiments, a wearable CUSP detector system can carry its own power supply. In some embodiments, a wearable CUSP detector system can comprise an imaging device and computer.

[0184] In some preferred embodiments of the detector systems of the disclosure, a wearable CUSP detector system can comprise a wearable band. A wearable band can be, but is not limited to, a wristband, a waistband, an ankleband, a bracelet, a neck band, a necklace, a head band, a finger band, a ring or an arm band. In some embodiments, a wearable CUSP detector system can be incorporated into clothing garments, including, but not limited to, belt or belt buckle, blouse or shirt, clothing buckle, clothing button, coat or jacket, dress or skirt, glove, hat or cap, headband, hoodie or poncho, neck tie, pants, jeans, or short, shirt or blouse, shoes or boots, socks, sweat suit, and undergarment, underpants, undershirt, bra, or underwear. In some preferred embodiments, a wearable CUSP detector system is worn by a subject such that the CUSP detector system is in contact with skin of the subject. In some embodiments, a wearable device can comprise a patch that is worn against the skin of a subject. Examples of wearable devices are described in US20140180019A1, US Patent No. 8,920,332, US20160058375A1, US20150277559A1, US20170091412A1, US20170079583A1, WO/2018/106249,

WO/2017/132618, US20180064377A, and US Patent No. 9,874,554.

[0185] In some preferred embodiments of the detector systems of the disclosure, a wearable CUSP detector system can comprise at least one aperture array, wherein the aperture array comprises an ordered array of NABs of at least one cluster of NABs, wherein each cluster of NABs within the ordered array can be independently imaged such that the activation of NAB clusters allows for the quantitative measurement of biomolecules. The imaging and image processing can be handled by an onboard imaging device and computer.

[0186] In some preferred embodiments of the detector systems of the disclosure, a wearable CUSP detector system can monitor and analyze the sweat from a subject. In some embodiments, the wearable CUSP detector system can be in contact with the skin of a subject, allowing for movement-driven flow of the sweat over an ordered array of NABs. In some embodiments, as the sweat flows over the ordered array of NABs, the array can be imaged to analyze the sweat sample for the presence or concentration of certain biomolecules.

[0187] In some preferred embodiments of the detector systems of the disclosure, a wearable CUSP detector system can comprise at least one needle. In some embodiments, a needle can be a microneedle or a nanoneedle. In some embodiments, the needle of a wearable CUSP detector system can be used to extract a blood and/or serum sample from a subject to be analyzed using an ordered array of NABs.

[0188] A wearable CUSP detector system may have a feature that communicates with a secondary device. A secondary device can be, but is not limited to, a computer, a smartphone or a server over a wide-area network such as the internet. In a non-limiting example, a wearable CUSP detector system may store data until the wearable CUSP detector system is able to transfer the analysis data to a secondary device for further analysis and/or storage. The secondary device may also act as a relay to transfer data to and/or from the wearable CUSP detector system to and/or from an external service or database or server.

[0189] Data collected by a wearable CUSP detector system may be communicated to external devices through a communications interface. A communications interface may include wireless communication functionality so that when the wearable CUSP detector system comes within range of a wireless base station or access point, the stored data automatically uploads to an Internet-viewable source such as a website. The wireless communications functionality may be provided using one or more communications technologies known in the art, e.g., Bluetooth, RFID, Near-Field Communications (NFC), Zigbee, Ant, optical data transmission, Wi-Fi interfaces, TCP/IP interfaces, etc. A wearable CUSP detector system may also contain wired communication capability, including, but not limited to, USB.

