STATEMENT OF PRIORITY

This application cliams the benefit, under 35 U.S.C. §119(e), of U.S. Provisional Application No. 63/342,376, filed May 16, 2022, the entire contents of which is incorporated by reference herein in its entirety.

STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

A Sequence Listing in XML format, entitled 5470-922WO_ST26.xml, 329,537 bytes in size, generated on May 16, 2023, and filed herewith, is hereby incorporated by reference in its entirety for its disclosures.

FIELD OF THE INVENTION

The invention relates to synthetic RNA molecules and nucleic acid constructs comprising the same. The invention further relates to methods of using the synthetic RNA molecules such as to deliver the synthetic RNA molecule to a cell, to treat a disorder in a subject in need thereof such as disorders comprising intragenic nucleotide repeat regions, and to treat Huntington's disease or myotonic dystrophy.

BACKGROUND OF THE INVENTION

Trinucleotide repeat disorders are genetic disorders wherein repeats of three nucleotides within a gene increase in copy number until they cross a threshold above which the gene becomes unstable. Disorders may also be caused by repeats of greater than three nucleotides.

Myotonic dystrophy has two forms. Type 1 (DM1) is caused by an unstable CTG repeat expansion in the DM protein kinase (DMPK) gene. Type 2 (DM2) is caused by unstable CCTG repeat expansion in the cellular nucleic acid-binding protein (CNBP) gene. Excess repeats form double stranded hairpin structures.

Huntington disease is caused by an expanded polyglutamine tract encoded by CAG repeat extension. CAG repeats less than 26 are considered normal, whereas once repeats number more than 35, the mutant Huntingtin (HTT) mRNA produces mutant HTT protein with poly-glutamine, which forms aggregates and causes toxicity on neurons. The present invention overcomes shortcomings in the art by providing synthetic RNA molecules for the treatment of disorders comprising intragenic nucleotide repeat regions.

SUMMARY OF THE INVENTION

One aspect of the present invention relates to a synthetic RNA molecule comprising an antisense strand, wherein the nucleotide sequence of at least a portion of the antisense strand is complementary (e.g., having at least 70% identity) to a portion of the nucleotide sequence of a mammalian gene comprising an intragenic nucleotide repeat region having a 5' end and a 3' end and comprising at least about four or more (e.g., at least about 4, 5, 6, 7, 8, 9, 10 or more) tandem repeats; wherein the nucleic acid molecule degrades and/or inhibits the expression of the mammalian gene mRNA.

In some embodiments, the portion of the antisense strand may be complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 50 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region to about 50 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region (e.g., "the ' J2J' region").

In some embodiments, the portion of the antisense strand may be complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising the about 50 nucleotides upstream of the 5 ¹ end of the intragenic nucleotide repeat region to about 50 nucleotides downstream (within) the 5' end of the intragenic nucleotide repeat region (e g., a region of the gene comprising, consisting essentially of, or consisting of about 50 nucleotides upstream and dow nstream of the 5' end intragenic nucleotide repeat region, i.e., the "5' junction").

In some embodiments, the portion of the antisense strand may be complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 50 nucleotides upstream (within) of the 3' end of the intragenic nucleotide repeat region to about 50 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region (e.g., a region of the gene comprising, consisting essentially of, or consisting of about 50 nucleotides upstream and downstream of the 3' end intragenic nucleotide repeat region, i.e., the "3' junction").

In some embodiments, the portion of the antisense strand may be complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising the 5' end of the intragenic nucleotide repeat region to the 3' end of the intragenic nucleotide repeat region (e.g., a region of the gene comprising, consisting essentially of, or consisting of the intragenic nucleotide repeat region).

Another aspect of the invention provides a nucleic acid construct comprising and/or encoding a synthetic RNA molecule of the present invention.

Another aspect of the invention provides a vector comprising a synthetic RNA molecule and/or nucleic acid construct of the present invention.

In another aspect, the present invention provides a cell (e.g., an in vitro cell) comprising a synthetic RNA molecule, nucleic acid construct, and/or vector of the present invention.

Also provided are compositions comprising one or more synthetic RNA molecule, nucleic acid construct, vector, and/or cell of the present invention. In some embodiments, the composition may comprise two or more synthetic RNA molecules of the invention, e.g., wherein each RNA molecule comprises a different antisense strand.

Also provided are pharmaceutical formulations comprising a synthetic RNA molecule, nucleic acid construct, vector, and/or cell of the present invention in a pharmaceutically acceptable earner.

Also provided is a transgenic animal comprising a synthetic RNA molecule, nucleic acid construct, vector, and/or cell of the present invention.

Another aspect of the present invention relates to a method of delivering a synthetic RNA molecule to a cell (e.g., a muscle cell such as a myoblast, e.g., a neural cell such as cells of the peripheral and central nervous systems, e.g., brain cells such as neurons, oligodendrocytes, glial cells, astrocytes, e.g., spinal cord cells such as cervical, thoracic, lumbar, and/or sacral neurons, dorsal root ganglia cells (DRG; e.g., DRG neurons), the method comprising contacting the cell with the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition of the present invention.

Another aspect of the present invention relates to a method of delivering a synthetic RNA molecule to a cell in a mammalian subject, the method comprising: administering to the subject an effective amount of the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition, thereby delivering the synthetic RNA molecule to a cell in the mammalian subject.

Another aspect of the present invention relates to a method of treating a disorder in a mammalian subject in need thereof, wherein the disorder is treatable by expressing a synthetic RNA molecule in the subject, e.g., in a target organ system of the subject, the method comprising administering to the subject a therapeutically effective amount of the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition, to the mammalian subject under conditions whereby the synthetic RNA molecule is expressed in the subject, e.g., in the target organ system, thereby treating the disorder.

Another aspect of the present invention relates to a method of treating myotonic dystrophy (DM) disorder in a mammalian subject in need thereof, wherein the DM disorder is treatable by expressing a synthetic RNA molecule in the muscular system of the subject, the method comprising administering a therapeutically effective amount of the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition, to the mammalian subject under conditions whereby the synthetic RNA molecule is expressed in the muscular system, thereby treating the DM disorder.

Another aspect of the present invention relates to a method of treating Huntington disease in a mammalian subject in need thereof, wherein the disease is treatable by expressing synthetic RNA molecule in the nervous system of the subject, the method comprising administering a therapeutically effective amount of the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition, to the mammalian subject under conditions whereby the synthetic RNA molecule is expressed in the nervous system, thereby treating the disease.

BRIEF DESCRIPTION OF THE DRAWINGS

FIGS. 1A-1B show schematics of the mechanisms of myotonic dystrophy 1 (DM1) and pathways for treatment, including utilizing artificial miRNAs to inhibit and degrade DMPK mRNA, and/or introducing exogenous expression of muscleblind-like protein. Nucleotides shown in figures for "CUG" repeats in FIG. 1A and FIG. IB are representative only as a schematic and do not necessarily represent any particular sequence.

FIG. 2 shows a schematic map of the mRNA structure of the DMPK gene, as well as the locations targeted by example synthetic RNA molecules of the present invention.

FIGS. 3A-3B show schematic maps of example nucleic acid constructs comprising the synthetic RNA molecules of the present invention generated as related to Example 1.

FIG. 4 shows fluorescence images of transfected cells.

FIG. 5 shows a bar graph of luciferase activity for constructs comprising the noted artificial miRNAs. After 48-hour co-transfection, pEMBL-CMV-hCGin-miR-Ml, M2, M3, M4 and miR-M13 could inhibit luciferase activity, compared with pEMBL-CMV-hCGin (control). *p<0.05; **p<0.01; ***p<0.001 vs AAV9-CMV-hCGin. n=4. MiR-124 as additional negative control. FIG. 6 shows a bar graph of percent luciferase activity as compared to pEMBL- CMV-hCGin (control). *p<0.05; **p<0.01; ***p<0.001 vs AAV9-CMV-hCGin . n=4. MiR- 124 as additional negative control. After 48-hour co-transfection, pEMBL-CMV-hCGin-miR- Ml, M2, M3, M4 and miR-M13 could inhibit luciferase activity about 55.3%, 53.1%, 35.2%, 33.0% and 19.4%, respectively, compared with pEMBL-CMV-hCGin.

FIG. 7 shows a bar graph of luciferase activity (top panel) and % activity compared to control (bottom panel) of AAV9-CMV-hCGin-miR-Ml, M2, M3, M4 and M13. These constructs could inhibit luciferase activity to about 61.9%, 67.7% , 91.4%, 50.1% and 49.9%, respectively, compared with AAV9-CMV-hCGin (control). *p<0.05; **p<0.01; ***p<0.001 vs AAV9-CMV-hCGin . n=4.

FIG. 8 shows images of normal human myoblast cell cultures infected by AAV9- CMV-GFP at MOI of 5 x 10 ⁵ vg/cell.

FIG. 9 shows an image of blot data. The depicted artificial miDMPKs inhibited DMPK gene expression in normal human myoblast. AAV9-CMV-miDMPK-Ml, M2, M3, M4 and M13 could efficiently inhibit DMPK expression as compared with AAV9-CMV- hCGin (control). n=4.

FIG. 10 shows bar graphs of the ratio of DMPK/GAPDH (top panel) and % as compared to control (bottom panel) of artificial miRNAs inhibition of DMPK gene expression in normal human myoblast. AAV9-CMV-miDMPK-Ml, M2, M3, M4 and M13 could efficiently inhibit DMPK expression compared with AAV9-CMV-hCGin (control). As compared with control (100%), the expression of DMPK was 26.1 % (Ml ), 18.1 % (M2). 27.7% (M3), 57.8% (M4) and 20.4% (M13), respectively. **p<0.01, ***p<0.001 vs AAV9- CMV-hCGin. n=4.

FIG. 11 shows images of DM1 patient myoblasts infected by AAV9-CMV-GFP at MOI of 5 x 10 ⁵ vg/cell, with or without Hoechst 33342.

FIG. 12 shows images of blot data in DM1 patient myoblasts. AAV9-CMV-M3, M4 and M13 could efficiently inhibit DMPK expression compared with AAV9-CMV-hCGin (control). n=4.

FIGS. 13A-13C show bar graphs of quantified data in DM1 patient myoblasts. FIG. 13A shows the ratio of wildtype wtDMPK/GAPDH (top panel) and % as compared to control (bottom panel) of artificial miRNAs inhibition of DMPK gene expression, wherein AAV9- CMV-miDMPK-M3, M4 and M13 could efficiently inhibit DMPK expression compared with AAV9-CMV-hCGin (control). *p<0.05 vs AAV9-CMV-hCGin. n=4. FIG. 13B shows the ratio of disease state mutDMPK/GAPDH (top panel) and % as compared to control (bottom panel) of artificial miRNAs inhibition of DMPK gene expression, wherein AAV9-CMV- miDMPK-M3, M4 and Ml 3 could efficiently inhibit DMPK expression compared with AAV9-CMV-hCGin (control). *p<0.05 vs AAV9-CMV-hCGin. n=4. FIG. 13C shows the ratio of total DMPK/GAPDH (top panel) and % as compared to control (bottom panel) of artificial miRNAs inhibition of DMPK gene expression, wherein AAV9-CMV-miDMPK- M3, M4 and M13 could efficiently inhibit DMPK expression compared with AAV9-CMV- hCGin (control). *p<0.05 vs AAV9-CMV-hCGin. n=4.

FIGS. 14A-14B show schematics of the 5'-junction to 3'-junction (J2J) region (FIG. 14A) and further developed artificial microRNAs targeting this region in DMPK (FIG. 14B). Sequence shown in FIG. 14A and 14B comprise the residues representing the J2J region, e.g., residues starting at about residue position 2688 to 2747 of SEQ ID NO:74 (human DMPK). Nucleotide positions and length of J2J region can vary and depend on number of intragenic repeats; as such the nucleotides shown in FIG. 14A and 14B regarding the J2J portion are representative only as a schematic and do not necessarily represent any particular sequence. MiR sequences shown in FIG. 14B are SEQ ID NOs: 14-42.

FIGS. 15A-15B show schematics of the mechanisms of Huntington's disease (FIG. 15A) and pathways for treatment (FIG. 15B), including utilizing artificial miRNAs to inhibit and degrade HTT mRNA. Nucleotides shown in figures for "CAG" repeats and polyglutamine in FIG. 15A and FIG. 15B are representative only as a schematic and do not necessarily represent any particular sequence.

FIG. 16 shows a schematic map of the mRNA structure of the HTT gene, as well as the locations targeted by example synthetic RNA molecules of the present invention.

FIG. 17 shows fluorescence images of transfected cells.

FIG. 18 shows a bar graph of % luciferase activity. After 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT-H2 and miHTT-H5 could efficiently inhibit luciferase activity about 46.4% and 54.8%, respectively, compared with pEMBL-CMV-hCGin (control). **p<0.01 vs pEMBL-CMV-hCGin. n=4.

FIG. 19 shows a bar graph of luciferase activity. After 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT-H14, H15, H17, H19 (miR-137) and miHTT-H21 (miR-216b) could efficiently inhibit luciferase activity compared with pEMBL-CMV-hCGin (control). MiDMPK-M5, M7 and M9 for DMPK are also shown as negative controls. ***p<0.001 vs pEMBLl-CMV-hCGin. n=4.

FIG. 20 shows a bar graph of % luciferase activity. After 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT-H14, H15, H17, H19 (miR-137) and miHTT-H21 (miR-216b) could efficiently inhibit luciferase activity compared with pEMBL-CMV-hCGin (control). Compared with control (100%), the activity of luciferase was 2.5% (H14), 8.8% (H15), 9.2% (H17), 12.9% (miR-137), and 4.2% (miR-216b), respectively. M1HTT-H2, H4 and H5 are shown as positive controls. MiDMPK-M5, M7 and M9 for targeting DMPK gene are also shown as negative controls. ***p<0.001 vs pEMBL-CMV-hCGin. n=4.

FIG. 21 shows a bar graph of luciferase activity. After 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT-H24, H26, H27, H28 and H29 could efficiently inhibit luciferase activity compared with pEMBL-CMV-hCGin (control). MiHTT-H2, H4 and EL5 and MiHTT-H19-21 are shown as positive controls. ***p<0.001 vs pEMBL-CMV-hCGin. n=4.

FIG. 22 shows a bar graph of % luciferase activity. After 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT-H24, H26, H27, H28 and H29 could efficiently inhibit luciferase activity compared with pEMBL-CMV-hCGin (control). Compared with control (100%), the activity of luciferase was 30.8% (H24), 9.1% (H26), 9.9% (H27), 16.6% (H28), and 19.6% (H29), individually. MiHTT-H2, H4 and H5 are shown as positive controls. MiHTT-H19-21 are also shown as positive controls. ***p<0.001 vs pEMBL-CMV-hCGin. n=4.

FIG. 23 shows images of AAVRhlO mediated GFP expression in U87 cells. AAVRH10-CMV-GFP was infected at MOI 5 x 10 ⁵ vg/cell.

FIG. 24 shows an image of western blot data. After AAVRHlO-CMV-hCGin- miHTT-Hl -H5 treatment in U87 cells, HTT expression was reduced by AAVRH10-CMV- hCGin-miHTT-H2, -miHTT-H4 and -miHTT-H5. n=4 .

FIG. 25 shows bar graphs of quantitative data from HTT western blots in the human neural cell line U87. HTT/beta-actin shown as a ratio in left panel, as percent HTT expression/control in right panel. HTT protein expression was inhibited by AAVRH10- CMV-hCGin-miHTT-H2 (26.8%), miHTT4 (41.5%) and miHTT-H5(58.4%). (*p<0.05, **p<0.01, n=4).

FIG. 26 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against beta-tubulin as a control in U87 cells. AAVRH10-CMV-miHTT-H15 and H16 could significantly inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). *p<0.05, ***p<0.001 vs AAVRH10-CMV-hCGin. n=4.

FIG. 27 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against beta-tubulin as a control in U87 cells. AAVRH10-CMV-miHTT-H21 and H22 could significantly inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). ***p<0.001 vs control group (AAVRH10-CMV-hCGin), n=4.

FIG. 28 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against beta-tubulin as a control in U87 cells. AAVRH10-CMV-miHTT-H2, H4 and H5, as internal control for the 2 ^nd round infections, could significantly inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). *p<0.05, ***p<0.001 vs AAVRH10-CMV-hCGin, n=4.

FIG. 29 shows a bar graph of % HTT expression/control in the U87 cell line. AAVRH10-CMV-miHTT-H2, H4, H5, H15, H16, H21 (miR-216b) and miHTT-H22 (miR- 27a) could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). Compared to control (100%), the expression of HTT was 57.1% (H2), 24.1% (H4). 38.4% (H5), 42% (H15), 61.8% (H16), 33.8% (H21/miR-216b), and 31.8% (H22/miR-27a), respectively. *p<0.05, ***p<0.001 vs AAVRH10-CMV-hCGin. n=4.

FIG. 30 shows images of human HTT patient fibroblasts infected by AAVrhlO- CMV-GFP at an MOI of 5 x 10 ⁵ vg/cell. To improve infectivity of AAVRH10 in lung fibroblasts from an HTT patient, Hoechst 33342 was added to the media with serially increasing concentration. Infectivity was enhanced by Hoechst 33342 in a dose-dependent manner.

FIG. 31 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against GAPDH as a control in HTT patent fibroblasts. Artificial miHTTs inhibited HTT gene expression in human HD patient fibroblasts. Infection was administered with Hoechst 33342 (2pM). AAVRH10-CMV-miHTT-H2, H4 and H5 could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). **p<0.01, ***p<0.001 vs AAVRH10-CMV-hCGin. n=4.

FIG. 32 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against GAPDH as a control in HTT patent fibroblasts. Infection was administered with Hoechst 33342 (2pM). AAVRH10-CMV-miHTT-H15 and H16 could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). *p<0.05, **p<0.01 vs AAVRH10-CMV-hCGin. n=4.

FIG. 33 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against GAPDH as a control in HTT patent fibroblasts. Infection was administered with Hoechst 33342 (2pM). AAVRH10-CMV-miHTT-H17, H20 (miR-455) and H21 (miR-216b) could efficiently inhibit HTT expression as compared with AAVRH10- CMV-hCGin (control). *p<0.05, **p<0.01 vs AAVRH10-CMV-hCGin. n=4. FIG. 34 shows a bar graph of % HTT expression/control inhibited by miHTTs in human HD patient fibroblasts. Infection was administered with Hoechst 33342 (2pM). AAVRH10-CMV-miHTT-H2, H4, H5, H16, H17, H20 (miR-455) and H21 (miR-216b) could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). Compared to control (100%), the expression of HTT was 25.4% (H2), 36.0% (H4). 49.1% (H5), 43.7% (H16), 67.0%(H20/Mir-455) and 51.8% (H21/miR-216b), respectively. *p<0.05, **p<0.01, ***p<0.001 vs AAVRH10-CMV-hCGm n=4.

FIG. 35 shows images of human HTT patient fibroblasts infected by AAVrhlO- CMV-GFP at an MOI of 5 x 10 ⁵ vg/cell and Hoechst at 4 pM.

FIG. 36 shows blot data (top panel) and a quantified bar graph (bottom panel) of HTT expression against GAPDH as a control in HTT patent fibroblasts. Infection was administered with Hoechst 33342 (4 pM). AAVRH10-CMV-miHTT-Hl, H2, H4 and H5 could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). *p<0.05, **p<0.01, ***p<0.001 vs AAVRH10-CMV-hCGin. n=4.

FIG. 37 shows blot data (top panel) and a quantified bar graph (botom panel) of HTT expression against GAPDH as a control in HTT patent fibroblasts. Infection was administered with Hoechst 33342 (4 pM). AAVRH10-CMV-miHTT-H24 could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). ***p<0.001 vs AAVRH10-CMV-hCGin. n=4.

