DIFFERENTIATION AND MYOTUBE FORMATION

Cross-Reference to Related Applications

This application claims to the benefit of United States Provisional Patent Application

No. 61/650,218, filed May 22, 2012. The contents of the foregoing are incorporated herein by reference in their entirety.

Technical Field

This invention relates to the field of molecular biology and medicine.

Background

Skeletal muscle differentiation is a highly coordinated multi-step process in which mononucleated myoblasts first withdraw from the cell cycle upon extracelluar cues, differentiate into post-mitotic myocytes (early differentiation), and subsequently fuse into multi-nucleated myotubes (late differentiation), which finally bundle to form mature muscle fibers (terminal differentiation). This process is elaborately controlled by the activation of myogenic factor 5 (Myf5), myogenic differentiation antigen (MyoD), myogenin, and muscle regulatory factor 4 (MRF4): four myogenic regulatory factors (MRFs) belonging to a family of basic helix-loop-helix transcription factors. During myogenesis, MRFs are activated and operate in concert with other transcriptional regulators, such as myocyte enhancer factor 2 (MEF2), in a space- and time-correlated manner to regulate the transcription of muscle- specific genes including myosin heavy chain (MyHC) and muscle creatine kinase (MCK) (Braun et al., Nat. Rev. Mol. Cell. Bio. 12:349-361, 201 1; Molkentin et al, Cell 83 : 1125- 1 136, 1995; Olson et al, Genes Dev. 8: 1-8, 1994). Previous studies have confirmed that Myf5 and MyoD are muscle determination factors which are mainly expressed in undifferentiated myoblasts and differentiating myocytes, while myogenin is activated at an early stage of differentiation (Berkes et al, Semin. Cell Dev. Biol. 16:585-595, 2005). MRF4 has been shown to be transiently expressed during somitogenesis and later fiber maturation (Hinterberger et al, Dev. Biol. 147: 144-156, 1991), and to play a role in myogenic lineage commitment (Kassar-Duchossoy et al, Nature 431 :466-471, 2004), as well as myoblast fusion and differentiation (Suelves et al, EMBO J. 23 :365-375, 2004; Sumariwalla et al, Genesis 30:239-249, 2001). Muscle disorders, such as muscle atrophy, muscle weakness, myopathy, chronic fatigue syndrome, fibromyalgia, muscular dystrophy, fatigue fibromyalgia, spinal muscle atrophy, distal muscular dystrophy, dermatomyositis, polymyositis, rhabdomyolysis, polymyalgia rheumatica, and claudication, are characterized by a loss in muscle fiber function or mass in a mammal. Muscle disorders affect a significant population of humans worldwide. For example, Duschenne Muscular Dystrophy (DMD) occurs in 1 out of 3000 males in the U.S. (McPhee et al, Pathophysiology of Disease, Prentice Hall, 1995).

Summary

The inventions described herein are based, at least in part, on the discovery that oligonucleotides that decrease the expression of Mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) mRNA in a myoblast or myocyte increase the differentiation of a myoblast into a myocyte, and induce the formation of myotubes from myocytes and/or myoblasts. In view of these discoveries, provided herein are methods of inducing differentiation of a mammalian or avian myoblast into a mammalian or avian myocyte that include or consist of contacting the mammal or avian myoblast with an oligonucleotide that decreases Map4k4 mRNA expression in a mammalian or avian myoblast. Also provided are methods of inducing mammalian or avian myoblasts or myocytes to form a myotube that include or consist of contacting two or more mammalian or avian myoblasts or two or more mammalian or avian myocytes with an oligonucleotide that decreases Map4k4 mRNA expression in a mammalian or avian myoblast or myocyte, and screening methods for identifying a candidate agent useful for inducing muscle formation in a mammal or avian. Compositions containing an oligonucleotide that decreases Map4k4 mRNA expression in a mammalian or avian myoblast or myocyte, and one or more additional muscle disorder therapeutics agents are also provided.

Provided herein are methods of inducing differentiation of a mammalian myoblast into a mammalian myocyte that include or consist of contacting a mammalian (e.g., a human) myoblast with an oligonucleotide selected from the group consisting of an inhibitory RNA, an antisense oligonucleotide, and a ribozyme that decreases Map4k4 mRNA expression in a mammalian myoblast, in an amount sufficient to induce differentiation of the mammalian myoblast into a mammalian myocyte. In some embodiments, the mammalian myoblast is present in vitro. In some embodiments, the mammalian myoblast is present in a mammal. In some embodiments, the oligonucleotide is administered to the mammal by intravenous, intra- arterial, subcutaneous, intraperitoneal, intramuscular, ocular, or intrathecal administration. In some embodiments, the oligonucleotide is administered to the mammal by intramuscular administration. In some embodiments, the mammal is a human. In some embodiments, the mammal has been diagnosed as having a muscle disorder or frailty disorder. In some embodiments, the muscle disorder is selected from the group of: muscle atrophy, muscle weakness, myopathy, chronic fatigue syndrome, fibromyalgia, muscular dystrophy, fatigue fibromyalgia, spinal muscle atrophy, distal muscular dystrophy, dermatomyositis, polymyositis, rhabdomyolysis, polymyalgia rheumatica, muscle tear, and claudication. In some embodiments, the subject is a human. In some embodiments, the contacting results in treatment of the muscle disorder or frailty syndrome in the mammal (e.g., human). In some embodiments, the contacting results in a decrease in the expression of Map4k4 mRNA in the mammalian myoblast, and the decrease in the expression of Map4k4 mRNA in the mammalian myoblast results in an increase in the expression of one or more of myogenic regulatory factor 5 (Myf5), creatine kinase, calsequestrin 1, peptidylarginine deiminase, and CD24a in the mammalian myoblast.

Also provided are methods of inducing mammalian myoblasts or myocytes to form a myotube that include or consist of contacting two or more myoblasts or two or more myocytes with an oligonucleotide selected from the group consisting of an inhibitory RNA, an antisense oligonucleotide, and a ribozyme that decreases Map4k4 mRNA expression in a mammalian myoblast or myocyte, in an amount sufficient or effective to induce the two or more myoblasts or the two or more myocytes to form a myotube. In some embodiments, the two or more mammalian myoblasts or the two or more mammalian myocytes are present in vitro. In some embodiments, the two or more mammalian myoblasts or the two or more mammalian myocytes are present in a mammal. In some embodiments, the oligonucleotide is administered to the mammal by intravenous, intra-arterial, subcutaneous, intraperitoneal, intramuscular, ocular, or intrathecal administration. In some embodiments, the

oligonucleotide is administered to the mammal by intramuscular administration. In some embodiments, the mammal is a human. In some embodiments, the mammal has been diagnosed as having a muscle disorder or frailty disorder. In some embodiments, the muscle disorder is selected from the group of: muscle atrophy, muscle weakness, myopathy, chronic fatigue syndrome, fibromyalgia, muscular dystrophy, fatigue fibromyalgia, spinal muscle atrophy, distal muscular dystrophy, dermatomyositis, polymyositis, rhabdomyolysis, polymyalgia rheumatica, muscle tear, and claudication. In some embodiments, the subject is a human. In some embodiments, the contacting results in treatment of the muscle disorder or frailty disorder.

In certain embodiments of any of the methods described herein, the oligonucleotide is an inhibitory RNA (e.g., a small inhibitory RNA). In some embodiments of any of the methods described herein, the oligonucleotide is an antisense oligonucleotide. In some embodiments of any of the methods described herein, the oligonucleotide is a ribozyme. In some embodiments of any of the methods described herein, the oligonucleotide is modified (e.g., modified at a base moiety, a sugar moiety, or phosphate backbone). In some embodiments of any of the methods described herein, the oligonucleotide is delivered using a liposome or a nanoparticle.

