US20130022974A1 | 2013-01-24 | |||
US20100055688A1 | 2010-03-04 | |||
US20090192112A1 | 2009-07-30 | |||
US20120289408A1 | 2012-11-15 | |||
US20140045915A1 | 2014-02-13 | |||
US20100179213A1 | 2010-07-15 |
WU ET AL.: "DNA Methylation on N6-Adenine in Mammalian Embryonic Stem Cells", NATURE, vol. 532, 30 March 2016 (2016-03-30), pages 329 - 333, XP055423560
ZHOU ET AL.: "DNA N6-Methyladenine Demethylase ALKBH1 Enhances Osteogenic . Differentiation of Human MSCs", BONE RESEARCH, vol. 4, 11 October 2016 (2016-10-11), pages 1 - 9, XP055423579
LUO ET AL.: "DNA N6-Methyladenine: a New Epigenetic Mark in Eukaryotes?", NATURE REVIEWS MOLECULAR CELL BIOLOGY, vol. 16, 1 December 2015 (2015-12-01), pages 705 - 710, XP055423580
ZDZALIK ET AL.: "Protozoan ALKBH8 Oxygenases Display both DNA Repair and tRNA Modification Activities", PLOS ONE, vol. 9, no. 6, 10 June 2014 (2014-06-10), pages 1 - 13, XP055423581
CLAIMS What is claimed is: 1. A method of detecting a modified nucleic acid in a sample, the method comprising: isolating DNA from a sample to obtain isolated DNA; sequencing the isolated DNA; and analyzing the isolated DNA sequence to detect that nucleic acid modification. 2. The method of claim 1, wherein isolating DNA from a sample further comprises subjecting the sample to chromatin-immunoprecipitation (ChIP) to obtain the isolated DNA, wherein the isolated DNA is from a genomic region. 3. The method of claim 2, wherein the genomic region is an H2A.X deposition region. 4. The method of claim 2, wherein sequencing the isolated DNA further comprises subjecting the isolated DNA to singular molecular real time (SMRT) sequencing. 5. The method of claim 4, wherein the method further comprises circularizing the isolated DNA. 6. The method of claim 1, wherein the nucleic acid modification is N6- methyladenine (N6-mA). 7. The method of claim 5, wherein isolating DNA from a sample further comprises subjecting the sample to DNA-immunoprecipitation (DIP) to obtain the isolated DNA. 8. The method of claim 6, wherein sequencing the isolated DNA further comprises subjecting the isolated DNA to next generation sequencing. 9. The method of claim 1, wherein the sample is a biological sample. 10. The method of claim 9, wherein the biological sample is a stem cell. 11. The method of claim 10, wherein the stem cell is one selected from the group consisting of an embryonic stem cell and an induced pluripotent stem cell. 12. A method for diagnosing cancer in a subject in need thereof, the method comprising: determining the level of N6-mA in a biological sample of the subject; measuring the level of N6-mA of a comparator control; and diagnosing the subject with cancer when the level of N6-mA in the biological sample is different than the level of N6-mA of the comparator control. 13. The method of claim 12, wherein the level of N6-mA in the biological sample is elevated when compared with the comparator control. 14. The method of claim 12, wherein the level of N6-mA in the biological sample is reduced when compared with the comparator control. 15. The method of claim 12, wherein the comparator control is at least one selected from the group consisting of: a positive comparator control, a negative comparator control, a historical control, a historical norm, or the level of a reference molecule in the biological sample. 16. The method of claim 12, wherein the subject is human. 17. A method for modulating the level of N6-mA in a sample, the method comprising administering a modulator of ALKBHl to the sample. 18. The method of claim 17, wherein the modulator is at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, an antisense nucleic acid molecule. 19. The method of claim 17, wherein the modulator decreases the level or activity of ALKBHl . 20. The method of claim 19, wherein the level of N6-mA is increased. 21. The method of claim 17, wherein the modulator increases the level or activity of ALKBH1. 22. The method of claim 21, wherein the level of N6-mA is decreased. 23. A composition comprising a modulator of N6-mA, wherein the composition comprises an agent selected from the group consisting of an inhibitor of ALKBHl and an activator of ALKBHl . |
COMPOSITIONS AND METHODS FOR DETECTING N6-METHYLADENINE IN
THE MAMMALIAN GENOME CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims priority to U.S Provisional Patent
Application No. 62/309,093, filed March 16, 2016, which is hereby incorporated herein by reference in its entirety. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR
DEVELOPMENT
This invention was made with government support under Grant No.
1R01GM114205-01, awarded by National Institutes of Health. The Government has certain rights in the invention.
BACKGROUND OF THE INVENTION DNA methylation is a crucial component of epigenetic regulation that controls many important aspects of mammalian biology, such as imprinting, X
chromosome inactivation and tumorigenesis (Venolia and Gartler, 1983, Nature 302:82- 3; Bell and Felsenfeld, 2000, Nature 405:482-5; Smith and Meissner, 2013, Nat Rev Genet 14:204-20; Schubeler, 2015, Nature 517:321-6). The prevailing dogma states that DNA methylation exclusively occurs on the fifth position of cytosine (5mC) in mammals, whereas the other modifications are absent, such as A^-methyladenine (N6-mA) which is predominantly present in prokaryotes and a limited number of eukaryotes (Heyn and Esteller, 2015, Cell 161 :710-3). Several reports have very recently expanded the list of organisms with N6-mA to three additional eukaryotes: insects (D. melcmogaster) (Zhang et al., 2015, Cell 161 :893-906), nematodes (C. elegans) (Greer et al., 2015, Cell 161 :868- 78) and green algae (C. reinhardtii) (Fu et al, 2015, Cell 161 :879-92). Despite this progress, the central issue regarding additional DNA modifications in mammals remains unsolved. A single report in 1980's showed indirect evidence of N6-mA in mammalian genomes (Achwal et al., 1983, FEBS Lett 158:353-8); subsequent studies, however, were unable to confirm the presence of N6-mA in mammalian genomes (Ratel et al., 2006, FEBS Lett 580:3179-84). It was therefore determined that the abundance of N6-mA must be extremely low in mammalian genomes, if at all existent (Heyn and Esteller, 2015, Cell 161 :710-3; Ratel et al., 2006, Bioessays 28:309-15) and that N6-mA might have been excluded from mammalian genomes during evolution. SMRT (Single Molecular Real- Time) sequencing, which can distinguish modified bases via differential DNA
polymerase kinetics during synthesis, has recently been applied to identify DNA modifications in a variety of organisms (Davis et al., 2013, Curr Opin Microbiol 16: 192- 8). Although this approach has greatly facilitated the identification of N6-mA in various eukaryotes, high sequencing coverage is needed for precise calling of a modified base, which presents a unique hurdle for adapting SMRT sequencing to interrogating the large genomes of mammals (2.8 Gb oiMus musculus, for example).
DNA methylation (5mC) is primarily involved in gene silencing in mammalian cells, while N6-mA is implicated in gene activation in insects (D.
melanogaster) (Zhang et al., 2015, Cell 161 :893-906); and N6-mA also collaborates with H3K4 methylation in worms (C. elegans) (Greer et al., 2015, Cell 161 :868-78). In addition to repressing the expression of genes, a major function of 5mC in mammals is to control retrotransposons, which comprise nearly half of the mammalian genome (Goodier and Kazazian, 2008, Cell 135:23-35). For example, the long interspersed element 1 (LINEl or LI), a non-LTR family retrotransposon, is repressed by 5mC and small RNAs, especially in the germline (Goodier and Kazazian, 2008, Cell 135:23-35; Bourc'his and Estor, 2004, Nature 431 :96-9; Kanellopoulou, 2005, Genes Dev 19:489-501). Several thousands of full-length LINEl s (6-7 Kb), which contain their own promoters at the 5'UTR, can transcribe autonomously, while the majority of the LINEls, which lost the 5' UTR and other regions proximal to the 5' end, such as the open reading frame 1 (ORFl), are transcriptionally incompetent (Goodier and Kazazian, 2008, Cell 135:23-35).
Although generally considered "junk DNAn," LINEls, especially, the full-length ones, have been long proposed to play a role in the regulation of high-order chromatin structure and long-range gene silencing. Mary Lyon (Lyon, 1998, Cytogenet Cell Genet 80: 133-7) first proposed that LINEl may serve as the "way stations" (Gartler and Riggs, 1983, Annu Rev Genet 17: 155-90) to facilitate heterochromatinization on the inactive X chromosomes in female cells because LINEls, especially the young (emerged in the mouse genome less than 1.5 million years ago (Goodier and Kazazian, 2008, Cell 135:23- 35; Goodier et al., 2001, Genome Res 11 : 1677-85; Castro-Diaz et al., 2014, Genes Dev 28: 1397-409)) full-length Lis are specifically enriched on the X-chromosome over the autosomes (Abrusan et al., 2008, PLoS Genet 4:el000172; Bailey et al., 2000, PNAS 97:6634-9). Subsequent bioinformatics analysis and experimental evidence both indicate that young full-length Lis may be involved in the propagation of heterochromatin during X-inactivation(Abrusan et al., 2008, PLoS Genet 4:el000172; Bailey et al., 2000, PNAS 97:6634-9; Chow et al., 2010, Cell 141 :956-69). However, it is still debatable whether young full-length Lis plays any direct roles in epigenetic silencing.
Accumulating evidence has demonstrated the vital role of histone proteins in regulating DNA functions. Histone octamers form the core complex that stabilizes nucleosome structures via an intricate web of interactions with DNA (Baillie et al., 2011, Nature 479:534-7); the primary sequences of histones are highly conserved in evolution, as alteration may destabilize histone-DNA interactions (Luger et al., 1997, Nature
389:251-60). On the other hand, incorporation of histone variant proteins, which carry significantly different primary sequences from the major histone isoforms, is another important aspect of epigenetic regulation (Banaszynski et al., 2010, Dev Cell 19:662-74; Malik and Henikoff, 2003, Nat Struct Biol 10:882-91). These variants, which usually account for a very small fraction of the total histone pool, are deposited in critical genomic regions and play important roles in cell fate decisions and development
(Banaszynski et al., 2010, Dev Cell 19:662-74; Malik and Henikoff, 2003, Nat Struct Biol 10:882-91). For example, recent work has demonstrated an unexpected role of H2A.X, a H2A variant, in determining the cell fate transition of embryonic stem cells (ESCs) and the quality of induced pluripotent stem cells (iPSCs) (Wu et al., 2014, Cell Stem Cell 15:281-94; Buganim et al., 2014, Cell Stem Cell 15:295-309). It has been shown that the local structure of histone variant-containing nucleosomes may be different from the canonical ones, consistent with the significant differences in protein (histone) primary sequences (Jin and Felsenfeld, 2007, Genes Dev 21 : 1519-29). By the same token, it is conceivable that the altered nucleosome structures may be employed in accommodating variations in DNA structures, such as chemical modifications. Therefore, there is a long-felt need in the art for methods to detect DNA modifications in mammalian cells. The present invention fulfills this need.
SUMMARY OF THE INVENTION
In one aspect, the invention provides a method of detecting a modified nucleic acid in a sample. In one embodiment, the method comprises isolating DNA from a sample to obtain isolated DNA; sequencing the isolated DNA; and analyzing the isolated DNA sequence to detect the nucleic acid modification.
In one embodiment, isolating DNA from a sample further comprises subjecting the sample to chromatin-immunoprecipitation (ChIP) to obtain the isolated DNA. In one embodiment, the isolated DNA is from a genomic region. In one embodiment, the genomic region is an H2A.X deposition region. In one embodiment, isolating DNA from a sample further comprises subjecting the sample to DNA- immunoprecipitation (DIP) to obtain the isolated DNA.
In one embodiment, sequencing the isolated DNA further comprises subjecting the isolated DNA to singular molecular real time (SMRT) sequencing. In one embodiment, the method further comprises circularizing the isolated DNA. In one embodiment, sequencing the isolated DNA further comprises subjecting the isolated DNA to next generation sequencing.
In one embodiment, the nucleic acid modification is A^-methyladenine
(N6-mA).
In one embodiment, the sample is a biological sample. In one embodiment, the biological sample is a stem cell. In one embodiment, the stem cell is one selected from the group consisting of an embryonic stem cell and an induced pluripotent stem cell.
In another aspect, the invention provides a method for diagnosing cancer in a subject in need thereof. In one embodiment, the method comprises determining the level of N6-mA in a biological sample of the subject; measuring the level of N6-mA of a comparator control; and diagnosing the subject with cancer when the level of N6-mA in the biological sample is different than the level of N6-mA of the comparator control. In one embodiment, the level of N6-mA in the biological sample is elevated when compared with the comparator control. In one embodiment, the level of N6-mA in the biological sample is reduced when compared with the comparator control.
In one embodiment, the comparator control is at least one selected from the group consisting of: a positive comparator control, a negative comparator control, a historical control, a historical norm, or the level of a reference molecule in the biological sample. In one embodiment, the subject is human.
In one aspect, the invention provides method for modulating the level of N6-mA in a sample. In one embodiment, the method comprises administering a modulator of ALKBHl to the sample.
In one embodiment, the modulator is at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, an antisense nucleic acid molecule.
In one embodiment, the modulator decreases the level or activity of
ALKBHl . In one embodiment, the modulator increases the level or activity of ALKBHl . In one embodiment, the level of N6-mA is increased. In one embodiment, the level of N6-mA is decreased.
In another aspect, the invention provides a composition comprising a modulator of N6-mA. In one embodiment, the composition comprises an agent selected from the group consisting of an inhibitor of ALKBHl and an activator of ALKBHl .
BRIEF DESCRIPTION OF THE DRAWINGS
The following detailed description of preferred embodiments of the invention will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating the invention, there are shown in the drawings embodiments which are presently preferred. It should be understood, however, that the invention is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.
Figure 1, comprising Figure 1 A through ID, depicts results of experiments demonstrating SMRT-ChIP approach identified N6-mA in mammalian genomes. Figure 1 A depicts the schmatics of SMRT-ChlP. Figure IB depicts sequencing tracks of N6-mA in ESCs. Figure 1C depicts LC-Mass Spectrometry analysis of N6-mA {m/z 266.1 to m/z 150.1). and stable isotope labeled N6-mA {m/z 271.1 to m/z 155.1), internal standard. Figure ID depicts quantification of the LC-MS/MS results. P < 0.01, t-test; Error bars, ± the S.E.M. of three biological replicates.
Figure 2, comprising Figure 2A through Figure 2E, depicts results of experiments demonstrating Alkbhl is a demethylase for N6-mA in ESCs. Figure 2A depicts mass spectrometry analysis of N6-mA m Alkbhl KO ESCs (P value determined by t-tests). Figure 2B depicts dot blotting of N6-mA m Alkbhl KO or WT ESCs (in triplicates). Figure 2C depicts in vitro demethylation reaction with recombinant ALKBHl proteins monitored by dot blotting. Figure 2D depicts quantification of demethylation activity in three independent demethylase assays (P value < 5.0E-05, t-test). Figure 2E depicts in vitro demethylation reaction monitored by Mass Spectrometry (P value < 0.01, t-test). Error bars, S.D. for three biological replicates.
Figure 3, comprising Figure 3 A through Figure 3D, depicts results of experiments demonstrating Alkbhl deficiency silences genes on X-chromosome and young full-length Lis. Figure 3A depicts RNA-seq analysis of Alkbhl KO ESCs vs WT controls, blue: top downregulated genes, red: upregulated genes (false positives). Figure 3B depicts downregulated genes were most enriched on X chromosome (P<0.01, Binomial test) and Chrl3 to a lesser extent (P<0.05, Binomial test). Figure 3C depicts qRT-PCR analysis of downregulated genes (*, p < 0.05, t-test). Figure 3D depicts RT- qPCR of transposon expression (*, p < 0.01, t-test). LlMd-Gf-X: a young full-length LI on Chr-X. LlMd-Gf-17: a young full-length LI on Chrl7. Error bars: ± the S.E.M. of three technical replicates.
Figure 4, comprising Figure 4A through Figure 4D, depicts results of experiments demonstrating N6-mA is enriched at young full-length Lis, which are located in the vicinity of the downregulated genes m Alkbhl KO ESCs. Figure 4A depicts enrichment of N6-mA on full-length Lis (P value determined by t-test). Figure 4B depicts relative enrichment of N6-mA peaks on each chromosome (P=1.4E-322,
Binomial test) and relative enrichment of young full-length Lis on each chromosome. Figure 4C depicts normalized frequency of full-length Lis was plotted as a function of their genomic distance to downregulated genes (red, N6-mA enriched, median: 424kb; gray, non-enriched, median: 1.6 Mb). Figure 4D depicts the Daxl gene locus.
Figure 5, comprising Figure 5A through Figure 5E, depicts results of experiments demonstrating N6-mA upregulation induced transcriptional silencing on X- chromosome, which are persistent during differentiation. Figure 5A depicts aggregation of 5mC. Figure 5B depicts aggregation of H3K9Me3 signals. Figure 5C depicts normalized frequency of decommissioned enhancers was plotted as a function of their genomic distance to full-length Lis red, N6-mA enriched, median: 484Kb; gray, non- enriched, median: 2Mb. Figure 5D depicts RT-qPCR analysis of the Gm8817 and Rhox6 gene (on the X-chromosome) during EB differentiation. * P < 0.05, t-test; Error bars, ± the S.E.M. of three biological replicates. Figure 5E depicts schematics of Alkbhl and N6- mA functions.