FIG. 38 shows a bar graph of % of HTT expression/ GAPDH inhibited by miHTTs in human HD patient fibroblasts. Infection was administered with Hoechst 33342 (4pM). AAVRH10-CMV-miHTT-H2, H4, H5, H16, H17, H20 (miR-455) and H21 (miR-216b) could efficiently inhibit HTT expression as compared with AAVRH10-CMV-hCGin (control). As compared to control (100%), the expression of HTT was 25.4% (H2), 36.0% (H4). 49.1% (H5), 43.7% (H16), 67.0%(H20/Mir-455) and 51.8% (H21/miR-216b), respectively. *p<0.05, **p<0.01, ***p<0.001 vs AAVRH10-CMV-hCGin. n=4.

FIG. 39 shows a schematic of the 5'-junction to 3'-junction (J2J) region in HTT and example tested artificial miRNAs of the invention targeting the J2J region. Sequence shown in FIG. 39 comprises "CAG" repeats representing the J2J region, e.g., residues starting at about residue position 197 to 244 of SEQ ID NO:78 (human HTT). Nucleotide positions and length of J2J region can vary and depend on number of intragenic repeats; as such the nucleotides shown in FIG. 39 regarding the J2J portion are representative only as a schematic and do not necessarily represent any particular sequence. FIG. 40 shows a schematic of further developed artificial microRNAs targeting the J2J region in HTT. MiR sequences shown in FIG. 40 are SEQ ID NOs:43-73.

FIG. 41 shows a schematic identifying locations of intragenic nucleotide repeats of several example disorders, including Unverricht-Lundbord disease (EPM1), amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD), myotonic dystrophy type 2 (DM2), oculopharyngeal muscular dystrophy (OPMD), Fragile X syndrome (FXS) and Fragile X-associated tremor/ataxia syndrome (FXTAS), familial cortical myoclonic tremor with epilepsy (FCMTE), Huntington's disease (HD) and spinal-bulbar muscular atrophy (SMBA), Huntington's disease like-2 (HDL2), Fuchs endothelial comeal dystrophy (FECD), and myotonic dystrophy type 1 (DM1). Sequences shown in FIG. 41 include SEQ ID NO: 150 (EPM1).

DETAILED DESCRIPTION

The present invention now will be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations, and variations thereof.

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and/or paragraph in which the reference is presented. Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a composition comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.

As used in the description of the invention and the appended claims, the singular forms "a," "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise.

Also as used herein, "and/or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").

The term "about," as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified value as well as the specified value. For example, "about X" where X is the measurable value, is meant to include X as well as variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of X. A range provided herein for a measurable value may include any other range and/or individual value therein.

As used herein, phrases such as "between X and Y" and "between about X and Y" should be interpreted to include X and Y. As used herein, phrases such as "between about X and Y" mean "between about X and about Y" and phrases such as "from about X to Y" mean "from about X to about Y."

The term "comprise," "comprises" and "comprising" as used herein, specify the presence of the stated features, integers, steps, operations, elements, and/or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and/or groups thereof.

As used herein, the transitional phrase "consisting essentially of' means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term "consisting essentially of' when used in a claim of this invention is not intended to be interpreted to be equivalent to "comprising." With respect to the terms "comprising", "consisting essentially of', and "consisting of', where one of these three terms is used herein, the presently disclosed subject matter can include the use of either of the other two terms.

Except as otherwise indicated, standard methods known to those skilled in the art may be used for cloning genes, amplifying and detecting nucleic acids, and the like. Such techniques are known to those skilled in the art. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual 4th Ed. (Cold Spring Harbor, NY, 2014); Ausubel etal. Current Protocols in Molecular Biology (Green Publishing Associates, Inc. and John Wiley & Sons, Inc., New York)

Nucleotide sequences are presented herein by single strand only, in the 5' to 3' direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letter code, both in accordance with 37 C.F.R. §1.822 and established usage.

To illustrate further, if, for example, the specification indicates that a particular amino acid can be selected from A, G, I, L and/or V, this language also indicates that the amino acid can be selected from any subset of these ammo acid(s) for example A, G, I or L; A, G, I or V; A or G; only L; etc. as if each such sub combination is expressly set forth herein. Moreover, such language also indicates that one or more of the specified amino acids can be disclaimed (e.g., by negative proviso). For example, in particular embodiments the amino acid is not A, G or I; is not A; is not G or V; etc. as if each such possible disclaimer is expressly set forth herein.

The term "sequence identity," as used herein, has the standard meaning in the art. As is known in the art, a number of different programs can be used to identify whether a polynucleotide or polypeptide has sequence identity or similarity to a known sequence. Sequence identity or similarity may be determined using standard techniques known in the art, including, but not limited to, the local sequence identity algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the sequence identity alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 45:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 55:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, WI), the Best Fit sequence program described by Devereux et al., Nucl. Acid Res. 12:381 (1984), preferably using the default settings, or by inspection. An example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairw ise alignments. It can also plot a tree showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol. 35:351 (1987); the method is similar to that described by Higgins & Sharp, CABIOS 5: 151 (1989).

Another example of a useful algorithm is the BLAST algorithm, described in Altschul et al., J. Mol. Biol. 275:403 (1990) and Karlin etal., Proc. Natl. Acad. Sci. USA 90:5873 (1993). A particularly useful BLAST program is the WU-BLAST-2 program which was obtained from Altschul et al., Meth. EnzymoL, 266 460 (1996); blast. wustl/edu/blast/README.html. WU-BLAST-2 uses several search parameters, which are preferably set to the default values. The parameters are dynamic values and are established by the program itself depending upon the composition of the particular sequence and composition of the particular database against which the sequence of interest is being searched; however, the values may be adjusted to increase sensitivity.

An additional useful algorithm is gapped BLAST as reported by Altschul et al., Nucleic Acids Res. 25:3389 (1997).

A percentage amino acid sequence identity value is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region. The "longer" sequence is the one having the most actual residues in the aligned region (gaps introduced by WU-Blast-2 to maximize the alignment score are ignored).

In a similar manner, percent nucleic acid sequence identity is defined as the percentage of nucleotide residues in the candidate sequence that are identical with the nucleotides in the polynucleotide specifically disclosed herein.

The alignment may include the introduction of gaps in the sequences to be aligned. In addition, for sequences which contain either more or fewer nucleotides than the polynucleotides specifically disclosed herein, it is understood that in one embodiment, the percentage of sequence identity will be determined based on the number of identical nucleotides in relation to the total number of nucleotides. Thus, for example, sequence identity of sequences shorter than a sequence specifically disclosed herein, will be determined using the number of nucleotides in the shorter sequence, in one embodiment. In percent identity calculations relative weight is not assigned to various manifestations of sequence variation, such as insertions, deletions, substitutions, etc. In one embodiment, only identities are scored positively (+1) and all forms of sequence variation including gaps are assigned a value of "0," which obviates the need for a weighted scale or parameters as described below for sequence similarity calculations. Percent sequence identity can be calculated, for example, by dividing the number of matching identical residues by the total number of residues of the "shorter" sequence in the aligned region and multiplying by 100. The "longer" sequence is the one having the most actual residues in the aligned region.

As used herein, the terms "reduce," "reduces," "reduction," "diminish," "inhibit" and similar terms mean a decrease of at least about 5%, 10%, 15%, 20%, 25%, 35%, 50%, 75%, 80%, 85%, 90%, 95%, 97% or more.

As used herein, the terms "enhance," "enhances," "enhancement" and similar terms indicate an increase of at least about 25%, 50%, 75%, 100%, 150%, 200%, 300%, 400%, 500% or more.

As used herein, the term "polypeptide" encompasses both peptides and proteins, unless indicated otherwise.

A "polynucleotide," "nucleic acid," or "nucleotide sequence" is a sequence of nucleotide bases, and may be RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides), but in representative embodiments are either single or double stranded DNA or RNA sequences.

The term "open reading frame (ORF)," as used herein, refers to a portion of a polynucleotide, e.g., a gene, that encodes a polypeptide.

As used herein, an "isolated" polynucleotide (e.g., an "isolated DNA" or an "isolated RNA") means a polynucleotide at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide. In representative embodiments an "isolated" nucleotide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.

Likewise, an "isolated" polypeptide means a polypeptide that is at least partially separated from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide. In representative embodiments an "isolated" polypeptide is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material. As used herein, an "isolated" nucleic acid, nucleic acid molecule, and/or nucleotide sequence (e.g., an "isolated DNA" or an "isolated RNA") means a nucleic acid or nucleotide sequence separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the nucleic acid or nucleotide sequence.

Likewise, an "isolated" polypeptide means a polypeptide that is separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polypeptide.

An "isolated cell" refers to a cell that is separated from other components with which it is normally associated in its natural state. For example, an isolated cell can be a cell in culture medium and/or a cell in a pharmaceutically acceptable carrier of this invention. Thus, an isolated cell can be delivered to and/or introduced into a subject. In some embodiments, an isolated cell can be a cell that is removed from a subject and manipulated as described herein ex vivo and then returned to the subject.

As used herein, by "isolate" or "purify" (or grammatical equivalents) a virus vector or virus particle or population of virus particles, it is meant that the virus vector or virus particle or population of virus particles is at least partially separated from at least some of the other components in the starting material. In representative embodiments an "isolated" or "purified" virus vector or virus particle or population of virus particles is enriched by at least about 10-fold, 100-fold, 1000-fold, 10,000-fold or more as compared with the starting material.

The term "endogenous" refers to a component naturally found in an environment, i.e., a gene, nucleic acid, miRNA, protein, cell, or other natural component expressed in the subject, as distinguished from an introduced component, i.e., an "exogenous" component.

As used herein, the term "heterologous" refers to a nucleotide/polypeptide that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.

A "heterologous nucleotide sequence" or "heterologous nucleic acid" is a sequence that is not naturally occurring in the virus. Generally, the heterologous nucleic acid or nucleotide sequence comprises an open reading frame that encodes a polypeptide and/or a nontranslated RNA. In some embodiments, a synthetic RNA molecule of the present invention comprises an inhibitory nucleic acid molecule, e.g., an inhibitory RNA. As used herein, "inhibitory nucleic acid" and/or "inhibitory RNA" refers to a nucleic acid molecule which can inhibit the expression of a target, e.g., dsRNA, inhibitory RNA (iRNA), short-hairpin RNA (shRNA), microRNA (miRNA; miR), and the like, which are well known in the art.

As used herein, the term "iRNA" refers to an agent that contains RNA (or modified nucleic acids as described herein) and which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. In some embodiments, an iRNA as described herein effects inhibition of the expression and/or activity of a target.

Double-stranded RNA molecules (dsRNA) have been shown to block gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi). The inhibitory nucleic acids described herein can include an RNA strand (the antisense strand) having a region which is 30 nucleotides or less in length, i.e., 15-30 nucleotides in length, generally 19-24 nucleotides in length, which region is substantially complementary to at least part the targeted mRNA transcript. The use of these iRNAs enables the targeted degradation of mRNA transcripts, resulting in decreased expression and/or activity of the target.

A dsRNA includes two RNA strands that are sufficiently complementary to hybridize to form a duplex structure under conditions in which the dsRNA will be used. One strand of a dsRNA (the antisense strand) typically includes a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence. The target sequence can be derived from the sequence of an mRNA formed during the expression of the target, e.g., it can span one or more intron boundaries. The other strand (the sense strand) includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure is between 15 and 30 base pairs in length inclusive, more generally between 18 and 25 base pairs in length inclusive, yet more generally between 19 and 24 base pairs in length inclusive, and most generally between 19 and 21 base pairs in length, inclusive. Similarly, the region of complementarity to the target sequence is between 15 and 30 base pairs in length inclusive, more generally between 18 and 25 base pairs in length inclusive, yet more generally between 19 and 24 base pairs in length inclusive, and most generally between 19 and 21 base pairs in length nucleotides in length, inclusive. As the ordinarily skilled person will recognize, the targeted region of an RNA targeted for cleavage will most often be part of a larger RNA molecule, often an mRNA molecule. Where relevant, a "part" of an mRNA target is a contiguous sequence of an mRNA target of sufficient length to be a substrate for RNAi-directed cleavage (i.e., cleavage through a RISC pathway). dsRNAs having duplexes as short as 9 base pairs can, under some circumstances, mediate RNAi-directed RNA cleavage. Most often a target will be at least 15 nucleotides in length, preferably 15-30 nucleotides in length.

In some embodiments of the invention, the inhibitory RNA contemplated is a miRNA. A "microRNA," "miRNA," or "miR" is a small non-coding RNA molecule capable of mediating transcriptional or post-translational gene silencing. Typically, miRNA is transcribed as a hairpin or stem-loop (e.g., having a self-complementarity, single-stranded backbone) duplex structure, referred to as a primary miRNA (pri-miRNA), which is enzymatically processed (e.g., by Drosha, DGCR8, Pasha, etc.) into a pre-miRNA. The length of a pri-miRNA can vary. In some embodiments, a pri-miRNA ranges from about 100 to about 5000 base pairs (e.g., about 100, about 200, about 500, about 1000, about 1200, about 1500, about 1800, or about 2000 base pairs) in length. In some embodiments, a pri- miRNA is greater than 200 base pairs in length (e.g., 2500, 5000, 7000, 9000, or more base pairs in length. Pre-miRNA, which is also characterized by a hairpin or stem-loop duplex structure, can also vary in length. In some embodiments, pre-miRNA ranges in size from about 40 base pairs in length to about 500 base pairs in length. In some embodiments, pre- miRNA ranges in size from about 50 to 100 base pairs in length. In some embodiments, pre- miRNA ranges in size from about 50 to about 90 base pairs in length (e.g., about 50, about 52, about 54, about 56, about 58, about 60, about 62, about 64, about 66, about 68, about 70, about 72, about 74, about 76, about 78, about 80, about 82, about 84, about 86, about 88, or about 90 base pairs in length). Generally, pre-miRNA is exported into the cytoplasm, and enzymatically processed by Dicer to first produce an imperfect miRNA/miRNA* duplex and then a single- stranded mature miRNA molecule, which is subsequently loaded into the RNA- induced silencing complex (RISC). Typically, a mature miRNA molecule ranges in size from about 19 to about 30 base pairs in length. In some embodiments, a mature miRNA molecule is about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, or 30 base pairs in length.

A "therapeutic polypeptide" is a polypeptide that can alleviate, reduce, prevent, delay and/or stabilize symptoms that result from an absence or defect in a protein in a cell or subject and/or is a polypeptide that otherwise confers a benefit to a subject, e.g., anti-cancer effects or improvement in transplant survivability or induction of an immune response.

The terms "nucleotide sequence of interest (NOI)," "heterologous nucleotide sequence" and "heterologous nucleic acid molecule" are used interchangeably herein and refer to a nucleic acid sequence that is not naturally occurring (e.g., engineered). Generally, the NOI, heterologous nucleic acid molecule or heterologous nucleotide sequence comprises an open reading frame that encodes a polypeptide and/or nontranslated RNA of interest (e.g, for delivery to a cell and/or subject).

As used herein, the term "nucleic acid construct" means a nucleic acid molecule capable of transporting another nucleic acid to which it is linked. One type of nucleic acid construct is a vector, which can be a transformation vector or an expression vector. Another type of nucleic acid construct of this invention is a "plasmid," which refers to a circular double stranded nucleic acid loop into which additional nucleic acid segments can be ligated. Another type of nucleic acid construct is a viral vector, wherein additional nucleic acid segments can be ligated into a viral genome. Certain vectors are capable of autonomous replication in a cell into which they are introduced. Other vectors are integrated into the genome of a cell upon introduction into the cell, and are then replicated along with the cell genome. Moreover, certain vectors can direct the expression of genes or coding sequences to which they are operatively linked. Such vectors are referred to herein as "expression vectors." In some embodiments of this invention, an expression vector can be a viral vector (e.g., adenovirus, AAV, herpesvirus, vaccinia, poxviruses, baculoviruses, and the like). In some embodiments, the vector is a nonviral vector.

An expression vector of the invention can comprise a nucleic acid of the invention in a form suitable for expression of the nucleic acid in a cell, which means that the expression vector includes one or more regulatory sequences, selected on the basis of the cells to be used for expression, which is operatively linked to the nucleic acid sequence to be expressed. With respect to an expression vector, "operatively linked" is intended to mean that the nucleotide sequence of interest is linked to the regulatory sequence(s) in a manner which allows for expression of the nucleotide sequence (e.g., in a cell when the vector is introduced into the cell). The term "regulatory sequence" is intended to include promoters, enhancers, and other expression control elements (e.g., polyadenylation signals) as are well known in the art. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells and those that direct expression of the nucleotide sequence only in certain host cells or under certain conditions. It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of RNA desired, etc. The expression vectors of the invention can be introduced into cells to thereby produce RNA molecules encoded by nucleic acids as described herein. As used herein, the term "vector," "virus vector," "delivery vector" (and similar terms) may be used to refer to a virus particle that functions as a nucleic acid delivery vehicle, and which comprises the viral nucleic acid (i.e., the vector genome) packaged within the virion. Virus vectors according to the present invention comprise a chimeric AAV capsid according to the invention and can package an AAV or rAAV genome or any other nucleic acid including viral nucleic acids. Alternatively, in some contexts, the term "vector," "virus vector," "delivery vector" (and similar terms) may be used to refer to the vector genome (e.g., vDNA) in the absence of the virion and/or to a viral capsid that acts as a transporter to deliver molecules tethered to the capsid or packaged within the capsid.

The term "vector," as used herein, means any nucleic acid entity capable of amplification in a host cell. Thus, the vector may be an autonomously replicating vector, i.e., a vector, which exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated. The choice of vector will often depend on the host cell into which it is to be introduced. Vectors include, but are not limited to plasmid vectors, phage vectors, viruses or cosmid vectors. Vectors usually contain a replication origin and at least one selectable gene, i. e. , a gene which encodes a product which is readily detectable or the presence of which is essential for cell growth.

In some embodiments, the virus vectors of the invention can be parvovirus vectors including but not limited to adeno-associated virus (AAV) vectors.

The term "parvovirus" as used herein encompasses the family Parvoviridae, including autonomously replicating parvoviruses and dependoviruses. The autonomous parvoviruses include members of the genera Parvovirus, Erythrovirus, Densovirus, Iter virus, and Contravirus. Exemplary autonomous parvoviruses include, but are not limited to, minute virus of mouse, bovine parvovirus, canine parvovirus, chicken parvovirus, feline panleukopenia virus, feline parvovirus, goose parvovirus, Hl parvovirus, Muscovy duck parvovirus, Bl 9 virus, and any other autonomous parvovirus now known or later discovered. Other autonomous parvoviruses are known to those skilled in the art. See, e.g, BERNARD N. FIELDS et al., VIROLOGY, Volume 2, Chapter 69 (4th ed., Lippincott-Raven Publishers).

As used herein, the tenn "adeno-associated virus" (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, any serotype listed in Table 1, and any other AAV now known or later discovered. See, e.g., BERNARD N. FIELDS et al. , VIROLOGY, volume 2, chapter 69 (4th ed, Lippincott-Raven Publishers). A number of additional AAV serotypes and clades have been identified (see, e.g., Gao et al., (2004) J. Virology 78:6381-6388; Mori et al., (2004) Virology 33-:375-383; and Table 1).