Also provided are methods of identifying a candidate agent useful for inducing muscle formation in a mammal that include or consist of providing a mammalian myoblast, contacting the mammalian myoblast with a candidate agent, determining a test level of Map4k4 expression in the mammalian myoblast, comparing the test level of Map4k4 expression in the mammalian myoblast to a reference level of Map4k4 expression in a control mammalian myoblast untreated with the candidate agent, and identifying a candidate agent that results in a test level of Map4k4 expression that is lower than the reference level of Map4k4 expression as being useful for inducing muscle formation in a mammal. In some embodiments, the mammalian myoblast or the control mammalian myoblast is in vitro. In some embodiments, the mammalian myoblast or the control mammalian myoblast is in a mammal. In some embodiments, the level of Map4k4 expression is Map4k4 protein expression. In some embodiments, the level of Map4k4 expression is Map4k4 mRNA expression.

Also provided are compositions including or consisting of an oligonucleotide selected from the group consisting of an inhibitory RNA, an antisense oligonucleotide, and a ribozyme that decreases Mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) mRNA expression in a mammalian myoblast or myocyte, and one or more additional muscle disorder therapeutic agents. In some embodiments, the one or more additional muscle disorder therapeutic agents are selected from the group of: a non-steroidal anti-inflammatory drug (NSAID), an immunosuppressive drug, a corticosteroid, and a cyclooxygenase (COX) inhibitor. In some embodiments, the composition is formulated for intramuscular administration. In some embodiments, the composition is formulated in a liposome or a nanoparticle. Also provided herein are methods of using an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte in the manufacture of a medicament for treating a muscle disorder, e.g., Duchenne Muscular Dystrophy, or inducing muscle formation, in a mammal.

Also provided herein are oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte for use in treating a muscle disorder or inducing muscle formation in a mammal.

Also provided herein are methods of using an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte in the manufacture of a medicament for inducing differentiation of a mammalian myoblast into a mammalian myocyte and/or inducing mammalian myoblasts or myocytes to form a myotube.

Also provided herein are oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte for use in inducing differentiation of a mammalian myoblast into a mammalian myocyte and/or inducing mammalian myoblasts or myocytes to form a myotube.

Also provided herein are methods of using an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte in the manufacture of a medicament for increasing muscle mass in a mammal (e.g., a human).

Also provided herein are oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte for use in increasing muscle mass in a mammal (e.g., a human).

Also provided herein are methods of using an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte in the manufacture of a medicament for treating a muscle disorder or frailty syndrome in a mammal (e.g., a human).

Also provided herein are oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte for use in treating a muscle disorder or frailty syndrome in a mammal (e.g., a human). By the phrase "decrease expression" is meant a reduction in the level of a specific protein or a reduction in the level of an mRNA encoding a specific protein in a mammalian or avian cell (e.g., a mammalian or avian myoblast or myocyte) upon contacting the mammalian or avian cell with an agent (e.g., an oligonucleotide that decreases Map4k4 mRNA expression in a mammalian or avian myoblast or myocyte) as compared to a control mammalian or avian cell not contacted with the agent. In some embodiments, a level of a Map4k4 protein or an mRNA encoding a Map4k4 protein (a Map4k4 mRNA) is reduced in a mammalian or avian myoblast or myocyte. In some embodiments, a level of one of more of a myogenic regulatory factor 5 (Myf5), creatine kinase (CK), calsequestrin 1, peptidylarginine deiminase, and CD24a are increased in a mammalian or avian myoblast or myocyte as a result of a decrease in Map4k4 mRNA expression in a mammalian or avian myoblast or myocyte.

By the term "Map4k4 protein" or "Mitogen-activated protein kinase kinase kinase kinase 4 protein" is meant an endogenous mammalian or avian Map4k4 protein. In some embodiments, the Map4k4 protein is a human Map4k4 protein (e.g., SEQ ID NO: 1, 3, 5, 7, or 9). Additional examples of Map4k4 protein are described herein.

By the term "Map4k4 mRNA" or "Mitogen-activated protein kinase kinase kinase kinase 4 mRNA" is meant an endogenous messenger RNA that encodes a mammalian or avian Map4k4 protein. In some embodiments, the Map4k4 mRNA is a human Map4k4 mRNA (e.g., SEQ ID NO: 2, 4, 6, 8, or 10).

By the term "muscle disorder" is meant a medical condition characterized by a decrease in muscle fiber function and/or mass in a mammal or avian. Non-limiting examples of muscle disorders include muscle atrophy, muscle weakness, myopathy, chronic fatigue syndrome, fibromyalgia, muscular dystrophy (e.g., Duchenne Muscular Dystrophy), fatigue fibromyalgia, spinal muscle atrophy, distal muscular dystrophy, dermatomyositis, polymyositis, rhabdomyolysis, polymyalgia rheumatica, muscle tear, and claudication.

By the term "myoblast" is meant an embryonic (undifferentiated) progenitor cell that gives rise to a myocyte. In some embodiments, a myoblast can be identified by its expression of myogenic differentiation antigen (MyoD) and/or myogenic factor 5 (Myf5).

By the term "myocyte" is meant a specialized differentiated, contractile mammalian or avian cell found in mammalian or avian muscle tissue. In some embodiments, a myocyte can be identified by its expression of myosin heavy chain (MHC).

By the term "myotube" is meant a multi-nucleated fiber that is formed from the fusion of a plurality of myoblasts and/or myocytes.

By the term "muscle disorder therapeutic agent" is meant a pharmaceutical agent that is administered to subjects to treat a muscle disorder (e.g., any of the muscle disorders described herein). Non-limiting examples of muscle disorder therapeutic agents include nonsteroidal inflammatory drugs (NSAIDs), an immunosuppressive drug, a corticosteroid, and a cyclooxygenase inhibitor (e.g., a COX-I or COX-II inhibitor). Other definitions appear in context throughout this disclosure. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.

Other features and advantages of the invention will be apparent from the following detailed description and figures, and from the claims.

Brief Description of the Drawings

Figure 1 is a Western blot showing the expression of Map4k4 and a-tubulin protein in C2C12 myoblasts transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and harvested (t = 0) or cultured in differentiation medium for 24 to 96 hours.

Figure 2 is a set of fluorescence micrographs showing the expression of MyHC in C2C12 myoblasts that were transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and harvested (t = 0) or cultured in differentiation medium for 24 to 96 hours.

Figure 3 is a graph showing the percentage of myotubes with the indicated number of nuclei in C2C12 myoblasts that were transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and cultured in differentiation medium for 72 hours.

Figure 4 is a graph showing the ratio of the nuclei number in MyHC-positive myotubes versus the total number of nucleic in one microscopic field (fusion index) for C2C12 myoblasts that were transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and then cultured in differentiation medium for 72 hours.

Figure 5 is a graph showing the percent myotube diameter compared to control for C2C12 myoblasts transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and cultured in differentiation medium for 72 hours. The control myotube diameter was the average myotube diambeter in C2C12 myoblasts transfected with a scrambled siRNA, recovered for 24 hours, and cultured in differentiation medium for 72 hours.

Figure 6 is a Western blot showing the expression of Map4k4, myogenic

differentiation antigen (MyoD), Myogenin, myocyte-specific enhancer factor 2c (Mef2c), m myosin heavy chain (MyHC), and a-tubulin protein in C2C12 myoblasts transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and harvested (t = 0) or cultured in differentiation medium for 8 to 96 hours.

Figure 7 is a graph showing the normalized expression of MyHC protein in C2C12 myoblasts transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and cultured in differentiation medium for 48 to 96 hours.

Figure 8 is a graph showing the relative creatine kinase (CK) activity in C2C12 myoblasts transfected with scrambled or Map4k4 siRNA, recovered for 24 hours, and cultured in differentiation medium for 72 hours.