Figure 6, comprising Figure 6A through Figure 6D, depicts results of experiments demonstrating low N6-mA levels in adult tissues and the lack of DNA alkylation adducts in ESCs. Figure 6A depicts a majority of N6-mA peaks identified by SMRT-ChIP is located in H2A.X deposition region in ESCs determined by native ChlP. Figure 6B depicts the number of SMRT-ChIP N6mA sites at different coverage and QV cut-off. Figure 6C depicts a DNA motif of H2A.X deposition region determine with standard ChlP-Seq and sequence motifs for N6-mA peaks at H2A.X deposition regions determined with SMRT-ChIP. Figure 6D depicts the distribution of N6-mA peaks at H2A.X deposition regions. (P value determined by Binomial test).
Figure 7, comprising Figure 7A through Figure 7E, depicts results of experiments demonstrating the LC-MS/MS data of N6mA. Figure 7 A depicts the experimental workflow for determining N6-mA level with LC-MS/MS. [N5]-N6-mA was used as Internal Standard. Figure 7B depicts results showing N6-mA levels are ultralow in adult tissues. Figure 7C depicts results showing no detection of DNA alkylation adducts, such as Nl-mA, N3-mA or N3-mC in mouse ES cells or Alkbhl KO cells by MS. Figure 7D depicts LC-MS/MS analysis of Nl-mA or N6-mA digested from synthetic oligonucleotides and ES cell DNA samples. Figure 7E depicts ESI-QTOF- MS/MS spectra of analytical standard of N6-mA nucleosides and N6-mA containing UPLC fraction from ES cells. Figure 8, comprising Figure 8A through Figure 8L, depicts results of experiments demonstrating Alkbhl is a specific N6-mA demethylase in vivo and in vitro. Figure 8A depicts Schematics of CRSPR/Cas9 approach. Alkbhl KO alleles do not contain the Xmal site at Exon3. The PCR-DNA digestion approach showed the homozygosity of the KO alleles, which are resistant to Xmal digestion. Western blotting didn't detect any ALKBHl proteins in the KO cells. Figure 8B depicts dot blotting results demonstrating three additional Alkbhl KO ESC clones show similar levels of N6- mA upregulation. Figure 8C depicts experiments validating the specificity of anti-N6-mA antibodies with synthetic oligonucleotides. Figure 8D depicts experiments validating of anti-N6-mA antibodies with DNA samples of different N6mA/dA ratio.125 ng of genomic DNA (MEFs) which don't contain any endogenous N6-mA were spiked with N6-mA containing oligonucleotides at indicated concentration. Figure 8E depicts tandem mass spectrometric analysis showing the lack of H2AK118/119 methylation in WT or Alkbhl KO ESCs. Spectral counts for H2A peptides containing Kl 18/119 revealed that H2AK118/119 is predominately non-methylated at similar levels between wild-type and Alkbhl KO ESCs. Spectral counts are reported as an average with standard deviation from biological triplicate analyses. Kl 18/119: no methylation; K118/119mel : Kl 18/119 monomethylation. Figure 8F depicts MS analysis showing that the co-purified factors with recombinant ALKBHl proteins are mainly heat shock proteins. Figure 8G depicts experimental results demonstrating ALKBHl proteins don't have noticeable activities towards to dual- or hemi- methylated double-stranded oligonucleotide substrates. Figure 8H depicts experimental results demonstrating ALKBHl activities are dependent on Fe and a-KG. Error bars: standard deviation of triplicates. Figure 81 depicts ectopic expression of WT, but not mutant Alkbhl (D233A) at the catalytic motif, can rescue the aberrant increase of N6-mA level in Alkbhl KO ESCs. The WT and mutant Alkbhl were expressed at similar levels. Figure 8J depicts quantification of three independent rescue experiments. (P value as labeled, determined by t-test; Error bars: S.D. for three biological replicates). Figure 8K depicts the demethylation activity of N6-mA by recombinant D233 A mutant protein is much reduced in comparison with the WT counterpart. Figure 8L depicts experimental results demonstrating no significant activities were detected with increasing concentrations of recombinant D233 A mutant proteins in demethylation reaction. Error bars: standard deviation of triplicates.
Figure 9, comprising Figure 9A through Figure 9D, depicts RNA-Seq analysis m Alkbhl KO ESCs. Figure 9A depicts RT-qPCR validation of the RNA-Seq analysis. Unchanged genes (gene names labeled in black) identified by RNA-Seq were unaltered in RT-qPCR analysis. Highly repressed (red), or modestly repressed (green) genes identified by RNA-Seq also showed expected levels of repression in RT-qPCR analyses. Of note, the genes (blue) identified as upregulated in RNA-Seq; however, they don't show differential expression (no significance) in RT-qPCR analysis, which further confirmed the suppression function of ALKBHL Error bars: standard deviation of triplicates. Figure 9B depicts MA plot of RNA-Seq analyzed by DESeq2, which shows the similar pattern to that of CuffDiff2. Figure 9C depicts gene ontology analysis demonstrated that lineage specifying factors involved in embryonic development are greatly downregulated by Alkbhl deficiency. Figure 9D depicts RNA-Seq transcripts of the representative subfamilies in three major retrotransposon superfamilies (LINE, SINE and LTR) in Alkbhl KO ESCs.
Figure 10, comprising Figure 10A through Figure 10H depicts the validation of N6-mA DIP-Seq approach. Figure 10A depicts "spike-in" experiments for determining the threshold and linear response range of N6-mA DIP. Genomic DNAs were spiked with N6-mA containing oligonucleotides at indicated concentration (X-axis). After N6-mA DIP, the relative enrichment of N6-mA over input control was determined by a RT-qPCR approach. Blue line: linear regression based on data points between 20ppm-130ppm. The threshold (the red line) is the background signals detected by RT- qPCR in which unmodified (control) oligonucleotides were spiked in. Figure 10B depicts the track of different sequencing method showing N6-mA sites overlapped between SMRT-ChIP and DIP-Seq in Alkbhl KO ESCs. Figure IOC depicts the number of SMRT-ChIP N6mA sites in Alkbhl KO cells at different coverage and QV cut-off. With rising coverage and QV cut-off, overlap between SMRT-ChIP N6mA sites and DIP-Seq N6mA sites also increases. Figure 10D depicts the biological replicates of Alkbhl KO ESCs N6mA-DIP peaks show 87.4% overlap. Figure 10E depicts a large majority of N6- mA peaks are in the intergenic regions at the whole genome level or on the X- chromosome. Figure 10F depicts m Alkbhl KO ESCs, N6-mA peaks are mainly targeted to LINE- Is on the X-chromosome or genome-wide. Figure 10G depicts N6-mA peaks are significantly enriched on full-length, but not on truncated Lis (P < 1.0E-05, Chi-square test). Figure 10H depicts enrichment of N6-mA in each full length LI subfamily. Lx, Ll_Musl-4: >6 million years; L1VL1, LlMdFl-4: 1.5-6 million years; LIMdGf, LIMdA, LlmdT: <1.5 million years.
Figure 11, comprising Figure 11 A and Figure 1 IB, depicts N6mA enrichment on 5 '-End of young full length LI . Figure 11a depicts aggregation plot shows that signal intensity of N6-mA at young full-length LI is enriched at the 5' UTR and ORF1. Figure 1 IB depicts qPCR analysis of N6-mA DIP samples confirmed the enrichment at the 5 'UTR and ORFl regions of LI that are retained in the young full- length Lis, but not the 3 'UTR or Nanog promoter.
Figure 12, comprising Figurel2A through Figure 12C, depicts results of experiments demonstrating the correlation between N6-mA deposition on young full- length Lis and epigenetic silencing. Figure 12A depicts violin diagram of the density distribution of the distance between LI and downregulated genes in Alkbhl KO cells. Figure 12B depicts the distances between ESC-expressing genes m Alkbhl KO ES cells and young full-length Lis plotted for indicated chromosomes. Figure 12C depicts the distances between downregulated genes m Alkbhl KO ES cells and young full-length Lis plotted for indicated chromosomes.
Figure 13, comprising Figure 13 A through Figure 13E, depicts results of experiments demonstrating N6-mA accumulation correlates with epigenetic silencing. Figure 13 A depicts normalized 5mC levels on gene bodies or promoters in WT or Alkbhl KO ESCs. Figure 13B depicts histone marks (H2A.X or H3K27Me3) or 5mC levels on young full-length Lis, SINE or LTR transposons. Figure 13C depicts Representative sequencing tracks of decommissioned enhancers. Note that H3K27Ac and H3K4mel levels at this locus are greatly downregulated in Alkbhl KO ESCs. Figure 13D depicts a violin diagram shows the density distribution of the distance between LI and
decommissioned enhancers m Alkbhl KO cells. Figure 13E depicts the ChlP-qPCR approach demonstrating that H3K4me3 levels are decreased at the transcription start sites (TSS) of LINE- 1 or Daxl, an X-chromosome gene, while unchanged at the control gene TSS. (* P < 0.01, t-test; Error bars, ± the S.E.M. of three technical triplicates).
Figure 14, comprising Figure 14A through Figure 14E, depicts results of experiments demonstrating N6-mA accumulation results in imbalanced cell fate decisions during ESC differentiation. WT or Alkbhl KO ESCs were subject to EB differentiation. mRNA samples were collected at dayl or day 9. Gene expression levels were quantified by RT-qPCR approaches. (* P < 0.01, t-test ; Error bars, ± the S.E.M. of technical triplicates). Figure 14A depicts results demonstrating at day9, Nanog expression is reduced significantly in WT-ESC derived EBs as expected, while its level in Alkbhl KO ESC-derived EBs is still high. Figure 14B depicts results demonstrating Lefty-1 and Lefty-2 are repressed at Day 1 or 9 in Alkbhl KO ESC-derived EBs. Figure 14C depicts results demonstrating activation of Cdx2, is insufficient in Alkbhl KO ESC-derived EBs. Figure 14D depicts results demonstrating expressions of other endoderm markers, Foxa2, Gata4, Gata6, are significantly higher in Alkbhl KO ESC-derived EBs than WT ESC- derived EBs. Figure 14E depicts results demonstrating ectoderm markers, Fgf5 and Pax6 are transiently (day 1) overexpressed in Alkbhl KO ESC-derived EBs. Figure 14F depicts results demonstrating mesoderm marker, T/Brachyury is similarly expressed in WT- or Alkbhl KO ESC-derived EBs during differentiation.
Figure 15 depicts dotting blotting results using anti-N6-mA antibodies. Only ovary cancer stem cells that are resistant to chemotherapy express appreciable amount of N6-mA, while the differentiated cancer cells or controls do not. Once established, N6-mA becomes a stable mark as it is retained even after engraftment to mice.
Figure 16 depicts dotting blotting results using anti-N6-mA antibodies. N6-mA is detectable in both human iPS and ES cells. The level in certain iPS cells are higher than human ES cells.
DETAILED DESCRIPTION
The present invention is based, in part, on the discovery that N 6 - methyladenine (N6-mA) is present in mammalian genomes. For example, it is demonstrated herein that N6-mA constitutes a crucial component of the epigenetic regulation repertoire in mammalian genomes. The invention is also based, in part, on the identification oiAlkbhl as a major specific demethylase for A^-methyladenine, which is a close homologue to the bacteria DNA demethylase Alkb, but is not able to hydroxylate 5-methylcytosine or demethylate the damage-induced DNA alkylations. For example, it is demonstrated herein that an increase of N6-mA levels in Alkbhl deficient cells leads to gene silencing.
The invention is also partly based on the discovery that N6-mA, which is undetectable in normal adult tissues, is a novel biomarker for cancer detection in humans.
In some embodiments, the present invention provides methods and kits for identifying N6-mA in a DNA sample. In other embodiments, the invention provides methods and compositions for modulating the levels of N6-mA. In yet another embodiment, the invention provides a method for diagnosing or prognosing cancer in a subject in need thereof using N6-mA as a biomarker.
Definitions
Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although any methods and materials similar or equivalent to those described herein can be used in the practice for testing of the present invention, the preferred materials and methods are described herein. In describing and claiming the present invention, the following terminology will be used.
It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.
The articles "a" and "an" are used herein to refer to one or to more than one {i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.
"About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass non-limiting variations of ±40% or ±20% or ±10%, ±5%, ±1%, or ±0.1% from the specified value, as such variations are appropriate.
The term "abnormal" when used in the context of organisms, tissues, cells or components thereof, refers to those organisms, tissues, cells or components thereof that differ in at least one observable or detectable characteristic (e.g., age, treatment, time of day, etc.) from those organisms, tissues, cells or components thereof that display the "normal" (expected) respective characteristic. Characteristics that are normal or expected for one cell or tissue type, might be abnormal for a different cell or tissue type.
The terms "biomarker" and "marker" are used herein interchangeably.
They refer to a substance that is a distinctive indicator of a biological process, biological event and/or pathologic condition.
The phrase "body sample" or "biological sample" is used herein in its broadest sense. A sample may be of any biological tissue or fluid from which biomarkers of the present invention may be assayed. Examples of such samples include but are not limited to blood, saliva, buccal smear, feces, lymph, urine, gynecological fluids, biopsies, amniotic fluid and smears. Samples that are liquid in nature are referred to herein as "bodily fluids." Body samples may be obtained from a patient by a variety of techniques including, for example, by scraping or swabbing an area or by using a needle to aspirate bodily fluids. Methods for collecting various body samples are well known in the art. Frequently, a sample will be a "clinical sample," i.e., a sample derived from a patient. Such samples include, but are not limited to, bodily fluids which may or may not contain cells, e.g., blood (e.g., whole blood, serum or plasma), urine, saliva, tissue or fine needle biopsy samples, and archival samples with known diagnosis, treatment and/or outcome history. Biological or body samples may also include sections of tissues such as frozen sections taken for histological purposes. The sample also encompasses any material derived by processing a biological or body sample. Derived materials include, but are not limited to, cells (or their progeny) isolated from the sample, proteins or nucleic acid molecules extracted from the sample. Processing of a biological or body sample may involve one or more of: filtration, distillation, extraction, concentration, inactivation of interfering components, addition of reagents, and the like.
In the context of the present invention, the term "control," when used to characterize a subject, refers, by way of non-limiting examples, to a subject that is healthy, to a patient that otherwise has not been diagnosed with a disease. The term "control sample" refers to one, or more than one, sample that has been obtained from a healthy subject or from a non-disease tissue such as normal colon. The term "control or reference standard" describes a material comprising none, or a normal, low, or high level of one of more of the marker (or biomarker) expression products of one or more the markers (or biomarkers) of the invention, such that the control or reference standard may serve as a comparator against which a sample can be compared.
"Differentially increased levels" refers to biomarker methylation levels which are at least 1%, 2%, 3%, 4%, 5%, 10% higher or more, for example, 5%, 10%, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% higher or more, and/or 0.5 fold, 1.1 fold, 1.2 fold, 1.4 fold, 1.6 fold, 1.8 fold higher or more, as compared with a control.
"Differentially decreased levels" refers to biomarker methylation levels which are at least at least 1%, 2%, 3%, 4%, 5%, 10% lower or less, for example, 5%, 10%, 20%, 30%, 40%, or 50%, 60%, 70%, 80%, 90% lower or less, and/or 0.9 fold, 0.8 fold, 0.6 fold, 0.4 fold, 0.2 fold, 0.1 fold or less, as compared with a control.
A "disease" is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal's health continues to deteriorate. In contrast, a "disorder" in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal's state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal's state of health.
A disease or disorder is "alleviated" if the severity of a sign or symptom of the disease, or disorder, the frequency with which such a sign or symptom is experienced by a patient, or both, is reduced.
The terms "effective amount" and "pharmaceutically effective amount" refer to a sufficient amount of an agent to provide the desired biological result. That result can be reduction and/or alleviation of a sign, symptom, or cause of a disease or disorder, or any other desired alteration of a biological system. An appropriate effective amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.
As used herein "endogenous" refers to any material from or produced inside the organism, cell, tissue or system. The term "expression" as used herein is defined as the transcription and/or translation of a particular nucleotide sequence driven by its promoter.
The "level" of one or more biomarkers means the absolute or relative amount or concentration of the biomarker in the sample. The term "level" also refers to the absolute or relative amount of methylation of the biomarker in the sample.
"Measuring" or "measurement," or alternatively "detecting" or
"detection," means assessing the presence, absence, quantity or amount (which can be an effective amount) of either a given substance within a clinical or subject-derived sample, including the derivation of qualitative or quantitative concentration levels of such substances, or otherwise evaluating the values or categorization of a subject's clinical parameters.
"Naturally-occurring" as applied to an object refers to the fact that the object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man is a naturally-occurring sequence.
By "nucleic acid" is meant any nucleic acid, whether composed of deoxyribonucleosides or ribonucleosides, and whether composed of phosphodiester linkages or modified linkages such as phosphotriester, phosphoramidate, siloxane, carbonate, carboxymethylester, acetamidate, carbamate, thioether, bridged
phosphoramidate, bridged methylene phosphonate, phosphorothioate,
methylphosphonate, phosphorodithioate, bridged phosphorothioate or sulfone linkages, and combinations of such linkages. The term nucleic acid also specifically includes nucleic acids composed of bases other than the five biologically occurring bases
(adenine, guanine, thymine, cytosine and uracil). The term "nucleic acid" typically refers to large polynucleotides.