[0190] In some embodiments, the wearable CUSP detector system may transmit and receive data and/or commands to and/or from a secondary electronic device. The secondary electronic device may be in direct or indirect communication with the wearable CUSP detector system. Direct communication refers herein to the transmission of data between a first device and a secondary device without any intermediary devices. For example, two devices may communicate to one another over a wireless connection (e.g. Bluetooth) or a wired connection (e.g. USB). Indirect communication refers to the transmission of data between a first device and a secondary device with the aid of one or multiple intermediary third devices which relay the data. Third devices may include, but are not limited to, a wireless repeater (e.g. WiFi repeater), a computing device such as a smartphone, laptop, desktop or tablet computer, a cell phone tower, a computer server, and other networking electronics. For example, a wearable CUSP detector system may send data to a smartphone which forwards the data through a cellular network data connection to a server which is connected through the internet to the cellular network.

[0191] In some embodiments wherein a wearable CUSP detector system transmits data to a secondary device, e.g. a server or database, the secondary device can receive and/or store and/or analyze data obtained from a plurality of wearable CUSP detector systems from a plurality of users. The data from the plurality of wearable CUSP detector systems can be stored and/or further analyzed using the secondary device. In a non-limiting example, data from a plurality of wearable CUSP detector systems can be used to analyze a population of users to identify trends and patterns within the population.

[0192] In some embodiments wherein a wearable CUSP detector system transmits data to a secondary device, the CUSP detector system may also transmit contextual information associated with the data that was collected. Contextual information includes, but is not limited to, time, location, and/or activity that a user was performing at the time of data collection.

Contextual information can also comprise health and/or demographic information of the user.

[0193] A wearable CUSP detector system can comprise an onboard imaging device. An onboard imaging device can comprise one or more light sources that may emit light having one or more wavelengths. The light sources can include, but are not limited to, suitable coherent light sources (e.g. a laser or a UV light source) or a suitable incoherent light source (e.g. an arc-lamp or a light-emitting diode (LED)). An onboard imaging can comprise one or more photodetectors, including, but not limited to, a charge-coupled device (CCD) imaging sensor, a complementary metal-oxide-semiconductor (CMOS) imaging sensor, or a N-type metal-oxide-semiconductor (NMOS) imaging sensor. An onboard imaging device can comprise emission filters, excitation filters.

EXAMPLES

Example 1 : Selection of NABs using CUSP structural NAB libraries

[0194] Libraries of NABs are generated to include a ligand-binding domain, for example, a Malachite Green binding domain (Fig 10. Depicted as the constant specific ligand binding module), which serves as a reporter region, and a group of short constant regions (that confer secondary or tertiary structure, including but not limited to stem-loops, G-quadruplexes, i-Motifs or Holliday Junctions) and short variable regions, which serves as the biomolecule binding domain. A complex analyte solution containing specific biomolecules (Fig. 10, depicted by blue stars and purple asterisks) is mixed with a library of inactive NABs. Selection of active NABs occurs by induced affinity of the ligand binding domain with its ligand fixed to a solid support.

Example 2: Selection of NABs using CUSP structural NAB libraries in an arrayed format

[0195] There are several instantiations of the solid support from Example 1. CUSP libraries may be arrayed on solid supports either in an ordered arrangement as individual clones, or in a random placement using methods such as 'polony' formation by amplification of single molecules to small (on the order of 1000 molecules) cluster clones (for more description of 'polony' formation, see R.D. Mitra, G.M. Church, In situ localized amplification and contact replication of many individual DNA molecules, Nucleic Acids Res 27(24) (1999) e34). Starting with already purified clones, each clone can be printed and sequenced from the original plate/well position after an analyte binding assay. In the case of unordered arrays, such as on a sequencing platform, the position of the clone on the chip will be recorded along with its sequence. Clones can be either directly printed and covalently affixed to a solid support or amplified in place using covalently affixed primers, but in either case the appropriate single stranded DNA for the NAB library can be generated by the action an exonuclease with either 5' or 3' specificity (e.g. lambda exonuclease or exonuclease) (for more description of exonucleases or lambda exonucleases, respectively, see I.R. Lehman, A.L. Nussbaum, The

Deoxyribonucleases of Escherichia Coli. V. On the Specificity of Exonuclease I

(Phosphodiesterase), J Biol Chem 239 (1964) 2628-36; J.W. Little, Lambda exonuclease, Gene Amplif Anal 2 (1981) 135-45). In the appropriate buffer condition the single stranded DNA NAB will refold. Analyte solutions can be then applied to the array. Using an induced affinity NAB library, for example with Malachite Green enhanced fluorescence, the analyte solution can be applied at a variety of concentrations and for each concentration, the fluorescence of positive NAB clusters can be recorded.