Figure 9 is a graph of the number of nuclei in MyHC-positive cells compared to the total nuclei in the microscopic field (fusion index) for C2C12 myoblasts that were infected with adenoviruses expressing Green Fluorescent Protein (GFP), wild type Map4k4, and Map4k4 kinase-inactive mutant (D 152N), and differentiated for 72 hours.

Figure 10 is a set of fluorescent micrographs showing the expression of MyHC in C2C12 myoblasts transfected with scrambled siRNA or siRNA targeting Map4k4, p38a, JNK1, JNK2, JNK1 + JNK2, Erkl, Erk2, or Erk 1 + Erk2, recovered for 24 hours, and cultured in differentiation medium for 72 hours.

Figure 1 1 is a Western blot showing the expression of Map4k4, phospho-p38, p38, phospho-extracellular signal-regulated kinase 1 (Erkl), phospho-extracellular signal- regulated kinase 2 (Erk2), Erkl, Erk2, phospho-JNK2, phospho-c-Jun N-terminal kinase 1 (JNK1), c-Jun-N-terminal kinase 2 (JNK2), or JNK1 in C2C12 myoblasts following transfection with scrambled or Map4k4 siRNA, recovery for 24 hours, and culturing in differentiation medium for 0 to 96 hours.

Figure 12 is a graph of the percentage of nucleic in MyHC-positive cells compared to the total nuclei in the microscopic field (fusion index) in C2C12 myoblasts cultured in normal growth medium for one day (24 hours), and then cultured for 96 hours (4 days) in

differentiation medium, where cells were transfected with scrambled or Map4k4 siRNA during the first day in normal growth medium (days - 1 to 4), after 24 hours in the

differentiation medium (days 1 to 4), and after 48 hours in the differentiation medium (days 2 to 4).

Figure 13 is a graph showing the relative Myf5 protein expression in C2C12 myoblasts that were transfected with scrambled or Map4k4 siRNA, recovered for 24 hours in normal growth medium, and then cultured in differentiation medium for 0 to 96 hours. Figure 14 is a graph of the percentage of nuclei in MyHC-positive cells compared to the total nuclei in the microscopic field (fusion index) for C2C12 myoblasts transfected with scrambled siRNA, siRNA targeting Map4k4, siRNA targeting Myf5, or siRNA targeting both Map4k4 and siRNA, recovered for 24 hours in normal growth medium, and cultured for 72 hours in differentiation medium.

Figure 15 is a graph of the relative mRNA expression of several different muscle contraction genes and muscle differentiation genes in C2C12 myoblasts transfected with scrambled or Map4k4 siRNA, recovered for 24 hours in normal growth medium, and cultured in differentiation medium for 72 hours. mRNA expression was determined using mRNA microarray analysis.

Detailed Description

The inventions described herein are based, at least in part, on the discovery that decreasing Map4k4 expression in myoblasts results in differentiation of the myoblasts into myocytes, and results in the increased formation of myotubes. Thus, provided herein are methods of inducing differentiation of a mammalian or avian myoblast into a mammalian or avian myocyte, and methods of inducing mammalian or avian myoblasts or myocytes to form a myotube. The methods include administering an oligonucleotide that decreases the level of Map4k4 mRNA in a myoblast or myocyte.

Also provided are methods of identifying candidate agents that are useful for inducing muscle formation in a mammal or avian. The screening methods include, inter alia, contacting a mammalian or avian myoblast or myocyte with a candidate agent and determining the level of Map4k4 expression in the mammalian or avian myoblast or myocyte.

Also provided are compositions that contain an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or myocyte, and one or more additional muscle disorder therapeutic agents and/or one or more additional muscle promoting agents, such as neutraceuticals. Various, non-limiting features of each aspect of the invention are described below. Map4k4

Mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4; also known as NCK-interacting Kinase, or NIK) is a serine/threonine kinase that regulates diverse signaling pathways and is essential for mammalian development (Xue et al, Development, 128(9): 1559-1572, 2001). The N-terminus of the human Map4k4 polypeptide has a catalytic kinase domain with 11 kinase subdomains (Yao et al, J. Biol. Chem., 274: 2118-2125, 1999).

Non-limiting examples of Map4k4 proteins are endogenous Map4k4 proteins, e.g., an endogenous human Map4k4 protein (e.g., a Map4k4 protein containing the sequence of SEQ ID NO: 1, 3, 5, 7, or 9), an endogenous dog Map4k4 protein (e.g., SEQ ID NO: 11), and an endogenous chicken Map4k4 protein (SEQ ID NO: 13). In some embodiments, an endogenous form of Map4k4 protein contains a sequence that is at least 80% identical (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to SEQ ID NO: 1, 3, 5, 7, 9, 11, or 13. A number of additional endogenous mammalian or avian forms of Map4k4 protein are known in the art.

Examples of Map4k4 proteins include for example, the following proteins: human Map4k4 protein isoform 1 (SEQ ID NO: 1), human Map4k4 protein isoform 2 (SEQ ID NO: 3), human Map4k4 protein isoform 3 (SEQ ID NO: 5), human Map4k4 protein isoform 4 (SEQ ID NO: 7), human Map4k4 protein isoform 5 (SEQ ID NO: 9), dog Map4k4 protein (SEQ ID NO: 11), and chicken Map4k4 protein (SEQ ID NO: 13).

Non-limiting examples of Map4k4 cDNA that encode human, dog, and chicken Map4k4 protein are: human Map4k4 Isoform 1 cDNA (SEQ ID NO: 2), human Map4k4 Isoform 2 cDNA (SEQ ID NO: 4), human Map4k4 isoform 3 cDNA (SEQ ID NO: 6), human Map4k4 isoform 4 cDNA (SEQ ID NO: 8), human Map4k4 isoform 5 cDNA (SEQ ID NO: 10), dog Map4k4 cDNA (SEQ ID NO: 12), and chicken Map4k4 cDNA (SEQ ID NO: 14). In some embodiments, the Map4k4 mRNA contains a sequence that is at least 80% identical (e.g., at least 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical) to SEQ ID NO: 2, 4, 6, 8, 10, 12, or 14. Additional examples of Map4k4 mRNA that encode other endogenous forms of mammalian or avian Map4k4 protein are known in the art.

Methods of Inducing Differentiation of a Myoblast and Inducing Myoblasts/Myocytes to Form a Myotube

Also provided are methods of inducing differentiation of a mammalian (e.g., human, a cow, a horse, or a bison) or avian myoblast into a mammalian or avian myocyte that include contacting a mammalian or avian myoblast with one or more oligonucleotides that decreases Map4k4 mRNA expression in a mammalian or avian myoblast, in an amount sufficient to induce differentiation of the mammalian or avian myoblast into a mammalian or avian myocyte.

Also provided are methods of inducing mammalian or avian myoblasts or myocytes to form a myotube that include contacting two or more mammalian or avian myoblasts and/or two or more mammalian or avian myocytes with one or more oligonucleotides that decrease Map4k4 mRNA expression in a mammalian or avian myoblast or a mammalian or avian myocyte, where the oligonucleotides are administered in an amount sufficient to induce the two or more myoblasts and/or the two or more myocytes to form a myotube.

Also provided are methods of increasing muscle mass in a mammal (e.g., a human, cow, horse, or bison) or avian that include administering to the mammal or avian an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte, in an amount sufficient to increase muscle mass in the mammal or avian. In some embodiments, the oligonucleotide (e.g., any of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte described herein) are formulated as a muscle- promoting neutraceutical (e.g., optionally formulated in combination with one or more additional muscle-promoting agents, such as whey protein, casein, and creatine). An increase in the muscle mass in a mammal or avian can be determined by physical examination of the mammal or avian (e.g., eye observation, imaging techniques, or strength testing). In some embodiments of these methods, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myocyte or mammalian or avian myoblast is self- administered (e.g., by intramuscular, perimuscular, or subcutaneous administration).