Conventional notation is used herein to describe polynucleotide sequences: the left-hand end of a single-stranded polynucleotide sequence is the 5'-end; the left-hand direction of a double-stranded polynucleotide sequence is referred to as the 5 '-direction. The direction of 5' to 3' addition of nucleotides to nascent RNA transcripts is referred to as the transcription direction. The DNA strand having the same sequence as an mRNA is referred to as the "coding strand"; sequences on the DNA strand that are located 5' to a reference point on the DNA are referred to as "upstream sequences"; sequences on the DNA strand which are 3' to a reference point on the DNA are referred to as "downstream sequences."
A "polynucleotide" means a single strand or parallel and anti-parallel strands of a nucleic acid. Thus, a polynucleotide may be either a single-stranded or a double-stranded nucleic acid. In the context of the present invention, the following abbreviations for the commonly occurring nucleic acid bases are used. "A" refers to adenosine, "C" refers to cytidine, "G" refers to guanosine, "T" refers to thymidine, and "U" refers to uridine.
The term "oligonucleotide" typically refers to short polynucleotides, generally no greater than about 60 nucleotides. It will be understood that when a nucleotide sequence is represented by a DNA sequence (i.e., A, T, G, C), this also includes an RNA sequence (i.e., A, U, G, C) in which "U" replaces "T."
A "reference level" of a biomarker means a level of the biomarker, for example level of methylation of the biomarker that is indicative of a particular disease state, phenotype, or lack thereof, as well as combinations of disease states, phenotypes, or lack thereof. A "positive" reference level of a biomarker means a level that is indicative of a particular disease state or phenotype. A "negative" reference level of a biomarker means a level that is indicative of a lack of a particular disease state or phenotype.
By the term "specifically binds," as used herein, is meant a molecule, such as an antibody, which recognizes and binds to another molecule or feature, but does not substantially recognize or bind other molecules or features in a sample.
"Cancer," as used herein, refers to the abnormal growth or division of cells. Generally, the growth and/or life span of a cancer cell exceeds, and is not coordinated with, that of the normal cells and tissues around it. Cancers may be benign, pre-malignant or malignant. Cancer occurs in a variety of cells and tissues, including the oral cavity (e.g., mouth, tongue, pharynx, etc.), digestive system (e.g., esophagus, stomach, small intestine, colon, rectum, liver, bile duct, gall bladder, pancreas, etc.), respiratory system (e.g., larynx, lung, bronchus, etc.), bones, joints, skin (e.g., basal cell, squamous cell, meningioma, etc.), breast, genital system, (e.g., uterus, ovary, prostate, testis, etc.), urinary system (e.g., bladder, kidney, ureter, etc.), eye, nervous system (e.g., brain, etc.), endocrine system (e.g., thyroid, etc.), and hematopoietic system (e.g., lymphoma, myeloma, leukemia, acute lymphocytic leukemia, chronic lymphocytic leukemia, acute myeloid leukemia, chronic myeloid leukemia, etc.).
As used herein, the phrase "stem cells" refers both to the earliest renewable cell population responsible for generating cell mass in a tissue or body and the very early progenitor cells, which are somewhat more differentiated, yet are not committed and can readily revert to become a part of the earliest renewable cell population.
The terms "precursor cell," "progenitor cell," and "stem cell" are used interchangeably in the art and as used herein refer either to a pluripotent or lineage- uncommitted progenitor cell, which is potentially capable of an unlimited number of mitotic divisions to either renew itself or to produce progeny cells which will
differentiate into the desired cell type. In contrast to pluripotent stem cells, lineage- committed progenitor cells are generally considered to be incapable of giving rise to numerous cell types that phenotypically differ from each other. Instead, progenitor cells give rise to one or possibly two lineage-committed cell types.
"Standard control value" as used herein refers to a predetermined methylation level of a biomarker. The standard control value is suitable for the use of a method of the present invention, in order for comparing the amount of methylation of a biomarker of interest that is present in a sample. An established sample serving as a standard control provides an average amount methylation of a biomarker of interest that is typical for an average, healthy person of reasonably matched background, e.g., gender, age, ethnicity, and medical history. A standard control value may vary depending on the biomarker of interest and the nature of the sample.
By the term "modulating," as used herein, is meant mediating a detectable increase or decrease in the level of a response in a subject compared with the level of a response in the subject in the absence of a treatment or compound, and/or compared with the level of a response in an otherwise identical but untreated subject. The term encompasses perturbing and/or affecting a native signal or response thereby mediating a beneficial therapeutic response in a subject, preferably, a human.
"Instructional material," as that term is used herein, includes a publication, a recording, a diagram, or any other medium of expression which can be used to communicate the usefulness of the composition and/or compound of the invention in a kit. The instructional material of the kit may, for example, be affixed to a container that contains the compound and/or composition of the invention or be shipped together with a container which contains the compound and/or composition. Alternatively, the instructional material may be shipped separately from the container with the intention that the recipient uses the instructional material and the compound cooperatively.
Delivery of the instructional material may be, for example, by physical delivery of the publication or other medium of expression communicating the usefulness of the kit, or may alternatively be achieved by electronic transmission, for example by means of a computer, such as by electronic mail, or download from a website.
As used herein, the term "subject" refers to a human or another mammal
(e.g., primate, dog, cat, goat, horse, pig, mouse, rat, rabbit, and the like). In many embodiments of the present invention, the subject is a human being. In such
embodiments, the subject is often referred to as an "individual" or a "patient." The terms "individual" and "patient" do not denote a particular age.
Ranges: throughout this disclosure, various aspects of the invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 2.7, 3, 4, 5, 5.3, and 6. This applies regardless of the breadth of the range.
Description The present invention is based, in part, on the discovery of the presence of N6-mA in the mammalian genome, the demethylase for N6-mA, and the role of N6-mA in epigenetic regulation in human embryonic stem cells, iPS cells and cancer cells. The present invention is also based on the development of a novel technology to detect DNA modification in mammalian cells.
Accordingly, the invention provides a method for the detection of N6-mA. In one embodiment, N6-mA is identified in a genomic region using SMRT-ChIP (Single Molecular Real-Time sequencing of Chromatin Immunoprecipitation-enriched DNA). In another embodiment, a genomic region having N6-mA is identified using DIP-Seq (DNA Immunoprecipitation - Next generation sequencing) wherein DNA is immunoprecipitated using a N6-mA antibody.
The invention also provides a kit for detecting N6-mA, the kit comprising a reagent to isolate DNA and a reagent to sequence the DNA.
The invention is also based on the discovery that ALKBHl is the demethylase for N6-mA. Thus, the invention provides methods and compositions for modulating the level of A^-methyladenine.
In one embodiment, the invention is a composition comprising a modulator for modulating the level or frequency of N6-mA. In one embodiment, the modulator is an activator that increases the level or activity of ALKBHl . In another embodiment, the modulator is an inhibitor that decreases level or activity of ALKBHl expression. In various embodiments the modulator is at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, an antisense nucleic acid molecule.
In one embodiment, the method comprises administering a modulator of
ALKBHl . In various embodiments the modulator is at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, an antisense nucleic acid molecule. In one embodiment, the modulator is an activator that increases the level or activity of ALKBHl . In another embodiment, the modulator is an inhibitor that decreases level or activity of ALKBHl expression. The invention is also based in part on the discovery that N6-mA is novel biomarker for cancer detection in humans. Thus, the invention provides methods of detecting, diagnosing and prognosing the outcome, of cancer in a subject in need thereof.
In one embodiment, the method comprises determining the level of N6- mA in a biological sample from the subject; comparing the level of N6-mA in the biological sample with a comparator control; and diagnosing or prognosing the subject with cancer when the level of N6-mA in the biological sample is different than the level of N6-mA of the comparator control.
Detection Methods
In one aspect, the invention provides methods of detecting N6-mA. In another aspect, the invention provides methods of measuring the level of N6-mA. In another aspect, the invention provides methods of determining the location of N6-mA. In one embodiment, N6-mA is identified in a genomic region using SMRT-ChIP (Single Molecular Real-Time sequencing of Chromatin Immunoprecipitation-enriched DNA).
In one embodiment, the locations of N6-mA are identified in a genomic region. In one embodiment, the method comprises isolating DNA from a biological sample to obtain a DNA sample; sequencing the DNA sample; and analyzing the DNA sequence to identify a nucleic acid modification. In another embodiment, isolating DNA from a sample further comprises subjecting the sample to chromatin-immunoprecipitation (ChIP) to isolate the DNA sample, wherein the DNA sample is in a genomic region. In some embodiments, the genomic region is an H2A.X deposition region. In another embodiment, the ChIP is performed using an antibody against a histone protein, including, but not limited to, HI, H2A, H2B, H3, H4 and H2A.X.
In one embodiment, sequencing the DNA sample further comprises subjecting the DNA sample to singular molecular real time (SMRT) sequencing. SMRT sequencing systems are applied to the detection of modified nucleic acid templates through analysis of the sequence and/or kinetic data derived from such systems. In particular, modifications in a template nucleic acid strand alter the enzymatic activity of a nucleic acid polymerase in various ways, e.g., by increasing the time for a bound nucleotide to be incorporated and/or increasing the time between incorporation events. In certain embodiments, polymerase activity is detected using a single molecule nucleic acid sequencing technology. In certain embodiments, polymerase activity is detected using a nucleic acid sequencing technology that detects incorporation of nucleotides into a nascent strand in real time. In preferred embodiments, a single molecule nucleic acid sequencing technology is capable of real-time detection of nucleotide incorporation events. Such sequencing technologies are known in the art and include, e.g., the SMRT sequencing and nanopore sequencing technologies. For more information on nanopore sequencing, see, e.g., U.S. Pat. No. 5,795,782; Kasianowicz, et al. (1996) Proc Natl Acad Sci USA 93(24): 13770-3; Ashkenas, et al. (2005) Angew Chem Int Ed Engl 44(9): 1401- 4; Howorka, et al. (2001) Nat Biotechnology 19(7): 636-9; and Astier, et al. (2006) J Am Chem Soc 128(5): 1705-10, all of which are incorporated herein by reference in their entireties for all purposes.
In yet another embodiment, the method further comprises circularizing the DNA sample. Topologically circular DNA samples allow each base to be read many times by a single sequencing polymerase. Thus, the coverage requirement for
modification detection can be achieved both by sequencing different fragments pulled down from the same genomic regions and by sequencing the same fragment with many passes.
In another embodiment, a genomic region having N6-mA is identified using DIP-Seq (DNA Immunoprecipitation - Next generation sequencing). In one embodiment, the method comprises isolating DNA from a sample to obtain a DNA sample; sequencing the DNA sample; and analyzing the DNA sequence to identify a nucleic acid modification. In another embodiment, isolating DNA from a sample further comprises subjecting the sample to DIP to isolate the DNA sample. In one embodiment, the DIP is performed using an antibody against N6-mA. In another embodiment, sequencing the DNA sample further comprises subjecting the DNA sample to next generation sequencing.
In one embodiment, the sample includes, but is not limited to a biological sample, an isolated cell and recombinant nucleic acid sample. In some embodiments, the biological sample includes, but is not limited to, a cancer cell and a stem cell. In another embodiment, the stem cell includes, but is not limited to, an embryonic stem cell (EPC), and an induced pluripotent stem cell (iPSC). In some embodiments, the biological sample includes a cancer cell, such as but is not limited to, a primary cancer cell, a cancer stem cell, or a metastatic cancer cell. Non-limiting examples of cancer cells include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, appendix cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain and spinal cord tumors, brain stem glioma, brain tumor, breast cancer, bronchial tumors, burkitt lymphoma, carcinoid tumor, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, central nervous system lymphoma, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, cerebral
astrocytotna/malignant glioma, cervical cancer, childhood visual pathway tumor, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, craniopharyngioma, cutaneous cancer, cutaneous t-cell lymphoma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, ewing family of tumors, extracranial cancer, extragonadal germ cell tumor, extrahepatic bile duct cancer, extrahepatic cancer, eye cancer, fungoides, gallbladder cancer, gastric (stomach) cancer, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (gist), germ cell tumor, gestational cancer, gestational trophoblastic tumor, glioblastoma, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, histiocytosis, hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, hypothalamic tumor, intraocular (eye) cancer, intraocular melanoma, islet cell tumors, kaposi sarcoma, kidney (renal cell) cancer, langerhans cell cancer, langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, macroglobulinemia, malignant fibrous histiocvtoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, myeloid leukemia, myeloma, myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-hodgkin lymphoma, non-small cell lung cancer, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, respiratory tract carcinoma involving the nut gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, sezary syndrome, skin cancer (melanoma), skin cancer (nonmelanoma), skin carcinoma, small cell lung cancer, small intestine cancer, soft tissue cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer , stomach (gastric) cancer, supratentorial primitive neuroectodermal tumors, supratentorial primitive neuroectodermal tumors and pineoblastoma, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer, transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, Waldenstrom macroglobulinemia, wilms tumor.
In one aspect, the invention includes isolating a stem cell from a subject. Therefore, the invention also provides methods of isolating, culturing and expansion of stem cells. In one embodiment the stem cells include, but are not limited to, EPCs, iPSCs, and their progenitor derivatives.
Stem cells of the invention and their progeny can be sterile, and maintained in a sterile environment. Such stem cells, pluralities, populations, and cultures thereof can also be included in a medium.
Kits
In one aspect, the invention provides a kit for detecting N6-mA. In another aspect, the invention provides a kit for measuring the level of N6-mA. In another aspect, the invention provides a kit for determining the location of N6-mA. In one embodiment, the kit of the invention comprises at least one reagent for isolating DNA and at least one reagent for sequencing the DNA.
In one embodiment, the at least one reagent for isolating a DNA sample comprises an antibody against a target, such as, but not limited to, N6-mA, HI, H2A, H2B, H3, H4 and H2A.X. In another embodiment, the at least one reagent for sequencing the DNA includes, but is not limited to, a polymerase, dNTPs, and labeled dNTPs.
In one embodiment, the kit comprises instructions for carrying out and evaluating the described methods of N6-mA methylation analysis.
In a further embodiment, said kit may further comprise standard reagents for performing a N6-mA position-specific methylation analysis.
Biomarker
The present invention provides DNA methylation biomarkers associated with cancer. In one embodiment, N6-mA is a biomarker associated with cancer.
Accordingly, a DNA methylation marker associated with cancer is considered a biomarker in the context of the present invention. In one embodiment, the level or frequency of N6-mA is increased in a cancer cell, as compared with a comparator control. In another embodiment, the location of N6-mA is altered in a cancer cell compared, as compared with a comparator control. In one embodiment, N6-mA is overexpressed in ovarian cancer. In another embodiment, the cancer is resistant to chemotherapy.
Accordingly, the invention provides methods for identifying one or more biomarkers that can be used to aid in the detection of cancer, diagnosis of cancer, prediction of cancer, prognosis of cancer, and the selection of a particular treatment for cancer.
In some embodiments, the methods of the invention are performed by obtaining a set of measured values for one or more biomarkers from a test biological sample, obtaining a set of measured values for one or more biomarkers from a control or reference biological sample, comparing the measured values for each biomarker between the test and control or reference sample, and identifying biomarkers which are
substantially or significantly different in value between the test sample and the control or reference sample. The process of comparing a measured value and a reference value can be carried out in any convenient manner appropriate to the type of measured value and reference value for the biomarker of the invention. For example, "measuring" can be performed using quantitative or qualitative measurement techniques, and the mode of comparing a measured value and a reference value can vary depending on the
measurement technology employed. For example, when a qualitative colorimetric assay is used to measure biomarker levels, the levels may be compared by visually comparing the intensity of the colored reaction product, or by comparing data from densitometric or spectrometric measurements of the colored reaction product (e.g., comparing numerical data or graphical data, such as bar charts, derived from the measuring device). However, it is expected that the measured values used in the methods of the invention will most commonly be quantitative values (e.g., quantitative measurements of concentration). In other examples, measured values are qualitative. As with qualitative measurements, the comparison can be made by inspecting the numerical data, or by inspecting
representations of the data (e.g., inspecting graphical representations such as bar or line graphs).
A measured value is generally considered to be substantially equal to a reference value if it is about 95-105% of the value of the reference value. A measured value is considered less than a reference value if the measured value is less than about 95% of the reference value. A measured value is considered greater than a reference value if the measured value is at least more than about 5% greater than the reference value.
The process of comparing may be manual (such as visual inspection by the practitioner of the method) or it may be automated. For example, an assay device (such as a luminometer for measuring chemiluminescent signals) may include circuitry and software enabling it to compare a measured value with a reference value for a desired biomarker. Alternately, a separate device (e.g., a digital computer) may be used to compare the measured value(s) and the reference value(s). Automated devices for comparison may include stored reference values for the biomarker(s) being measured, or they may compare the measured value(s) with reference values that are derived from contemporaneously measured reference samples. Methods for screening for the biomarker of the invention are described elsewhere herein. The method for screening the biomarker can find genes that are differentially methylated in cancer as well as at various dysplasic stages of the tissue which progresses to cancer. The screening can be used for cancer screening, risk- assessment, prognosis, disease identification, the diagnosis of disease stages, and can aid in the selection of therapeutic targets and therapies.
The identification of genes that are methylated in cancer and abnormalities at various stages of cancer makes it possible to diagnose cancer at an early stage in an accurate and effective manner and allows methylation assessment of multiple genes and the identification of new targets for therapeutic intervention. Furthermore, the
methylation data according to the present invention may be combined with other methylation biomarkers, such as 5mC, or non-methylation related biomarker detection methods for cancer detection and diagnosis.