The genomic sequences of various serotypes of AAV and the autonomous parvoviruses, as well as the sequences of the native terminal repeats (TRs), Rep proteins, and capsid subunits are known in the art. Such sequences may be found in the literature or in public databases such as GenBank®. These sequences include known amino acid sequences of the serotype capsid proteins, including but not limited to, AAD27757.1 (AAV1), YP_068409.1 (AAV5), AAC03780.1 (AAV2), AAC58045.1 (AAV4), NP_043941.1 (AAV3), AAB95450.1 (AAV6), YP_077178.1 (AAV7), YP_077180.1 (AAV8), AAS99264.1 (AAV9). See in addition, e.g., GenBank® Accession Numbers NC_002077, NC_001401, NC_001729, NC_001863, NC_001829, NC_001862, NC_000883, NC_001701, NC_001510, NC_006152, NC_006261, AF063497, U89790, AF043303, AF028705, AF028704, J02275, J01901, J02275, X01457, AF288061, AH009962, AY028226, AY028223, NC_001358, NC_001540, AF513851, AF513852, AY530579; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also, e.g., Srivistava et al. (1983) J. Virology 45:555; Chiorini et al. (1998) J. Virology 71 :6823; Chiorini et al. (1999) J. Virology 73: 1309; Bantel-Schaal et al. (1999) J. Virology 73:939; Xiao et al. (1999) J. Virology 73:3994; Muramatsu et al. (1996) Virology 221:208; Shade et al. (1986) J. Virol. 58:921; Gao et al. (2002) Proc. Nat. Acad. Sci. USA 99: 11854; Mori et al. (2004) Virology 33-:375-383; international patent publications WO 00/28061, WO 99/61601, WO 98/11244; and U.S. Patent No. 6,156,303; the disclosures of which are incorporated by reference herein for teaching parvovirus and AAV nucleic acid and amino acid sequences. See also Table 1.

The capsid structures of autonomous parvoviruses and AAV are described in more detail in BERNARD N. FIELDS et al. VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers). See also, description of the crystal structure of AAV2 (Xie et al. (2002) Proc. Nat. Acad. Sci. 99: 10405-10); AAV4 (Padron et al. (2005) J. Virol. 79: 5047- 58); AAV5 (Walters et al. (2004) J. Virol. 78:3361-71); and CPV (Xie et al. (1996) J. Mol. Biol. 6:497-520 and Tsao et al. (1991) Science 251 : 1456-64). A "rAAV vector genome" or "rAAV genome" is an AAV genome (z.e., vDNA) that comprises at least one terminal repeat (e.g, two terminal repeats) and one or more heterologous nucleotide sequences. rAAV vectors generally require only the 145 base terminal repeat(s) (TR(s)) in cis to generate virus. All other viral sequences are dispensable and may be supplied in trans (Muzyczka, (1992) Curr. Topics Microbiol. Immunol. 158:97). Typically , the rAAV vector genome will only retain the minimal TR sequence(s) so as to maximize the size of the transgene that can be efficiently packaged by the vector. The structural and non-structural protein coding sequences may be provided in trans (e.g., from a vector, such as a plasmid, or by stably integrating the sequences into a packaging cell). The rAAV vector genome optionally comprises two AAV TRs, which generally will be at the 5’ and 3’ ends of the heterologous nucleotide sequence(s), but need not be contiguous thereto. The TRs can be the same or different from each other.

A "rAAV particle" comprises a rAAV vector genome packaged within an AAV capsid.

The term "terminal repeat" or "TR" or "inverted terminal repeat (ITR)" includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (z.e., mediates the desired functions such as replication, virus packaging, integration and/or pro virus rescue, and the like). The TR can be an AAV TR or a non- AAV TR. For example, a non- AAV TR sequence such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or any other suitable virus sequence (e.g, the SV40 hairpin that serves as the origin of SV40 replication) can be used as a TR, which can further be modified by truncation, substitution, deletion, insertion and/or addition. Further, the TR can be partially or completely synthetic, such as the "double-D sequence" as described in United States Patent No. 5,478,745 to Samulski et al., which is hereby incorporated by reference in its entirety.

An "AAV terminal repeat" or "AAV TR" may be from any AAV, including but not limited to serotypes 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or any other AAV now known or later discovered (see, e.g., Table 1). An AAV terminal repeat need not have the native terminal repeat sequence (e.g., a native AAV TR sequence may be altered by insertion, deletion, truncation and/or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, integration, and/or provirus rescue, and the like. AAV proteins VP1, VP2 and VP3 are capsid proteins that interact together to form an AAV capsid of an icosahedral symmetry. VP 1.5 is an AAV capsid protein described in US Publication No. 2014/0037585, which is hereby incorporated by reference in its entirety.

The term "template" or "substrate" is used herein to refer to a polynucleotide sequence that may be replicated to produce the parvovirus viral DNA. For the purpose of vector production, the template will typically be embedded within a larger nucleotide sequence or construct, including but not limited to a plasmid, naked DNA vector, bacterial artificial chromosome (BAC), yeast artificial chromosome (YAC) or a viral vector (e.g, adenovirus, herpesvirus, Epstein-Barr Virus, AAV, baculoviral, retroviral vectors, and the like). Alternatively, the template may be stably incorporated into the chromosome of a packaging cell.

As used herein, parvovirus or AAV "Rep coding sequences" indicate the nucleic acid sequences that encode the parvoviral or AAV non-structural proteins that mediate viral replication and the production of new virus particles. The parvovirus and AAV replication genes and proteins have been described in, e.g., FIELDS et al., VIROLOGY, volume 2, chapters 69 & 70 (4th ed., Lippincott-Raven Publishers).

The "Rep coding sequences" need not encode all of the parvoviral or AAV Rep proteins. For example, with respect to AAV, the Rep coding sequences do not need to encode all four AAV Rep proteins (Rep78, Rep 68, Rep52 and Rep40), in fact, it is believed that AAV5 only expresses the spliced Rep68 and Rep40 proteins. In representative embodiments, the Rep coding sequences encode at least those replication proteins that are necessary for viral genome replication and packaging into new virions. The Rep coding sequences will generally encode at least one large Rep protein (i.e., Rep78/68) and one small Rep protein (i.e., Rep52/40). In particular embodiments, the Rep coding sequences encode the AAV Rep78 protein and the AAV Rep52 and/or Rep40 proteins. In other embodiments, the Rep coding sequences encode the Rep68 and the Rep52 and/or Rep40 proteins. In a still further embodiment, the Rep coding sequences encode the Rep68 and Rep52 proteins, Rep68 and Rep40 proteins, Rep78 and Rep52 proteins, or Rep78 and Rep40 proteins.

As used herein, the term "large Rep protein" refers to Rep68 and/or Rep78. Large Rep proteins of the claimed invention may be either wild-type or synthetic. A wild-type large Rep protein may be from any parvovirus or AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, or any other AAV now known or later discovered (see, e.g., Table 2). A synthetic large Rep protein may be altered by insertion, deletion, truncation and/or missense mutations. Those skilled in the art will further appreciate that it is not necessary that the replication proteins be encoded by the same polynucleotide. For example, for MVM, the NS- 1 and NS-2 proteins (which are splice variants) may be expressed independently of one another. Likewise, for AAV, the pl9 promoter may be inactivated and the large Rep protein(s) expressed from one polynucleotide and the small Rep protein(s) expressed from a different polynucleotide. Typically, however, it will be more convenient to express the replication proteins from a single construct. In some systems, the viral promoters (e.g., AAV pl 9 promoter) may not be recognized by the cell, and it is therefore necessary to express the large and small Rep proteins from separate expression cassettes. In other instances, it may be desirable to express the large Rep and small Rep proteins separately, i.e., under the control of separate transcriptional and/or translational control elements. For example, it may be desirable to control expression of the large Rep proteins, so as to decrease the ratio of large to small Rep proteins. In the case of insect cells, it may be advantageous to down-regulate expression of the large Rep proteins (e.g., Rep78/68) to avoid toxicity to the cells (see, e.g., Urabe et al., (2002) Human Gene Therapy 13:1935).

As used herein, the parvovirus or AAV "cap coding sequences" encode the structural proteins that form a functional parvovirus or AAV capsid (i. e. , can package DNA and infect target cells). Typically, the cap coding sequences will encode all of the parvovirus or AAV capsid subunits, but less than all of the capsid subunits may be encoded as long as a functional capsid is produced. Typically, but not necessarily, the cap coding sequences will be present on a single nucleic acid molecule.

The virus vectors of the invention can further be "targeted" virus vectors (e.g., having a directed tropism) and/or a "hybrid" parvovirus (i.e., in which the viral TRs and viral capsid are from different parvoviruses) as described in international patent publication WO 00/28004 and Chao et al., (2000) Molecular Therapy 2:619, which is hereby incorporated by reference in its entirety .

The term "tropism" as used herein refers to preferential entry of the virus into certain cells or tissues, optionally followed by expression (e.g., transcription and, optionally, translation) of a sequence(s) earned by the viral genome in the cell, e.g, for a recombinant virus, expression of a heterologous nucleic acid(s) of interest.

As used herein, "transduction" of a cell by a virus vector (e.g., an AAV vector) means entry of the vector into the cell and transfer of genetic material into the cell by the incorporation of nucleic acid into the virus vector and subsequent transfer into the cell via the virus vector. Unless indicated otherwise, "efficient transduction" or "efficient tropism," or similar terms, can be determined by reference to a suitable positive or negative control (e.g, at least about 50%, 60%, 70%, 80%, 85%, 90%, 95% or more of the transduction or tropism, respectively, of a positive control or at least about 110%, 120%, 150%, 200%, 300%, 500%, 1000% or more of the transduction or tropism, respectively, of a negative control).

Similarly, it can be determined if a virus "does not efficiently transduce" or "does not have efficient tropism" for a target tissue, or similar terms, by reference to a suitable control. In particular embodiments, the virus vector does not efficiently transduce (z. e. , does not have efficient tropism for) tissues outside the lungs, e.g., CNS, kidney, gonads and/or germ cells. In particular embodiments, undesirable transduction of tissue(s) is 20% or less, 10% or less, 5% or less, 1% or less, 0. 1% or less of the level of transduction of the desired target tissue(s).

The virus vectors of the invention can further be duplexed parvovirus particles as described in international patent publication WO 01/92551 (the disclosure of which is incorporated herein by reference in its entirety ). Thus, in some embodiments, double stranded (duplex) genomes can be packaged into the virus capsids of the invention.

Further, the viral capsid or genomic elements can contain other modifications, including insertions, deletions and/or substitutions.

As used herein, the term "amino acid" or "amino acid residue" encompasses any naturally occurring amino acid, modified forms thereof, and synthetic amino acids.

Naturally occurring, levorotatory (L-) amino acids are shown in Table 2.

Conservative amino acid substitutions are known in the art. In particular embodiments, a conservative amino acid substitution includes substitutions within one or more of the following groups: glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagine, glutamine; serine, threonine; lysine, arginine; and/or phenylalanine, tyrosine.

Alternatively, the amino acid can be a modified amino acid residue (nonlimiting examples are shown in Table 3) and/or can be an amino acid that is modified by post- translation modification (e g., acetylation, amidation, formylation, hydroxylation, methylation, phosphorylation or sulfatation).

Further, the non-naturally occurring amino acid can be an "unnatural" amino acid as described by Wang et al., Annu Rev Biophys Biomol Struct. 35:225-49 (2006)). These unnatural amino acids can advantageously be used to chemically link molecules of interest to the AAV capsid protein. By the terms "treat," "treating" or "treatment of (and grammatical variations thereof) it is meant that the severity of the subject’s condition is reduced, at least partially improved or stabilized and/or that some alleviation, mitigation, decrease or stabilization in at least one clinical symptom is achieved and/or there is a delay in the progression of the disease or disorder.

By "substantially retain" a property and/or to maintain a property "substantially the same" as a comparison (e.g., a control), it is meant that at least about 75%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or 100% of the property (e.g., activity or other measurable characteristic) is retained.

A "subject" of the invention may include any animal in need thereof. In some embodiments, a subject may be, for example, a mammal, a reptile, a bird, an amphibian, or a fish. A mammalian subject may include, but is not limited to, a laboratory animal (e.g., a rat, mouse, guinea pig, rabbit, primate, etc.), a farm or commercial animal (e.g., cattle, pig, horse, goat, donkey, sheep, etc.), or a domestic animal (e.g., cat, dog, ferret, gerbil, hamster etc.). In some embodiments, a mammalian subject may be a primate, or anon-human primate (e.g., a chimpanzee, baboon, macaque (e.g., rhesus macaque, crab-eating macaque, stump-tailed macaque, pig-tailed macaque), monkey (e.g., squirrel monkey, owl monkey, etc.), marmoset, gorilla, etc.). In some embodiments, a mammalian subject may be a human. The terms "subject" and "patient" are in some embodiments used interchangeably herein, such as but not limited to in reference to a human subject or patient. Optionally, the subject is "in need of the methods of the present invention, e.g., because the subject has or is believed at risk for a disorder including those described herein or that would benefit from the delivery of a synthetic nucleic acid including those described herein. A "subject in need" of the methods of the invention can be any subject known or suspected to have a disorder associated at least in part by a gene comprising intragenic nucleotide repeats (tandem repeats) to which the methods of the present invention disclosed herein may provide beneficial health effects, or a subject having an increased risk of developing the same. As a further option, the subject can be a laboratory animal and/or an animal model of disease.

As used herein the term "control" refers to a comparative sample and/or other reference source for a control subject.

The terms "administering" and "administration" of a treatment to a subject include any route of introducing or delivering to a subject a compound to perform its intended function. Administration can be carried out by any suitable route, including orally, intranasally, parenterally (intravenously, intramuscularly, intraperitoneally, intracistemally, intrathecally, intraventricularly, or subcutaneously), or topically. Administration includes self-administration and administration by another.

The terms "prevent," "preventing" and "prevention" (and grammatical variations thereof) refer to prevention and/or delay of the onset of a disease, disorder and/or a clinical symptom(s) in a subject and/or a reduction in the severity of the onset of the disease, disorder and/or clinical symptom(s) relative to what would occur in the absence of the methods of the invention. The prevention can be complete, e.g., the total absence of the disease, disorder and/or clinical symptom(s). The prevention can also be partial, such that the occurrence of the disease, disorder and/or clinical symptom(s) in the subject and/or the severity of onset are substantially less than what would occur in the absence of the present invention.

A "treatment effective" or "effective" amount as used herein is an amount that is sufficient to provide some improvement or benefit to the subject. Alternatively stated, a "treatment effective" or "effective" amount is an amount that will provide some alleviation, mitigation, decrease or stabilization in at least one clinical symptom in the subject. Those skilled in the art will appreciate that the therapeutic effects need not be complete or curative, as long as some benefit is provided to the subject.

A "prevention effective" amount as used herein is an amount that is sufficient to prevent and/or delay the onset of a disease, disorder and/or clinical symptoms in a subject and/or to reduce and/or delay the severity of the onset of a disease, disorder and/or clinical symptoms in a subject relative to what would occur in the absence of the methods of the invention. Those skilled in the art will appreciate that the level of prevention need not be complete, as long as some preventative benefit is provided to the subject.

The term "enhance" or "increase" refers to an increase in the specified parameter of at least about 1.25-fold, 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 8-fold, 10-fold, twelve- fold, or even fifteen-fold, and/or at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 100% or more, or any value or range therein.

The term "inhibit" or "reduce" or grammatical variations thereof as used herein refers to a decrease or diminishment in the specified level or activity of at least about 15%, 25%, 35%, 40%, 50%, 60%, 75%, 80%, 90%, 95% or more. In particular embodiments, the inhibition or reduction results in little or essentially no detectible activity (at most, an insignificant amount, e.g., less than about 10% or even 5%).

Compositions of the invention The invention, in part, relates to compositions and methods of using synthetic RNA molecules such as synthetic microRNAs (miRNAs) in the treatment of disorders with intragenic nucleotide repeat regions.

MicroRNAs (miRs) are short non-coding sequences that cleave or inhibit messenger RNAs (mRNAs) by targeting regions of the target mRNA. MicroRNAs are small RNAs of about 17-25 nucleotides, which function as regulators of gene expression in eukaryotes. miRNAs are initially expressed in the nucleus as part of long primary transcripts called primary miRNAs (pri-miRNAs) Inside the nucleus, pri-miRNAs are partially digested by the enzyme Drosha, to form about 65-120 nucleotide-long hairpin precursor miRNAs (pre- miRNAs) that are exported to the cytoplasm for further processing by Dicer into shorter, mature miRNAs, which are the active molecules. In animals, these short RNAs comprise a 5' proximal "seed" region (about nucleotides 2 to 8) which is generally presumed to be the primary determinant of the pairing specificity of the miRNA to a portion of the target mRNA, often the 3' untranslated region (3'-UTR) of the target mRNA.

A miRNA molecule or an equivalent or a mimic or an isomiR thereof of the invention may be a synthetic or natural or recombinant or mature or part of a mature miRNA or a human miRNA or derived from a human miRNA. A human miRNA molecule is a miRNA molecule which is found in a human cell, tissue, organ or body fluids (i.e., endogenous human miRNA molecule). A human miRNA molecule may also be a human miRNA molecule derived from an endogenous human miRNA molecule by substitution, deletion and/or addition of a nucleotide. A miRNA molecule or an equivalent or a mimic thereof maybe a single stranded or double stranded RNA molecule.

Thus, one aspect of the present invention provides a synthetic RNA molecule comprising an antisense strand, wherein the nucleotide sequence of at least a portion of the antisense strand is complementary (e.g., having at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100% identity-) to a portion of the nucleotide sequence of a mammalian gene comprising an intragenic nucleotide repeat region having a 5' end and a 3' end and comprising at least about four or more (e.g., at least about 4, 5, 6, 7, 8, 9, 10 or more) tandem repeats; wherein the nucleic acid molecule degrades and/or inhibits the expression of the mammalian gene mRNA.

In some embodiments of this invention, the sense strand of the double stranded RNA molecule can be fully complementary to the antisense strand or the sense strand can be substantially complementary or partially complementary to the antisense strand. By substantially or partially complementary is meant that the sense strand and the antisense strand can be mismatched at about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide pairings. Such mismatches can be introduced into the sense strand sequence, e.g., near the 3’ end, to enhance processing of the double stranded RNA molecule by Dicer, to duplicate a pattern of mismatches in a siRNA molecule inserted into a chimeric nucleic acid molecule or artificial microRNA precursor molecule of this invention (see Examples section), and the like, as would be know n to one of skill in the art. Such modification will weaken the base pairing at one end of the duplex and generate strand asymmetry, therefore enhancing the chance of the antisense strand, instead of the sense strand, being processed and silencing the intended gene (Geng and Ding "Double-mismatched siRNAs enhance selective gene silencing of a mutant ALS-causing Allelel" Acta Pharmacol. Sin. 29:211-216 (2008); Schwarz et al. "Asymmetry in the assembly of the RNAi enzyme complex" Cell 115: 199-208 (2003)).

The at least a portion of the antisense strand that is complementary to a portion of the nucleotide sequence of a mammalian gene comprising an intragenic nucleotide repeat region may be any length of nucleotides of the antisense strand which is capable of binding to the portion of the nucleotide sequence of the mammalian gene wherein the nucleic acid molecule degrades and/or inhibits the expression of the mammalian gene mRNA. In some embodiments, the at least a portion of the antisense strand that is complementary to a portion of the nucleotide sequence of the gene may comprise about 4 to about 30 consecutive nucleotides, e.g., about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides, or any value or range therein. For example, in some embodiments, the portion of the antisense strand may comprise about 5 to about 30 consecutive nucleotides, about 10 to about 25 consecutive nucleotides, about 15 to about 22 consecutive nucleotides, or about 4 consecutive nucleotides, about 7 consecutive nucleotides, about 10 consecutive nucleotides, about 15 consecutive nucleotides, about 18 consecutive nucleotides, about 20 consecutive nucleotides, about 21 consecutive nucleotides, about 22 consecutive nucleotides, about 23 consecutive nucleotides, about 25 consecutive nucleotides, or about 30 consecutive nucleotides.