In various embodiments of all the methods described herein, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is "synthetic," i.e., is synthesized in vitro. In some embodiments of all the methods described herein, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte contains or consists of one or more (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) modified nucleotides (e.g., one or more different types of modified nucleotides known in the art or described herein).

In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is a small inhibitory or interfering RNA (e.g., siRNA), an antisense oligonucleotide, or a ribozyme (e.g., any of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte described herein).

In some embodiments, the mammal (e.g., human) has been previously diagnosed or is suspected of having a muscle disorder. Non-limiting examples of muscle disorders include muscle atrophy, muscle weakness, myopathy, chronic fatigue syndrome, fibromyalgia, muscular dystrophy (e.g., DMD), fatigue fibromyalgia, spinal muscle atrophy, distal muscular dystrophy, dermatomyositis, polymyositis, rhabdomyolysis, polymyalgia, rheumatica, muscle tears, and claudication. In some embodiments, the mammal is healthy human (e.g., a human that wishes to build muscle mass or strength). In some embodiments, the mammal is a healthy farm animal (e.g., a cow, buffalo, goat, pig, sheep, goat, donkey, yak, llama, or horse). In some embodiments, the avian is a healthy farm animal (e.g., a turkey, a duck, a quail, a pheasant, or a chicken). In some embodiments, the mammal or avian is a healthy farm animal and the mammal or avian is administered an oligonucleotide that decreases Map4k4 mRNA expression in a mammalian or avian myocyte or myoblast in order to the muscle mass in the mammal or avianm and thereby, increase food production. In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myocyte or myoblast can be formulated as a feed (e.g., a veterinary feed).

A mammal or avian can be diagnosed as having a muscle disorder by a medical or veterinary professional by interviewing (when the mammal is a human) and/or physically examining the mammal or avian. In some embodiments, a medical professional may diagnose a human as having a muscle disorder by the observation of one or more symptoms of a muscle disorder. The symptoms experienced by a mammal, e.g., human, or avian, will depend on the specific muscle disorder. Non-limiting examples of symptoms of a muscle disorder include muscle weakness, cramps, pain, paralysis, muscle stiffness, swelling, muscle wasting (atrophy), frequent falls, difficulty getting up from a lying or sitting position, trouble running or jumping, and a waddling gait.

An increase in differentiation of mammalian or avian myoblasts into a mammalian or avian myocyte in a mammal can be indicated by an increase in the function of muscle (e.g., determined through strength testing), or an increase in the density or mass of muscle fibers in a mammal or avian (e.g., observed by imaging techniques or other physical measurements). An increase in differentiation of a mammalian or avian myoblast into a mammalian or avian myocyte in a mammal can also be indicated by a decrease in the number of symptoms and/or a decrease in the frequency and/or severity of one or more of the symptoms of a muscle disorder in a mammal or avian having a muscle disorder (e.g., any of the symptoms described herein). An increase in differentiation of a mammalian or avian myoblast into a mammalian or avian myocyte can also be indicated by a decrease in the expression (protein or mRNA) of myogenic factor 5 (Myf5), and/or an increase in the expression (protein or mRNA) of creatine kinase, Myf5, calsequestrin 1, peptidylarginine deiminase, CD24a, and/or myosin heavy chain (MHF). In some embodiments, differentiation of a myoblast into a myocyte can be observed by a change in the morphology of a myoblast over time (e.g., an increase in cell volume and/or surface area).

An increase in the formation of myotubes can be indicated by an increase in muscle function (e.g., determined by strength testing) and/or an increase in the density or mass of muscle fibers in a mammal or avian (e.g., observed by imaging techniques or other physical measurements). An increase in the formation of myotubes in a mammal or avian can also be indicated by decrease in the number of symptoms and/or a decrease in the frequency and/or severity of one or more of the symptoms of a muscle disorder in a mammal or avian having a muscle disorder (e.g., any of the symptoms described herein). An increase in the formation of myotubes can also be indicated by an increase in the fusion index (an increase in the percentage of nuclei present in MyHC-positive cells compared to the total number of nuclei in a microscopic field).

The mammal or avian may be female or male, and may be an adult or juvenile (e.g., an infant). The mammal or avian may have been previously treated with a muscle disorder therapeutic agent. Where the mammal is an adult, the mammal may be, e.g., between 18 to 20 years old or at least or about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or at least or about 100 years old.

The oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte can be administered by intravenous, intraarterial, subcutaneous, intraperitoneal, intramuscular, ocular, or intrathecal

administration. In some instances, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is administered by local administration to muscle tissue in the mammal. In other instances, the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is systemically delivered to the mammal or avian. Combinations of such treatments are contemplated by the present invention. The oligonucleotides that decrease Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte can be administered by a medical professional (e.g., a physician, a physician's assistant, a nurse, a nurse's assistant, or a laboratory technician) or veterinary professional. Alternatively or in addition, the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian myoblast or a mammalian myocyte can be self-administered by a human, e.g., the patient her/himself. The

oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte can be administered in a hospital, a clinic, a veterinary clinic, a farm, or a primary care facility (e.g., a nursing home), or any combination thereof.

The appropriate amount (dosage) of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte administered can be determined by a medical professional or a veterinary professional based on a number of factors including, but not limited to, the route of administration, the severity of the muscle disorder, the particular muscle disorder, the mammal's responsiveness to other muscle disorder therapeutic agents, the health of the mammal or avian, the mammal's or avian's mass, the other therapies administered to the mammal or avian, the age of the mammal or avian, the sex of the mammal or avian, and any other co-morbidity present in the mammal or avian.

A medical professional or veterinary professional having ordinary skill in the art can readily determine the effective amount of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte that is required. For example, a physician or veterinarian could start with doses of the

oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte (e.g., any of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte described herein) at levels lower than that required to achieve the desired therapeutic effect and then gradually increase the dose until the desired effect is achieved.

In some embodiments, the mammal or avian is administered at a dose of between 1 mg to 500 mg of any of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte described herein (e.g., between 1 mg to 400 mg, between 1 mg to 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 150 mg, between 1 mg and 100 mg, between 1 mg and 50 mg, between 5 mg and 50 mg, between 5 mg and 40 mg, between 10 mg and 400 mg, between 20 mg and 300 mg, or between 50 mg and 250 mg).

In some embodiments, the mammal or avian is further administered an additional muscle disorder therapeutic agent (e.g., an SAID, an immunosuppressive drug, a corticosteroid, and/or a cyclooxygenase inhibitor) and/or a muscle-promoting neutraceutical (e.g., any of the muscle-promoting neutraceuticals described herein. In some embodiments, the mammal or avian is administered a dose of between 1 mg to 500 mg (e.g., each) of at least one additional muscle disorder therapeutic agent or muscle-promoting neutraceutical (e.g., between 1 mg to 400 mg, between 1 mg to 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 150 mg, between 1 mg and 100 mg, between 1 mg and 50 mg, between 5 mg and 50 mg, and between 5 mg and 40 mg). The additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical can be administered to the mammal or avian at substantially the same time as the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte. Alternatively or in addition, the additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical may be administered to the mammal or avian at one or more time points other than the time point at which the oligonucleotide that decreases the expression of Map4k4 mRNA is administered. In some embodiments, the additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical is formulated together with an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte (e.g., using any of the examples of formulations and compositions described herein).

In some embodiments, the additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical is formulated in a first dosage form, and the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is formulated in a second dosage form. In some embodiments where the additional muscle disorder therapeutic agent is formulated in a first dosage form, and the oligonucleotide that decreases the expression of Map4k4 mRNA is formulated in a second dosage form, the first dosage form and the second dosage form can be formulated for the same route of administration (e.g., oral, subcutaneous, intramuscular, intravenous, intaarterial, intrathecal, and intraperitoneal administration) or can be formulated for different routes of administration (e.g., the first dosage form formulated for oral administration and the second dosage form formulated for subcutaneous administration). Combinations of such treatment regimes are clearly contemplated in the present invention.