[0196] The NAB libraries used for array-based screening can all be structural NAB libraries. This has the distinct advantage that the variable region complexity of the libraries will be on the same order of magnitude (~10 ⁸ ) as are typical for array technologies. Structural NAB libraries can be of the hybrid disruption, induce affinity forms. Split structural libraries are also applicable. Indeed 'polony' formation may be selected on the successful binding of a biomolecule and consequent ligation of the two halves of the NAB.

Example 3— Beads coated with NABs can identify the presence or absence of a biomolecule in a complex biological fluid.

[0197] The following example shows that a substrate displaying one or more NABS can be used to distinguish between solutions containing different sets of metabolites.

[0198] A first population of beads was coated with a plurality of a first NAB. The first NAB comprised the nucleic acid sequence

CTCTCGGGACGACCGCCCTAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC (SEQ ID NO: 1) with an ATTO 488 fluorophore attached to the 5' end. The first NAB had been previously shown to bind to pentamethylcyclopentadienyl-rhodium(III) (CP*RH(III)) derivatized L-tryptophan. The first NAB can also bind to a quencher-bearing oligonucleotide (QBO). When the QBO is bound to the first NAB, the QBO quenches the ATTO 488 fluorophore that is attached to the NAB. However, when the first NAB binds to derivatized L- tryptophan, the QBO is displaced, resulting in the generation of a fluorescent signal due to the dequenching of the ATTO 488 fluorescence. Accordingly, the first NAB is an example of the hybrid disruption detection method of the present disclosure.

[0199] A second population of beads was coated with a plurality of a second NAB. The second NAB comprised the nucleic acid sequence

CTCTCGGGACGACGGCCCGATCTCAGAGTAGTCGTCCC (SEQ ID NO: 2) with an ATTO 565 fluorophore attached to the 5' end. The second NAB had been previously shown to bind to CP*RH(III)) derivatized L-tyrosine. The second NAB can also bind to a QBO. When the QBO is bound to the second NAB, the QBO quenches the ATTO 565 fluorophore that is attached to the NAB. However, when the second NAB binds to derivatized L-tyrosine the QBO is displaced, resulting in the generation of a fluorescent signal due to the dequenching of the ATTO 565 fluorescence. Accordingly, the second NAB is an example of the hybrid disruption detection method of the present disclosure.

[0200] The first population and second population of beads were incubated together to create a mixed population of beads. With neither derivatized L-tryptophan nor derivatized L-tyrosine present, the mixed population of beads displayed only a basal level of fluorescence signal in the 488 nm wavelength (ATTO 488) and 561 nm (ATTO 565) wavelength channels, as shown in Fig. 27. As shown in the left panel of Fig. 28, when the mixed population of beads is incubated with 0.1 mM derivatized L-tryptophan, a fluorescence signal is recorded only in the 488 nm wavelength (ATTO 488) channel, indicating binding of derivatized L-tryptophan to the first NAB. As shown in the middle panel of Fig. 28, when the mixed population of beads is incubated with 0.1 mM derivatized L-tyrosine, a fluorescence signal is recorded only in the 561 nm wavelength (ATTO 565) channel, indicating binding of derivatized L-tyrosine to the second NAB. As shown in the right panel of Fig. 28, when the mixed population of beads is incubated with both 0.1 mM derivatized L-tryptophan and 0.1 mM derivatized L-tyrosine, a fluorescence signal is recorded in both the 488 nm wavelength (ATTO 488) channel and the 561 nm wavelength (ATTO 565) channel, indicating concurrent binding of derivatized L-tryptophan to the first NAB and binding of derivatized L-tyrosine to the second NAB. These results demonstrate that substrates coated with one or more NABs of the present disclosure can be used to identify the presence or absence of a particular biomolecule in a complex biological fluid.