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene, e.g., about 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 8, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 consecutive nucleotides, or any value or range therein. For example, in some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30, about 5 to about 25, about 7 to about 30, about 10 to about 22, or about 4, about 7, about 10, about 12, about 20, about 22, about 25, or about 30 consecutive nucleotides within a region of the gene.

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 25 to about 150 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region to about 10 to about 150 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region (e.g., "the 'J2J' region"), e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region, or any value or range therein, and about 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region, or any value or range therein. For example, in some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 10 to about 150, about 25 to about 100, about 15 to about 125, about 40 to about 80, or about 50 to about 100 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region to about 10 to about 150, about 25 to about 100, about 15 to about 125, about 40 to about 80, or about 50 to about 100 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region, in any combination. In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 10, about 40, about 50, about 100, about 125, or about 150 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region to about 10, about 40, about 50, about 100, about 125, or about 150 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region, in any combination. In some embodiments, the portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 50 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region to about 50 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region.

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising the about 10 to about 150 nucleotides upstream of the 5' end of the intragenic nucleotide repeat region to about 10 to about 150 (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150, or any value or range therein) nucleotides downstream (within) the 5' end of the intragenic nucleotide repeat region, e.g., a region of the gene comprising, consisting essentially of, or consisting of about 10 to about 150 (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150, or any value or range therein) nucleotides upstream and downstream of the 5' end intragenic nucleotide repeat region, i.e., the "5' junction". For example, in some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising, consisting essentially of, or consisting of about 10 to about 150, about 25 to about 100, about 15 to about 125, about 40 to about 80, or about 50 to about 100 nucleotides upstream and downstream of the 5' end intragenic nucleotide repeat region, in any combination. In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising, consisting essentially of, or consisting of about 10, about 40, about 50, about 100, about 125, or about 150 nucleotides upstream and downstream of the 5' end intragenic nucleotide repeat region, in any combination, in any combination. In some embodiments, the portion of the nucleotide sequence of the gene comprising, consisting essentially of, or consisting of about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 50 upstream and downstream of the 5' end intragenic nucleotide repeat region, in any combination.

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 10 to about 150 (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150, or any value or range therein) nucleotides upstream (within) of the 3' end of the intragenic nucleotide repeat region to about 50 nucleotides downstream of the 3' end of the intragenic nucleotide repeat region (e.g., a region of the gene comprising, consisting essentially of, or consisting of about 10 to about 150 (e.g., about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, or 150, or any value or range therein) nucleotides upstream and downstream of the 3' end intragenic nucleotide repeat region, i.e., the "3' junction").For example, in some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising, consisting essentially of, or consisting of about 10 to about 150, about 25 to about 100, about 15 to about 125, about 40 to about 80, or about 50 to about 100 nucleotides upstream and downstream of the 3' end intragenic nucleotide repeat region, in any combination. In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene comprising, consisting essentially of, or consisting of about 10, about 40, about 50, about 100, about 125, or about 150 nucleotides upstream and downstream of the 3' end intragenic nucleotide repeat region, in any combination, in any combination. In some embodiments, the portion of the nucleotide sequence of the gene comprising, consisting essentially of, or consisting of about 4 to about 30 consecutive nucleotides within a region of the gene comprising about 50 upstream and downstream of the 3' end intragenic nucleotide repeat region, in any combination.

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene compnsmg the 5' end of the intragenic nucleotide repeat region to the 3' end of the intragenic nucleotide repeat region (e.g., a region of the gene comprising, consisting essentially of, or consisting of the intragenic nucleotide repeat region). The nucleotide sequence of at least a portion of the antisense strand may be complementary to a portion of the nucleotide sequence of a mammalian gene comprising an intragenic nucleotide repeat region having a 5' end and a 3' end and comprising at least about four or more (e.g., at least about 4, 5, 6, 7, 8, 9, 10 or more, or any value or range therein) tandem repeats, wherein the nucleic acid molecule degrades and/or inhibits the expression of the mammalian gene mRNA. In some embodiments, the intragenic nucleotide repeat region comprises about 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500 or more tandem repeats. The intragenic nucleotide repeat region may comprise a range of tandem repeats, wherein a subrange may comprise a "normal" (non-pathological) number of repeats, and wherein another subrange may comprise a pathological number of repeats These subranges may or may not be overlapping, e.g., partially, substantially, or completely overlapping.

The length of each tandem repeat of the invention, i.e., the number of consecutive nucleotides comprising each tandem repeat, may comprise any length of consecutive nucleotides which comprise a repeating pattern in the gene. For example, in some embodiments, each tandem repeat may be a 3-mer (trinucleotide), 4-mer (tetranucleotide), 5- mer, 6-mer, 7-mer, 8-mer, 9-mer, 10-mer, 11-mer, 12-mer, 13-mer, 14-mer, 15-mer or more nucleotide repeat.

The nucleotide sequence of a mammalian gene contemplated in this invention may comprise any standard feature of a mammalian gene. For example, in some embodiments, the nucleotide sequence of the mammalian gene may comprise a 5' untranslated region (UTR), one or more intron(s), one or more exon(s) (e g., coding regions), and/or a 3' UTR. In some embodiments, the intragenic nucleotide repeat region is located within said 5' UTR, intron, exon, and/or 3' UTR.

Genes applicable to the invention include any gene comprising an intragenic nucleotide repeat region (i.e., tandem repeats). Non-limiting examples of genes applicable to the invention include DMPK gene (myotonic dystrophy (DM1)), CNPB1 (DM2), C9orf72 (amyotrophic lateral sclerosis and frontotemporal dementia (ALS/FTD)), FMRI (Fragile X syndrome (FXS), Fragile X-associated tremor/ataxia syndrome (FXTAS)), AFF2 (Fragile XE syndrome (FRAXE), TCF4 (Fuchs endothelial comeal dystrophy (FECD)), HTT (Huntington disease (HD)), JPH3 (Huntington disease-like 2 (HDL2)), CSTB (progressive myoclonic epilepsy 1 (EPM1; also known as Unverricht-Lundbord disease (ULD)), SAMD12, TNRC6A, and/or RAPGEF2 (familial cortical myoclonic tremor with epilepsy type 1 (FCMTE), also known as benign adult familial myoclonic epilepsy (BAFME)), androgen receptor (AR; spinobulbar muscular dystrophy (SBMA)), PBPN1 ((OPMD), XYLT1 (Baratela-Scott syndrome (BSS)), FXN (Friedreich's syndrome (FRDA)), ATN1 (dentatorubro-pallidoluysian atrophy (DRPLA), ATXN1 (SCA1), ATXN2 (SCA2), ATXN3 (SCA3), CACNA1A (SCA6), ATXN7 (SCA7), PPP2R2B (SCA12), TBP (SCA17), ATXN8OS (SCA8), BEAN1 (SCA31), NOP56 (SCA36), and NOTCH2NLC (neuronal intranuclear inclusion disease (NIID)).

Accordingly, the nucleotide sequence of the at least a portion of the antisense strand may be complementary to a portion of any mammalian gene comprising an intragenic nucleotide repeat region (i.e., tandem repeats). For example, in some embodiments, the nucleotide sequence of the at least a portion of the antisense strand is complementary to a portion of a mammalian DMPK, CNPB1 (DM2), C9orf72, FMRI, AFF2, TCF4, HTT, JPH3, CSTB, SAMD12, TNRC6A, RAPGEF2 AR, PBPN, XYLT1, FXN, ATN1, ATXN1, ATXN2, ATXN3, CACNA1A, ATXN7, PPP2R2B, TBP, ATXN8OS, BEAN1, NOP56, N0TCH2NLC, or any combination thereof. In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand may be complementary to a portion of a human, rat, hamster, porcine, canine, feline, rabbit, mouse, and/or non-human primate DMPK gene.

In some embodiments, the portion of the nucleotide sequence of the mammalian DMPK gene may comprise, consist essentially of, or consist of about 4 to about 30 consecutive nucleotides (e g., about 20 consecutive nucleotides) of SEQ ID NO:74-77 [wildtype human, mouse, and non-human primate DMPK],

In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand may comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO:l-42 or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein). In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand does not comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO: 1-42. SEQ ID NO:1. [miR-Ml] CAGCAGCAGCAGCAGCAGCA

SEQ ID NO:2. [miR-M2] GCAGCAGCAGCAGCAGCAGC

SEQ ID NO:3. [miR-M3] CAGCAGCATTCCCGGCTACA

SEQ ID NO:4. [miR-M4] CCCCCCAGCAGCAGCAGCAG

SEQ ID NO:5. [miR-M5] CACCATGGCCCCTCCCCGGG

SEQ ID NO:6. [miR-M6] CCGGCCGAGGCCTCCTCCCC

SEQ ID NO: 7. [miR-M7] CTCTTCAGCATGTCCCACTT

SEQ ID NO:8. [miR-DM8] CGGCTCAGGCTCTGCCGGGT

SEQ ID NO:9. [miR-DM9] TGGCAGGGAGCTGCTGGTGG

SEQ ID NO:10. [miR-DMIO] CTCCTCCTCCAGGGCTTCCT

SEQ ID NO:11. [miR-DMll] ACCCGGCCCCTCCCTCCCCG

SEQ ID NO: 12. [miR-DM12] TGCCTTCCCAGGCCTGCAGT

SEQ ID NO:13. [miR-DM13] CAACGATAGGTGGGGGTGCG

SEQ ID NO: 14. [miR-DMPK-Dl] cggctacaaggacccttcgag

SEQ ID NO: 15. [miR-DMPK-D2] cccggctacaaggacccttc SEQ ID NO: 16. [miR-DMPK-D3] attcccggctacaaggaccc

SEQ ID NO: 17. [miR-DMPK-D4] cattcccggctacaaggacc

SEQ ID NO: 18. [miR-DMPK-D5] gcatcccggctacaaggac

SEQ ID NO: 19. [miR-DMPK-D6] agcattcccggctacaagga

SEQ ID NO:20. [miR-DMPK-D7] cagcattcccggctacaagg

SEQ ID NO:21. [miR-DMPK-D8] gcagcattcccggctacaag

SEQ ID NO:22. [miR-DMPK-D9] agcagcattcccggctacaa

SEQ ID NO:23. [miR-DMPK-DlO] cagcagcattcccggctaca

SEQ ID NO:24. [miR-DMPK-Dll] gcagcagcattcccggctac

SEQ ID NO:25. [miR-DMPK-D12] agcagcagcattcccggcta

SEQ ID NO:26. [miR-DMPK-D13] cagcagcagcattcccggct

SEQ ID NO:27. [miR-DMPK-D14] gcagcagcagcatcccggc

SEQ ID NO:28. [miR-DMPK-D15] agcagcagcagcattcccgg

SEQ ID NO:29. [miR-DMPK-MO] agcagcagcagcagcagcag

SEQ ID NO:30. [miR-DMPK-D16] cccagcagcagcagcagcag

SEQ ID NO:31. [miR-DMPK-D17] ccccagcagcagcagcagca

SEQ ID NO:32. [miR-DMPK-D18] cccccagcagcagcagcagc

SEQ ID NO:33. [miR-DMPK-D19] tccccccagcagcagcagca

SEQ ID NO:34. [miR-DMPK-D20] atccccccagcagcagcagc

SEQ ID NO:35. [miR-DMPK-D21] gatccccccagcagcagcag

SEQ ID NO:36. [miR-DMPK-D22] tgatccccccagcagcagca

SEQ ID NO:37. [miR-DMPK-D23] gtgatccccccagcagcagc

SEQ ID NO:38. [miR-DMPK-D24] gacgacgacccccctagtgt

SEQ ID NO:39. [miR-DMPK-D25] gtctgtgatccccccagcagca

SEQ ID NO:40. [miR-DMPK-D26] ggtctgtgatccccccagcagc SEQ ID NO:41. [miR-DMPK-D27] gaaatggtctgtgatccccc

SEQ ID NO:42. [miR-DMPK-D28] aagaaagaaatggtctgtga

In some embodiments, the portion of the antisense strand may be complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene (e.g., DMPK) comprising the ' J2 J' region, wherein the nucleotide sequence of the at least a portion of the antisense strand comprises, consists essentially of, or consists of the nucleotide sequence of any one of SEQ ID NO: 1-4 or 14-42 or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79,

80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein).

In some embodiments, the portion of the antisense strand may be complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides outside of a region of the gene (e.g., DMPK) comprising the ' J2J' region, wherein the nucleotide sequence of the at least a portion of the antisense strand comprises, consists essentially of, or consists of the nucleotide sequence of any one of SEQ ID NO:5-13 or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80,

81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein).

In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand may be complementary to a portion of a human, mouse, rat, hamster, porcine, canine, rabbit, feline, and/or non-human primate HTT gene (e.g., Huntington disease).

In some embodiments, the portion of the nucleotide sequence of the mammalian HTT gene may comprise, consist essentially of, or consist of about 10 to about 30 consecutive nucleotides (e.g., about 20 consecutive nucleotides) of SEQ ID NO:78-81 [wildtype human, mouse, and non-human primate HTT],

In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand may comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO:43-73, or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein). In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand does not comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO:43-73.

SEQ ID NO:43. [miR-HTT-H24] CTGCTGCTGCTGCTGCTGCT

SEQ ID NO:44. [miR-HTT-H25] CAGTCCTTCCCTTTGCTCTC

SEQ ID NO:45. [miR-HTT-H26] TACCCTGGTTTCATTAAAAT

SEQ ID NO:46. [miR-HTT-H27] AAAtCGCtGAtttGtGtAGtC

SEQ ID NO:47. [miR-HTT-H28] AAAtCGCtGAtttGtGtAGtC

SEQ ID NO:48. [miR-HTT-H29] TTAATGCTAATCGTGATAGGGGTT

SEQ ID NO:49. [miR-HTT-H30] CTCCTACATATTAGCATTAACA

SEQ ID NO:50. [miR-HTT-H31] AAACCGttACCAttACtGAGtt

SEQ ID NO:51. [miR-HTT-H32] AAACCGttACCAttACtGAGtt

SEQ ID NO:52. [miR-HTT-H33] TAGCAAGAGAACCATTACCATT

SEQ ID NO:53. [miR-HTT-RO] gacttgagggactcgaaggc

SEQ ID NO:54. [miR-HTT-Rl] cttgagggactcgaaggcctt

SEQ ID NO:55. [miR-HTT-R2] aaggacttgagggactcgaa

SEQ ID NO:56. [miR-HTT-R3] gaaggacttgagggactcga

SEQ ID NO:57. [miR-HTT-R4] ggaaggacttgagggactcg

SEQ ID NO:58. [miR-HTT-R5] tggaaggacttgagggactc

SEQ ID NO:59. [miR-HTT-R6] ctggaaggacttgagggact

SEQ ID NO:60. [miR-HTT-R7] gctggaaggacttgagggac

SEQ ID NO:61. [miR-HTT-R8] ctgctggaaggacttgaggg

SEQ ID NO:62. [miR-HTT-R9] gctgctggaaggacttgagg

SEQ ID NO:63. [miR-HTT-RlO] tgctgctggaaggacttgag

SEQ ID NO:64. [miR-HTT-Rll] ctgctgctggaaggacttga

SEQ ID NO:65. [miR-HTT-R12] gctgctgctggaaggacttg

SEQ ID NO:66. [miR-HTT-R13] tgctgctgctggaaggactt SEQ ID NO:67. [miR-HTT-R14] ttgctgctgctgctgctgct

SEQ ID NO:68. [miR-HTT-R15] gtgctgctgctgctgctgc

SEQ ID NO:69. [miR-HTT-R16] ctgttgctgctgctgctgct

SEQ ID NO:70. [miR-HTT-R17] gctgttgctgctgctgctgc

SEQ ID NO:71. [miR-HTT-R18] ggctgttgctgctgctgctg

SEQ ID NO:72. [miR-HTT-R19] ggtggcggctgttgctgctg

SEQ ID NO:73. [miR-HTT-R20] ggcggcggtggcggctgttg

In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand may comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO:128-149, or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein). In some embodiments, the nucleotide sequence of the at least a portion of the antisense strand does not comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO: 128-149

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene comprising about 4 to about 30 consecutive nucleotides within a region of the gene (e g., HTT) comprising the 'J2J' region, wherein the nucleotide sequence of the at least a portion of the antisense strand comprises, consists essentially of, or consists of the nucleotide sequence of any one of SEQ ID NO:43, 53-73, 128, 129, 131, or 132, or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein).

In some embodiments, the portion of the antisense strand is complementary to a portion of the nucleotide sequence of the gene (e.g., HTT) comprising about 4 to about 30 consecutive nucleotides outside of a region of the gene comprising the ' J2 J' region, wherein the nucleotide sequence of the at least a portion of the antisense strand comprises, consists essentially of, or consists of the nucleotide sequence of any one of SEQ ID NO:44-52, 130, or 133- 149, or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto, or any value or range therein). In some embodiments, the RNA molecule may be a single-stranded RNA molecule (e.g., miRNA, also referred to as miR). Further example RNA molecules which are miRNA are described in the PCT publication WO 2021/127455, incorporated herein by reference.

In some embodiments, the RNA molecule may be a double-stranded RNA molecule also comprising a sense strand (e.g., shRNA, microRNA duplex, pre-miRNA).

In some embodiments of this invention, the sense strand of a double stranded RNA molecule can be fully complementary to the antisense strand or the sense strand can be substantially complementary or partially complementary to the antisense strand. By substantially or partially complementary is meant that the sense strand and the antisense strand can be mismatched at about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotide pairings. Such mismatches can be introduced into the sense strand sequence, e.g., near the 3’ end, to enhance processing of the double stranded RNA molecule by Dicer, to duplicate a pattern of mismatches in a siRNA molecule inserted into a chimeric nucleic acid molecule or artificial microRNA precursor molecule of this invention, and the like, as would be known to one of skill in the art. Such modification will weaken the base pairing at one end of the duplex and generate strand asymmetry, therefore enhancing the chance of the antisense strand, instead of the sense strand, being processed and silencing the intended gene (Geng and Ding "Double- mismatched siRNAs enhance selective gene silencing of a mutant ALS-causing Allelel" Acta Pharmacol. Sin. 29:211-216 (2008); Schwarz et al. "Asymmetry in the assembly of the RNAi enzyme complex" Cell 115: 199-208 (2003)).

In some embodiments, an RNA molecule of the present invention may be a short hairpin RNA (shRNA) molecule. In some embodiments, an RNA molecule of the present invention may be a pre-microRNA The design and production of any such shRNA of this invention is well known in the art.

Further provided herein is a nucleic acid construct comprising and/or encoding a synthetic RNA molecule of the invention. Non-limiting examples of a nucleic acid construct of the present invention include isolated nucleic acid molecules, expression vectors, non- viral vectors and viral vectors.

In some embodiments, a nucleic acid construct of the present invention may further comprise a promoter. In some embodiments, the promoter may be a neuro-specific promoter. In some embodiments, the promoter may be a muscle-specific promoter. Other non-limiting examples of promoters of the invention include, e g., a CMV promoter and/or a CB promoter.