The amount of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte (and optionally, an additional muscle disorder therapeutic agent) administered will depend on whether the administration is local or systemic. In some embodiments, the mammal or avian is administered more than one dose of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myocyte or mammalian or avian myoblast. In some embodiments, the mammal or avian is administered more than one dose of any of the compositions described herein. In some embodiments, the mammal or avian is administered a dose of an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myocyte or mammalian or avian myoblast at least once a month (e.g., at least twice a month, at least three times a month, at least four times a month, at least once a week, at least twice a week, three times a week, once a day, or twice a day).

In some embodiments, an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is administered to a mammal or avian chronically. In some embodiments, any of the compositions described herein is administered to the mammal or avian chronically. Chronic treatments include any form of repeated administration for an extended period of time, such as repeated

administrations for one or more months, between a month and a year, one or more years, or longer. In some embodiments, chronic treatments can involve regular administrations, for example one or more times a day, one or more times a week, or one or more times a month. In general, a suitable dose such as a daily dose of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avain myoblast or mammalian or avian myocyte will be the amount of the oligonucleotide that is the lowest dose effective to produce a desired therapeutic effect. Such an effective dose will generally depend upon the factors described herein. If desired, the effective daily dose of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte can be administered as two, three, four, five, or six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.

In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is formulated for sustained-release (e.g., formulated in a biodegradable polymer or a nanoparticle). In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is administered in a sustained-release formulation directly into muscle tissue in a mammal or avian (intramuscular or perimuscular injection). In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is provided in a sustained-release formulation, and is administered systemically (e.g., oral, intravenous, intaarterial, intraperitoneal, or subcutaneous administration). In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is formulated for oral, intraglandular, periglandular, subcutaneous, interductal, intramuscular, perimuscular, intraperitoneal, intramuscular, intraarterial, transdermal, interlymphatic, or intravenous administration.

Methods of Treating a Muscle Disorder or Frailty Syndrome

Also provided herein are methods of treating muscle disorder or frailty syndrome in a mammal (e.g., any of the muscle disorders described herein or known in the art). These methods include administering to a mammal in need thereof an oligonucleotide that decreases the expression of a Map4k4 mRNA in a mammalian myocyte or mammalian myoblast (e.g., any of the oligonucleotides that decrease the expression of a Map4k4 mRNA in a mammalian myoblast or mammalian myocyst described herein) in an amount sufficient to treat a muscle disorder or frailty syndrome in the mammal.

In some embodiments of all the methods described herein, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte is "synthetic," i.e., is synthesized in vitro. In some

embodiments of all the methods described herein, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte includes or consists of one or more (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, or 26) modified nucleotides (e.g., one or more different types of modified nucleotides known in the art or described herein).

In some embodiments, the mammal has been previously diagnosed or is suspected of having a muscle disorder (e.g., Duchenne Muscular Dystrophy or any of the other muscle disorders described herein or known in the art). In some embodiments, the mammal has previously been diagnosed or is suspected of having frailty syndrome. The mammal may be female or male, and may be an adult or juvenile (e.g., an infant). Where the mammal is an adult, the mammal may be, e.g., between 18 to 20 years old or at least or about 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or at least or about 100 years old.

A mammal can be diagnosed as having a muscle disorder (e.g., any of the muscle disorders described herein) by a medical professional by observation of one or more symptoms in the mammal (e.g., one or more of any of the symptoms of muscle disorders described herein or known in the art). In some embodiments, the mammal may already be receiving a treatment for a muscle disorder. In some embodiments, the prior treatment for a muscle disorder has been unsuccessful.

A mammal can be diagnosed as having frailty syndrome by a medical professional by observation of one or more symptoms in the mammal (e.g., one or more symptoms selected from the group of unintentional weight loss, self-reported exhaustion, low physical activity, slowed walking speed, muscle atrophy, and muscle weakness). In some embodiments, the mammal may have already received a treatment for frailty disorder. In some embodiments, the prior treatment for frailty disorder has been unsuccessful.

The oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte may be administered by intravenous, intraarterial, subcutaneous, intraperitoneal, interlymphatic, intramuscular, ocular, or intrathecal administration. The oligonucleotide can be formulated using any of the examples of techniques described herein (e.g., formulated for subcutaneous, intravenous, intraarterial, interlymphatic, intramuscular, perimuscular, or intrathecal administration, and/or formulated in a liposome or nanoparticle).

The oligonucleotide that decreases Map4k4 mRNA in a mammalin myoblast or mammalian myocyst can be administered by a medical professional (e.g., a physician, a physician's assistant, a nurse, a nurse's assistant, or a laboratory technician) or veterinary professional. Alternatively or in addition, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyst can be self- administered by a human, e.g., the patient her/himself. The oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalin myoblast or mammalian myocyst can be administered in a hospital, a clinic, or a primary care facility (e.g., a nursing home), or any combination thereof.

In some embodiments, the mammal is administered a dose of between 1 mg to 500 mg of any of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyst described herein (e.g., between 1 mg to 400 mg, between 1 mg to 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 150 mg, between 1 mg and 100 mg, between 1 mg and 50 mg, between 5 mg and 50 mg, and between 5 mg and 40 mg).

Successful treatment of a muscle disorder can be indicated by a decrease in the number of symptoms and/or a decrease in the severity and/or frequency of one or more of the symptoms of a muscle disorder in a mammal (e.g., any of the symptoms described herein). In some embodiments, successful treatment of a muscle disorder can be indicated by an increase in muscle strength in the subject (e.g., determined by strength testing).

Successful treatment of frailty disorder can be indicated by a decrease in the number of symptoms and/or a decrease in the severity and/or frequence of one or more of the symptoms of frailty disorder in a mammal (e.g., any of the symptoms described herein). In some embodiments, successful treatment can be indicated by an increase muscle strength in the subject (e.g., determined by strength testing or exercise (e.g., walking) test).

In some embodiments, the mammal is further administered an additional muscle disorder therapeutic agent (e.g., any of the additional muscle disorder therapeutic agents described herein) and/or a muscle-promoting neutraceutical (e.g., any of the muscle- promoting neutraceuticals described herein). The additional muscle therapeutic agent and/or muscle-promoting neutraceutical can be administered to the mammal at substantially the same time as the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte. Alternatively or in addition, the additional muscle therapeutic agent and/or muscle-promoting neutraceutical can be administered to the mammal at one or more time points other than the time point at which the oligonucleotide that decreases the expression of Map4k4 mRNA is administered. In some embodiments, the additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical is formulated together with an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte (e.g., using any of the examples of formulations and compositions described herein).

In some embodiments, the additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical is formulated in a first dosage form, and the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte is formulated in a second dosage form. In some embodiments where the muscle disorder therapeutic agent and/or muscle-promoting neutraceutical is formulated in a first dosage form, and the oligonucleotide that decreases the expression of Map4k4 mRNA is formulated in a second dosage form, the first dosage form and the second dosage form can be formulated for the same route of administration (e.g., oral, subcutaneous, intramuscular, intravenous, intaarterial, intrathecal, interlymphatic, and intraperitoneal administration) or can be formulated for different routes of administration (e.g., the first dosage form formulated for oral administration and the second dosage form formulated for subcutaneous

administration). Combinations of such treatment regimes are clearly contemplated in the present invention.

As described above, the amount of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myocyte or mammalian myoblast (and optionally, an additional muscle disorder therapeutic agent and/or muscle-promoting neutraceutical) administered will depend on whether the administration is local or systemic. In some embodiments, the mammal is administered more than one dose of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte. In some embodiments, the mammal is administered more than one dose of any of the compositions described herein. In some embodiments, the mammal is administered a dose of an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte at least once a month (e.g., at least twice a month, at least three times a month, at least four times a month, at least once a week, at least twice a week, three times a week, once a day, or twice a day).