According to the method of the present invention, the progression of cancer at various stages or phases can be determined by determining the N6-mA methylation status (e.g., level, frequency, location, etc.) of one or more nucleic acid biomarkers obtained from a sample. By comparing the methylation status of a nucleic acid isolated from a sample at each stage of cancer with the methylation status of one or more nucleic acids isolated from a sample in which there is no cell proliferative disorder of tissue, a specific stage of cancer in the sample can be detected. In one embodiment, the methylation status may be hypermethylation. In another embodiment, the methylation status may be hypomethylation.
In another embodiment, methylation of a gene or genes is decreased relative to a control sample from a subject that does not have cancer (e.g., a population average of samples, a control sample, a prior sample from the same patient, etc.). In another embodiment, methylation of a gene or genes is increased relative to a control sample from a subject that does not have cancer (e.g., a population average of samples, a control sample, a prior sample from the same patient, etc.). Accordingly, the invention in some instances provides a combination of markers for cancer, wherein some of the markers include decreased methylation of a gene or genes and other markers include increased methylation of a gene or genes. In one embodiment of the present invention, nucleic acid may be methylated in the regulatory region of a gene. In another embodiment, a gene which is involved in cell transformation can be diagnosed at an early stage by detecting methylation outside of the regulatory region of the gene, because - in some instances - methylation proceeds inwards from the outside of the gene.
In yet another embodiment of the present invention, cells that are likely to form cancer can be diagnosed at an early stage using the methylation marker genes. When genes confirmed to be methylated in cancer cells are methylated in cells that appear normal clinically or morphologically, this indicates that the normally appearing cells are more likely to progress to cancer. Thus, cancer can be diagnosed at an early stage by detecting the methylation of cancer-specific genes in cells that appear normal.
The use of the methylation marker gene of the present invention allows for detection of a cellular proliferative disorder (dysplasia) of cells or tissues in a sample. The detection method comprises bringing a sample comprising at least one nucleic acid isolated from a subject into contact with at least one agent capable of determining the methylation state of the nucleic acid. The method comprises detecting the methylation of at least one region in at least one nucleic acid, wherein the methylation of the nucleic acid differs from the methylation state of the same region of a nucleic acid present in a sample in which there is no abnormal growth (dysplastic progression) of cells.
In yet another embodiment of the present invention, the likelihood of progression of tissue to cancer can be assessed by examining the methylation status (e.g., level, frequency, location, etc.) of a gene or genes which is specifically contains N6-mA in cancer, and determining the methylation status of tissue that is likely to progress to cancer.
In some embodiments, the cancer is a cancer cell, such as but is not limited to, a primary cancer cell, a cancer stem cell, or a metastatic cancer cell. Non- limiting examples of cancer cells include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, appendix cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain and spinal cord tumors, brain stem glioma, brain tumor, breast cancer, bronchial tumors, burkitt lymphoma, carcinoid tumor, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, central nervous system lymphoma, cerebellar astrocytoma, cerebral
astrocytoma/malignant glioma, cerebral astrocytotna/malignant glioma, cervical cancer, childhood visual pathway tumor, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, craniopharyngioma, cutaneous cancer, cutaneous t-cell lymphoma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, ewing family of tumors, extracranial cancer, extragonadal germ cell tumor, extrahepatic bile duct cancer, extrahepatic cancer, eye cancer, fungoides, gallbladder cancer, gastric (stomach) cancer, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (gist), germ cell tumor, gestational cancer, gestational trophoblastic tumor, glioblastoma, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, histiocytosis, hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, hypothalamic tumor, intraocular (eye) cancer, intraocular melanoma, islet cell tumors, kaposi sarcoma, kidney (renal cell) cancer, langerhans cell cancer, langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, macroglobulinemia, malignant fibrous histiocvtoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis,
myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, myeloid leukemia, myeloma, myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-hodgkin lymphoma, non-small cell lung cancer, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer,
pheochromocytoma, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, respiratory tract carcinoma involving the nut gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, sezary syndrome, skin cancer (melanoma), skin cancer (nonmelanoma), skin carcinoma, small cell lung cancer, small intestine cancer, soft tissue cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer , stomach (gastric) cancer, supratentorial primitive neuroectodermal tumors, supratentorial primitive neuroectodermal tumors and pineoblastoma, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer, transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, Waldenstrom macroglobulinemia, wilms tumor.
Diagnostic
In one embodiment, the present invention provides a method to detect and identify already known and newly discovered diagnostically, prognostically and therapeutically relevant cancers, as well as methods that can predict which treatments and therapies are more likely to be effective. The basis of these methods resides in the measurement of N6-mA methylation status (e.g., level, frequency, location, etc.). The methods and compositions of the invention thus provide tools useful in choosing a therapy for cancer patients, methods of determining the efficacy of a therapy in a cancer patient, and methods of determining the prognosis for a cancer patient.
One aspect of the present invention relates to a method of diagnosing a condition associated with an aberrant N6-mA methylation of DNA in a sample from a subject by measuring the N6-mA methylation status (e.g., level, frequency, location, etc.) in a test sample in comparison to that of a normal or standard sample, wherein the difference between the methylation status (e.g., level, frequency, location, etc.) of the test sample as compared with that of the normal/standard sample indicates the likelihood of cancer in the test sample.
In some embodiments, the cancer is a cancer cell, such as but is not limited to, a primary cancer cell, a cancer stem cell, or a metastatic cancer cell. Non- limiting examples of cancer cells include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, appendix cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain and spinal cord tumors, brain stem glioma, brain tumor, breast cancer, bronchial tumors, burkitt lymphoma, carcinoid tumor, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, central nervous system lymphoma, cerebellar astrocytoma, cerebral
astrocytoma/malignant glioma, cerebral astrocytotna/malignant glioma, cervical cancer, childhood visual pathway tumor, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, craniopharyngioma, cutaneous cancer, cutaneous t-cell lymphoma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, ewing family of tumors, extracranial cancer, extragonadal germ cell tumor, extrahepatic bile duct cancer, extrahepatic cancer, eye cancer, fungoides, gallbladder cancer, gastric (stomach) cancer, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (gist), germ cell tumor, gestational cancer, gestational trophoblastic tumor, glioblastoma, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, histiocytosis, hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, hypothalamic tumor, intraocular (eye) cancer, intraocular melanoma, islet cell tumors, kaposi sarcoma, kidney (renal cell) cancer, langerhans cell cancer, langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, macroglobulinemia, malignant fibrous histiocvtoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis,
myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, myeloid leukemia, myeloma, myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-hodgkin lymphoma, non-small cell lung cancer, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, respiratory tract carcinoma involving the nut gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, sezary syndrome, skin cancer (melanoma), skin cancer (nonmelanoma), skin carcinoma, small cell lung cancer, small intestine cancer, soft tissue cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer , stomach (gastric) cancer, supratentorial primitive neuroectodermal tumors, supratentorial primitive neuroectodermal tumors and pineoblastoma, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer, transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, Waldenstrom macroglobulinemia, wilms tumor.
Aberrant methylation can be any change in the status frequency, location, of methylation. A methylation level that is increased is referred as hypermethylation and a methylation level that is decreased is referred to as hypomethylation. In some embodiments, the aberrant methylation is hypermethylation. In other embodiments, the aberrant methylation is hypomethylation.
The methylation of DNA can be detected via methods known in the art and those described elsewhere herein. In one embodiment, the level can be measured via SMRT-ChIP In another preferred embodiment, the methylation levels of a plurality DNA can be measured through DIP-Seq.
In another embodiment, the methods of present invention are directed to a method of diagnosing cancer in a test subject or a test sample through determining the N6-mA methylation level of DNA from the test subject or test sample in relative to the N6-mA methylation level of the DNA from a normal subject or sample. Although improved diagnostic and prognostic accuracy and sensitivity may be achieved by using a combination of markers, such as N6-mA methylation and 5mC methylation, practical considerations may dictate use of one or more biomarkers and smaller combinations thereof. Any combination of markers may be used which comprises one or more of the markers described herein.
The methylation status (e.g., level, frequency, location, etc.) of the differentially methylated DNA regions can provide a variety of information about cancer. It can be used to predict the course of cancer in the individual or to predict the
susceptibility to cancer or to stage the progression of the cancer in the individual. It can help to predict the likelihood of overall survival or predict the likelihood of reoccurrence of cancer. It can help to determine the effectiveness of a particular treatment or therapy administered to the individual.
Following the diagnosis of a subject according to the methods of the invention, it is possible to predict whether standard chemotherapy can be used to treat the patient or whether a more aggressive or alternative therapy is needed. By way of non- limiting example, patients with high N6-mA DNA methylation levels identified by the present invention may have poor outcomes based on standard care. Accordingly, the method comprises identifying nucleic acid altered methylation status (e.g., level, frequency, location, etc.) of one or more genes, where the methylation status indicates the possibility for poor survival using only standard chemotherapy.
The prognostic methods can be used to identify patients with aggressive cancer. Such patients can be offered additional appropriate therapeutic or preventative options, including personalized medicine based on their genome, transplants, surgical procedures, chemotherapy, radiation, biological response modifiers, or other therapies. Such patients may also receive recommendations for further diagnostic or monitoring procedures, including but not limited to increased frequency of checkups.
The biomarkers of the invention can be used among other things for the determination of a subject's susceptibility to a disease or disorder, determination as to whether a subject is presently affected by a disease or disorder, prognosis of a subject affected by a disease or disorder (e.g., identification of cancerous states, stages of cancer, or responsiveness of cancer to therapy), and use of therametrics (e.g., monitoring a subject's condition to provide information as to the effect or efficacy of therapy).
The diagnostic methods of the invention also provide for optimizing therapy, by classification, and based on that information, selecting the appropriate therapy, dose, treatment modality, etc. which optimizes the differential between delivery of an anti-proliferative treatment to the undesirable target cells, while minimizing undesirable toxicity. The treatment is optimized by selection for a treatment that minimizes undesirable toxicity, while providing for effective anti-proliferative activity. Compositions and Methods for Modulating N6-mA
The invention is based in part on the discovery that ALKBHl is the demethylase for N6-mA. Thus, the invention provides methods and compositions for modulating level of N6-mA in a sample. In various embodiments, the sample includes a cancer cell. In some embodiments, the cancer cell, is a primary cancer cell, a cancer stem cell, or a metastatic cancer cell. Non-limiting examples of cancer cells include acute lymphoblastic leukemia, acute myeloid leukemia, adrenocortical carcinoma, appendix cancer, basal cell carcinoma, bile duct cancer, bladder cancer, bone cancer, brain and spinal cord tumors, brain stem glioma, brain tumor, breast cancer, bronchial tumors, burkitt lymphoma, carcinoid tumor, central nervous system atypical teratoid/rhabdoid tumor, central nervous system embryonal tumors, central nervous system lymphoma, cerebellar astrocytoma, cerebral astrocytoma/malignant glioma, cerebral
astrocytotna/malignant glioma, cervical cancer, childhood visual pathway tumor, chordoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, chronic myeloproliferative disorders, colon cancer, colorectal cancer, craniopharyngioma, cutaneous cancer, cutaneous t-cell lymphoma, endometrial cancer, ependymoblastoma, ependymoma, esophageal cancer, ewing family of tumors, extracranial cancer, extragonadal germ cell tumor, extrahepatic bile duct cancer, extrahepatic cancer, eye cancer, fungoides, gallbladder cancer, gastric (stomach) cancer, gastrointestinal cancer, gastrointestinal carcinoid tumor, gastrointestinal stromal tumor (gist), germ cell tumor, gestational cancer, gestational trophoblastic tumor, glioblastoma, glioma, hairy cell leukemia, head and neck cancer, hepatocellular (liver) cancer, histiocytosis, hodgkin lymphoma, hypopharyngeal cancer, hypothalamic and visual pathway glioma, hypothalamic tumor, intraocular (eye) cancer, intraocular melanoma, islet cell tumors, kaposi sarcoma, kidney (renal cell) cancer, langerhans cell cancer, langerhans cell histiocytosis, laryngeal cancer, leukemia, lip and oral cavity cancer, liver cancer, lung cancer, lymphoma, macroglobulinemia, malignant fibrous histiocvtoma of bone and osteosarcoma, medulloblastoma, medulloepithelioma, melanoma, merkel cell carcinoma, mesothelioma, metastatic squamous neck cancer with occult primary, mouth cancer, multiple endocrine neoplasia syndrome, multiple myeloma, mycosis, myelodysplastic syndromes, myelodysplastic/myeloproliferative diseases, myelogenous leukemia, myeloid leukemia, myeloma, myeloproliferative disorders, nasal cavity and paranasal sinus cancer, nasopharyngeal cancer, neuroblastoma, non-hodgkin lymphoma, non-small cell lung cancer, oral cancer, oral cavity cancer, oropharyngeal cancer, osteosarcoma and malignant fibrous histiocytoma, osteosarcoma and malignant fibrous histiocytoma of bone, ovarian, ovarian cancer, ovarian epithelial cancer, ovarian germ cell tumor, ovarian low malignant potential tumor, pancreatic cancer, papillomatosis, paraganglioma, parathyroid cancer, penile cancer, pharyngeal cancer, pheochromocytoma, pineal parenchymal tumors of intermediate differentiation, pineoblastoma and supratentorial primitive neuroectodermal tumors, pituitary tumor, plasma cell neoplasm, plasma cell neoplasm/multiple myeloma, pleuropulmonary blastoma, primary central nervous system cancer, primary central nervous system lymphoma, prostate cancer, rectal cancer, renal cell (kidney) cancer, renal pelvis and ureter cancer, respiratory tract carcinoma involving the nut gene on chromosome 15, retinoblastoma, rhabdomyosarcoma, salivary gland cancer, sarcoma, sezary syndrome, skin cancer (melanoma), skin cancer (nonmelanoma), skin carcinoma, small cell lung cancer, small intestine cancer, soft tissue cancer, soft tissue sarcoma, squamous cell carcinoma, squamous neck cancer , stomach (gastric) cancer, supratentorial primitive neuroectodermal tumors, supratentorial primitive neuroectodermal tumors and pineoblastoma, T-cell lymphoma, testicular cancer, throat cancer, thymoma and thymic carcinoma, thyroid cancer, transitional cell cancer, transitional cell cancer of the renal pelvis and ureter, trophoblastic tumor, urethral cancer, uterine cancer, uterine sarcoma, vaginal cancer, visual pathway and hypothalamic glioma, vulvar cancer, Waldenstrom macroglobulinemia, wilms tumor. In one embodiment, the method comprises administering a modulator of ALKBHl . In one embodiment the modulator is at least one selected from the group consisting of a chemical compound, a protein, a peptide, a peptidomemetic, an antibody, a ribozyme, a small molecule chemical compound, a nucleic acid, a vector, an antisense nucleic acid molecule. In one embodiment, the modulator is an activator that increases the level of activity of ALKBHl . In another embodiment, the modulator is an inhibitor that decreases the level or activity of ALKBHl .
Inhibitors
In one embodiment, the present invention provides methods and compositions for increasing the level or frequency of A^-methyladenine. In one embodiment, the composition or method increases the level of N6-mA by inhibiting the level, activity, or both of ALKBHl, the N6-mA demethylase.
In one embodiment, the composition of the invention comprises an inhibitor of ALKBHl . In another embodiment, the method of the invention comprises administering an inhibitor of ALKBHl . An inhibitor of ALKBHl is any compound, molecule, or agent that reduces, inhibits, or prevents the level or activity of ALKBHl . For example, an inhibitor of ALKBHl is any compound, molecule, or agent that reduces ALKBHl expression, level, activity, or both. In various embodiments, an inhibitor of ALKBHl comprises a nucleic acid, a peptide, a small molecule, a siRNA, a ribozyme, an antisense nucleic acid, an antagonist, an aptamer, a peptidomimetic, or any combination thereof.
Nucleic acid inhibitors
In some aspects, the invention includes an isolated nucleic acid or an isolated oligonucleotide. In some instances the inhibitor is an siRNA or antisense molecule, which inhibits ALKBHl . In one embodiment, the nucleic acid comprises a promoter/regulatory sequence such that the nucleic acid is preferably capable of directing expression of the nucleic acid. Thus, the invention encompasses expression vectors and methods for the introduction of exogenous DNA into cells with concomitant expression of the exogenous DNA in the cells such as those described, for example, in Sambrook et al. (2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York), and in Ausubel et al. (1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York) and as described elsewhere herein.
In one embodiment, siRNA is used to decrease the level of ALKBHl . RNA interference (RNAi) is a phenomenon in which the introduction of double-stranded RNA (dsRNA) into a diverse range of organisms and cell types causes degradation of the complementary mRNA. In the cell, long dsRNAs are cleaved into short 21-25 nucleotide small interfering RNAs, or siRNAs, by a ribonuclease known as Dicer. The siRNAs subsequently assemble with protein components into an RNA-induced silencing complex (RISC), unwinding in the process. Activated RISC then binds to complementary transcript by base pairing interactions between the siRNA antisense strand and the mRNA. The bound mRNA is cleaved and sequence specific degradation of mRNA results in gene silencing. See, for example, U.S. Patent No. 6,506,559; Fire et al., 1998, Nature 391(19):306-311; Timmons et al., 1998, Nature 395:854; Montgomery et al., 1998, TIG 14 (7):255-258; David R. Engelke, Ed., RNA Interference (RNAi) Nuts & Bolts of RNAi Technology, DNA Press, Eagleville, PA (2003); and Gregory J. Hannon, Ed., RNAi A Guide to Gene Silencing, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (2003). Soutschek et al. (2004, Nature 432: 173-178) describe a chemical modification to siRNAs that aids in intravenous systemic delivery. Optimizing siRNAs involves consideration of overall G/C content, C/T content at the termini, Tm and the nucleotide content of the 3' overhang. See, for instance, Schwartz et al., 2003, Cell, 115: 199-208 and Khvorova et al., 2003, Cell 115:209-216. Therefore, the present invention also includes methods of decreasing levels of ALKBHl using RNAi technology.