In some embodiment, the promoter is an inducible promoter. As used herein, an "inducible promoter" refers to a promoter that is characterized by initiating or enhancing transcriptional activity when in the presence of, influenced by, or contacted by an inducer or inducing agent or when or suitable inducing conditions are applied. An "inducer" or "inducing agent," as defined herein, can be endogenous, or a normally exogenous compound or protein that is administered in such a way as to be active in inducing transcriptional activity from the inducible promoter. The term "inducer" as used herein can also relate to applying suitable conditions such that transcriptional activity from the inducible promoter is induced. In some embodiments, the inducer or inducing agent, i.e., a chemical, a compound, a protein, or suitable conditions, can itself be the result of transcription or expression of a nucleic acid sequence (i.e., an inducer can be an inducer protein expressed by another component or module), which itself can be under the control of, e.g., an inducible or repressible promoter. In some embodiments, an inducible promoter is induced in the absence of certain agents, such as a repressor. Examples of inducible promoters include but are not limited to, forskolin-inducible, hypoxia-inducible, temperature-inducible, tetracycline- inducible (Tet-ON), pH-inducible, osmolarity-inducible, metallothionine-inducible, hormone- (e.g. ecdysone-) inducible, carbon source-inducible, alcohol (e.g. ethanol)-inducible, amino acid-mducible, mifepristone (RU-486)-inducible, cumate-mducible, 4-hydroxytamoxifen (OHT)-inducible, gas-inducible, riboswitch-, ribozyme- and aptazyme-inducible, rapamycin- inducible, chemically-induced proximity -inducible, Rheoswitch® promoters, CRISPR- Inducible and inducible promoters from mammalian viruses (e.g., the adenovirus late promoter; and the mouse mammary tumor virus long terminal repeat (MMTV-LTR)) and other steroid-responsive promoters, rapamycin responsive promoters and the like.

In some embodiments, a nucleic acid construct of the present invention may further comprise a polyadenylation (poly A) signal. Non-limiting examples of polyA signals of the invention include, e.g., a simian virus (SV) 40 polyA (SV40 polyA) and/or a synthetic polyA (e.g., small polyA).

In some embodiments, a nucleic acid construct of the present invention may further comprise one or more inverted terminal repeat(s) (ITR).

In some embodiments, a nucleic acid construct of the present invention may further comprise one or more mtron (e.g., hCG intron).

In some embodiments, a nucleic acid construct of the present invention may further comprise a gene open reading frame (e.g., a transgene, e.g., a therapeutic polynucleotide, e.g., encoding a therapeutic polypeptide/protein). For example, in some embodiments, a nucleic acid construct of the present invention may further comprise a gene open reading frame encoding a therapeutic protein, such as, but not limited to, wildtype HTT (e.g., HTT comprising less than or equal to about 35 tandem repeats; e.g., less than or equal to about 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 tandem repeats), CYP46A1, polyglutamine binding peptide 1 (QBP1), PTD-QBP1, ED11, Brain-derived neurotrophic factor (BDNF), Nerve growth factor (NGF), Neurotrophin-3, Neurotrophin-4, Cil iary neurotrophic factor, Glial cell line-derived neurotrophic factor (GDNF) family, Artemin, Neurturin, Persephin, Ephrins, Epidermal growth factor (EGF )and Transforming growth factor (TGF) families, Glia maturation factor, insulin-like growth factor 1 (IGF-1), vascular endothelial growth factor (VEGF), fibroblast growth factor (FGF), platelet-derived growth factor (PDGF), pituitary adenylate cyclase- activating peptide (PACAP), interleukin-1 (IL-1), interleukin-2 (IL-2), interleukin-3 (IL-3), interleukin-5 (IL-5), interleukin-8 (IL-8), macrophage colony-stimulating factor (M-CSF), granulocyte-macrophage colony-stimulating factor (GM-CSF), and neurotactin, C4 intrabody, VL12.3 intrabody, MW7 intrabody, Happl antibodies, Happ3 antibodies, mEM48 intrabody, certain monoclonal antibodies (e.g., 1C2), peptide P42 and variants thereof, as described in Marelli et al. (2016) Orphanet Journal of Rare Disease 11 :24, and/or any other therapeutic protein which may be therapeutic for Huntington's disease. In some embodiments, a nucleic acid construct of the present invention may further comprise a gene open reading frame encoding a therapeutic protein, such as, but not limited to, wildtype DMPK (e.g., DMPK comprising less than or equal to about 50 tandem repeats; e.g., less than or equal to about 50, 49, 48, 47, 46, 45, 44, 43, 42, 41, 40, 39, 38, 37, 36, 35, 34, 33, 32, 31, 30, 29, 28, 27, 26, 25, 24, 23, 22, 21 , 20, 19, 18, 17, 16, 15, 14, 13, 12, 1 1 , 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 tandem repeats), MBNL (e.g., MBNL1, MNBL2, MNBL3, and the like), nucleic acid- binding protein (CNPB; also referred to as zinc finger 9 gene (ZNF9)), Adrenomedullin (AM), Angiopoietin (Ang), Autocrine motility factor, Bone morphogenetic proteins (BMPs), Ciliary neurotrophic factor family, Ciliary neurotrophic factor (CNTF), Leukemia inhibitory factor (LIF), Interleukin-6 (IL-6), Colony-stimulating factors (CSF), Epidermal grow th factor (EGF), Ephrins, Erythropoietin, Fibroblast grow th factor, GDNF family, Growth differentiation factor-9 (GDF9), Hepatocyte growth factor (HGF), Hepatoma-derived growth factor (HDGF), Insulin-like growth factors, Keratmocyte growth factor (KGF), Migration- stimulating factor (MSF), Macrophage-stimulating protein (MSP), Myostatin (GDF-8), Neuregulins, Placental growth factor (PGF), Platelet-derived growth factor (PDGF), Renalase (RNLS), T-cell growth factor (TCGF), Thrombopoietin (TPO), Transforming growth factors (e.g., TFG-a, TFG-P, and the like), Vascular endothelial growth factor (VEGF), Wnt Signaling Pathway factors (e.g., wntl, wnl2. wnt2b, wnt3, wnt3a, wnt4, wnt5a, wnt5b, wnt6. wntl7a. wnt7b, wnt8a, wnt8b, wnt9a, wnt9b, wnt 10a. wnt10b, wnt11, wtn16, and the like), and/or any other therapeutic protein which may be therapeutic for myotonic dystrophy type 1 and/or type 2.

In some embodiments, a nucleic acid construct of the present invention may comprise, consist essentially of, or consist of the nucleotide sequence of any one of SEQ ID NO:82- 127 or a sequence about 70% identical thereto (e.g., about 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identical thereto).

Also provided herein is a vector comprising a nucleic acid construct of the present invention. In some embodiments, the vector may be a plasmid (e.g., pEMBL), phage, non- viral vector, viral vector, bacterial artificial chromosome, or yeast artificial chromosome plasmid. Non-limiting examples of viral vectors of the present invention include an AAV vector, an adenovirus vector, a herpesvirus vector, a lentivirus vector, an alphavirus vector or a baculovirus vector.

Also provided herein is a cell comprising a synthetic RNA molecule, nucleic acid construct, and/or vector of the present invention. In some embodiments, the nucleic acid molecule may be stably incorporated into the genome of the cell. The cell may be an in vitro, ex vivo, or in vivo cell.

Also provided herein is a composition comprising one or more synthetic RNA molecules, nucleic acid constructs, vectors, and/or cells of the present invention. It is understood that the compositions of this invention can comprise, consist essentially of or consist of any of the synthetic RNA molecules, nucleic acid constructs, vectors, and/or cells in any combination and in any ratio relative to one another. Furthermore, by "two or more" is meant 2, 3, 4, 5, 6, 7, 8, 9, 10, etc., up to a total number of synthetic RNA molecules, nucleic acid constructs, vectors, and/or cells of this invention. For example, in some embodiments, a composition of the present invention may comprise two or more synthetic RNA molecules of the present invention, wherein the two or more RNA molecules each comprise a different antisense strand (e.g., a different member of SEQ ID NO: 1-73 or 128-149). In some embodiments, the two or more synthetic RNA molecules may be present on the same nucleic acid construct, on different nucleic acid constructs, or any combination thereof

Further provided herein is a composition comprising a synthetic RNA molecule of this invention in a phamraceutically acceptable carrier, a composition comprising a nucleic acid construct of this invention in a pharmaceutically acceptable carrier, a composition comprising a vector of this invention in a pharmaceutically acceptable carrier, a composition comprising a virus particle of this invention, and a composition comprising a cell of this invention in a pharmaceutically acceptable carrier, e.g., a pharmaceutical composition or pharmaceutical formulation comprising a synthetic RNA molecule, nucleic acid construct, vector, viral particle, and/or cell of the present invention, in any combination.

Also provided herein is a transgenic animal comprising a synthetic RNA molecule of, nucleic acid construct, vector, and/or cell of the present invention. In some embodiments, the animal is a laboratory animal, e.g. , a mouse, rat, rabbit, dog, monkey, or non-human primate. Recombinant Viral Vector Production

Protocols for producing recombinant viral vectors and for using viral vectors for nucleic acid delivery can be found, e.g., in Current Protocols in Molecular Biology, Ausubel, F. M. et al. (eds.) Greene Publishing Associates, (1989) and other standard laboratory manuals (e.g., Vectors for Gene Therapy. In: Current Protocols in Human Genetics. John Wiley and Sons, Inc.: 1997). Further, production of AAV vectors is further described, e.g., in U.S. Patent Number 9,441,206, the contents of which is incorporated herein by reference in its entirety.

Viral vectors produced in a viral expression system can be released (i.e. set free from the cell that produced the vector) using any standard technique. For example, viral vectors can be released via mechanical methods, for example microfluidization, centrifugation, or sonication, or chemical methods, for example lysis buffers and detergents. Released viral vectors are then recovered (i.e., collected) and purified to obtain a pure population using standard methods in the art. For example, viral vectors can be recovered from a buffer they were released into via purification methods, including a clarification step using depth filtration or Tangential Flow Filtration (TFF). As described herein in the examples, viral vectors can be released from the cell via sonication and recovered via purification of clanfied lysate using column chromatography.

In one embodiment, the vector is a non-viral vector, e.g., liposome or microsphere. In one embodiment, the vector is a viral vector. In one embodiment of any aspect, the vector is a DNA or RNA virus. Nonlimiting examples of a viral vector of this invention include an AAV vector, an adenovirus vector, a lentivirus vector, a retrovirus vector, a herpesvirus vector, an alphavirus vector, a poxvirus vector, a baculovirus vector, and a chimeric virus vector.

Any viral vector that is known in the art can be used in the present invention. Examples of such viral vectors include, but are not limited to vectors derived from: Adenoviridae; Bimaviridae; Bunyaviridae; Caliciviridae, Capillovirus group; Carlavirus group; Carmovirus virus group; Group Caulimovirus; Closterovirus Group; Commelina yellow motle virus group; Comovirus virus group; Coronaviridae; PM2 phage group; Corcicoviridae; Group Cryptic virus; group Cryptovirus; Cucumovirus virus group Family ([PHgr]6 phage group; Cysioviridae; Group Carnation ringspot; Diantho virus virus group; Group Broad bean wilt; Fabavirus virus group; Filoviridae; Flaviviridae; Furovirus group; Group Germinivirus; Group Giardiavirus; Hepadnaviridae; Herpesviridae; Hordeivirus virus group; Illarvirus virus group; Inoviridae; Iridoviridae; Leviviridae; Lipothrixviridae; Luteovirus group; Marafivirus virus group; Maize chlorotic dwarf virus group; icroviridae; Myoviridae; Necrovirus group; Nepovirus virus group; Nodaviridae; Orthomyxoviridae; Papovaviridae; Paramyxoviridae; Parsnip yellow fleck virus group; Partitiviridae; Parvoviridae; Peaenation mosaic vims group; Phycodnaviridae; Picomaviridae; Plasmaviridae; Prodoviridae; Polydnaviridae; Potexvirus group; Potyvirus; Poxviridae; Reoviridae; Retroviridae; Rhabdoviridae; Group Rhizidiovirus; Siphoviridae; Sobemovirus group; SSV 1-Type Phages; Tectiviridae; Tenuivirus; Tetraviridae; Group Tobamovirus; Group Tobravirus; Togaviridae; Group Tombusvirus; Group Torovirus; Totiviridae; Group Tymovirus; and Plant virus satellites.

Viral vectors produced by the method of the invention may comprise the genome, in part or entirety, of any naturally occurring and/or recombinant viral vector nucleotide sequence (e.g., AAV, adeno virus, lenti virus, etc.) or variant. Viral vector variants may have genomic sequences of significant homology at the nucleic acid and amino acid levels, produce viral vector which are generally physical and functional equivalents, replicate by similar mechanisms, and assemble by similar mechanisms.

Variant viral vector sequences can be used to produce viral vectors in the viral expression system described herein. For example, or more sequences having at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 99%, or more nucleotide and/or amino acid sequence identity (e.g., a sequence having about 70-99% nucleotide sequence identity) to a given vector (for example, AAV, adeno vims, lentivims, etc.).

It is to be understood that a viral expression system will further be modified to include any necessary elements required to complement a given viral vector during its production using methods described herein. For example, in certain embodiment, the nucleic acid cassete is flanked by terminal repeat sequences. In one embodiment, for the production of rAAV vectors, the AAV expression system will further comprise at least one of a recombinant AAV plasmid, a plasmid expressing Rep, a plasmid expressing Cap, and an adenovirus helper plasmid. Complementary elements for a given viral vector are well known the art and a skilled practitioner would be capable of modifying the viral expression system described herein accordingly.

A viral expression system for manufacturing an AAV vector (e.g., an AAV expression system) could further comprise Replication (Rep) genes and/or Capsid (Cap) genes in trans, for example, under the control of a promoter. Expression of Rep and Cap can be under the control of one promoter, such that expression of these genes are turned "on" together, or under control of two separate promoters that are turned "on" by distinct promoters. On the left side of the AAV genome there are two promoters called p5 and pl 9, from which two overlapping messenger ribonucleic acids (mRNAs) of different length can be produced. Each of these contains an intron which can be either spliced out or not, resulting in four potential Rep genes; Rep78, Rep68, Rep52 and Rep40. Rep genes (specifically Rep 78 and Rep 68) bind the hairpin formed by the ITR in the self-priming act and cleave at the designated terminal resolution site, within the hairpin. They are necessary for the AAVS1 -specific integration of the AAV genome. All four Rep proteins w ere shown to bind ATP and to possess helicase activity. The right side of a positive-sensed AAV genome encodes overlapping sequences of three capsid proteins, VP1, VP2 and VP3, which start from one promoter, designated p40. The cap gene produces an additional, non- structural protein called the Assembly-Activating Protein (AAP). This protein is produced from ORF2 and is essential for the capsid-assembly process. Necessary elements for manufacturing AAV vectors are known in the art, and can further be reviewed, e g., in U.S. Patent Numbers US5478745A; US5622856A; US5658776A; US6440742B1; US6632670B1; US6156303A; US8007780B2; US6521225B1; US7629322B2; US6943019B2; US5872005A; and U.S. Patent Application Numbers US 2017/0130245; US20050266567A1; US20050287122A1; the contents of each are incorporated herein by reference in their entireties.

A viral expression system for manufacturing a lentivirus using methods described herein would further comprise long terminal repeats (LTRs) flanking the nucleic acid cassette. LTRs are identical sequences of DNA that repeat hundreds or thousands of times at either end of retrotransposons or proviral DNA formed by reverse transcription of retroviral RNA. The LTRs mediate integration of the retroviral DNA via an LTR specific integrase the host chromosome. LTRs and methods for manufacturing lentiviral vectors are further described, e.g., in U.S. Patent Numbers US7083981B2; US6207455B1; US6555107B2; US8349606B2; US7262049B2; and U.S. Patent Application Numbers US20070025970A1; US20170067079A1; US20110028694A1; the contents of each are incorporated herein by reference in their entireties.

A viral expression system for manufacturing an adenovirus using methods described herein would further comprise identical Inverted Terminal Repeats (ITR) of approximately 90-140 base pairs (exact length depending on the serotype) flanking the nucleic acid cassette. The viral origins of replication are within the ITRs exactly at the genome ends. The adenovirus genome is a linear double-stranded DNA molecule of approximately 36000 base pairs. Often, adenoviral vectors used in gene therapy have a deletion in the El region, where novel genetic information can be introduced; the El deletion renders the recombinant virus replication defective. ITRs and methods for manufacturing adenovirus vectors are further described, e.g., in U.S. Patent Numbers US7510875B2; US7820440B2; US7749493B2; US7820440B2; US10041049B2; International Patent Application Numbers W02000070071A1; and U.S. Patent Application Numbers W02000070071A1; US20030022356A1; US20080050770A1 the contents of each are incorporated herein by reference in their entireties.

In one embodiment, the viral expression system can be a host cell, such as a virus, a mammalian cell or an insect cell. Exemplary insect cells include but are not limited to Sf9, Sf21, Hi-5, and S2 insect cell lines. For example, a viral expression system for manufacturing an AAV vector could further comprise a baculovirus expression system, for example, if the viral expression system is an insect cell. The baculovirus expression system is designed for efficient large-scale viral production and expression of recombinant proteins from baculovirus-infected insect cells. Baculovirus expression systems are further described in, e.g., U.S. Patent Numbers US6919085B2; US6225060B1; US5194376A; the contents of each are incorporated herein by reference in their entireties.

In another embodiment, the viral expression system is a cell-free system. Cell-free systems for viral vector production are further described in, for example, Cerqueira A., et al. Journal of Virology, 2016; Sheng J., et al. The Royal Society of Chemistry, 2017; and Svitkin Y.V., and Sonenberg N. Journal of Virology, 2003; the contents of which are incorporated herein by reference in their entireties.

Methods

Various methods are provided herein, employing the synthetic RNA molecules, nucleic acid constructs, vectors, cells, and/or compositions of this invention.

Thus, one aspect of the present invention provides a method of delivering a synthetic RNA molecule to a cell (e.g., a muscle cell such as a myoblast, e.g., a neural cell such as cells of the peripheral and central nervous systems, e.g., brain cells such as neurons, oligodendrocytes, glial cells, astrocytes, e.g., spinal cord cells such as cervical, thoracic, lumbar, and/or sacral neurons, dorsal root ganglia cells (DRG; e.g., DRG neurons), the method comprising contacting the cell with a synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention.

In some embodiments, the cell is in a mammalian subject (e.g., a human patient). Administration of the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention to a human subject or an animal in need thereof can be by any means known in the art. Optionally, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition is delivered in an effective dose in a phannaceutically acceptable carrier.

Another aspect of the invention provides a method of delivering a synthetic RNA molecule to a cell in a mammalian subject, the method comprising: administering to the subject an effective amount of a synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention, thereby delivering the synthetic RNA molecule to a cell in the mammalian subject.

The synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the invention may be introduced to the cells in the appropriate amount. The virus vector may be introduced to the cells at the appropriate multiplicity of infection according to standard transduction methods appropriate for the particular target cells. Titers of the virus vector or capsid to administer can vary, depending upon the target cell type and number, and the particular virus vector or capsid, and can be determined by those of skill in the art without undue experimentation. In particular embodiments, at least about 10 ³ infectious units, more preferably at least about 10 ³ , 10 ⁴ , 10 ⁵ or 10 ⁶ infectious units are introduced to the cell.