Example 4— creating structured libraries of NABs with a stem-loop structure

[0201] The following example shows how a structured library can be constructed for a NAB with a stem-loop structure. The structured library can be used to screen for NABs with superior activity, including, but not limited to increased binding affinity for a particular biomolecule.

[0202] A NAB comprising the nucleic acid sequence

ctctcgggacgacCGCGGTAGTCTTAACCTAAAGCGGTGTCAGgtcgtccc (SEQ ID NO: 3) was chosen as a starting scaffold. This NAB, herein referred to as NAB_Trp-Cp*Rh(III)_01, has been shown to comprise a binding site for CP*RH(III)-derivatized L-tryptophan. As a first step towards designing a structured library, secondary structure prediction programs were used to identify potential ligand binding domains. The prediction programs revealed that NAB Trp- Cp*Rh(III)_01 could fold into three different stem-loop structures. These three structures are shown in Fig. 29 and have a folding dG of -8.89, -8.79 and -9.43, left to right.

[0203] Based on the secondary structure predictions, three different structured libraries were designed. In each of the three libraries, the sequence of the stem domains were fixed. Positions within the predicted ligand binding loops were then replaced with random nucleotides.

[0204] In the first library, called the N12N6 library, 18 positions were selected to be replaced with random nucleotides. These 18 positions were positions 15-26 and positions 38-43, as shown in the bottom Fig. 29.

[0205] In the second library, called the NsNs library, 16 positions were selected to be replaced with random nucleotides. These 16 positions were positions 15-22 and positions 35-42, as shown in the bottom Fig. 29.

[0206] In the third library, called the N7 library, 7 positions were selected to be replaced with random nucleotides. These 7 positions were positions 37-43, as shown in the bottom Fig. 29.

[0207] These structured libraries have substantially reduced complexity compared to the libraries used in previous studies, as the variable regions are located within loops of the predicted structures.

Example 5— creating structured libraries of NABs with a G-quadruplex structure

[0208] The following example shows how a structured library can be constructed for a NAB with a G-quadruplex structure. The structured library can be used to screen for NABs with superior activity, including, but not limited to increased binding affinity for a particular biomolecule.

[0209] A NAB comprising the nucleic acid sequence

CTCTCGGGACGACGGGGTCACAGGGGTCCGGGTGTGGGTGGTTGTCGTCCC (SEQ ID NO: 4) was chosen as a starting scaffold. This NAB, herein referred to as NAB Trp- Cp*Rh(III)_07, has been shown to comprise a binding site for CP*RH(III)-derivatized L- tryptophan. As a first step towards designing a structured library, secondary structure prediction programs were used to identify potential ligand binding domains. The prediction programs revealed that NAB_Trp-Cp*Rh(III)_07 could fold into two different G-quadruplex structures, as shown in the top of Fig. 30. The underlines denote the G-tracks of each G-quadruplex structure.

[0210] Based on the secondary structure predictions, two different structured libraries were designed. In each of the three libraries, the sequence of the G-quadruplex domains were fixed. Positions within the predicted ligand binding loops were then replaced with random nucleotides.

[0211] In the first library, called the N21 library, 21 positions were selected to be replaced with random nucleotides. These 21 positions were positions 17-22, positions 26-29 and positions 33- 43, as shown in bottom of Fig. 30.

[0212] In the second library, called the Nn library, 17 positions were selected to be replaced with random nucleotides. These 17 positions were positions 18-22, positions 26-29, positions 33- 35 and positions 39-43, as shown in bottom of Fig. 30.

[0213] These structured libraries have substantially reduced complexity compared to the libraries used in previous studies, as the variable regions are located within loops of the predicted structures.