In some embodiments, an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte is administered to a mammal chronically. In some embodiments, any of the compositions described herein is administered to the mammal chronically. Chronic treatments include any form of repeated administration for an extended period of time, such as repeated administrations for one or more months, between a month and a year, one or more years, or longer. In some embodiments, chronic treatments can involve regular administrations, for example one or more times a day, one or more times a week, or one or more times a month. In general, a suitable dose such as a daily dose of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte will be the amount of the oligonucleotide that is the lowest dose effective to produce a desired therapeutic effect. Such an effective dose will generally depend upon the factors described herein. If desired, the effective daily dose of the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte an be administered as two, three, four, five, or six or more sub-doses administered separately at appropriate intervals throughout the day, optionally, in unit dosage forms.

In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte is formulated for sustained-release (e.g., formulated in a biodegradable polymer or a nanoparticle). In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte is formulated for sustained-release, and is administered directly into muscle tissue in a mammal (intramuscular or perimuscular administration). In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte is formulated for sustained-release, and is administered systemically (e.g., oral, intravenous, intaarterial, intraperitoneal, interlymphatic, or subcutaneous administration). In some embodiments, the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian myoblast or mammalian myocyte is formulated for oral, intraglandular, periglandular, subcutaneous, interductal, intramuscular, perimuscular, intraperitoneal, intramuscular, intraarterial, transdermal, interlymphatic, or intravenous administration.

Oligonucleotides that Decrease the Expression of Map4k4 mRNA

Non-limiting examples of oligonucleotides that can decrease the expression of

Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte include inhibitory nucleic acids (e.g., small inhibitory nucleic acids (siRNA)), antisense

oligonucleotides, and ribozymes. Examples of aspects of these different oligonucleotides are described below. Any of the examples of oligonucleotides that can decrease expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte can be synthesized in vitro.

Antisense Oligonucleotides

Oligonucleotides that decrease the expression of Map4k4 mRNA expression in a mammalian or avian myoblast or mammalian or avian myocyte include antisense nucleic acid molecules, i.e., nucleic acid molecules whose nucleotide sequence is complementary to all or part of an mRNA based on the sequence of a gene encoding a Map4k4 protein (e.g., complementary to all or a part of SEQ ID NO: 2, 4, 6, 8, 10, 12, or 14). An antisense nucleic acid molecule can be antisense to all or part of a non-coding region of the coding strand of a nucleotide sequence encoding a Map4k4 protein. Non-coding regions (5' and 3' untranslated regions) are the 5' and 3' sequences that flank the coding region in a gene and are not translated into amino acids.

Based upon the sequences disclosed herein, one of skill in the art can easily choose and synthesize any of a number of appropriate antisense molecules to target a Map4k4 gene described herein. For example, a "gene walk" comprising a series of oligonucleotides of 15- 30 nucleotides spanning the length of a Map4k4 gene can be prepared, followed by testing for inhibition of expression of the Map4k4 gene. Optionally, gaps of 5-10 nucleotides can be left between the oligonucleotides to reduce the number of oligonucleotides synthesized and tested. Antisense oligonucleotides targeting Map4k4 can also be designed using the software available at the Integrated DNA Technologies website.

An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides or more in length. An antisense nucleic acid can be constructed using chemical synthesis and enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g., an antisense oligonucleotide) can be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids, e.g., phosphorothioate derivatives and acridine substituted nucleotides can be used.

Examples of modified nucleotides which can be used to generate the antisense nucleic acid include 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl- 2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D- mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5- oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3- N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine. Alternatively, the antisense nucleic acid can be produced biologically using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e., RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following subsection).

The antisense nucleic acid molecules described herein can be prepared in vitro and administered to a mammal, e.g., a human, or avian, e.g., chicken or turkey. Alternatively, they can be generated in situ such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding a Map4k4 protein to thereby inhibit expression, e.g., by inhibiting transcription and/or translation. The hybridization can be by conventional nucleotide complementarities to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of antisense nucleic acid molecules includes direct injection at a tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically. For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface, e.g., by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens. The antisense nucleic acid molecules can also be delivered to cells using the vectors described herein. For example, to achieve sufficient intracellular concentrations of the antisense molecules, vector constructs can be used in which the antisense nucleic acid molecule is placed under the control of a strong pol II or pol III promoter. In some embodiments, the vector used to express the oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myocyte or mammalian or avian myocyte can be a lentivirus, a retrovirus, or an adenovirus vector.

An antisense nucleic acid molecule of the invention can be an a-anomeric nucleic acid molecule. An a-anomeric nucleic acid molecule forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual, β-units, the strands run parallel to each other (Gaultier et al, Nucleic Acids Res. 15:6625-6641, 1987). The antisense nucleic acid molecule can also comprise a 2'-0-methylribonucleotide (Inoue et al, Nucleic Acids Res., 15:6131-6148, 1987) or a chimeric RNA-DNA analog (Inoue et al, FEBS Lett., 215:327-330, 1987).

Antisense molecules that are complementary to all or part of a Map4k4 gene are also useful for assaying expression of a Map4k4 gene using hybridization methods known in the art. For example, the antisense molecule is labeled (e.g., with a radioactive molecule) and an excess amount of the labeled antisense molecule is hybridized to an RNA sample. Unhybridized labeled antisense molecule is removed (e.g., by washing) and the amount of hybridized antisense molecule measured. The amount of hybridized molecule is measured and used to calculate the amount of expression of the Map4k4 mRNA. In general, antisense molecules used for this purpose can hybridize to a sequence from a Map4k4 gene under high stringency conditions such as those described herein. When the RNA sample is first used to synthesize cDNA, a sense molecule can be used. It is also possible to use a double-stranded molecule in such assays as long as the double-stranded molecule is adequately denatured prior to hybridization.

Non-limiting examples of antisense oligonucleotides that decrease Map4k4 mRNA expression in an endothelial cell include: CTTCTCCACTCTCTCCCACA (SEQ ID NO: 15), CCTCTTCTTCCTCACTCCCAC (SEQ ID NO: 16), CTTCTCCACTCTCTCCCAC (SEQ ID NO: 17), GCTTCTCCACTCTCTCCCAC (SEQ ID NO: 18), and GCTTCTCCACTCTC TCCCACA (SEQ ID NO: 19). All antisense sequences are predicted to bind within the 1000-3000 bp region of the Map4k4 gene sequence.

Ribozymes

Also provided are ribozymes that have specificity for sequences encoding a Map4k4 protein described herein (e.g., specificity for a Map4k4 mRNA, e.g., specificity for SEQ ID NO: 2, 4, 6, 8, 10, 12, or 14). Ribozymes are catalytic RNA molecules with ribonuclease activity that are capable of cleaving a single-stranded nucleic acid, such as an mRNA, to which they have a complementary region. Thus, ribozymes (e.g., hammerhead ribozymes (described in Haselhoff and Gerlach, Nature, 334:585-591, 1988)) can be used to

catalytically cleave mRNA transcripts to thereby inhibit translation of the protein encoded by the mRNA. A ribozyme having specificity for a nucleic acid molecule of the invention can be designed based upon the nucleotide sequence of a cDNA disclosed herein. For example, a derivative of a Tetrahymena L-19 IVS RNA can be constructed in which the nucleotide sequence of the active site is complementary to the nucleotide sequence to be cleaved in a Map4k4 mRNA (Cech et al. U.S. Pat. No. 4,987,071; and Cech et al, U.S. Pat.

No. 5, 116,742). Alternatively, a Map4k4 mRNA can be used to select a catalytic RNA having a specific ribonuclease activity from a pool of RNA molecules. See, e.g., Bartel and Szostak, Science, 261 : 141 1-1418, 1993.