The cell(s) into which the RNA molecule, nucleic acid, vector, cell, and/or composition of the invention, e.g., virus vector, can be introduced may be of any type, including but not limited to neural cells (including cells of the peripheral and central nervous systems, in particular, brain cells such as neurons, oligodendrocytes, glial cells, astrocytes), lung cells, cells of the eye (including retinal cells, retinal pigment epithelium, and corneal cells), epithelial cells (e.g., gut and respiratory epithelial cells), skeletal muscle cells (including myoblasts, myotubes and myofibers), diaphragm muscle cells, dendritic cells, pancreatic cells (including islet cells), hepatic cells, a cell of the gastrointestinal tract (including smooth muscle cells, epithelial cells), heart cells (including cardiomyocytes), bone cells (e.g, bone marrow stem cells), hematopoietic stem cells, spleen cells, keratinocytes, fibroblasts, endothelial cells, prostate cells, joint cells (including, e.g., cartilage, meniscus, synovium and bone marrow), germ cells, and the like. Alternatively, the cell may be any progenitor cell. As a further alternative, the cell can be a stem cell (e.g, neural stem cell, liver stem cell). As still a further alternative, the cell may be a cancer or tumor cell. Moreover, the cells can be from any species of origin, as indicated above.

The RNA molecule, nucleic acid, vector, cell, and/or composition of the invention, e.g., virus vector, may be introduced to cells in vitro for the purpose of administering the modified cell to a subject. In particular embodiments, the cells have been removed from a subject, the RNA molecule, nucleic acid, vector, cell, and/or composition of the invention, is introduced therein, and the cells are then replaced back into the subject. Methods of removing cells from subj ect for treatment ex vivo, followed by introduction back into the subj ect are known in the art (see, e.g., U.S. patent No. 5,399,346). Alternatively, the RNA molecule, nucleic acid, vector, cell, and/or composition of the invention, is introduced into cells from another subject, into cultured cells, or into cells from any other suitable source, and the cells are administered to a subject in need thereof.

Suitable cells for ex vivo gene therapy are as described above. Dosages of the cells to administer to a subject will vary upon the age, condition and species of the subject, the type of cell, the nucleic acid being expressed by the cell, the mode of administration, and the like. Typically, at least about 10 ² to about 10 ⁸ or about 10 ³ to about 10 ⁶ cells will be administered per dose in a pharmaceutically acceptable carrier. In particular embodiments, the cells transduced with the vims vector are administered to the subject in an effective amount in combination with a pharmaceutical carrier.

Also provided herein is a method of treating a disorder in a mammalian subject in need thereof, wherein the disorder is treatable by expressing a synthetic RNA molecule in a subject, e.g., in a target organ system of the subject, the method comprising administering to the subject a therapeutically effective amount of a synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention, to the mammalian subject under conditions whereby the synthetic RNA molecule is expressed in the subject, e.g., in the target organ system, thereby treating the disorder.

In some embodiments, the disorder may be, but is not limited to, myotonic dystrophy (e g., DM1, DM2), amyotrophic lateral sclerosis and/or frontotemporal dementia (ALS/FTD), Fragile X syndrome (FXS), Fragile X-associated tremor/ataxia syndrome (FXTAS), Fragile XE syndrome (FRAXE), Fuchs endothelial comeal dystrophy (FECD), Huntington disease (HD), Huntington disease-like 2 (HDL2), progressive myoclonic epilepsy 1 (EPM1; also known as Unverricht-Lundbord disease (ULD), familial cortical myoclonic tremor with epilepsy type 1 (FCMTE; also known as benign adult familial myoclonic epilepsy (BAFME)), spinobulbar muscular dystrophy, oculopharyngeal muscular dystrophy (OPMD), dentatorubropallidoluysian atrophy (DRPLA), spinocerebellar ataxia (SCA, e.g., polyglutamine ("PolyQ", with "CAG" expansion) SCA, e.g., type 1 (SCA1), type 2 (SCA2), type 3 (SCA3), type 6 (SCA6), type 7 (SCA7), type 12 (SCA12), type 17 (SCA17); e.g., other expansion CSA, e.g., SCA8 ("CTG" expansion), SCA31 ("TGGAA" expansion), SCA36 ("GGCCTG" expansion)), Baratela-Scott syndrome (BSS), Friedreich's ataxia (FRDA), neuronal intranuclear inclusion disease (NIID), or any combination thereof.

In some embodiments, the present invention provides a synthetic RNA molecule containing a nucleotide sequence that is fully complementary to a portion of the target gene for inhibition. However, it is to be understood that 100% complementarity between the antisense strand of the RNA molecule and the target sequence is not required to practice the present invention. Thus, sequence variations that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence can be tolerated. RNA sequences with insertions, deletions, and single point mutations relative to the target sequence may also be effective for inhibition. Thus, sequence identity and complementarity can be optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). In some embodiments, greater than 90% complementarity, or even 100% complementarity, between the inhibitory RNA and the portion of the target gene is preferred. Alternatively, e.g., with a dsRNA, the duplex region of the dsRNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a portion of the target gene transcript under strict conditions (e.g., 400mM NaCl, 40mM PIPES pH 6.4, ImM EDTA, 60°C hybridization for 12-16 hours; followed by washing).

The target system contemplated in the present invention may be any mammalian organ system to which the compositions and methods of the invention may provide benefit. Non-limiting examples of target organ systems include the nervous system (e g., PNS, CNS), the muscular system, the respiratory system, the reproductive system, the lymphatic system, the renal system, the digestive system, or any combination thereof. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention is administered to the CNS, the peripheral nervous system, or both. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention is administered to the muscular system.

In some embodiments, a synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention is administered directly to the CNS, e.g., the brain or the spinal cord. Direct administration can result in high specificity of transduction of CNS cells, e.g., wherein at least 80%, 85%, 90%, 95% or more of the transduced cells are CNS cells. Any method known in the art to administer a synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention directly to the CNS can be used. The synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may be introduced into the spinal cord, brainstem (medulla oblongata, pons), midbrain (hypothalamus, thalamus, epithalamus, pituitary gland, substantia nigra, pineal gland), cerebellum, telencephalon (corpus striatum, cerebrum including the occipital, temporal, parietal and frontal lobes, cortex, basal ganglia, hippocampus and amygdala), limbic system, neocortex, corpus striatum, cerebrum, and inferior colliculus. The synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may also be administered to different regions of the eye such as the retina, cornea or optic nerve. The vector may be delivered into the cerebrospinal fluid (e.g, by lumbar puncture) for more disperse administration of the vector.

A synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may be administered to the desired region(s) of the CNS by any route known in the art, including but not limited to, intrathecal, intracerebral, intraventricular, intranasal, intra-aural, intra-ocular (e.g., intra-vitreous, sub-retinal, anterior chamber) and peri-ocular (e.g., sub-Tenon's region) delivery or any combination thereof. The synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may be administered in a manner that produces a more widespread, diffuse transduction of tissues, including the CNS, the peripheral nervous system, and/or other tissues.

Accordingly, another aspect of the invention provides a method of treating Huntington disease in a mammalian subject in need thereof, wherein the disease is treatable by expressing synthetic RNA molecule in the nervous system of the subject, the method comprising administering to the subject a therapeutically effective amount of the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition of the present invention, to the mammalian subject under conditions whereby the synthetic RNA molecule is expressed in the nervous system, thereby treating the disease. In some embodiments, the mammalian subject is a human subject. In some embodiments of the methods provided herein, the synthetic RNA molecule degrades and/or inhibits expression of a native HTT gene mRNA in the subject, such that the native HTT gene expression is reduced to at least 80% or less (e.g., 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, or 5% or less) as compared to a control (e.g., native HTT gene expression in the subject, wherein the synthetic RNA molecule has not been administered).

Another aspect of the invention provides a method of treating myotonic dystrophy (DM) disorder in a mammalian subject in need thereof, wherein the DM disorder is treatable by expressing a synthetic RNA molecule in the muscular system of the subject, the method comprising administering to the subject a therapeutically effective amount of the synthetic RNA molecule, nucleic acid construct, vector, cell, and/or composition of the present invention, to the mammalian subject under conditions whereby the synthetic RNA molecule is expressed in the muscular system, thereby treating the DM disorder. In some embodiments, the DM disorder is myotonic dystrophy 1 (e.g., DM1) and/or myotonic dystrophy 2 (DM2). In some embodiments, the mammalian subject is a human subject.

In some embodiments of the methods provided herein, the synthetic RNA molecule degrades and/or inhibits expression of a native gene (e.g., DMPK, e.g., CNPB1) mRNA in the subject, such that the native gene expression is reduced to at least 80% or less (e.g., 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, or 5% or less) as compared to a control (e.g., native gene expression in the subject, wherein the synthetic RNA molecule has not been administered).

Dosages of virus vectors to be administered to a subject will depend upon the mode of administration, the disease or condition to be treated, the individual subject's condition, the particular virus vector, and the nucleic acid to be delivered, and can be determined in a routine manner. Exemplary doses for achieving therapeutic effects are virus titers of at least about 10 ² , 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ³ , 10 ¹⁴ , 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , 10 ¹⁸ transducing units or more, e.g., about 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ , 10 ¹⁵ 10 ¹⁶ , 10 ¹⁷ , or 10 ¹⁸ transducing units, yet more preferably about 10 ¹¹ , 10 ¹² , 10 ¹³ , 10 ¹⁴ or 10 ¹⁵ , 10 ¹⁶ , 10 ¹⁷ , 10 ¹⁸ transducing units. Doses and virus titer transducing units may be calculated as vector or viral genomes (vg).

In some embodiments, more than one administration (e.g., two, three, four or more administrations) may be employed to achieve the desired level of treatment (e.g., expression of synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention, etc.) over a period of various intervals, e.g, daily, weekly, monthly, yearly, etc. In one embodiment, the methods described herein further comprise administering an immune modulator. In one embodiment, an immune modulator is administered prior to administration of the synthetic RNA molecule. In one embodiment, an immune modulator is administered following administration of the synthetic RNA molecule. In one embodiment, an immune modulator is administered prior to and following administration of the synthetic RNA molecule. Immune modulators are known in the art and can be readily identified by a skilled person.

Exemplary modes of administration include oral, rectal, transmucosal, topical, intranasal, inhalation (e.g., via an aerosol), buccal (e.g., sublingual), vaginal, intrathecal, intraocular, transdermal, in utero (or in ovo), parenteral (e.g, intravenous, subcutaneous, intradermal, intramuscular [including administration to skeletal, diaphragm and/or cardiac muscle], intradermal, intrapleural, intracerebral, and intraarticular), topical (e.g, to both skin and mucosal surfaces, including airway surfaces, and transdermal administration), intro- lymphatic, and the like, as well as direct tissue or organ injection (e.g., to liver, skeletal muscle, cardiac muscle, diaphragm muscle or brain). Administration can also be to a tumor (e.g. , in or a near a tumor or a lymph node). The most suitable route in any given case will depend on the nature and severity of the condition being treated and on the nature of the particular vector that is being used. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may be delivered or administered to the subject by intravenous, intramuscular, intraperitoneal, or arterial delivery, or any combination thereof. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may be delivered or administered to the subject by intrathecal, intracerebral, intraparenchymal, intracerebroventricular, intranasal, intra-aural, intra-ocular, or peri-ocular delivery, or any combination thereof.

In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition of the present invention may be administered to a subject in need thereof as early as possible in the life of the subject, e.g., as soon as the subject is diagnosed with a disorder. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition is administered to a newborn subject, e.g, after newborn screening has identified aberrant gene expression or activity of a gene comprising an intragenic nucleotide repeat region. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition is administered to a fetus in utero, e.g., after prenatal screening has identified aberrant gene expression or activity of a gene comprising an intragenic nucleotide repeat region. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition is administered to a subject as soon as the subject develops symptoms associated with aberrant gene expression or activity of a gene comprising an intragenic nucleotide repeat region or is suspected or diagnosed as having aberrant gene expression or activity of a gene comprising an intragenic nucleotide repeat region. In some embodiments, the synthetic RNA molecule, nucleic acid, vector, cell, and/or composition is administered to a subject before the subject develops symptoms associated with aberrant gene expression or activity of a gene comprising an intragenic nucleotide repeat region, e.g., a subject that is suspected or diagnosed as having aberrant gene expression or activity of a gene comprising an intragenic nucleotide repeat region but has not started to exhibit symptoms.

In some embodiments, the synthetic RNA molecule degrades and/or inhibits expression of a native gene (e.g., DMPK, e.g., HTT) mRNA in the cell and/or subject, such that the native gene expression is reduced to at least 80% or less (e.g., 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 9%, 8%, 7%, 6%, or 5% or less) as compared to a control (e.g., native gene expression in the cell/subject, wherein the synthetic RNA molecule has not been delivered/administered).

Typically, the viral vector will be administered in a liquid formulation by direct injection (e.g., stereotactic injection) to the desired region or compartment in the CNS and/or other tissues. In some embodiments, the vector can be delivered via a reservoir and/or pump. In other embodiments, the vector may be provided by topical application to the desired region or by intra-nasal administration of an aerosol formulation. Administration to the eye or into the ear, may be by topical application of liquid droplets. As a further alternative, the vector may be administered as a solid, slow-release formulation. Controlled release of parvovirus and AAV vectors is described by international patent publication WO 01/91803.

Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution or suspension in liquid prior to injection, or as emulsions. Alternatively, one may administer the virus vector in a local rather than systemic manner, for example, in a depot or sustained-release formulation. Further, the virus vector can be delivered dried to a surgically implantable matrix such as a bone graft substitute, a suture, a stent, and the like (e.g., as described in U.S. Patent 7,201,898).

Pharmaceutical compositions suitable for oral administration can be presented in discrete units, such as capsules, cachets, lozenges, or tablets, each containing a predetermined amount of the composition of this invention; as a powder or granules; as a solution or a suspension in an aqueous or non-aqueous liquid; or as an oil-in-water or water-in-oil emulsion. Oral delivery can be performed by complexing a virus vector of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers include plastic capsules or tablets, as known in the art. Such formulations are prepared by any suitable method of pharmacy, which includes the step of bringing into association the composition and a suitable carrier (which may contain one or more accessory ingredients as noted above). In general, the pharmaceutical composition according to embodiments of the present invention are prepared by uniformly and intimately admixing the composition with a liquid or finely divided solid carrier, or both, and then, if necessary, shaping the resulting mixture. For example, a tablet can be prepared by compressing or molding a powder or granules containing the composition, optionally with one or more accessory ingredients. Compressed tablets are prepared by compressing, in a suitable machine, the composition in a free-flowing form, such as a powder or granules optionally mixed with a binder, lubricant, inert diluent, and/or surface active/dispersing agent(s). Molded tablets are made by molding, in a suitable machine, the powdered compound moistened with an inert liquid binder.

Pharmaceutical compositions suitable for buccal (sub-lingual) administration include lozenges comprising the composition of this invention in a flavored base, usually sucrose and acacia or tragacanth; and pastilles comprising the composition in an inert base such as gelatin and glycerin or sucrose and acacia.

Pharmaceutical compositions suitable for parenteral administration can comprise sterile aqueous and non-aqueous injection solutions of the composition of this invention, which preparations are optionally isotonic with the blood of the intended recipient. These preparations can contain anti-oxidants, buffers, bacteriostats and solutes, which render the composition isotonic with the blood of the intended recipient. Aqueous and non-aqueous sterile suspensions, solutions and emulsions can include suspending agents and thickening agents. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.

The compositions can be presented in unit/dose or multi-dose containers, for example, in sealed ampoules and vials, and can be stored in a freeze-dned (lyophilized) condition requiring only the addition of the sterile liquid carrier, for example, saline or water-for- injection immediately prior to use.

Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules and tablets of the kind previously described. For example, an injectable, stable, sterile composition of this invention in a unit dosage form in a sealed container can be provided. The composition can be provided in the form of a lyophilizate, which can be reconstituted with a suitable pharmaceutically acceptable carrier to form a liquid composition suitable for injection into a subject. The unit dosage form can be from about 1 pg to about 10 grams of the composition of this invention. When the composition is substantially water- insoluble, a sufficient amount of emulsifying agent, which is physiologically acceptable, can be included in sufficient quantify to emulsify the composition in an aqueous carrier. One such useful emulsifying agent is phosphatidyl choline.

Pharmaceutical compositions suitable for rectal administration can be presented as unit dose suppositories. These can be prepared by admixing the composition with one or more conventional solid earners, such as for example, cocoa buter and then shaping the resulting mixture.

Pharmaceutical compositions of this invention suitable for topical application to the skin can take the form of an ointment, cream, lotion, paste, gel, spray, aerosol, or oil. Carriers that can be used include, but are not limited to, petroleum jelly, lanoline, polyethylene glycols, alcohols, transdermal enhancers, and combinations of two or more thereof. In some embodiments, for example, topical delivery can be performed by mixing a pharmaceutical composition of the present invention with a lipophilic reagent (e.g. , DMSO) that is capable of passing into the skin.

Pharmaceutical compositions suitable for transdermal administration can be in the form of discrete patches adapted to remain in intimate contact with the epidermis of the subject for a prolonged period of time. Compositions suitable for transdermal administration can also be delivered by iontophoresis (see, for example, Pharm. Res. 3:318 (1986)) and typically take the form of an optionally buffered aqueous solution of the composition of this invention. Suitable formulations can comprise citrate or bis\tris buffer (pH 6) or ethanol/water and can contain from 0. 1 to 0.2M active ingredient.

The virus vectors disclosed herein may be administered to the lungs of a subject by any suitable means, for example, by administering an aerosol suspension of respirable particles comprised of the virus vectors, which the subject inhales. The respirable particles may be liquid or solid. Aerosols of liquid particles comprising the virus vectors may be produced by any suitable means, such as with a pressure-driven aerosol nebulizer or an ultrasonic nebulizer, as is known to those of skill in the art. See, e.g, U.S. Patent No. 4,501,729. Aerosols of solid particles comprising the virus vectors may likewise be produced with any solid particulate medicament aerosol generator, by techniques known in the pharmaceutical art.

The invention will now be described with reference to the following examples. It should be appreciated that these examples are not intended to limit the scope of the claims to the invention but are rather intended to be exemplary of certain embodiments. Any variations in the exemplified methods that occur to the skilled artisan are intended to fall within the scope of the invention.

EXAMPLES

Example 1: Artificial miRNAs and their application for disorders such as myotonic dystrophy.

This study examined AAV9-mediated artificial miRNAs and their application for myotonic dystrophy (DM1) as an example application of the present invention.

The study was performed in several parts, including: part I, designing and synthetizing artificial miRNAs (miRs) for the gene and/or gene product DMPK, referred to herein as miDMPKs; part II, screening for miDMPKs via transfection in the 293 cell line; part Illa, screening for miDMPKs via infection in muscle cell line C2C12; part Illb, screening for miDMPKs via infection in normal human myoblast cells; and part IIIc, screening for miDMPKs via infection in DM1 patient-derived myoblast cells.

DM1 is caused by an unstable CTG repeat expansion in the 3’-UTR of the DM protein kinase (DMPK) gene. Between 5 and 37 repeats is generally considered "normal," once repeats are more than 50, they form (pathologic) double stranded hairpin structure. These mutated "mutDMPK" can trap with muscleblind like splicing regulators (MBNL) and form aggregation or nuclear foci, which enhance PKC activation and increase CUG binding protein.

High-level binding protein leads to other mRNAs missplicing, and the reduction of muscleblind like protein itself also worsens mRNA missplicing. Decreased chloride channel protein 1 (CLCN1) causes muscle myotonia, while reduced insulin receptor leads to insulin resistance and high blood glucose. Deceased CTNT causes heart dysfunction. The general mechanism of DM1 is outlined in FIGS. 1A and IB. A design schematic of the artificial miRNAs is shown in FIG. 2, which indicates the targeted region of each miRNA along the DMPK mRNA. Targeting information is also provided in Table 4.