In another aspect, the invention includes a vector comprising an siRNA or antisense polynucleotide. Preferably, the siRNA or antisense polynucleotide is capable of inhibiting the expression of a target polypeptide, wherein the target polypeptide is ALKBHl . The incorporation of a desired polynucleotide into a vector and the choice of vectors is well-known in the art as described in, for example, Sambrook et al. (2012), and in Ausubel et al. (1997), and elsewhere herein. In certain embodiments, the expression vectors described herein encode a short hairpin RNA (shRNA) inhibitor. shRNA inhibitors are well known in the art and are directed against the mRNA of a target, thereby decreasing the expression of the target. In certain embodiments, the encoded shRNA is expressed by a cell, and is then processed into siRNA. For example, in certain instances, the cell possesses native enzymes (e.g., dicer) that cleaves the shRNA to form siRNA.
The siRNA, shRNA, or antisense polynucleotide can be cloned into a number of types of vectors as described elsewhere herein. For expression of the siRNA or antisense polynucleotide, at least one module in each promoter functions to position the start site for RNA synthesis.
In some embodiments, oligonucleotides useful for inhibiting the expression of ALKBHl are about 5 to about 25 nucleotides in length, about 10 to about 30 nucleotides in length, or about 20 to about 25 nucleotides in length. In certain embodiments, oligonucleotides targeting ALKBHlmRNA are about 8 to about 18 nucleotides in length, in other embodiments about 12 to about 16 nucleotides in length, and in other embodiments about 7-8 nucleotides in length.
Oligonucleotides can comprise a sequence that is at least partially complementary to a target mRNA sequence, for example, at least about 75%, 80%>, 85%>, 90%, 95%, 96%, 97%, 98%, or 99% complementary to a target mRNA sequence. In some embodiments, the oligonucleotide can be substantially complementary to a target mRNA sequence, that is at least about 90%, 95%, 96%, 97%, 98%, or 99%
complementary to a target polynucleotide sequence. In one embodiment, the
oligonucleotide comprises a sequence that is 100% complementary to a target mRNA sequence. In some embodiments, the target is ALKBHl mRNA.
Small molecule inhibitors
In various embodiments, the inhibitor is a small molecule that inhibits the level or activity of ALKBHl . When the inhibitor is a small molecule, a small molecule may be obtained using standard methods known to the skilled artisan. Such methods include chemical organic synthesis or biological means. Biological means include purification from a biological source, recombinant synthesis and in vitro translation systems, using methods well known in the art. In one embodiment, a small molecule inhibitor of the invention comprises an organic molecule, inorganic molecule,
biomolecule, synthetic molecule, and the like.
Combinatorial libraries of molecularly diverse chemical compounds potentially useful in treating a variety of diseases and conditions are well known in the art as are method of making the libraries. The method may use a variety of techniques well- known to the skilled artisan including solid phase synthesis, solution methods, parallel synthesis of single compounds, synthesis of chemical mixtures, rigid core structures, flexible linear sequences, deconvolution strategies, tagging techniques, and generating unbiased molecular landscapes for lead discovery vs. biased structures for lead development.
In a general method for small library synthesis, an activated core molecule is condensed with a number of building blocks, resulting in a combinatorial library of covalently linked, core-building block ensembles. The shape and rigidity of the core determines the orientation of the building blocks in shape space. The libraries can be biased by changing the core, linkage, or building blocks to target a characterized biological structure ("focused libraries") or synthesized with less structural bias using flexible cores.
The small molecule and small molecule compounds described herein may be present as salts even if salts are not depicted and it is understood that the invention embraces all salts and solvates of the inhibitors depicted here, as well as the non-salt and non-solvate form of the inhibitors, as is well understood by the skilled artisan. In some embodiments, the salts of the inhibitors of the invention are pharmaceutically acceptable salts.
Where tautomeric forms may be present for any of the inhibitors described herein, each and every tautomeric form is intended to be included in the present invention, even though only one or some of the tautomeric forms may be explicitly depicted. For example, when a 2-hydroxypyridyl moiety is depicted, the corresponding 2- pyridone tautomer is also intended.
The invention also includes any or all of the stereochemical forms, including any enantiomeric or diasteriomeric forms of the inhibitors described. The recitation of the structure or name herein is intended to embrace all possible
stereoisomers of inhibitors depicted. All forms of the inhibitors are also embraced by the invention, such as crystalline or non-crystalline forms of the inhibitors. Compositions comprising an inhibitor of the invention are also intended, such as a composition of substantially pure inhibitor, including a specific stereochemical form thereof, or a composition comprising mixtures of inhibitors of the invention in any ratio, including two or more stereochemical forms, such as in a racemic or non-racemic mixture.
In one embodiment, the small molecule inhibitor of the invention comprises an analog or derivative of an inhibitor described herein.
In one embodiment, the small molecules described herein are candidates for derivatization. As such, in certain instances, the analogs of the small molecules described herein that have modulated potency, selectivity, and solubility are included herein and provide useful leads for drug discovery and drug development. Thus, in certain instances, during optimization new analogs are designed considering issues of drug delivery, metabolism, novelty, and safety.
In some instances, small molecule inhibitors described herein are derivatized/analoged as is well known in the art of combinatorial and medicinal chemistry. The analogs or derivatives can be prepared by adding and/or substituting functional groups at various locations. As such, the small molecules described herein can be converted into derivatives/analogs using well known chemical synthesis procedures. For example, all of the hydrogen atoms or substituents can be selectively modified to generate new analogs. Also, the linking atoms or groups can be modified into longer or shorter linkers with carbon backbones or hetero atoms. Also, the ring groups can be changed so as to have a different number of atoms in the ring and/or to include hetero atoms. Moreover, aromatics can be converted to cyclic rings, and vice versa. For example, the rings may be from 5-7 atoms, and may be homocycles or heterocycles.
As used herein, the term "analog," "analogue," or "derivative" is meant to refer to a chemical compound or molecule made from a parent compound or molecule by one or more chemical reactions. As such, an analog can be a structure having a structure similar to that of the small molecule inhibitors described herein or can be based on a scaffold of a small molecule inhibitor described herein, but differing from it in respect to certain components or structural makeup, which may have a similar or opposite action metabolically. An analog or derivative of any of a small molecule inhibitor in accordance with the present invention can be used to reduce skin pigmentation.
In one embodiment, the small molecule inhibitors described herein can independently be derivatized/analoged by modifying hydrogen groups independently from each other into other substituents. That is, each atom on each molecule can be independently modified with respect to the other atoms on the same molecule. Any traditional modification for producing a derivative/analog can be used. For example, the atoms and substituents can be independently comprised of hydrogen, an alkyl, aliphatic, straight chain aliphatic, aliphatic having a chain hetero atom, branched aliphatic, substituted aliphatic, cyclic aliphatic, heterocyclic aliphatic having one or more hetero atoms, aromatic, heteroaromatic, polyaromatic, polyamino acids, peptides, polypeptides, combinations thereof, halogens, halo-substituted aliphatics, and the like. Additionally, any ring group on a compound can be derivatized to increase and/or decrease ring size as well as change the backbone atoms to carbon atoms or hetero atoms.
Polypeptide inhibitors
In other related aspects, the invention includes an isolated peptide inhibitor that inhibits ALKBHl . For example, in one embodiment, the peptide inhibitor of the invention inhibits ALKBHl directly by binding to ALKBHl thereby preventing or inhibiting the activity of ALKBHl .
The variants of the polypeptides according to the present invention may be
(i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code,
(ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the polypeptide is an alternative splice variant of the polypeptide of the present invention, (iv) fragments of the polypeptides and/or (v) one in which the polypeptide is fused with another polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag). The fragments include polypeptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence. Variants may be post-translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.
Antibody inhibitors
The invention also includes an inhibitor of ALKBHl comprising an antibody, or antibody fragment, that specifically binds with ALKBHl .
The antibodies may be intact monoclonal or polyclonal antibodies, and immunologically active fragments (e.g., a Fab or (Fab) 2 fragment), an antibody heavy chain, an antibody light chain, humanized antibodies, a genetically engineered single chain F v molecule (Ladner et al, U.S. Pat. No. 4,946,778), or a chimeric antibody, for example, an antibody which contains the binding specificity of a murine antibody, but in which the remaining portions are of human origin. Antibodies including monoclonal and polyclonal antibodies, fragments and chimeras, may be prepared using methods known to those skilled in the art.
Antibodies can be prepared using intact polypeptides or fragments containing an immunizing antigen of interest. The polypeptide or oligopeptide used to immunize an animal may be obtained from the translation of RNA or synthesized chemically and can be conjugated to a carrier protein, if desired. Suitable carriers that may be chemically coupled to peptides include bovine serum albumin and thyroglobulin, keyhole limpet hemocyanin. The coupled polypeptide may then be used to immunize the animal (e.g., a mouse, a rat, or a rabbit).
Activators
In one embodiment, the present invention provides methods and compositions for decreasing the level or frequency of N6-mA. In one embodiment, the composition or method decreases the level of N6-mA by activating the level, activity, or both of ALKBHl, the N6-mA demethylase.
In one embodiment, the composition of the invention comprises an activator of ALKBHl . In another embodiment, the method of the invention comprises administering an activator of ALKBHl . An activator of ALKBHl is any compound, molecule, or agent that increases or activates the level or activity of ALKBHl . It will be understood by one skilled in the art, based upon the disclosure provided herein, that an increase in the level of ALKBHl encompasses the increase in ALKBHl expression, including transcription, translation, or both. The skilled artisan will also appreciate, once armed with the teachings of the present invention, that an increase in the level of
ALKBHl includes an increase in ALKBHl activity (e.g., enzymatic activity, substrate binding activity, etc.). Thus, increasing the level or activity of ALKBHl includes, but is not limited to, increasing the amount of ALKBHl polypeptide, and increasing transcription, translation, or both, of a nucleic acid encoding ALKBHl; and it also includes increasing any activity of a ALKBHl polypeptide as well.
For example, an inhibitor of ALKBHl is any compound, molecule, or agent that reduces ALKBHl expression, level, activity, or both. In various embodiments, an inhibitor of ALKBHl comprises a nucleic acid, a peptide, a small molecule, a siRNA, a ribozyme, an antisense nucleic acid, an antagonist, an aptamer, a peptidomimetic, or any combination thereof.
The increased level or increased activity of ALKBHl can be assessed using a wide variety of methods, including those disclosed herein, as well as methods well-known in the art or to be developed in the future. That is, the skilled artisan would appreciate, based upon the disclosure provided herein, that increasing the level or activity of ALKBHl can be readily assessed using methods that assess the level of a nucleic acid encoding ALKBHl (e.g., mRNA), the level of ALKBHl polypeptide, and/or the level of ALKBHl activity in a sample.
One of skill in the art will realize that in addition to activating ALKBHl directly, diminishing the amount or activity of a molecule that itself diminishes the amount or activity of ALKBHl can serve to increase the amount or activity of ALKBHl . Thus, an activator of ALKBHl can include, but should not be construed as being limited to, a chemical compound, a protein, a peptidomemetic, an antibody, a ribozyme, and an antisense nucleic acid molecule. One of skill in the art would readily appreciate, based on the disclosure provided herein, that an ALKBHl activator encompasses a chemical compound that increases the level, enzymatic activity, or substrate binding activity of ALKBHl . Additionally, an ALKBHl activator encompasses a chemically modified compound, and derivatives, as is well known to one of skill in the chemical arts.
The ALKBHl activator compositions and methods of the invention that increase the level or activity (e.g., enzymatic activity, substrate binding activity, etc.) of ALKBHl include activating antibodies. The activating antibodies of the invention include a variety of forms of antibodies including, for example, polyclonal antibodies, monoclonal antibodies, intracellular antibodies ("intrabodies"), Fv, Fab and F(ab)2, single chain antibodies (scFv), heavy chain antibodies (such as camelid antibodies), synthetic antibodies, chimeric antibodies, and a humanized antibodies. In one embodiment, the activating antibody of the invention is an antibody that specifically binds to ALKBHl .
Further, one of skill in the art would, when equipped with this disclosure and the methods exemplified herein, appreciate that a ALKBHl activator includes such activators as discovered in the future, as can be identified by well-known criteria in the art of pharmacology, such as the physiological results of activation of ALKBHl as described in detail herein and/or as known in the art. Therefore, the present invention is not limited in any way to any particular ALKBHl activator as exemplified or disclosed herein; rather, the invention encompasses those activators that would be understood by the routineer to be useful as are known in the art and as are discovered in the future.
Further methods of identifying and producing an ALKBHl activator are well known to those of ordinary skill in the art, including, but not limited, obtaining an activator from a naturally occurring source (e.g., Streptomyces sp., Pseudomonas sp., Stylotella aurantium, etc.). Alternatively, a ALKBHl activator can be synthesized chemically. Further, the routineer would appreciate, based upon the teachings provided herein, that a ALKBHl activator can be obtained from a recombinant organism.
Compositions and methods for chemically synthesizing ALKBHl activators and for obtaining them from natural sources are well known in the art and are described in the art.
One of skill in the art will appreciate that an activator can be administered as a small molecule chemical, a protein, an antibody, a nucleic acid construct encoding a protein, or combinations thereof. Numerous vectors and other compositions and methods are well known for administering a protein or a nucleic acid construct encoding a protein to cells or tissues. Therefore, the invention includes a method of administering a protein or a nucleic acid encoding a protein that is an activator of ALKBHl . (Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Ausubel et al., 1997, Current Protocols in Molecular Biology, John Wiley & Sons, New York).
One of skill in the art will realize that diminishing the amount or activity of a molecule that itself diminishes the amount or activity of ALKBHl can serve to increase the amount or activity of ALKBHl . Antisense oligonucleotides are DNA or RNA molecules that are complementary to some portion of an mRNA molecule. When present in a cell, antisense oligonucleotides hybridize to an existing mRNA molecule and inhibit translation into a gene product. Inhibiting the expression of a gene using an antisense oligonucleotide is well known in the art (Marcus-Sekura, 1988, Anal. Biochem. 172:289), as are methods of expressing an antisense oligonucleotide in a cell (Inoue, U.S. Pat. No. 5, 190,931). The methods of the invention include the use of antisense oligonucleotide to diminish the amount of a molecule that causes a decrease in the amount or activity of ALKBHl, thereby increasing the amount or activity of ALKBHl . Contemplated in the present invention are antisense oligonucleotides that are synthesized and provided to the cell by way of methods well known to those of ordinary skill in the art. As an example, an antisense oligonucleotide can be synthesized to be between about 10 and about 100, more preferably between about 15 and about 50 nucleotides long. The synthesis of nucleic acid molecules is well known in the art, as is the synthesis of modified antisense oligonucleotides to improve biological activity in comparison to unmodified antisense oligonucleotides (Tullis, 1991, U.S. Pat. No. 5,023,243).
Similarly, the expression of a gene may be inhibited by the hybridization of an antisense molecule to a promoter or other regulatory element of a gene, thereby affecting the transcription of the gene. Methods for the identification of a promoter or other regulatory element that interacts with a gene of interest are well known in the art, and include such methods as the yeast two hybrid system (Bartel and Fields, eds., In: The Yeast Two Hybrid System, Oxford University Press, Cary, N.C.). Alternatively, inhibition of a gene expressing a protein that diminishes the level or activity of ALKBHl can be accomplished through the use of a ribozyme. Using ribozymes for inhibiting gene expression is well known to those of skill in the art (see, e.g., Cech et al., 1992, J. Biol. Chem. 267: 17479; Hampel et al., 1989, Biochemistry 28: 4929; Altman et al., U.S. Pat. No. 5, 168,053). Ribozymes are catalytic RNA molecules with the ability to cleave other single-stranded RNA molecules. Ribozymes are known to be sequence specific, and can therefore be modified to recognize a specific nucleotide sequence (Cech, 1988, J. Amer. Med. Assn. 260:3030), allowing the selective cleavage of specific mRNA molecules. Given the nucleotide sequence of the molecule, one of ordinary skill in the art could synthesize an antisense oligonucleotide or ribozyme without undue experimentation, provided with the disclosure and references incorporated herein.
EXPERIMENTAL EXAMPLES
The invention is further described in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless otherwise specified. Thus, the invention should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.
Without further description, it is believed that one of ordinary skill in the art can, using the preceding description and the following illustrative examples, make and utilize the compounds of the present invention and practice the claimed methods. The following working examples therefore, specifically point out the preferred embodiments of the present invention, and are not to be construed as limiting in any way the remainder of the disclosure.