Also provided herein are nucleic acid molecules that form triple helical structures. For example, expression of a Map4k4 polypeptide can be inhibited by targeting nucleotide sequences complementary to the regulatory region of the gene encoding the Map4k4 polypeptide (e.g., the promoter and/or enhancer, e.g., a sequence that is at least 1 kb, 2 kb, 3 kb, 4 kb, or 5 kb upstream of the transcription initiation start state) to form triple helical structures that prevent transcription of the gene in target cells. See generally Helene, Anticancer Drug Des. 6(6):569-84, 1991 ; Helene, Ann. N Y. Acad. Sci., 660:27-36, 1992; and Maher, Bioassays, 14(12): 807- 15, 1992.

In various embodiments, nucleic acid molecules (e.g., nucleic acid molecules used to decrease expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte) can be modified at the base moiety, sugar moiety, or phosphate backbone to improve, e.g., the stability, hybridization, or solubility of the molecule. For example, the deoxyribose phosphate backbone of the nucleic acids can be modified to generate peptide nucleic acids (see Hyrup et al, Bioorganic & Medicinal Chem., 4(1): 5-23, 1996). Peptide nucleic acids (PNAs) are nucleic acid mimics, e.g., DNA mimics, in which the deoxyribose phosphate backbone is replaced by a pseudopeptide backbone and only the four natural nucleobases are retained. The neutral backbone of PNAs allows for specific hybridization to DNA and RNA under conditions of low ionic strength. The synthesis of PNA oligomers can be performed using standard solid phase peptide synthesis protocols, e.g., as described in Hyrup et al, 1996, supra; Perry-O'Keefe et al, Proc. Natl. Acad. Sci. USA, 93 : 14670-675, 1996.

PNAs can be used in therapeutic and diagnostic applications. For example, PNAs can be used as antisense or antigene agents for sequence-specific modulation of gene expression by, e.g., inducing transcription or translation arrest or inhibiting replication. PNAs can also be used, e.g., in the analysis of single base pair mutations in a gene by, e.g., PNA directed PCR clamping; as artificial restriction enzymes when used in combination with other enzymes, e.g., SI nucleases (Hyrup, 1996, supra; or as probes or primers for DNA sequence and hybridization (Hyrup, 1996, supra; Perry-O'Keefe et al, Proc. Natl. Acad. Sci. USA, 93: 14670-675, 1996).

PNAs can be modified, e.g., to enhance their stability or cellular uptake, by attaching lipophilic or other helper groups to PNA, by the formation of PNA-DNA chimeras, or by the use of liposomes or other techniques of drug delivery known in the art. For example, PNA- DNA chimeras can be generated which may combine the advantageous properties of PNA and DNA. Such chimeras allow DNA recognition enzymes, e.g., RNAse H and DNA polymerases, to interact with the DNA portion while the PNA portion would provide high binding affinity and specificity. PNA-DNA chimeras can be linked using linkers of appropriate lengths selected in terms of base stacking, number of bonds between the nucleobases, and orientation (Hyrup,1996, supra).

The synthesis of PNA-DNA chimeras can be performed as described in Hyrup, 1996, supra, and Finn et al., Nucleic Acids Res., 24:3357-63, 1996. For example, a DNA chain can be synthesized on a solid support using standard phosphoramidite coupling chemistry and modified nucleoside analogs. Compounds such as 5'-(4-methoxytrityl)amino-5'-deoxy- thymidine phosphoramidite can be used as a link between the PNA and the 5' end of DNA (Mag et al., Nucleic Acids Res., 17:5973-88, 1989). PNA monomers are then coupled in a stepwise manner to produce a chimeric molecule with a 5' PNA segment and a 3' DNA segment (Finn et al, Nucleic Acids Res., 24:3357-63, 1996). Alternatively, chimeric molecules can be synthesized with a 5' DNA segment and a 3' PNA segment (Peterser et al, Bioorganic Med. Chem. Lett., 5: 1 119-1 1124, 1975).

In some embodiments, the oligonucleotide includes other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al, Proc. Natl. Acad. Sci. USA, 86:6553-6556, 1989; Lemaitre et al., Proc. Natl. Acad. Sci. USA, 84:648-652, 1989; WO 88/09810) or the blood-brain barrier (see, e.g., WO 89/10134). In addition, oligonucleotides can be modified with hybridization-triggered cleavage agents (see, e.g., Krol et al, Bio/Techniques, 6:958- 976, 1988) or intercalating agents (see, e.g., Zon, Pharm. Res., 5:539-549, 1988). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc. siRNA

Another means by which expression of a Map4k4 mRNA can be decreased in mammalian or avian myoblasts or mammalian or avian myocytes is by RNA interference (RNAi). RNAi is a process in which mRNA is degraded in host cells. To inhibit an mRNA, double-stranded RNA (dsRNA) corresponding to a portion of the gene to be silenced (e.g., a gene encoding a Map4k4 polypeptide) is introduced into a cell. The dsRNA is digested into 21-23 nucleotide-long duplexes called short interfering RNAs (or siRNAs), which bind to a nuclease complex to form what is known as the RNA-induced silencing complex (or RISC). The RISC targets the homologous transcript by base pairing interactions between one of the siRNA strands and the endogenous mRNA. It then cleaves the mRNA about 12 nucleotides from the 3' terminus of the siRNA (see Sharp et al, Genes Dev. 15:485-490, 2001, and Hammond et al, Nature Rev. Gen., 2: 1 10-1 19, 2001). RNA-mediated gene silencing can be induced in mammalian or avian cells in many ways, e.g., by enforcing endogenous expression of RNA hairpins (see, Paddison et al, Proc. Natl. Acad. Sci. USA, 99: 1443-1448, 2002) or, as noted above, by transfection of small (21- 23 nt) dsRNA (reviewed in Caplen, Trends in Biotech., 20:49-51, 2002). Methods for modulating gene expression with RNAi are described, e.g., in U.S. Patent No. 6,506,559 and U.S. Patent Publication No. 2003/0056235, which are hereby incorporated by reference.

Standard molecular biology techniques can be used to generate siRNAs. Short interfering RNAs can be chemically synthesized, recombinantly produced, e.g., by expressing RNA from a template DNA, such as a plasmid, or obtained from commercial vendors such as Dharmacon. The RNA used to mediate RNAi can include synthetic or modified nucleotides, such as phosphorothioate nucleotides. Methods of transfecting cells with siRNA or with plasmids engineered to make siRNA are routine in the art.

The siRNA molecules used to decrease expression of a Map4k4 mRNA can vary in a number of ways. For example, they can include a 3' hydroxyl group and strands of 21, 22, or 23 consecutive nucleotides. They can be blunt ended or include an overhanging end at either the 3' end, the 5' end, or both ends. For example, at least one strand of the RNA molecule can have a 3' overhang from about 1 to about 6 nucleotides (e.g., 1-5, 1-3, 2-4 or 3-5 nucleotides (whether pyrimidine or purine nucleotides) in length. Where both strands include an overhang, the length of the overhangs may be the same or different for each strand.

To further enhance the stability of the RNA duplexes, the 3' overhangs can be stabilized against degradation (by, e.g., including purine nucleotides, such as adenosine or guanosine nucleotides or replacing pyrimidine nucleotides by modified analogues (e.g., substitution of uridine 2 nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi). Any siRNA can be used in the methods of decreasing Map4k4 mRNA, provided it has sufficient homology to the target of interest (e.g., a sequence present in SEQ ID NO: 2, 4, 6, 8, 10, 12, or 14, e.g., a target sequence encompassing the translation start site or the first exon of the mRNA). There is no upper limit on the length of the siRNA that can be used (e.g., the siRNA can range from about 21 base pairs of the gene to the full length of the gene or more (e.g., 50-60, 60-70, 70-80, 80-90, or 90-100 base pairs).