In order to test the designed miRNAs, constructs were created comprising the miRNAs, as shown in FIGS. 3A-3B. pEMBL-D(+)-CMV-hCGintron was generated as a control vector, which has inserted an empty human chorionic gonadotropin (hCG) intron and is driven by a CMV promoter (FIG. 3A; double-stranded vectors, top). Two copies of control miRNA precursor (control sequences or non-functional mutations) were inserted into the hCG intron to generate the plasmid pEMBL-D(+)-CMV-hCGin-2x control pre-miR (FIG. 3A; double-stranded vectors, middle). Two copies of artificial pre-miR (matching with 3’- UTR targeting sequences, including about 100-150bp flanked upstream and downstream sequences) were cloned between the hCG introns (FIG. 3A; double-stranded vectors, bottom). A single-stranded vector was also generated in order to identify whether the pre- miRNA could be processed into mature miRNA and combined with DMPK target sequences (FIG. 3A; single-stranded vector). Partial sequences of DMPK, complementary with mature miRNA, were inserted behind luciferase gene. For the limit of package size, small poly A is used in the constructs.

Additional constructs were developed for expression of MBNL1. pEMBL-D(+)- CMV-GFP-sPA is a control vector. pEMBL-D(+)-CMV-MBNLl-sPA was used for overexpressing MBNL1, driven with muscle specific promoter CMV. The vector pEMBL- D(+)-CMV-MBNLl -hCGin-2x artificial pre-miR was also generated as a combination, which could produce both MBNL1 and artificial miRNA at the same time.

FIG. 3B illustrates a schematic of the in vitro screening performed for the artificial miRNAs of the invention. Using the constructs generated as described above, two copies of artificial miRNA precursor could be cut and processed into mature miRNA. The miRNA are able to match with target sequences in DMPK and inhibit luciferase expression. At the same time, control miRNA could also be processed but could not combine with DMPK target sequences, so it has no effect on the expression of luciferase.

To perform these assays, the miRNA and control constructs were introduced to 293 cells with co-transfection with calcium phosphate The cell pellet was harvested after 48 hours, after which the cells were lysed and luciferase activity (Luc) and protein concentration (Pr) measured. Activity of miRNAs was analyzed according to the ratio of Luc/Pr. Results are shown in FIGS. 4-6. As shown in FIG. 5, after 48-hour co-transfection, constructs comprising miR-Ml, M2, M3, M4, and M13 could inhibit luciferase activity as compared with control.

In similar assays, the miRNA and control constructs were introduced to mouse myoblast C2C12 cells via AAV9 vectors (AAV9-CMV-hCGin-empty or -miR-Ml, M2, M3, M4, or Ml 3). AAV particle infection was performed at a multiplicity of infection (MOI of 5 x 10 ⁵ viral genomes (vg)/cell. After 72 hours, the cell lysis was harvested and luciferase activity was detected. Results are shown in FIG. 7. AAV9 mediated artificial miRNAs inhibited luciferase gene expression in C2C12 myoblast cells. AAV9-CMv-hCGin-miR-Ml, M2, M3, M4, and Ml 3 could match with the targeting sequences inserted into the luciferase gene and inhibit luciferase activity about 61.9%, 67.7% , 91.4%, 50.1% and 49.9%, respectively, compared with AAV9-CMV-hCGin (control). Luciferase activity in RLU/mg as shown in FIG. 7, left panel, and as percentage in FIG. 7, right panel.

In similar assays, the miRNA and control constructs were introduced to normal human or DM1 patient derived myoblasts via AAV9 vectors (AAV9-CMV-hCGin-empty or - miR-Ml, M2, M3, M4, or M13). AAV particle infection was performed at both a high MOI (5 x 10’ vg/cell) and a low MOI (1 x 10 ⁵ vg/cell). After 1 week, the cell pellet was harvested and mRNA extracted. Several analyses were performed, including testing mutant DMPK rnRNA by RT-PCT and Northern blot, testing off-target activities of the miRs. Results are shown in FIGS. 8-13C. As shown in FIGS. 8 and 9, Artificial miDMPKs inhibited DMPK gene expression in normal human myoblasts, wherein AAV9-CMV-miDMPK-Ml, M2, M3, M4 and Ml 3 efficiently inhibited DMPK expression compared with AAV9-CMV-hCGin (control). FIG. 10 shows the AAV9-CMV-miDMPK-Ml, M2, M3, M4 and M13 efficiently inhibited DMPK expression compared with AAV9-CMV-hCGin (control) quantified by ratio of DMPK/GAPDH. As compared to control (100%), the expression of DMPK was 26.1% (Ml), 18.1% (M2). 27.7% (M3), 57.8% (M4) and 20.4% (M13), respectively. FIG. 11 shows AAV9-mediated GFP expression in the human myoblasts treated by Hoechst 3334, wherein the high concentration of Hoechst 33342 (4 pM) increased AAV vector entry into the cell and enhanced infectivity of AAV9-CMV-GFP in normal human myoblast. FIG. 12 shows blot data of mutant DMPK (mutDMPK) and wildtype DMPK (wt-DMPK) gene expression inhibition by treatment of artificial miRNA constructs comprising M3, M4, and M13. FIG. 13A shows constructs comprising the artificial miRNAs inhibited mutDMPK gene expression in DM1 patient myoblasts. AAV9-CMV-miDMPK-M3, M4 and M13 could efficiently inhibit DMPK expression compared with control, at 27.7%, 17.6%, and 7.9% expression (FIG. 13A, right panel), respectively. Similarly, FIG. 13B shows the constructs inhibited wtDMPK gene expression in DM1 patient myoblasts. In this case, AAV9-CMV-miDMPK- M3, M4 and M13 could efficiently inhibit DMPK expression compared with control, at 20.8%, 17.1%, and 11.2% expression (FIG. 13B, right panel), respectively. FIG. 13C further shows that all constructs inhibited total DMPK gene expression in DM1 patient myoblasts. AAV9-CMV-miDMPK-Ml, M2, M3, M4 and M13 could efficiently inhibit DMPK expression compared with control, at 44.3%, 36.9%, 24.2%, 17.4%, and 9.6% expression (FIG. 13C, right panel), respectively.

Ml, M2, M3, and M4 targeted sequences in the DMPK gene located in Region I (FIGS. 2 and 14A; Table 4), comprising the CTG repeat extension and its two terminal junctions (the "J2J" region). Similar successful targeting of HTT is described in Example 2, wherein a cluster of effective artificial miRNAs also targeted sequences in the HTT Region III comprising the HTT CAG repeat extension and its two terminal junctions ("J2J" region). In the disease state, the CTG repeats of the mutant DMPK form a structure similar to a knot, in which the two terminal ends are exposed (naked). Without wishing to be bound to theory, it is possible that the most effective miRNAs clustered to target this region because there are less RNA-binding proteins (RBPs) to stabilize the mRNA at these 5’-Junction and 3’- Junction regions, exposed as a part of naked mRNA. The clustering may also be caused by the many CTG repeats, wherein in either scenario the mRNA in these regions become more sensitive to miRNA targeting and binding. In these scenarios, it may be that the miRNA specific seed sequences become less important than is typical.

To test the hypothesis that this Region I (J2J region) is particularly effective to target, new miDMPKs were developed, as shown in FIG. 14B and as listed in the SEQUENCES section and/or in the Sequence Listing XML. These miDMPKs (at least D3 to D26, as shown), which have different seed sequences, have similar inhibition on DMPK protein. Accordingly, this region from 5 ’-Junction to 3 ’-Junction of CTG repeats could be considered of equal or more importance than the miRNA seed sequences in particular, despite miRNA binding capability being decided by its seed sequences.

In conclusion, this study showed that artificial miDMPKs could bind with DMPK mRNA sequences from Region I (CTG repeats) and Region V (3 -UTR), and inhibit DMPK protein expression. In particular, from the region between 5’-Junction and 3’-Junction of CTG repeats (J2J), miDMPK-Ml and M2 (CTG repeats), could inhibit total miDMPK expression, miDMPK-M3 (5 ’-Junction) and M4 (3 ’-Junction) could efficiently inhibit both mutant and wild type DMPK expression up to 82.4%, and from the 3’-UTR region, artificial miDMPK-Ml 3 could efficiently inhibit both mutant and wild type DMPKs expression, up to 92.1 %. These miDMPKs could be applied to treat a DM1 animal model with treatment either alone or in combination with exogenous MBNL delivery (e.g., overexpression). This study further indicates that there is a cluster of miRNA binding sites from 5 ’-Junction to 3’- Junction of CTG repeats (J2J) in DMPK gene.

While not wishing to be bound to theory, it is hypothesized that other genetic diseases caused by nucleotide repeat expansion might also present a cluster of miRNA binding sites from 5’-Junction to 3’-Junction of nucleotide repeats. Accordingly, those genetic diseases with nucleotide repeat expansion could be treated by designed artificial miRNAs designed to directly target the region from 5 ’-Junction to 3 ’-Junction of nucleotide repeats.

Example 2: Artificial miRNAs and their application for disorders such as Huntington's disease.

This study examined AAV9-mediated artificial miRNAs and their application for Huntington's disease (HD) as an example application of the present invention.

Huntington disease is caused by an expanded polyglutamine tract, encoded by CAG repeat extension (FIG. 15A). CAG repeats less than 26 are considered normal, whereas once repeats number more than 35, the mutant HTT mRNA produces mutant HTT protein with ployQ (poly-glutamine), which forms aggregates and causes serial toxicity on neurons. The basal ganglia is the most severely affected region in HD patient. Native CYP46A1 (as a monooxygenase) can convert cholesterol to cerebrosterol (24S-hydroxy cholesterol), wherein the latter protects neurons. Tn HD patients, however, 24s-OHC is downregulated and its neuroprotection is lost.

This study examined whether artificial miRs could be designed to target a specific site of HTT mRNA and interrupt its expression (FIG. 15B). The study was performed in several parts, including: part I, designing and synthetizing artificial miRNAs (miRs) for the gene and/or gene product HTT, referred to herein as miHTTs; part II, screening for miHTTs via transfection in the 293 cell line; part Illa, screening for miHTTs via infection in neural cell line U87; and part Illb, screening for miHTTs via infection in HD patient-derived fibroblast cells. Screening in 293 cells occurred via co-transfection, to screen all miHTTs via plasmid transfection and identify their efficiency of binding targeting sequence sin the 293 cell line. Screening in U87 cells and HD patient fibroblasts occurred via AAVRH10 mediated infection, to compare their efficiency of inhibiting HTT expression in neural cells. In addition, treatment was given in combination of miHTTs with CYP46A1 to test their synergistic effect. Screening similarly occurred in an HD animal model. A design schematic of example artificial miRNAs of this invention is shown in FIG. 16, which indicates the targeted region of several miRNA along the DMPK mRNA. Targeting information is also provided in Table 5.

In order to test the designed miRNAs, constructs were created comprising the miRNAs. pEMBL-D(+)-CMV-hCGintron was used as a control vector, which has inserted an empty human chorionic gonadotropin (hCG) intron and is driven by a CMV promotor. This plasmid, with miHTTs inserted, was co-transfected with calcium phosphate into 293 cells alone or in combination with an pAAV2.1-Luc vector comprising targeting sequences. After 48 hours, the cell pellet was harvested, lysed, and luciferase activity (Luc) and protein concentration (Pr) measured. Screening for effect of miHTTs was calculated according to the ratio of Luc/Pr. Results are shown in FIGS. 17-.

As shown in FIG. 17, transfection of the constructs showed successful signal by imaging. FIG. 18 shows the tested constructs comprising artificial miHTTs inhibited luciferase gene expression with targeting sequences via co-transfection. After 48-hour co- transfection, pEMBL-CMV-hCGin-miHTT-H2 and miHTT-H5 could efficiently inhibit luciferase activity about 46.4% and 54.8%, respectively, as compared with pEMBL-CMV- hCGin (control). Similarly, FIG. 19 shows additional tested constructs which inhibited luciferase gene expression with targeting sequences via co-transfection. In this 2 ^nd round screening, after 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT-H14, H15, H17, H19 (miR-137) and miHTT-H21 (miR-216b) could efficiently inhibit luciferase activity as compared with pEMBL-CMV-hCGin (control). MiDMPK-M5, M7 and M9 for DMPK were also used as additional non-HTT-targeting negative controls. FIG. 20 shows these results by percentage, wherein compared with control (100%), the activity of luciferase was 2.5% (H14), 8.8% (H15), 9.2% (H17), 12.9% (miR-137), and 4.2% (miR-216b), respectively. MiHTT-H2, H4 and H5 are shown as positive controls. MiDMPK-M5, M7 and M9 for targeting DMPK are shown as additional negative controls. FIG. 21 shows results from a third round screening, wherein after 48-hour co-transfection, pEMBL-CMV-hCGin-miHTT- H24, H26, H27, H28 and H29 could efficiently inhibit luciferase activity compared with pEMBL-CMV-hCGin (control). M1HTT-H2, H4 and H5 and M1HTT-H19-21 are shown as positive controls. FIG. 22 shows these results by percentage, wherein compared with control (100%), the activity of luciferase was 30.8% (H24), 9.1% (H26), 9.9% (H27), 16.6% (H28), and 19.6% (H29), respectively. MiHTT-H2, H4 and H5 are shown as positive controls. MiHTT-H19-21 are also shown as positive controls. The combination of these results indicated that the most effective tested miHTTs were found in Region I, Region IV, and Region V (see FIG. 16).

In similar assays, the miRNA and control constructs were introduced to human primary glioblastoma cell line U87 cells via AAVrhlO vectors (AAVrhlO-CMV-hCGin- empty or -miHTT-Hl~H33). AAV particle infection was performed at a multiplicity of infection (MOI of 5 x 10 ⁵ viral genomes (vg)/cell (FIG. 23). After 72 hours, the cell pellet was harvested and protein was extracted for detection of HTT protein by western blot. Results are shown in FIG. 24. After AAVRH10-CMV-hCGin-miHTT-Hl-H5 treatment in U87 cells, HTT expression was reduced by AAVRH10-CMV-hCGin-miHTT-H2, -miHTT- H4 and -miHTT-H5. FIG. 25 shows quantification of western blot data by ratio of HTT/beta- actin (FIG. 25, left panel) and % expression of HTT/control (FIG. 25, right panel). HTT protein expression was inhibited by AAVRH10-CMV-hCGin-miHTT-H2 (26.8%), miHTT4 (41.5%) and miHTT-H5 (58.4%).

The first round of infections was followed by an expanded panel, as shown in FIGS. 26-29. In this panel, AAVRH10-CMV-miHTT-H15 and H16 (FIG. 26), AAVRH10-CMV- miHTT-H21 and H22 (FIG. 27), and AAVRH10-CMV-miHTT-H2, H4 and H5, as internal control for the 2 ^nd round infection (FIG. 28), could significantly inhibit HTT expression compared with AAVRH10-CMV-hCGin (control). These results are further quantified as HTT expression over control (FIG. 29). AAVRH10-CMV-miHTT-H2, H4, H5, H15, H16, H21 (miR-216b) and miHTT-H22 (miR-27a) could efficiently inhibit HTT expression compared with AAVRH10-CMV-hCGin (control), wherein compared to the control (100%), the expression of HTT was 57.1% (H2), 24.1% (H4). 38.4% (H5), 42% (H15), 61.8% (H16), 33.8% (H21/miR-21 b), and 31.8% (H22/miR-27a), respectively.

Further studies were performed in human fibroblasts from HD patients. In these studies, constructs were delivered by AAVrhlO vectors (AAVrhlO-CMV-hC Gin-empty or - miHTT). Constructs tested included at least miHTT-Hl-H5 and H11-H22. Constructs as viral particles were infected into human lung fibroblast cultures from HD patients at an MOI of 5 x 10 ⁵ vg/cell. After 72 hours, the cell pellet was harvested, protein and mRNA were extracted, and mutant HTT (mHTT) was analyzed by protein (western blot) and/or RNA (RT-PCR and/or Northern blot), to examine inhibition of mutant HTT mRNA and protein expression levels, as w ell as off-target effects of the miRs. Successful infection with increasing levels of Hoechst 33342 is shown in FIG. 30. For the low infectivity of AAVRH10 in lung fibroblast from HTT patients, Hoechst 33342 was added to the medium in serial increasing concentration to increase AAV vector entry into the cells. Infectivity was greatly enhanced by Hoechst 33342 in a dose-dependent manner, with equal to or greater than 2pM being most effective. Further results of studies in HD patient fibroblasts are shown in FIGS. 31-34.

As shown in FIGS. 31, 32, and 33, artificial miHTTs inhibited HTT gene expression in human HD patient fibroblasts during infection with Hoechst 33342 (2pM). At least AAVRH10-CMV-miHTT-H2, H4 and H5 (FIG. 31), -Hl 5 and Hl 6 (FIG. 32), and -Hl 7, H20, H21(FIG. 33) could efficiently inhibit HTT expression compared with AAVRH10- CMV-hCGin (control). FIG. 34 shows results of HTT expression/control as percentage, wherein as compared to control (100%), the expression of HTT was 25.4% (H2), 36.0% (H4). 49.1% (H5), 43.7% (H16), 67.0%(H20/Mir-455) and 51.8% (H21/miR-216b), respectively.

Following initial studies in HD patient fibroblasts, further studies were performed wherein the miHTT-comprising constructs tested included at least miHTT-Hl-H5 and Hl 1- H22. Constructs as viral particles were infected into human lung fibroblast cultures from HD patients at an MOI of 5 x 10 ⁵ vg/cell with Hoechst 3342 at 4 pM. After 6 days, the cell pellet was harvested, protein and mRNA were extracted, and mutant HTT (mHTT) was analyzed by protein (western blot) and/or RNA (RT-PCR and/or Northern blot), to examine inhibition of mutant HTT mRNA and protein expression levels, as well as off-target effects of the miRs. Results are shown in FIGS. 35-38.

Successful infection is shown in FIG. 35. At least AAVRH10-CMV-miHTT-H2, H4 and H5 (FIG. 36), -H24 and H28 (FIG. 37), and -Hl, H2, H4, H5, and H24 (FIG. 38) could efficiently inhibit HTT expression compared with AAVRH10-CMV-hCGin (control). FIG. 38 shows results of HTT expression/control as percentage, wherein as compared to control (100%), the expression of HTT was 25.4% (H2), 36.0% (H4). 49.1% (H5), 43.7% (H16), 67.0%(H20/Mir-455) and 51.8% (H21/miR-216b), respectively.

Several of the most efficient miHTTs targeted sequences in the HTT gene located in Region III (FIGS. 16 and 39; Table 5), comprising the CAG repeat extension and its two terminal junctions (the "J2J" region). Similar successful targeting of DMPK is described in Example 1, wherein a cluster of effective artificial miRNAs also targeted sequences in the HTT Region I comprising the DMPK CTG repeat extension and its two terminal junctions ("J2J" region). In the disease state, the CAG repeats of the mutant HTT form a structure similar to a knot, in which the two terminal ends are exposed (naked). Without wishing to be bound to theory, it is possible that the most effective miRNAs clustered to target this region because there are less RNA-binding proteins (RBPs) to stabilize the mRNA at these 5’- Junction and 3 ’-Junction regions, exposed as a part of naked mRNA. The clustering may also be caused by the many CAG repeats, wherein in either scenario the mRNA in these regions become more sensitive to miRNA targeting and binding. In these scenarios, it may be that the miRNA specific seed sequences become less important than is typical.

To test the hypothesis that this Region III (J2J region) is particularly effective to target, new miHTTs were developed, as shown in FIG. 40 and as listed in the SEQUENCES section and/or the Sequence Listing XML. These miHTTs (at least R0-R20, as shown), which have different seed sequences, have similar inhibition on HTT protein. Accordingly, this region from 5 ’-Junction to 3 ’-Junction of CAG repeats could be considered of equal or more importance than the miRNA seed sequences in particular, despite miRNA binding capability being decided by its seed sequences.