Example 6— Trimer-scanning library using NABs with a stem-loop structure

[0214] The following is an example of a trimer-scanning library method that can be used to identify new NABs with a higher binding affinity for a particular biomolecule than an originally identified NAB. In this non-limiting example, the originally identified NAB can fold into a stem- loop structure.

[0215] A NAB comprising the nucleic acid sequence

GGAGACTCCTGGGACGACCGCGGTAGTCTTAACCTAAAGCGGTGTCAGGTCGTCCC GATGCTGCATACGTAA (SEQ ID NO: 12) was chosen as a starting scaffold. This NAB, herein referred to as ΝΑΒ_Τφ-Ορ*Κ1ι(ΠΙ)_01, has been shown to comprise a binding site for CP*RH(III)-derivatized L-tryptophan. Secondary structure predictions reveal that NAB Trp- Cp*Rh(III)_01 can fold into a stem-loop structure, as shown in the bottom left panel of Fig. 31.

[0216] For library design, the sequences of the stem domains were fixed. 24 nucleotides within the predicted loop structures were selected to be replaced by random nucleotides. To cover all of the 24 nucleotides, a set of 9 libraries were designed wherein within each library, 3 positions within the NAB were replaced with random nucleotides, as shown in the top panel of Fig. 31. Since each library has 3 variable position, and each position can be 1 of 4 nucleotides, each library contains a total of 64 different NABs (4 x 4 x 4 =64). In other words, each library is said to have a degeneracy of 64.

[0217] Each library was tested for its ability to bind to CP*RH(III)-derivatized L-tryptophan and compared to the binding of NAB_Trp-Cp*Rh(III)_01. To monitor binding, each NAB is labelled with a fluorophore and hybridized to a quencher-bearing oligonucleotide. When the quencher-bearing oligonucleotide is hybridized to the NAB, it quenches the fluorescence of the fluorophore attached to the NAB. Upon binding of CP*RH(III)-derivatized L-tryptophan to the NAB, the quencher-bearing oligonucleotide is displaced, resulting in the dequenching of the fluorophore attached to the NAB, thus the generation of a fluorescent signal.

[0218] Most of the libraries showed binding at various CP*RH(III)-derivatized L-tryptophan concentrations that was comparable to ΝΑΒ_Τφ-Ορ*Κ1ι(ΙΙΙ)_01. However, some libraries showed extremely reduced signal as compared to NAB_Trp-Cp*Rh(III)_01, indicating that the group of three nucleotides that is variable within that library are most likely part of an important CP*RH(III)-derivatized L-tryptophan binding region, or part of a region important for NAB activation (displacement of the quencher-bearing oligonucleotide). As shown in the bottom right panel of Fig. 31, the FT 165 library showed significantly reduced binding activity as compared to NAB_Trp-Cp*Rh(III)_01. In each set of bars, the left bar is NAB_Trp-Cp*Rh(III)_01 binding and the right bar is FT 165 binding.

Example 7— Trimer-scanning library using NABs with a G-quadruplex structure

[0219] The following is an example of a trimer-scanning library method that can be used to identify new NABs with a higher binding affinity for a particular biomolecule than an originally identified NAB. In this non-limiting example, the originally identified NAB can fold into a G- quadruplex structure.

[0220] A NAB comprising the nucleic acid sequence

GGAGACTCCTGGGACGACGGGGTCACAGGGGTCCGGGTGTGGGTGGTTGTCGTCCC GATGCTGCATACGTAA (SEQ ID NO: 22) was chosen as a starting scaffold. This NAB, herein referred to as ΝΑΒ_Τφ-Ορ*Κ1ι(ΠΙ)_07, has been shown to comprise a binding site for CP*RH(III)-derivatized L-tryptophan. Secondary structure predictions reveal that NAB Trp- Cp*Rh(III)_07 can fold into a G-quadruplex structure, as shown in the bottom left panel of Fig. 32. [0221] For library design, the sequences of the G-quadruplex domains were fixed. 16 nucleotides within the predicted ligand binding loops were selected to be replaced by random nucleotides. To cover all of the 16 nucleotides, a set of 6 libraries were designed wherein within each library, 3 positions within the NAB were replaced with random nucleotides, as shown in the top panel of Fig. 32. Since each library has 3 variable position, and each position can be 1 of 4 nucleotides, each library contains a total of 64 different NABs (4 x 4 x 4 =64). In other words, each library is said to have a degeneracy of 64.