Example 1 : DNA Methylation on A^-adenine in mammalian embryonic stem cells
The data presented herein demonstrates a SMRT-ChIP approach (Single Molecular Real-Time sequencing of Chromatin Immunoprecipitati on-enriched DNA) to interrogate DNA modifications enriched at H2A.X deposition regions in mouse ESCs. Also demonstrated herein is the discovery of N6-mA in mouse ESCs, together with its demethylase and a novel function in evolution, silencing of young full-length LINEls, which is correlated with the silencing of nearby enhancers and genes in the mammalian genome.
The materials and methods employed in this example are now described.
Mouse ES Cell Culture
Mouse TT2 ES cells were cultured on gelatin coating plates with recombinant LIF. ESCs were grown in DMEM supplemented with 15% fetal bovine serum, 1% non-essential amino acids, 2 mM L-Glutamine, 1000 units of mLIF (EMD Millipore), 0.1 mM β-mercaptoethanol (Sigma) and antibiotics.
Generation of Alkbhl knockout ES cell lines with CRISPR-Cas9
A Doxycycline (Dox)-inducible Cas9-EGFP ES cell line was established with TT2 ESC. Guide RNA oligos (5 ' -accgAGTGCCTCTGGC ATCCCGGG-3 ' (SEQ ID NO: l), 5'-aaacCCCGGGATGCCAGAGGCACT-3'(SEQ ID NO:2)) were annealed and cloned into a pLKO.1 based construct (Addgene: 52628). Guide RNA virus was made in 293FT cells and infected inducible Cas9 ES cells. ES cells were first selected with Puromycin (1 μg/ml) for two days, and Dox (0.5 μg/ml) was added to induce Cas9-EGFP expression for 24 hours. ES cells were then seeded at low density to obtain single-derived colonies. Then, 72 ES cell colonies were randomly picked up and screened by PCR- enzyme digestion that is illustrated in Figure 8A. PCR screening primers flanking guide RNA sequence are designed as following: 5 ' - AGGC AGATTTCTGAGTTC AAGG-3 ' (SEQ ID NO:3) and 5 ' -TTT AGTC ATGTGCTTGTCC AGG-3 ' (SEQ ID NO:4).
PCR products were digested by Xmal overnight at 37 degree and separated on 2% agarose gel. A total 8 mutants from which PCR products show resistance to Xmal digestion were subjected to DNA sequencing. Clones that harbor deletion and coding frame shift (premature termination mutation) were expanded and used in this study. Expression ALKBHl protein in 293FT cells and Generation of ALKBHl mutation proteins
Human Alkbhl -Flag DNA sequence was inserted into pCW lenti -virus based vector (puromycin or Hygromycin resistance). The amino acid of D233 was mutated to A by QuickChange Site-Directed Mutagenesis (QuikChange II XL Site- Directed Mutagenesis Kit, #200521, Agilent) according to the manual. For Alkbhl rescue experiment, wild-type and D233A mutated Alkbhl constructs were introduced to Alkbhl KO ES cells, pCW-Hygromycin was chosen as control. After infections, the cells were selected with Hygromycin at 200 μg/ml for 4 days, and then the cells were expanded to isolate genomic DNA for N6mA dot blotting or other tests.
The 293FT cells were transfected with pCW-hAlkbhl and pCW - hAlkbhl-D233A mutant plasmids along with package plasmids of pMD2.G and pSPAX2. Culture medium was changed 10 hours after transfection. The Viruses was collected and concentrated 24 and 48 hours after transfecction according to
manufacturer's manual (Lenti-X™ Concentrator, Clontech). To establish stable expression of hAlkbhl and hAlkbhl-D233A cell lines, 293FT cells were infected the corresponding virus, and then select with puromycin at 1 μg/ml for 4 days. The stable cell lines of hAlkbhl -293FT and D233A-293FT were expanded to purify the proteins according to the previous reported method with some modifications (Tomomori-Sato et al., 2013, Methods Mol Biol 977:273-87). Briefly, M2 FLAG antibody was added to the nuclear extract and incubated overnight, and then Dynabeads M-280 (sheep anti-mouse IgG, from Life technology) was added to the above solution and incubated for 3-4 hours. Subsequently, the beads were separated from the solution and wash clean with washing buffer (Tomomori-Sato et al., 2013, Methods Mol Biol 977:273-87). Finally, the beads were eluted with 3 x FLAG peptides, followed by standard chromatography purification to 95% purity. Proteins were analyzed by MS.
ALKBHl Demethylase Assays
Demethylation assays were performed in 50 μΕ volume, which contained 50 pmol DNA oligos and 500 ng recombinant ALKBHl (or D233 A mutant) protein. The reaction mixture also consisted of 50 μΜ KCL, ImM MgCl 2 , 50 μΜ HEPES (pH=7.0), 2 mM ascorbic acid, 1 mMf a-KG, and 1 mM (NH 4 ) 2 Fe(S0 4 ) 2 .6H20. Reactions performed at 37 degree for 1 hour and then stopped with EDTA followed by heating 95 degree for 5 minutes. Then the reaction product was subjected to dot blotting. Substrate sequences are listed in Table 1.
Dot Blotting
First, DNA samples were denatured at 95 degree for 5 minutes, cooled down on ice, neutralized with 10% vol of 6.6 M ammonium acetate. Samples were spotted on the membrane (Amersham Hybond-N+, GE) and air dry for 5 minutes, then UV-crosslink (2 χ auto-crosslink, 1800 UV Stratalinker, STRATAGE E). Membranes were blocked in blocking buffer (5% milk, 1% BSA, PBST) for 2 hours at room temperature, incubated with 6mA antibodies (202-003, Synaptic Systems, 1 : 1000) over night at 4 degree. After 5-times wash, membranes were incubated with HRP linked secondary anti-rabbit IgG antibody (1 :5000, Cell Signaling 7074S) for 30 minutes at room temperature. Signals were detected with ECL Plus Western Blotting Reagent Pack (GE Healthcare).
Single Molecule Real-Time sequencing (SMRT) library construction of genomic DNA samples and PCR control
DNA samples were purified by standard N-ChIP protocol. 5 μg anti-
H2A.X antibodies were used per 10 million cells. DNA (250 ng) from ChIP pull-down were converted to SMRTbell™ templates using the PacBio® RS DNA Template Preparation Kit 1.0 (PacBio catalog #100-259-100) following manufacturer's instructions. Control samples were amplified by PCR (18 cycles). In brief, samples were end-repaired and ligated to blunt adaptors. Exonuclease incubation was carried out in order to remove all unligated adapters. Samples were extracted twice (0.6 χ AMPure beads) and the final "SMRTbells" were eluted in 10 μΐ EB. Final quantification was carried out on an Agilent 2100 Bioanalyzer with 1 μΐ of library. The amount of primer and polymerase required for the binding reaction was determined using the SMRTbell concentration (ng/μΐ) and insert size previously determined using the manufacturer- provided calculator. Primers were annealed and polymerase was bound using the DNA/Polymerase Binding Kit P4 (PacBio catalog #100-236-500) and sequenced using DNA Sequencing reagent 2.0 (PacBio catalog #100-216-400). Sequencing was performed on PacBio RS II sequencer using SMRT Cell 8Pac V3 (PacBio catalog #100- 171-800). In all sequencing runs, a 240 min movie was captured for each SMRT Cell loaded with a single binding complex.
Detection of modified nucleotides with SMRT sequencing data
Base modification was detected using SMRT Analysis 2.3.0 (Pacific Biosciences), which uses previously published methods for identifying modified bases based on inter-pulse duration ratios in the sequencing data (Flusberg et al., 2010, Nat
Methods 7:461-5). All calculations used theMus musculus mmlO genome as a reference. For the detection of modified bases in individual samples, the
RS Modification Detection.1 protocol was used with the default parameters.
Modifications were only called if the computed modification QV was better than 20, corresponding to p < 0.01 (vs. in silico model, Welch's t-test). The in silico model consider the IPDs from the eight nucleotides 5' through the three nucleotides 3' of the site in question. Only the sites with a sequencing coverage higher than 25 fold were used for subsequent analyses. To assess the significance of the overlap between N6mA sites by SMRT-ChIP and peaks from DIP-Seq, intersection with DIP-seq peaks was analyzed for each of the N6mA site called by SMRT-ChIP. To assess if the overlap is higher than expected by random chance, a permutation based approach was used, in which the original mapping is randomly shuffled between "As" that meet coverage cutoff and their corresponding QV scores, and estimated the expected overlap by random chance. As preparation for PacBio RS II sequencing, these relatively short DNA fragments (200- 1000 bps on average) were made topologically circular, allowing each base to be read many times by a single sequencing polymerase. Thus, the coverage requirement for modification detection was achieved both by sequencing different fragments pulled down from the same genomic regions and by sequencing the same fragment with many passes. Of note, the SMRT-ChIP approach did not identify more N6-mA sites in Alkbhl KO cells than WT cells. Although the exact reason remain to be identified, this analysis showed that much fewer Adenines are sequenced at a comparable coverage in Alkbhl KO cells than WT cells (Figures 6B and IOC), presumably due to the difficulty of using native ChIP approach to isolate H2A.X-deposition regions from Alkbhl KO cells because of heterochromatinization. N6mA-DNA-IP sequencing and analysis
Genomic DNA from WT or KO ES cells was purified with DNeasy kit (QIAGEN, 69504). For each sample, 5 μg DNA was sonicated to 200 - 500 bp with Bioruptor. Then, adaptors were ligated to genomic DNA fragments following the Illumina protocol. The ligated DNA fragments were denatured at 95 degree for 5 minutes. Then, the single-stranded DNA fragments were immunoprecipitated with 6mA antibodies (5 μg for each reaction, 202-003, Synaptic Systems) over night at 4 degree. N6-Me-dA enriched DNA fragments were purified according to the Active Motif hMeDIP protocol. IP DNA and input DNA were PCR amplified with Illumina indexing primers. The same volume WT and KO DNA samples were subjected to multiplexed library construction and sequencing with Illumina HiSeq2000. After sequencing and filter, high quality raw reads were aligned to mouse genome (UCSC, mm 10) with bowtie (2.2.4, default) (Langmead et al., 2009, Genome Biol 10:R25). By default, bowtie searches for multiple alignments and only reports the best match; for repeat sequences, such as transposons, bowtie reports the best matched locus or random one from the best- matched loci. After alignment, N6-mA enriched regions were called with SICER (version 1.1, FDR < 1.0E-15, input DNA as control) (Zhang et al., 2009, Bioinformatics 25: 1952- 8). Higher FDR cut-off could not further reduce N6-mA peak number. MACS2 was also used for peak calling, which generated similar results as SICER. Part of the data analysis was done by in-house customized scripts in R, Python or Perl. Genomic DNA samples from mouse fibroblast cells (where the endogenous N6-mA level is undetectable) were spiked with increasing amount of N6-mA-containing, or unmodified (control), oligonucleotides, and the N6-mA levels were determined by qPCR approach after DIP and library construction. 5mC-DNA-IP sequencing 5mC-DNA-IP was performed according to the manufacture's protocol (Active Motif 5mC MeDIP kit). The 5mC data processed with MEDIPS in Bioconductor, and in-house scripts in R, Python or Perl.
ChlP-Sequencing and data analysis Pipeline
Native Chromatin immunoprecipitation (N-ChIP) assay was performed as previously described.10 million of ES cells were used for each ChIP and massive parallel sequencing (ChlP-Seq) experiment. Cell fractionation and chromatin pellet isolation were performed as described. Chromatin pellets were briefly digested with Micrococcal nuclease (New England BioLabs) and the mononucleosomes were monitored by electrophoresis. Co-purified DNA molecules were isolated and quantified (100-200 ng for sequencing). Co-purified DNA and whole cell extraction (WCE) input genomic DNA were subject to library construction, cluster generation and next-generation sequencing (Illumina HiSeq 2000).
The output sequencing reads were filtered and pre-analyzed with Illumina standard workflow. After filtration, the qualified tags (in fastq format) were aligned to the mouse genome (UCSC, mmlO) with bowtie (2.2.4, default) (Langmead et al., 2009, Genome Biol 10:R25). Then, these aligned reads were used for peak calling with the SICER algorithm (input control was used as control in peak calling).
Bioinformatics analysis of epigenetics ChIP Sequencing data H3K4Mel and H3K27Ac ChlP-Seq data were aligned to mouse genome (mm 10) and peaks were called with SICER. H3K4Mel and H3K27Ac enriched regions were defined as enhancers. Then, RSEG (Song and Smith, 2011, Bioinformatics 27:870-1 ) (mode 3) was to call the H3K27Ac differentiated regions. Decommissioned enhancers in KO cells are determined by H3K27Ac downregulation (compared to WT cells).
Detection of H3K4Me3 in KO cells with ChlP-qPCR
Native ChlP-qPCR assay was used to validate H4K4Me3 at levels on gene promoters (Figure 13). All procedures were similar to what has been described in ChlP- Seq experiments, except that the co-purified DNA molecules were diluted and subject to qPCR. (Histone H3K4Me3 antibodies: Abeam Ab8580). Real-time PCR was performed with SybrGreen Reagent (Qiagen, QuantiTect SYBR Green PCR Kit, Cat: 204143) and quantified by a CFX96 system (BioRAD, Inc). RNA-Seq and confirmation by RT-qPCR approaches
RNA was extracted with miRNeasy kit (QIAGEN, 217004) and standard RNA protocol. The quality of RNA samples was measured using the Agilent
Bioanalyzer. Then, RNA was prepared for sequencing using standard Illumina "TruSeq" single-end stranded or "Pair-End" mRNA-Seq library preparation protocols. 50bp of single-end and lOObp of pair-end sequencing were performed on an Illumina HiSeq 2000 instrument at Yale Stem Cell Center Genomics Core. RNA-Seq reads were aligned to mm9 with splicing sites library with Tophat (Trapnell et al., 2009, Bioinformatics 25: 1105-11; 2.0.4, default parameters). The gene model and FPKM were obtained from Cufflink2. The differentially expressed genes were identified by Cuffdiff (Trapnell et al., 2012, Nat Protoc 7:562-78; 2.0.0, default parameters). To make sure the normalization is appropriate, the data were also analyzed with DESeq2 (default parameters), which generated similar results (Figure 9B). For transposons analysis, unique best alignment reads were used (alignment with bowtie (0.12.9), -m 1; or BWA) and calculated RPKM for each subfamily. For qPCR, the cDNA libraries were generated with First-strand synthesis kit (Invitrogen). Real-time PCR was performed with SybrGreen Reagent
(Qiagen, QuantiTect SYBR Green PCR Kit, Cat: 204143) and quantified by a CFX96 system (BioRAD, Inc). For Figure 3D, the specific loci LIMd elements primers were designed and optimized based on published reference (Chow et al., 2010, Cell 141 :956- 69).
EB differentiation
For EB differentiation experiment, feeder free cultured ES cells were treated with 0.5% trypsin-EDTA free solution and resuspended with culture medium and counted. Then, cells were seeded at 200000 cell/ml to Petri dish with EB differentiation medium (ESC medium without LIF and beta-ME). Medium was changed every 2 days. Hi stone mass spectrometry
Histones were isolated in biological triplicate from wild-type and Alkbhl KO cells by acid-extraction and resolved/visualized by SDS-PAGE/Coomassie-staining. The low molecular weight region of the gel corresponding to core histones was excised and de-stained. The excised gel region containing the histones was treated with <i<5-acetic anhydride to convert unmodified lysine resides to heavy acetylated lysines (45 Da mass addition) as reported in Tackett et al., 2005. Following <i<5-acetic anhydride treatment, the gel region was subjected to in-gel trypsin digestion. Histone peptides were analyzed with a Thermo Velos Orbitrap mass spectrometer coupled to a Waters nanoACQUITY LC system as detailed in Byrum et al., 2013. Tandem mass spectrometric data was searched with Mascot for the following possible modifications: heavy lysine acetylation, lysine acetylation, lysine monomethylation, lysine dimethylation and lysine trimethylation. For each biological replicate, histone H2A was identified with 100% sequence coverage across Kl 18/119 that revealed predominately no detectable lysine methylation
LC-MS-MS Method for the determination of ISf-Me-dA
DNA was digested with DNA Degradase Plus (Zymo Research) by following manufacturer's instruction with small modification. Briefly, the digestion reaction was carried out at 37 °C for 70 min in a 25 μΐ final volume containing 5 units of DNA Degradase Plus and 5 fMol of Internal Standard. Following digestion, reaction mixture was diluted to 110 μΐ and the digested DNA solution was filtered with a Pall NanoSep 3kDa filter (Port Washington, NY) at 8000 rpm for 15 min. After centrifugal filtration, the digested DNA solution was injected onto an Agilent 1200 FIPLC fraction collection system equipped with a diode-array detector (Agilent Technologies, Santa Clara, CA). Analytes were separated by reversed-phase liquid chromatography using an Atlantis C 18 T3 (150 x 4.6 mm, 3 μπι) column. The column temperature was kept at 30 °C. For the purification of N6-mA, the mobile phases were water with 0.1% acetic acid (A) and acetonitrile with 0.1% acetic acid (B). The flow rate was 1.0 ml/min with a starting condition of 2% B, which was held for 5 min, followed by a linear gradient of 4% B at 20 min, 10% B at 30 min, followed by 6 min at 80% B, then re-equilibration at the starting conditions for 20 min. dA and 6-Me-dA eluted with retention times of 14.7 and 27.0 min, respectively. The amount of dA in samples was quantitated by the UV peak area (λ = 254 nm) at the corresponding retention time using a calibration curve ranging from 0.2 to 5 nMol dA on column. For the simultaneous purification of N3-Me-dC, Nl- Me-dA, N3-Me-dA, N6-Me-dA and dA, the mobile phases were water with 5 mM ammonium acetate (A) and acetonitrile (B). The flow rate was 0.45 ml/min and the gradient elution program was set at following conditions: 0 min, 1% B; 2 min, 1% B; 40 min, 4% B; 60 min, 30% B; 65 min, 30% B; 65.5 min, 1% B, and 75 min, 1% B. N3-Me- dC, Nl-Me-dA, N3-Me-dA, N6-Me-dA and dA eluted with retention times of 24.8, 25.0, 22.0, 60.2 and 54.2 min, respectively. The amount of dA in samples was quantitated by the UV peak area (λ = 254 nm) at the corresponding retention time using a calibration curve ranging from 0.9 to 7.2 nMol dA on column. HPLC fractions containing target analyte were dried in a SpeedVac and reconstituted in 22 μΐ of D.I. water prior to LC- MS/MS analysis.