In conclusion, this study showed that artificial miHTTs could bind with HTT mRNA sequences from Region III (CAG repeats) and Region V (3'-UTR), and inhibit HTT (wildtype and mutant) protein expression. From the region between 5’-Junction and 3’-Junction of CAG repeats, miHTT-H1, H2, H24 (CAG repeats), H4 (5 ’-Junction), H5 (3’-Junction) could efficiently inhibit HTT expression up to 90.8%. From the 3’-UTR region, artificial miHTTs- H15, H16 and H17 could moderately inhibit HTT expression. This study is also believed to be the first time to show miR-455 (miHTT-H20) and miR-216b (miHTT-H21) could also inhibit HTT expression.

The CAG or CTG repeats of mutHTT/mutDMPK form a complex secondary structure, like a knot, in which the two terminals are exposed like naked mRNA. While not wishing to be bound to theory, it is hypothesized that for diseases and disorders comprising excessive trinucleotide repeats, there may be less RNA-binding proteins (RBPs) to stabilize the mRNA at these 5' and 3' junctions of the "knot". Further, there may be a part of "naked" mRNA without binding of RBPs, wherein the space adjacent to 5’-/3’- junctions is enough for small molecular miRNA (~22bp) to bind with the naked mRNA. This corresponds with the data indicating a cluster of miRNA binding sites from 5’ -Junction to 3 ’-Junction of CAG/CTG repeats (the "J2J" region) in both HTT and DMPK genes.

While not wishing to be bound to theory, it is hypothesized that other genetic diseases caused by nucleotide repeat expansion might also present a cluster of miRNA binding sites from 5’-Junction to 3’-Junction of nucleotide repeats. Accordingly, those genetic diseases with nucleotide repeat expansion could be treated by designed artificial miRNAs designed to directly target the region from 5 ’-Junction to 3 ’-Junction of nucleotide repeats. Table 1. Table 2.

Table 3. Table 4: Example artificial miRNAs targeting DMPK (miDMPKs). Sequences provided in SEQUENCES section and/or the Sequence Listing XML. Table 5. Example artificial miRNAs targeting HTT (miHTT). Sequences provided in SEQUENCES section and/or the Sequence Listing XML.

SEQUENCES

SEQ ID NO:1. [miR-Ml] CAGCAGCAGCAGCAGCAGCA

SEQ ID NO:2. [miR-M2] GCAGCAGCAGCAGCAGCAGC

SEQ ID NO:3. [miR-M3] CAGCAGCATTCCCGGCTACA

SEQ ID NO:4. [miR-M4] CCCCCCAGCAGCAGCAGCAG

SEQ ID NO:5. [miR-M5] CACCATGGCCCCTCCCCGGG

SEQ ID NO:6. [miR-M6] CCGGCCGAGGCCTCCTCCCC

SEQ ID NO: 7. [miR-M7] CTCTTCAGCATGTCCCACTT

SEQ ID NO:8. [miR-DMS] CGGCTCAGGCTCTGCCGGGT

SEQ ID NO:9. [miR-DM9] TGGCAGGGAGCTGCTGGTGG

SEQ ID NO:10. [miR-DMlO] CTCCTCCTCCAGGGCTTCCT

SEQ ID NO:11. [miR-DMll] ACCCGGCCCCTCCCTCCCCG

SEQ ID NO: 12. [miR-DM12] TGCCTTCCCAGGCCTGCAGT

SEQ ID NO:13. [miR-DM13] CAACGATAGGTGGGGGTGCG

SEQ ID NO: 14. [miR-DMPK-Dl] cggctacaaggacccttcgag

SEQ ID NO:15. [miR-DMPK-D2] cccggctacaaggacccttc

SEQ ID NO: 16. [miR-DMPK-D3] attcccggctacaaggaccc

SEQ ID NO: 17. [miR-DMPK-D4] cattcccggctacaaggacc

SEQ ID NO: 18. [miR-DMPK-D5] gcattcccggctacaaggac

SEQ ID NO: 19. [miR-DMPK-D6] agcattcccggctacaagga

SEQ ID NO:20. [miR-DMPK-D7] cagcattcccggctacaagg

SEQ ID NO:21. [miR-DMPK-D8] gcagcattcccggctacaag

SEQ ID NO:22. [miR-DMPK-D9] agcagcattcccggctacaa

SEQ ID NO:23. [miR-DMPK-DlO] cagcagcattcccggctaca

SEQ ID NO:24. [miR-DMPK-Dll] gcagcagcattcccggctac SEQ ID NO:25. [miR-DMPK-D12] agcagcagcattcccggcta

SEQ ID NO:26. [miR-DMPK-D13] cagcagcagcatcccggct

SEQ ID NO:27. [miR-DMPK-D14] gcagcagcagcattcccggc

SEQ ID NO:28. [miR-DMPK-D15] agcagcagcagcattcccgg

SEQ ID NO:29. [miR-DMPK-MO] agcagcagcagcagcagcag

SEQ ID NO:30. [miR-DMPK-D16] cccagcagcagcagcagcag

SEQ ID NO:31. [miR-DMPK-D17] ccccagcagcagcagcagca

SEQ ID NO:32. [miR-DMPK-D18] cccccagcagcagcagcagc

SEQ ID NO:33. [miR-DMPK-D19] tccccccagcagcagcagca

SEQ ID NO:34. [miR-DMPK-D20] atccccccagcagcagcagc

SEQ ID NO:35. [miR-DMPK-D21] gatccccccagcagcagcag

SEQ ID NO:36. [miR-DMPK-D22] tgatccccccagcagcagca

SEQ ID NO:37. [miR-DMPK-D23] gtgatccccccagcagcagc

SEQ ID NO:38. [miR-DMPK-D24] gacgacgacccccctagtgt

SEQ ID NO:39. [miR-DMPK-D25] gtctgtgatccccccagcagca

SEQ ID NO:40. [miR-DMPK-D26] ggtctgtgatccccccagcagc

SEQ ID NO:41. [miR-DMPK-D27] gaaatggtctgtgatccccc

SEQ ID NO:42. [miR-DMPK-D28] aagaaagaaatggtctgtga

SEQ ID NO:43. [miR-HTT-H24] CTGCTGCTGCTGCTGCTGCT

SEQ ID NO:44. [miR-HTT-H25] CAGTCCTTCCCTTTGCTCTC

SEQ ID NO:45. [miR-HTT-H26] TACCCTGGTTTCATTAAAAT

SEQ ID NO:46. [miR-HTT-H27] AAAtCGCtGAtttGtGtAGtC

SEQ ID NO:47. [miR-HTT-H28] AAAtCGCtGAtttGtGtAGtC

SEQ ID NO:48. [miR-HTT-H29] TTAATGCTAATCGTGATAGGGGTT

SEQ ID NO:49. [miR-HTT-H30] CTCCTACATATTAGCATTAACA SEQ ID NO:50. [miR-HTT-H31] AAACCGttACCAttACtGAGtt

SEQ ID NO:51. [miR-HTT-H32] AAACCGttACCAttACtGAGtt

SEQ ID NO:52. [miR-HTT-H33] TAGCAAGAGAACCATTACCATT

SEQ ID NO:53. [miR-HTT-RO] gacttgagggactcgaaggc

SEQ ID NO:54. [miR-HTT-Rl] cttgagggactcgaaggcctt

SEQ ID NO:55. [miR-HTT-R2] aaggacttgagggactcgaa

SEQ ID NO:56. [miR-HTT-R3] gaaggacttgagggactcga

SEQ ID NO:57. [miR-HTT-R4] ggaaggacttgagggactcg

SEQ ID NO:58. [miR-HTT-R5] tggaaggacttgagggactc

SEQ ID NO:59. [miR-HTT-R6] ctggaaggacttgagggact

SEQ ID NO:60. [miR-HTT-R7] gctggaaggacttgagggac

SEQ ID NO:61. [miR-HTT-R8] ctgctggaaggacttgaggg

SEQ ID NO:62. [miR-HTT-R9] gctgctggaaggacttgagg

SEQ ID NO:63. [miR-HTT-RlO] tgctgctggaaggacttgag

SEQ ID NO:64. [miR-HTT-Rll] ctgctgctggaaggacttga

SEQ ID NO:65. [miR-HTT-Rl 2] gctgctgctggaaggacttg

SEQ ID NO:66. [miR-HTT-R13] tgctgctgctggaaggactt

SEQ ID NO:67. [miR-HTT-R14] ttgctgctgctgctgctgct

SEQ ID NO:68. [miR-HTT-R15] gttgctgctgctgctgctgc

SEQ ID NO:69. [miR-HTT-R16] ctgttgctgctgctgctgct

SEQ ID NO:70. [miR-HTT-R17] gctgttgctgctgctgctgc

SEQ ID NO:71. [miR-HTT-R18] ggctgttgctgctgctgctg

SEQ ID NO:72. [miR-HTT-R19] ggtggcggctgttgctgctg

SEQ ID NO:73. [miR-HTT-R20] ggcggcggtggcggctgtg SEQ ID NO:74. [Homo sapiens DMPK, mRNA; GenBank® Acc. No. NM OO 1081563.2]

SEQ ID NO:75. [mus musculus DMPK, mRNA GenBank® Acc. No. NM 032418.3]

SEQ ID NO:76. [macaca mulatta DMPK, mRNA GenBank® Acc. No.

NM OO 1260568.1]

SEQ ID NO:77. [Rattus norvegicus DMPK, mRNA GenBank® Acc. No.

NM 001372064.1]

SEQ ID NO:78. [Homo sapiens huntingtin (HTT), mRNA GenBank® Acc. No.

NM 001388492.1]

SEQ ID NO:79. [mus musculus huntingtin (HTT), mRNA GenBank® Acc. No.

NM 010414.3]

SEQ ID NO:80. [macaca mulatta huntingtin (HTT), mRNA GenBank® Acc. No.

XM 028848247.1]

SEQ ID NO:81. [rattus norvegicus huntingtin (HTT), mRNA GenBank® Acc. No.

NM 024357.4]

SEQ ID NO:82. [pEMBL-CMV-hCGin-2x-(miRNA insert)]

Ctgcgcgctcgctcgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacc tttggtcgcccggcctcagtgagcgag cgagcgcgcagagagggagtggAattcacgcgtggatcttaatagtaatcaattacgggg tcattagttcatagcccatatatggagtt ccgcgttacataacttacgglaaatggcccgcctggctgaccgcccaacgacccccgccc attgacgtcaataalgacgtatgttccca tagtaacgccaatagggactttccatgacgtcaatgggtggagtatttacggtaaactgc ccacttggcagtacatcaagtgtatcatat gccaagtccgccccctattgacglcaatgacggtaaatggcccgcctggcattatgccca gtacatgaccttacgggactttcctacttg gcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacac caatgggcgtggatagcggttgactcacgg ggattccaagtctccaccccattgacgtcaatgggagtttgtttggcaccaaaatcaacg ggacttccaaaatgtcgtaataaccccg ccccgttgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctc gtttagtgaaccgtcagatcactagaag ctttatgcggtagtttatcacagttaaatgctaacgcagtcagtgcttctgacacaacag tctcgaacttaagctgcagaagttggtcgt gaggcactgggcaggtaagtatcaaggttacaagacaggtttaaggagaccaatagaaac tgggcttgtcgagacagagaagactct tgcgttctgataggcacctattggtcttactgacatccactttgcctttctctccacagg tgtccactcccagttcaattacagctcttaagg ctagagtacttaatacgactcactataggctagcaccggtatcgatggtacc[insert] gtcgacacagatcttccggactgggcacct tccacctccttccaggcaatcactggcatgagaaggggcagaccagtgtgagctgtggaa ggacgcctctttctggaggagtgtgac ccccagtaagcttcacgtggggcagttcctgagggtggggatctgaaatgttggggtatc tcaggtccctcgggctgtggggtgggct ctgaaaggcaggtgtccgggtggtgggtcctgaataggagatgccgggaagggtctctgg gtctttgtgggtggtgtaccctggggg atgggaaggccggggctcagggctgtggtctcaggcccgggtgaagcagtgtccttgtcc ggttaccctgcagggcggctcgtctg ggttccgtttatccgggcaaaccggccgcgactctagatcataatcagccataccacatt tgtagaggtttacttgcttaaaaaacctcc cacacctccccctgaacctgaaacataaaatgaatgcaattgtgcAGGCCTtgcATGCAT tgcgcggccgcgcagttgtgt taacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcac aaataaagcattttttcactgcatctagttgtgg tttgtccaaactcatcaatgtatcttaaggcgggaattgatctaggaacccctagtgatg gagttggccactccctctctgcgcgctcgct cgctcactgaggccgcccgggcaaagcccgggcgtcgggcgacctttggtcgcccggcct cagtgagcgagcgagcgcgcaga gagggagtgg

SEQ ID NO:83. ]pEMBL-CMV-hCGin-2x-(miDMPK-Ml)]

SEQ ID NO:84. ]pEMBL-CMV-hCGin-2x-(miDMPK-M2)] SEQ ID NO:85. [pEMBL-CMV-hCGin-2x-(miDMPK-M3)]

SEQ ID NO:86. [pEMBL-CMV-hCGin-2x-(miDMPK-M4)]

SEQ ID NO:87. [pEMBL-CMV-hCGin-2x-(miDMPK-M5)]

SEQ ID NO:88. [pEMBL-CMV-hCGin-2x-(miDMPK-M6)]

SEQ ID NO:89. [pEMBL-CMV-hCGin-2x-(miDMPK-M7)]

SEQ ID NO:90. [pEMBL-CMV-hCGin-2x-(miDMPK-M8)]

SEQ ID NO:91. [pEMBL-CMV-hCGin-2x-(miDMPK-M9)]

SEQ ID NO:92. [pEMBL-CMV-hCGin-2x-(miDMPK-M10)]

SEQ ID NO:93. [pEMBL-CMV-hCGin-2x-(miDMPK-Mll)]

SEQ ID NO:94. [pEMBL-CMV-hCGin-2x-(miDMPK-M12)]

SEQ ID NO:95. [pEMBL-CMV-hCGin-2x-(miDMPK-M13)]

SEQ ID NO:96. [pEMBL-CMV-hCGin-2x-(miHTT-Hl)]

SEQ ID NO:97. [pEMBL-CMV-hCGin-2x-(miHTT-H2)]

SEQ ID NO:98. [pEMBL-CMV-hCGin-2x-(miHTT-H3)]

SEQ ID NO:99. [pEMBL-CMV-hCGin-2x-(miHTT-H4)]

SEQ ID NO: 100. [pEMBL-CMV-hCGin-2x-(miHTT-H5)]

SEQ ID NO: 101. [pEMBL-CMV-hCGin-2x-(miHTT-H6)]

SEQ ID NO: 102. [pEMBL-CMV-hCGin-2x-(miHTT-H7)]

SEQ ID NO: 103. [pEMBL-CMV-hCGin-2x-(miHTT-H8)]

SEQ ID NO: 104. [pEMBL-CMV-hCGin-2x-(miHTT-H9)]

SEQ ID NO: 105. [pEMBL-CMV-hCGin-2x-(miHTT-H10)J

SEQ ID NO: 106. [pEMBL-CMV-hCGin-2x-(miHTT-Hll)]

SEQ ID NO: 107. [pEMBL-CMV-hCGin-2x-(miHTT-H12)] 2x-(miHTT-H13)]

SEQ ID NO: 109. [pEMBL-CMV-hCGin-2x-(miHTT-H14)]

SEQ ID NO: 110. [pEMBL-CMV-hCGin-2x-(miHTT-H15)] SEQ ID NO:111. [pEMBL-CMV-hCGin-2x-(miHTT-H16)]

SEQ ID NO: 112. [pEMBL-CMV-hCGin-2x-(miHTT-H17)]

SEQ ID NO: 113. [pEMBL-CMV-hCGin-2x-(miHTT-H18)]

SEQ ID NO: 114. [pEMBL-CMV-hCGin-2x-(miHTT-H19)]

SEQ ID NO: 115. [pEMBL-CMV-hCGin-2x-(miHTT-H20)]

SEQ ID NO: 116. [pEMBL-CMV-hCGin-2x-(miHTT-H21)]

SEQ ID NO: 117. [pEMBL-CMV-hCGin-2x-(miHTT-H22)]

SEQ ID NO: 118. [pEMBL-CMV-hCGin-2x-(miHTT-H24)]

SEQ ID NO: 119. [pEMBL-CMV-hCGin-2x-(miHTT-H25)]

SEQ ID NO: 120. [pEMBL-CMV-hCGin-2x-(miHTT-H26)]

SEQ ID NO: 121. [pEMBL-CMV-hCGin-2x-(miHTT-H27)]

SEQ ID NO: 122. [pEMBL-CMV-hCGin-2x-(miHTT-H28)]

SEQ ID NO: 123. [pEMBL-CMV-hCGin-2x-(miHTT-H29)]

SEQ ID NO: 124. [pEMBL-CMV-hCGin-2x-(miHTT-H30)]

SEQ ID NO: 125. [pEMBL-CMV-hCGin-2x-(miHTT-H31)]

SEQ ID NO: 126. [pEMBL-CMV-hCGin-2x-(miHTT-H32)]

SEQ ID NO: 127. [pEMBL-CMV-hCGin-2x-(miHTT-H33)]

SEQ ID NO:128.[miR-HTT-Hl] GCTGCTGCTGCTGCTGCTGC

SEQ ID NO: 129. [miR-HTT-H2] TGCTGCTGCTGCTGCTGCTG

SEQ ID NO: 130. [miR-HTT-H3] GGCGGCGGCGGCGGCGGCGG

SEQ ID NO: 131. [miR-HTT-H4] TGCTGGAAGGACTTGAGGGA

SEQ ID NO: 132. [miR-HTT-H5] TGTTGCTGCTGCTGCTGCTG

SEQ ID NO:133. [miR-HTT-H6] CGAGGCCGGGGCGGGGCACA

SEQ ID NO: 134. [miR-HTT-H7] CGGGGCGGGGCCGTGGAGGG SEQ ID NO: 135. [miR-HTT-H8] ACTGTGCCACTATGTTTTCA

SEQ ID NO: 136. [miR-HTT-H9] GCCTTCATCAGCTTTTCCAG

SEQ ID NO:137. [miR-HTT-HlO] GAGGGGTGGGGAGGCTGGGG

SEQ ID NO:138. [miR-HTT-H11] TCCTTGACCTGCTGCTGCAG

SEQ ID NO:139. [miR-HTT-H12] CCTTCCACTGGCCATGATGC

SEQ ID NO: 140. [miR-HTT-H13] ACTGTGCCACTATGTTTTCA

SEQ ID NO:141. [miR-HTT-H14] TGAGGTATCAGATTGTCTAG

SEQ ID NO:142. [miR-HTT-H15] AAAttAATCTCTTACCTGAT

SEQ ID NO: 143. [miR-HTT-H16] CCCAGGGCTAGCAAGGAACA

SEQ ID NO: 144. [miR-HTT-H17] AATTCAGTAGCTTCCCTTAA

SEQ ID NO:145. [miR-HTT-H18] CTGGGCCCGCAGCGGAAGGG

SEQ ID NO:146. [miR-HTT-H19 (miR-137)] TTATTGCTGTCTACTATCCG

SEQ ID NO:147. [miR-HTT-H20 (miR-455)] TCAGTCCTTCCCAAAGCTCT

SEQ ID NO:148. [miR-HTT-H21 (miR-216b)] TAATCTCTTTACTGATATAA

SEQ ID NO: 149. [miR-HTT-H22 (miR-27a)] TCAGCAGTGTTATTTCTTAC

The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.