[0222] Each library was tested for its ability to bind to CP*RH(III)-derivatized L-tryptophan and compared to the binding of NAB_Trp-Cp*Rh(III)_07. To monitor binding, each NAB is labelled with a fluorophore and hybridized to a quencher-bearing oligonucleotide. When the quencher-bearing oligonucleotide is hybridized to the NAB, it quenches the fluorescence of the fluorophore attached to the NAB. Upon binding of CP*RH(III)-derivatized L-tryptophan to the NAB, the quencher-bearing oligonucleotide is displaced, resulting in the dequenching of the fluorophore attached to the NAB, thus the generation of a fluorescent signal.

[0223] Most of the libraries showed binding at various CP*RH(III)-derivatized L-tryptophan concentrations that was comparable to ΝΑΒ_Τφ^ρ*Κ1ι(ΙΙΙ)_07. However, some libraries showed extremely reduced signal as compared to NAB_Trp-Cp*Rh(III)_07, indicating that the group of three nucleotides that is variable within that library are most likely part of an important CP*RH(III)-derivatized L-tryptophan binding region, or part of a region important for NAB activation (displacement of the quencher-bearing oligonucleotide). As shown in the bottom right panel of Fig. 32, the FT 159 library showed significantly reduced binding activity as compared to NAB_Trp-Cp*Rh(III)_07. In each set of bars, the left bar is NAB_Trp-Cp*Rh(III)_07 binding and the right bar is FT 159 binding.

Example 8-screening for NABS using microarrays

[0224] The following is a non-limiting example of how NAB libraries can be designed and used with printed microarrays to screen for novel NABs.

[0225] First, a random set of 10 positions within potential ligand binding domains of a structured NAB can be selected to be replaced by random nucleotides. With 10 variable positions and four possible nucleotides, the number of possible NABS is 1,048,576 (410). These 1,048,576 NAB sequences can be coupled to a solid support such as an ordered microarray, to allow for exhaustive screening of analyte binding using a fluorescence microarray reader. In a non-limiting example, a biotin-labeled NAB library can be coupled to a solid support coated with streptavidin as shown in Figs. 33 and 34.

[0226] As shown in Figs. 33 and 34, the 10 positions can be screened by changing varying 3 positions at a time, creating libraries with 64 different NABs.

[0227] In some embodiments using a printed microarray, since every spot on a commercial microarray has roughly the same number of printed nucleic acid molecules, quantification of NAB affinity can be achieved by directly comparing fluorescent signals obtained from each spot.

[0228] In some embodiments in which quencher-bearing oligonucleotide is used, the quencher oligonucleotides can be re-hybridized after each use of a microarray, allowing for rapid and cost- effective screening of multiple distinct ligands at multiple distinct concentrations.

INCORPORATION BY REFERENCE

[0229] Every document cited herein, including any cross referenced or related patent or application is hereby incorporated herein by reference in its entirety unless expressly excluded or otherwise limited. The citation of any document is not an admission that it is prior art with respect to any invention disclosed or claimed herein or that it alone, or in any combination with any other reference or references, teaches, suggests or discloses any such invention. Further, to the extent that any meaning or definition of a term in this document conflicts with any meaning or definition of the same term in a document incorporated by reference, the meaning or definition assigned to that term in this document shall govern.

OTHER EMBODIMENTS

[0230] While particular embodiments of the disclosure have been illustrated and described, various other changes and modifications can be made without departing from the spirit and scope of the disclosure. The scope of the appended claims includes all such changes and modifications that are within the scope of this disclosure.