LC-MS-MS analysis of N3-Me-dC, Nl-Me-dA, N3-Me-dA and N6-Me- dA was performed on Ultra Performance Liquid Chromatography system from Waters Corporation (Milford, MA) coupled to TSQ Quantum Ultra triple-stage quadrupole mass spectrometer (Thermo Scientific, San Jose, CA). 20 μΐ of sample was introduced into mass spectrometry through a 100 mm x 2.1 mm HSS T3 column (Waters) at flow rate of 0.15 ml/min. Mobile phases were comprised of water with 0.1% formic acid (A) or acetonitrile (B). Elution gradient condition was set as following: 0 min, 1%B; 3 min,
1%B; 15 min, 7.5%B; 15.5 min, 1%B; 20 min, 1%B. Ionization was operated in positive mode and analytes were detected in selected reaction monitoring (SRM) mode.
Specifically, 6-Me-dA and its internal standard were detected by monitoring transition ions of m/z 266.1 to m/z 150.1 and m/z 271.1 to m/z 155.1, respectively. Similarly, N3- Me-dC, Nl-Me-dA and N3-Me-dA was detected by monitoring transition ions of m/z
242.1 to m/z 126.1, m/z 266.1 to m/z 150.1 and m/z 266.1 to m/z 150.1, respectively. Mass spectrometry conditions were set as following: source voltage, 3000 V; temperature of ion transfer tube, 280 °C; skimmer offset, 0; scan speed, 75 ms; scan width, 0.7 m/z; Ql and Q3 peak width, 0.7 m/z; collision energy, 17 eV; collision gas (argon), 1.5 arbitrary units. For quantification of N6-Me-dA, the linear calibration curves ranging from 1.5 to 750 fMol, were obtained using the ratio of integrated peak area of the analytical standard over that of the internal standard. The linear calibration curves for analysis of N3-Me-dC, Nl-Me-dA and N3-Me-dA were obtained using integrated peak area of the analytical standard. N3-Me-dA is not commercial available and was prepared from the reaction between 3-methyladenine and deoxythymidine in the presence of Nucleoside
Deoxyribosyltransferase II. The chemical identity of purified N3 -Me-dA was confirmed by using an Agilent 1200 series Diode Array Detector (DAD) HPLC system coupled with Agilent quadrupole-time-of-flight (QTOF)-MS (Agilent Technologies, Santa Clara, CA). Electrospray ionization (ESI)-MS-MS spectrum of N3 -Me-dA was obtained by in source fragmentation. One product ion was observed from MS/MS spectra of the protonated precursor ion of N 3 -Me-dA, resulting from the loss of the deoxyribosyl group. The accurate masses for parent and fragment ion are m/z 266.1253 and m/z 150.0774, with mass error 0.4 ppm and 3.8 ppm, respectively. The method sensitivity for N3-Me-dC, Nl-Me-dA, N3-Me-dA and N6-Me-dA was detected at 1.0 fmol, 1.6 fmol, 1.0 fmol and 1.6 fmol, respectively. In order to confirm the chemical identity of the N6-Me-dA isolated from HLPC purification, HPLC fractions containing N6-Me-dA was analyzed by HPLC-QTOF -MS/MS. The chemical identity of N 6 -Me-dA in HPLC fractions was characterized on an Agilent 1200 series Diode Array Detector (DAD) HPLC system coupled with Agilent quadrupole-time-of-flight (QTOF)-MS (Agilent Technologies, Santa Clara, CA). HPLC separation was carried out on a CI 8 reverse phase column (Waters Atlantis T3, 3 μπι, 150 mm x 2.1 mm) with a flow rate at 0.15 ml/min and mobile phase A (0.05% acetic acid in water) and B (acetonitrile). The gradient elution program was set at following conditions: 0 min, 1% B; 2 min, 1% B; 15 min, 30% B; 15.5 min, 1% B; and 25 min, 1% B. N 6 -Me-dA was eluted with retention times of 12.7 min. The electrospray ion source in positive mode with the following conditions were used: gas temperature, 200 °C; drying gas flow, 12 1/min; nebulizer, 35 psi; Vcap, 4000 V; fragmentor, 175 V; skimmer, 67 V. Electrospray ionization (ESI)-MS-MS spectrum of N6-Me-dA isolated from genomic DNA was obtained by in source fragmentation. One product ion was observed from MS/MS spectra of the protonated precursor ion of N6- Me-dA, resulting from the loss of the deoxyribosyl group. The accurate masses for parent and fragment ion are m/z 266.1245 and m/z 150.0775, with mass error 3.0 ppm and 3.1 ppm, respectively. The same MS/MS fragmentation spectra was obtained from analytical standard of N6-Me-dA.
For in vitro demethylation assay, sample was treated with EDTA to remove Fe 2+ . The mixture was transferred to Amicon Ultra Centrifugal Filter (EMD Millipore Corporation, 10K MWCO), followed by spin at 11000 rpm and 4 °C for 14 min. The concentrated sample was wash three times by adding 500 μΐ DI-H20, followed spin at 1 1000 rpm and 4 °C for 14 min. The washed sample was digested with DNA Degradase Plus (Zymo Research) by following manufacturer's instruction with small modification. Briefly, the digestion reaction was carried out at 37 °C for 60 min in 60 μΐ final volume containing 0.17 units/μΐ of DNA Degradase Plus and 50 fmol of Internal Standard of N6-Me-dA. Following digestion, reaction mixture was filtered with a Pall NanoSep 3kDa filter (Port Washington, NY) at 10000 rcf and room temperature for 10 min to remove enzyme. The LC-MS/MS conditions for the quantification of dA and N6- Me-dA were set the same as those for quantification of N6-Me-dA in in vivo samples. The linear calibration curves for quantification of dA and N6-Me-dA was obtained using the ratio of integrated peak area of the analytical standard over that of the internal standard of N^-Me-dA.
Table 1. Primers used in RT-qPCR and ChlP-PCR
Reverse CAGCATGAATACAGTGGAGTCTC (SEQ ID NO:22)
Forward GGACACAATGAAAGCATTTCTAAGAG (SEQ ID NO:23)
Ll chrX
Reverse GGGTGTTAGCAGAGAAGAACG (SEQ ID NO:24)
Forward GTTCTGTGACTCCTGAAAATGCA (SEQ ID NO:25)
Ll_chrl7
Reverse GAGTGCCTGAAACTGGGCTTA (SEQ ID NO:26)
Forward CACTCCCACCCCACCTAGT (SEQ ID NO:27)
L1 0RF1
Reverse TAACTCTTTAGCAGTGCTCTCCTGT (SEQ ID NO:28)
Forward AGCTTCTGGAACAGGCAGAA (SEQ ID NO:29)
L1 5UTR
Reverse CACTGTGTTGCTTTGGCAGT (SEQ ID NO: 30)
Forward GGTGTGGTGGCGCACACC (SEQ ID NO:31)
SINE Bl
Reverse CCTGGCTGTCCTGGAGCTC (SEQ ID NO:32)
Forward CTGCCTTCAGACACACCAGAAG (SEQ ID NO:33)
SINE B2
Reverse GATGGAAGAGGTTTTGCCAAG (SEQ ID NO:34)
Forward GTCCCTAGGAAGCCAAGTGAA (SEQ ID NO:35)
Cdx2
Reverse TTGGCTCTGCGGTTCTGAAA (SEQ ID NO:36)
Forward TTTAAACCGCCATGCACTCG (SEQ ID NO:37)
FoxA2
Reverse CACGGAAGAGTAGCCCTCGG (SEQ ID NO: 38)
Forward ACACCCCAATCTCGATATGTTTGA (SEQ ID NO:39)
Gata4
Reverse ATTGCACAGGTAGTGTCCCG (SEQ ID NO:40)
Forward CTCAGGGGTAGGGGCATCA (SEQ ID NO:41)
Gata6
Reverse CCTCCTTGCCTCTTGGTAGC (SEQ ID NO:42)
Forward CTACCCGGATGGCAAAGTCA (SEQ ID NO:43)
Fgf5
Reverse TCCGTAAATTTGGCACTTGCAT (SEQ ID NO:44)
Forward GCACATGCAAACACACATGA (SEQ ID NO:45)
Pax6
Reverse ACTTGGACGGGAACTGACAC (SEQ ID NO:46)
Forward AAGACTCCTGGAAGGTGGAGAG (SEQ ID NO:47)
T
Reverse CATCCTCCTGCCGTTCTTGGT (SEQ ID NO:48)
Forward AGGAGCACTACACTGACCTGA (SEQ ID NO:49)
Nmel
Reverse GGTTGGTCTCTCCAAGCATCA (SEQ ID NO:50)
Forward TGGGCCTACAAGTGCTATCTG (SEQ ID NO:51)
Ig£2r
Reverse TTCTCAAAAGTGAGTCACCCAC (SEQ ID NO: 52)
Forward TTCGGAACAAATTAGTCAGGTGC (SEQ ID NO:53)
Mdm4
Reverse AGTGCATTACCTCTTTCATGGTG (SEQ ID NO: 54)
Forward GGAGACCTTACCACTTGAAGATG (SEQ ID NO: 55)
Ephxl
Reverse GCCCGGAACCTATCTATCCTCT (SEQ ID NO:56)
Forward AAGGGGTGAACCTTCAGCG (SEQ ID NO:57)
Wdr74
Reverse GCCCACCAAGATTTGGGTCTC (SEQ ID NO: 58)
Forward CACAGCCTACAGGGGCATTG (SEQ ID NO:59)
Exoc4
Reverse TTGGCAGCGATTTCAAGAGTC (SEQ ID NO: 60)
Forward TCTGGGTATGTGGTACACTGAT (SEQ ID NO:61)
Tspan8
Reverse AGGGGTTC GTGC T AGAGTC TC (SEQ ID NO: 62)
Forward GCAGCCCTCTCAACCAGTTC (SEQ ID NO:63)
Mrpll8
Reverse TTCTTTCCGAGCTACCCCTAA (SEQ ID NO: 64)
Forward ATGTCTACTGTCCACGAAATCCT (SEQ ID NO: 65)
Anxa2
Reverse CGAAGTTGGTGTAGGGTTTGACT (SEQ ID NO:66) Forward GGACTCGCCGCCTATGTTC (SEQ ID NO: 67)
Esrrb
Reverse CGTTAAGCATGTACTCGCATTTG (SEQ ID NO: 68)
Forward CATCCACTTCTACCCCACCTT (SEQ ID NO: 69)
Sox2
Reverse AGCTCCCTGTCAGGTCCTT (SEQ ID NO: 70)
ChlP-qPCR primers
Forward AGCAACTGGTTTGTGAGGTGTCCGGTGAC (SEQ ID NO:71)
Oct4
Reverse CTCCCCAATCCCACCCTCTAGCCTTGAC (SEQ ID NO: 72)
Forward C AGAC TGGGAGGGAGGGA A A (SEQ ID NO:73)
Nanog
Reverse GAGGTGCAGCCGTGGTTAAA (SEQ ID NO: 74)
Forward CTTGCGTGCGCATTCAGTAT (SEQ ID NO: 75)
Daxl
Reverse TGCTTCGCGCTCATCAGTAG (SEQ ID NO:76)
Ll- Forward ACTGCGGTACATAGGGAAGC (SEQ ID NO: 77)
Promoter Reverse TGTGATCCACTCACCAGAGG (SEQ ID NO: 78)
Forward gctgttgccccttcccctcc (SEQ ID NO: 79)
Gata6
Reverse cctgcgggcgtgggttgag (SEQ ID NO: 80)
Forward TATCCACATGACCGACAGCG (SEQ ID NO: 81)
Hoxa3
Reverse CCCCAAATCGGGACAGACTC (SEQ ID NO: 82)
The results of the experiments are now described.
Identification of N6-mA in mouse embryonic stem cells
Since SMRT sequencing usually requires high sequencing coverage to recognize modified DNA bases (Fang et al., 2012, Nat Biotechnol 30: 1232-9; Davis et al., 2013, Curr Opin Microbiol 16: 192-8), it is difficult to interrogate the large
mammalian genomes (2.8 Gb oiMus musculus, for example) with this approach (Davis et al., 2013, Curr Opin Microbiol 16: 192-8). Therefore, SMRT-ChIP approach was developed to interrogate specific genomic regions of interest (Figure 1A). Since H2A.X deposition is strongly associated with cell fate transitions in mammals (Wu et al., 2014, Cell Stem cell 14:281-94), H2A.X deposition regions in ESCs were examined in the current study. DNA molecules residing in H2A.X-deposition regions in mouse ESCs were subject to SMRT sequencing directly without PCR amplification. In total, 90% of SMRT-ChIP reads are overlapped with H2A.X deposition regions identified by
traditional ChlP-Seq in the previous work (Wu et al., 2014, Cell Stem cell 14:281-94 ) (Figure 6A).
This approach identified N6-mA sites in H2A.X deposition regions with high confidence (398 sites at sequence coverage > 3 OX, QV score > 30 to 1108 sites at sequence coverage > 25X, QV score > 20; see Figure 6B). A representative N6-mA site is shown in Figure IB. Several specific DNA motifs, which are different from H2A.X deposition motifs (Figure 6C), were significantly associated with these putative N6-mA sites, indicating that its distribution in the genome is controlled by yet unknown factors or pathways (Figure 6C). These N6-mA sites are enriched at intergenic, but not gene-rich regions (P<2.2E-16, Figure 6D).
Next, the presence of N6-mA was confirmed with mass spectrometry (MS). To this end, DNA molecules from the whole genome or H2A.X-deposition regions were subject to an established and highly sensitive (LOQ: 1.6 fmol) mass spectrometry (LC-MS/MS) approach (Lu et al., 2010, Toicol Sci 115:441-51 ), which leverages stable isotope-labeled [ 15 N 5 ]-N6-mA as internal standard for sample enrichment and
quantification (Figure 1C, ID and 7A). This approach unequivocally identified N6-mA in ESCs (Figure 1C); and estimated a frequency of 25-30 parts per million (ppm) of deoxy- adenine (dA) in the H2A.X deposition regions for the N6-mA modification (Figure ID), a 4-fold enrichment over the whole genomic input DNA samples (6-7 ppm).
Additionally, very low levels of N6-mA were found in other differentiated mouse cells and adult tissues (Figure 7B).
Importantly, none of the other known alkylation adducts, such as 1- methyladenine (Nl-mA), 3-methyladenine (N3-mA) or 1-methylcytosine (N3-mC) (Sedgwick, 2004, Nat Rev Mol Cell Biol 5 : 148-57), were detected from H2A.X- deposition-region or whole genomic DNA samples (Figure 7C). Of note, although it was reported that Nl-mA shares similar kinetic profiles to N6-mA in SMRT sequencing (Flusberg et al., 2010, Nat Methods 7:461-5), this MS approach, which can distinguish N6-mA from Nl-mA, ruled out this plausible explanation of the SMRT-ChIP data (Figures 7D and 7E).
Alkbhl is a major demethylase for N6-mA in ESCs
Next the N6-mA demethylase was identified. The mammalian Alkbh family genes, which contain the conserved Fe ++ ion and 2-oxo-glutarate-dependent, dioxygenase domain, are promising candidates (Sedgwick, 2004, Nat Rev Mol Cell Biol 5: 148-57; Shen et al., 2014, Annu Rev Biochem 83 :585-614). Among these genes, Alkbh2 and 3 can efficiently remove 1mA or 3mC from DNA or RNA, but not N6-mA (Shen et al., 2014, Annu Rev Biochem 83 :585-614). Alkbhl is arguably the most intriguing member in this gene family: it shares the strongest similarity to bacteria demethylase Alkb and yet only has negligible demethylation activities on 3-mC in comparison to Alkh2 and Alkbh3 (Sedgwick, 2004, Nat Rev Mol Cell Biol 5 : 148-57; Shen et al., 2014, Annu Rev Biochem 83 :585-614). Additionally, Alkbhl deficiency in mice results in 80% reduction of the litter size due to embryonic lethality among other phenotypes, indicating that Alkbhl plays a critical role in early development (Miiller et al., 2013, PLoS One 8:e67403; Nordstrand et al., 2010, PLoS One 5:el3827).
Given these considerations, Alkbhl homozygous knock out ESC lines were generated (referred to as Alkbhl KO ESCs hereafter) via CRISPR/Cas9 technology (Figure 8A). MS analysis demonstrated that N6-mA levels in whole genomic input DNA or H2A.X deposition regions are both significantly increased (3-4 fold) in multiple Alkbhl KO ESC clones (Figure 2A). Similar elevated N6-mA levels in Alkbhl KO ESCs are confirmed by immunoblotting experiments with specific antibodies against N6-mA (Figures 2B, and 8B-8D). A previous work suggested that Alkbhl may regulate histone H2A Kl 18 or Kl 19 methylation in ESCs (Ougland et al., 2012, Stem cells 30:2672-82). The possibility of Alkbhl being a histone demethylase was ruled out since H2AK118/119 is predominately non-methylated at similar levels between wild-type and Alkbhl KO ESCs (Figure 8E).
Next the catalytic activities of recombinant ALKBHl proteins were investigated with in vitro demethylation assays. The recombinant ALKBHl proteins were generated with >95% purity (Figure 8F). The recombinant ALKBHl can efficiently reduce N6-mA level from single-stranded synthetic oligonucleotide substrates (Figures 2C-2E), while its activities towards dual- or hemi -methylated double-stranded substrates are much reduced, suggesting the demethylation may be coupled with transcription and/or replication in vivo (Figure 8G). Furthermore, these activities are dependent on Fe ++ ion and 2-oxo-glutarate, as expected for an active dioxygenase (Figure 8H).
The catalytic activities of ALKBHl were further substantiated by a point mutant at a critical residue (D233A) that may coordinate the Fe ++ ion. Corroborated by the much reduced activities of the recombinant mutant proteins (D233A) (Figures 81 and 8 J), the increase of N6-mA in Alkbhl KO mouse ESCs could be efficiently rescued by ectopic expression of WT but not mutant Alkbhl (Figures 8K and 8L).
N6-mA preferentially suppresses the expression of genes and young full- length LINE-1 on the X-chromosome
The discovery of Alkbhl as a N6-mA demethylase enables us to interrogate the functions of N6-mA in ESCs. Since this modification may be an important component of epigenetic regulation of gene expression, a RNA-Seq approach was used to interrogate the transcriptome of Alkbhl KO ESCs. This analysis demonstrated that 550 genes are significantly downregulated (FPKM>5, FDR<0.05, fold change >2 or <0.5, from Cuffdiff2) (Figure 3A; (Wu et al., 2016, "DNA Methylation on N6-adenine in mammalian embryonic stem cells," Nature)), which can be verified by the RT-qPCR approach (Figure 9 A), Although a small number of low-expressing genes (70) were initially identified as upregulated by the RNA-Seq analysis, they are mostly likely false positives which cannot be verified with RT-qPCR approach (0/5, Figures 9A and 9B), indicating that increasing N6-mA level in ESCs leads to gene silencing in principle. Gene ontology analysis showed that the top downregulated genes are enriched for
developmental factors or lineage specifying genes (Figure 9C). On the other hand, the expressions of pluripotency genes, such as Oct4 and Nanog, were unaltered and Alkbhl KO ESCs maintained the undifferentiated morphology and were able to self-renew.
Unexpectedly, the genomic locations of the downregulated genes have a strong chromosome bias (P<0.01, Bionomial test): they are most significantly enriched on the X-chromosome, whereas modestly enriched on Chrl3 (P<0.05, Bionomial test), but not on the other chromosomes (Figure 3B). qRT-PCR analysis confirmed the downregulation of the X-chromosome genes, together with other genes on autosomes (Figure 3C). These results indicate that accumulation of N6-mA represses transcription on the X-chromosome.
To test this hypothesis, the expression of young full-length LINE-1 transposons (Lis), which are specifically enriched on the X-chromosome, were investigated (Figure 4; Abrusan et al., 2008, PLoS Genet 4:el000172; Bailey et al., 2000, PNAS 97:6634-9). Of note, owing to their unique sequences, the expression of such Lis can be interrogated and distinguished from other LI subfamilies (Chow et al., 2010, Cell 141 :956-69). These results demonstrated that a young full-length LI (belong to the LIMd-Gf subfamily (Goodier et al., 2011, Genome Res 11 : 1677-85; Castro-Diaz et al., 2014, Genes Dev 28: 1397-409)) located on the X-chromosome is much more repressed (more than 60 fold) than its counterpart located on Chrl7 (Figure 3D). These results indicated that the LI density may affect the silencing effects of N6-mA. Consistently, qRT-PCR approach targeting the 5'-UTR or open reading frame 1 (ORFl), which are usually retained in young full-length Lis, but not old, truncated Lis (Goodier and Kazaqzian, 2008, Cell 135:23-35), also demonstrated a significant decrease of LI expression, while the SINE family transposons were almost unaffected (Figure 3D). Additionally, analyses of the transposons transcripts in the RNA-Seq experiments confirmed the downregulation of the young full-length LI subfamilies (Figure 9D). These results raised the intriguing possibility that genes and young full-length Lis on X- chromosomes may be co-regulated by N6-mA.
N6-mA specifically targets young full-length Lis enriched on the X- chromosome
The above results suggest that N6-mA adopts a new function in transcriptional silencing in mammals whereas it is implicated in gene activation in other species (Heyn and Esteller, 2015, Cell 161 :710-3; Zhang et al., 2015, Cell 161 :893-906; Greer et al., 2015, Cell 161 :868-78; Fu et al., 2015, Cell 161 :879-92). To further investigate N6-mA function, the differential methylation regions (DMR) of N6-mA in Alkbhl KO ESCs were identified.
Since there is a global increase of N6-mA in Alkbhl KO cells as indicated by MS analyses (Figure 2) while SMRT-ChIP approach can only interrogate H2A.X deposition regions (Figure 1 A), a N6-mA DIP-Seq (N6-mA DNA IP with anti-N6- methyladenine antibodies followed by next generation sequencing) experiment was performed. First, to validate this approach, its detection limit and lineage response range by a "spike-in experiment" was determined. With this approach, it was shown that the detection limit is around 10-15 ppm N6-mA (of Adenine), while this approach can't distinguish N6-mA from unmodified Adenines at 5ppm anymore. Importantly, N6-mA levels in Alkbhl KO cells (30-35 ppm) is within the lineage range of this approach (20ppm to 120 ppm) (Figure 10A).
Consistent with the genome-wide upregulation, N6-mA DIP-Seq identified 37,581 N6-mA sites in Alkbhl KO ESCs, in agreement with the estimate (35,000-40,000 sites) based on MS results (30-35 ppm). On the other hand, the N6-mA peaks in WT ES cells are underrepresented since N6-mA frequency is only 6-7 ppm in these cells. SMRT-ChIP approach was also used to interrogate N6-mA distribution in H2A.X-deposition regions in Alkbhl KO EScells (Figures 10B and IOC). These results demonstrated that putative N6-mA sites called by SMRT-ChIP at various cutoffs (sequences coverage: 10x-30x; QV: 20-30) significantly (P<1.0E-5; observed vs.
permutation) overlap with those identified by DIP-Seq. In addition, the percentage of overlap increases with rising sequencing coverage and QV scores. These results further validate the SMRT-ChIP approach.
N6-mA peaks called from DIP-Seq are enriched in intergenic regions, but not gene-coding regions (Figure 10E). Further analysis showed that N6-mA are deposited at LINE elements (Figure 10F), especially full-length Lis, but not the truncated ones (Figure 10G). Remarkably, N6-mA deposition at Lis is inversely correlated with their evolutionary age; over 99% of the young full-length Lis are enriched for N6-mA, while no such enrichment is observed on old Lis (Figures 4A and 10H). One of the major differences between the young and old Lis is the former retain the 5'UTR and ORFl regions: old Lis gradually lost their 5'UTR and ORFl during multiple rounds of remobilization in evolution and therefore, became inactive (Goodier and Kazaqzian, 2008, Cell 135:23-35). Interestingly, N6-mA deposition is biased at the 5'UTR and ORFl regions than at the 3' UTR (Figure 11 A). This enrichment pattern was further confirmed with qPCR approach (Figure 1 IB).
Furthermore, it is well-known that young full-length Lis are strongly enriched on X-chromosomes over autosomes (Abrusan et al., 2008, PLoS Genet
4:el000172; Bailey et al., 2000, PNAS 97:6634-9) and this analysis corroborated this longstanding observation (P = 1.4E-322 Figure 4B). In agreement, N6-mA peaks in Alkbhl KO ESCs are also significantly enriched on X-chromosome over autosomes (P= 1.4E-322, Figure 4B). Therefore, these results are consistent with the downregulation of young full-length LINE- Is and protein-coding genes located on X-chromosomes (Figure 3).
In classic epigenetic silencing pathways, the distance between the silencing center and genes is a critical determinant. Consistent with notion, further analysis showed that the downregulated genes are located much closer to the N6-mA enriched Lis (median: 424Kb) than to the non-enriched ones (median: 1.6M) (Figure 4C). Furthermore, the distances from downregulated genes to the N6-mA enriched Lis fall within a narrow range (25-75%: 196 kb— 925kb), while such distances to the non- enriched ones display greater variations (688Kb— 3.2Mb, Figure 12A). For instance, the NrObl/Daxl gene that is significantly downregulated in Alkbhl KO ESCs (Figure 3) is not enriched for N6-mA; it is, however, located 30Kb from a N6-mA enriched young full-length LI (Figure 4D, labeled in green). Notably, other transposons located in this genomic region are not enriched for N6-mA (Figure 4D).
Furthermore, the distances between either the ES-cell expressing genes in WT ESC (FPKM > 5.0 in RNA-seq) or downregulated genes in Alkbhl KO ESCs and young full-length Lis on Chrl3 are significantly shorter than the other autosomes (P < 2.2E-16, Figures 12B and 12C). On the other hand, on a few chromosomes which are devoid of the downregulated genes in Alkbhl KO ESCs, especially Chrl 1 and Chr4 (Figure 3), such distances are significantly longer than the other chromosomes (LI to ES cell-expressing genes: around 1000 kb , P <2.98E-13; LI to downregulated genes:
around 800 kb, P <=0.01 Figures 12B and 12C).
Increasing N6-mA levels leads to epigenetic silencing on the X- chromosome, which are persistent during ES cell differentiation
The above results indicated that N6-mA may have a direct effect on the transcription of Lis and their neighboring genes. Thus, the impacts of N6-mA deposition on young full-length Lis and their neighboring genes was investigated by interrogating the genome-wide deposition of several key epigenetic marks implicated in transcriptional regulation.
First, N6-mA's effects on young full-length LI transposons was studied.
This analysis demonstrated that although the genome-wide distribution and intensities of 5mC methylation sites are similar in Alkbhl KO to the WT control (Figure 13 A), 5mC level on young full-length Lis is modestly higher in Alkbhl KO than WT control, while there are no such differences on old Lis (Figure 5 A) or SINEs (Figure 13B). Other epigenetic silencing marks, such as H3K9me3 (Figure 5B), H3K27me3 and H2A.X, are deposited on young full-length Lis at similar levels (Figure 13). Although these results are in agreement with previous works showing that the young Lis are silenced by 5mC in human ESCs (Castro-Diaz et al., 2014, Genes Dev 28: 1397-409), additional mechanisms may be also involved since the effects of 5mC seems to be modest.
Second, the epigenetic status of the enhancers was interrogated and the results demonstrated that 450 enhancers are decommissioned as their H3K27Ac levels are significantly decreased in Alkbhl KO ESCs (one locus shown in Figure 13C; (Wu et al., 2016, "DNA Methylation on N6-adenine in mammalian embryonic stem cells," Nature)). These decommissioned enhancers are located much closer to N6-mA-enriched Lis (median: 485Kb) than non-enriched ones (2.03Mb, Figure 5C). Furthermore, such distances fall into a much narrower range (25-75%: 197Kb— 985Kb) than those to the non-enriched ones (806Kb— 3.8Mb) (Figure 13D). Furthermore, the H3K4Me3 levels are reduced at the transcription start sites of the downregulated genes (but not at the unaffected ones) (Figure 13E). These data demonstrate that N6-mA deposition at LI is correlated with the downregulation of nearby genes at the transcription level.
Third, the potential effects of N6-mA deposition on X-chromosome genes during differentiation were investigated. Embyroid body (EB) formation and
differentiation assays were performed. While the Alkbhl KO ESCs are able to differentiate in general, the cell fate decisions are imbalanced, as is consistent with previous reports (Figure 14). Importantly, X-chromosome genes, such as Gm8817 and Rhox6 (Liu et al., 2011, Int J Dev Biol 55:909-16), failed to be activated to the normal level in Alkbhl KO ESC-derived EBs (Figure 5D), indicating that N6-mA have long- lasting effects on their activation during differentiation.
N6-mA in mammalian ESCs and epigenetic regulation during early embryogenesis In summary, a novel approach (SMRT-ChIP) was developed to interrogate DNA modifications in specific genomic regions, which led to the discovery of N6-mA in the mammalian genome, together with its demethylase ^/A /. These findings challenge the prevailing paradigm that 5mC is the only form of DNA methylation in the
mammalian genome.
Intriguingly, N6-mA seems to adopt new functions during evolution. In mammalian ESCs, N6-mA accumulation on young full-length Lis correlates with direct silencing of such Lis, as well as decommissioning of nearby enhancers and genes, which are in direct contrast to the role of N6-mA in simple eukaryotes and invertebrates (Zhang et al., 2015, Cell 161 :893-906; Greer et al., 2015, Cell 161 :868-78; Fu et al., 2015, Cell 161 :879-92). In addition, the only Fe++, 2KG dependent di oxygenase orthologue in the drosophila genome has been reported to demethylate N6-mA in DNA (Zhang et al., 2015, Cell 161 :893-906) and oxidize 5mC in RNA (Delatte et al., 2016, Science 351 :282-5), whereas the functions of mammalian orthologues (Tetl-3 and Alkbl-8 genes) are much divergent. N6-mA silencing of LI transposon in Albkhl deficient cells is inversely correlated with the evolutionary age; the full-length young Lis are specifically targeted and silenced by N6-mA. Although the precise reasons of this finding remains elusive, these results showed that N6-mA deposition is strong on the unique 5' UTR and ORF1 regions of such Lis which harbor the promoters. These results also suggest that Alkbhl must be targeted to these regions in WT ES cells and future investigation will determine molecular underpinning of this specific targeting. Furthermore, as young full-length Lis are strongly enriched on X-chromosome, N6-mA deposition displays a strong bias towards X-chromosome. As such, these findings herein may shed new light to the longstanding "Mary Lyon" hypothesis of LI function during X-inactivation (Lyon, 1998, Cytogenet Cell Genet 80: 133-7). Finally, while young full-length Lis are active during early embryogenesis (Fadloun et al., 2013, Nat Struct Mol Biol 20:332-8), constant activation may cause genomic instability since they are capable of reintegration (Goodier and Kazaqzian, 2008, Cell 135:23-35; Goodier et al., 2011, Genome Res 11 : 1677-85), which implies the existence of a previously unknown silencing mechanism. Thus, without wishing to be bound to any particular theory, it is possible that N6-mA mediated silencing plays an important role in safeguarding active Lis in the mammalian genomes. The levels of N6-mA are controlled precisely by Alkbhl in ESCs such that they favor LI transcription while preventing it from succumbing to over-activation and genomic instability, which is reminiscent of the function of a rheostat (Figure 5E). In addition, LINE- Is are inactive in a group of South American rodents, in which a new family of endogenous retrotransposons (mysTR) emerge (Erickson et al., 2011, J Virol 85: 12315- 23). Koziol et al. reported the presence of N6-mA in adult mouse tissues (Koziol et al., 2015, Nat Struct Mol Biol 23 :24-30). However, N6-mA levels in these tissues seem to be lower than the detection limit of the DIP-seq approach. Taken together, the discovery of N6-mA in mammalian ESCs sheds new light on epigenetic regulation during early embryogenesis.
Example 2: N6-mA is overexpressed in cancer cells
The data presented herein demonstrates that N6-mA is overexpressed in cancer cell lines. Figure 15 shows that N6-mA is detectable in an ovarian cancer stem cell line that is chemotherapy resistant. Furthermore, N6-mA expression is maintained in the cancer cells after engraftment into mice. However, ovarian cancer cells that are responsive to chemotherapy and control ovarian cells as well as control HEK293T cells do not express appreciable amounts of N6-mA. Figure 16 shows that N6-mA is detectable in both human iPS and ES cells. However, the N6-mA levels in certain iPS cells appear to be higher than human ES cells.
N6-mA is also highly upregulated in primary and recurrent human glioblastomas (GBM), while it is undetectable in normal brain tissues. Experiments further demonstrated that N6-mA is specifically upregulated in the cancer stem cells in GBM, which are able to reconstitute tumorigenesis in patient-derived xenograft (PDX) mouse models. Inhibiting N6-mA levels by post-translation modification can effectively curb tumor growth. At the molecular level, N6-mA represses the expression of cell-death- related genes induced by hypoxia, a common condition that stimulates the selection and maintenance of cancer stem cells in various tissues. These results are consistent with those observed in ovarian cancer stem cells, which is consistent with the explanation that N6-mA is a common mechanism cancer stem cells utilize to gain growth advantages. The disclosures of each and every patent, patent application, and publication cited herein are hereby incorporated herein by reference in their entirety. While this invention has been disclosed with reference to specific embodiments, it is apparent that other embodiments and variations of this invention may be devised by others skilled in the art without departing from the true spirit and scope of the invention. The appended claims are intended to be construed to include all such embodiments and equivalent variations.