Non-limiting examples of siRNAs that can be used to decrease Map4k4 mRNA expression in an endothelial cell include: TGCTGTCTGGTGAAGAATTA (SEQ ID NO: 20), GACCAACTCTGGCTTGTTATT (SEQ ID NO: 21), CAGAAGTGGCCAAGGGAAA (SEQ ID NO: 22), AGAAGAAGGTGCA GGTTTA (SEQ ID NO: 23), AGAGAAG

GCAATAGAGATA (SEQ ID NO: 24), GCTTACATCTCCAGGGAAA (SEQ ID NO: 25). SiRNAs that can be used to decrease the expression of Map4k4 mRNA in an endothelial cell can also be purchased from Dharmacon (e.g., SEQ ID NO: 21).

Compositions and Kits

Provided herein are compositions that contain one or more types of oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or a mammalian or avian myocyte (e.g., any of the oligonucleotides that decrease expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte described herein) and an additional muscle disorder therapeutic agent (e.g., any of the examples of muscle disorder therapeutic agents described herein or known in the art) and/or a muscle-promoting neutriceutical (e.g., soy protein, whey protein, creatine, and/or casein). In some embodiments, the composition can contain one or more of: a pharmaceutically acceptable excipient or buffer, an antimicrobial or antifungal agent, or a stabilizing protein (e.g., human serum albumin).

Non-limiting examples of muscle disorder therapeutic agents are NSAIDs, immunosuppressive drugs, corticosteroids, and cyclooxygenase inhibitors (e.g., COX-I inhibitors or cyclooxygenase-II inhibitors). Non-limiting examples of NSAIDs that can be salicylates (e.g., aspirin, diflusinal, and salsalate), propionic acid derivatives (e.g., ibuprofen, dexiboprofen, naproxen, fenoprofen, ketoprofen, dexketoprofen, flurbiprofen, oxaprozin, and loxoprofen), acetic acid derivatives (e.g., indomethacin, sulindac, etodolac, ketorolac, diclofenac, and nabumetone), enolic acid derivatives (e.g., piroxicam, meloxicam, tanoxicam, droxicam, lornoxicam, and isoxicam), fenamic acid derivatives (e.g., mefamic acid, meclofenamic acid, flufenamic acid, and tolfenamic acid), sulphonanilides (e.g., nimesulide), licofelone, and lysine clonixinate. Non-limiting examples of COX-I inhibitors include aspirin, ibuprofen, and naproxen. Non-limiting examples of COX-II inhibitors include celecoxib, valdecoxib, and rofecoxib. Non-limiting examples of corticosteroids include hydrocortisone, cortisone acetate, tixocortol pivalate, prednisolone, methylprednisolone, prednisone, triamcinolone acetonide, triamcinolone alcohol, mometasone, amcinonide, budesonide, desonide, fluocinolone, halcinonide, betamethasone, dexamethasone, and fluocortolone. Non-limiting examples of immunosuppressive drugs include cyclosporine, tacrolimus, and pimecrolimus. Any of the compositions described herein can be formulated as a liquid for systemic administration. In some embodiments, the compositions are formulated for intraarterial, intravenous, interlymphatic, intraperitoneal, intrathecal, ocular, nasal, intramuscular, perimuscular, intraductal, or subcutaneous administration.

In some embodiments, the compositions are formulated as a solid (e.g., as a veterinary feed). In some embodiments, the compositions are formulated for oral or topical (e.g., transdermal) administration. In some embodiments, the compositions are formulated as a suppository.

In some embodiments, the compositions are encapsulated in nanomaterials for targeted delivery (e.g., encapsulated in a nanomaterial having one or more muscle tissue- or cell-targeting molecules on its surface) (e.g., see, examples of muscle-targeted nanoparticles described in U.S. Patent Application Publication No. 2010/0087522; herein incorporated by reference). In some embodiments, the compositions are encapsulated by a nanoparticle that has on its surface molecules that recognize tissue factor (see, e.g., Morawski et al, Magnetic Res. Med. 51 :480-486, 2004). In some embodiments, the compositions are formulated as an emulsion or as a liposome-containing composition. In some embodiments, the compositions are formulated for sustained release (e.g., formulated in a biodegradable polymers or in nanoparticles). In some embodiments, the compositions are formulated in an implantable device that allows for sustained release of the oligonucleotides that decrease the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte, the additional muscle disorder therapeutic agent, and/or the additional muscle-promoting neutraceutical. Such sustained release compositions and devices are commercially available or can be made using known techniques.

Pharmaceutical compositions are formulated to be compatible with their intended route of administration or the intended target tissue, e.g., systemic or local administration. In some embodiments, the composition is delivered muscle tissue in the mammal or avian (by intramuscular or perimuscular injection). In some embodiments, the compositions are formulated for oral, intravenous, intradermal, subcutaneous, transmucosal (e.g., nasal sprays are formulated for inhalation), perimuscular, intramuscular, or transdermal (e.g., topical ointments, salves, gels, patches, or creams as generally known in the art) administration. The compositions can include a sterile diluent (e.g., sterile water or saline), a fixed oil, polyethylene glycol, glycerine, propylene glycol, or other synthetic solvents; antibacterial or antifungal agents, such as benzyl alcohol or methyl parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like; antioxidants, such as ascorbic acid or sodium bisulfite;

chelating agents, such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates, or phosphates; and isotonic agents, such as sugars (e.g., dextrose), polyalcohols (e.g., manitol or sorbitol), or salts (e.g., sodium chloride). Liposomal suspensions can also be used as pharmaceutically acceptable carriers (see, e.g., U.S. Patent No. 4,522,811 ; herein

incorporated by reference). Preparations of the compositions can be formulated and enclosed in ampules, disposable syringes, or multiple dose vials that prevent exposure of the caged tamoxifen or caged tamoxifen derivative molecules to light.

Where required (as in, for example, injectable formulations), proper fluidity can be maintained by, for example, the use of a coating such as lecithin, or a surfactant. Absorption of an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte, an additional muscle disorder therapeutic agent, and/or an additional muscle-promoting neutraceutical can be prolonged by including an agent that delays absorption (e.g., aluminum monostearate and gelatin). Alternatively, controlled release can be achieved by implants and microencapsulated delivery systems, which can include biodegradable, biocompatible polymers (e.g., ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid; Alza Corporation and Nova Pharmaceutical, Inc.).

Where oral administration is intended, the agents can be included in pills, capsules, troches and the like, and can contain any of the following ingredients, or compounds of a similar nature: a binder, such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient, such as starch or lactose; a disintegrating agent, such as alginic acid, Primogel, or corn starch; a lubricant, such as magnesium stearate; a glidant, such as colloidal silicon dioxide; a sweetening agent, such as sucrose or saccharin; or a flavoring agent, such as peppermint, methyl salicylate, or orange flavoring.

The compositions described herein can be formulated for parenteral (e.g., oral) administration in dosage unit form (i.e., physically discrete units containing a predetermined quantity of active compound for ease of administration and uniformity of dosage). Toxicity and therapeutic efficacy of compositions can be determined by standard pharmaceutical procedures in cell cultures or experimental animals. One can, for example, determine the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population), the therapeutic index being the ratio of LD50:ED50. Compositions that exhibit high therapeutic indices are preferred. Where a composition exhibits an undesirable side effect, care should be taken to target the composition to the site of the affected or targeted tissue (the aim being to minimize potential damage to unaffected cells and, thereby, reduce side effects). Toxicity and therapeutic efficacy can be determined by other standard pharmaceutical procedures.

In some embodiments, the compositions described herein are formulated in a single dosage form. In some embodiments, a single dosage of the composition contains between 1 mg to 500 mg, between 1 mg and 400 mg, between 1 mg and 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 100 mg, and between 1 mg and 50 mg of an oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myocyte or mammalian or avian myoblast.

In some embodiments, a single dosage of the composition contains between 1 mg to 500 mg, between 1 mg and 400 mg, between 1 mg and 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 100 mg, and between 1 mg and 50 mg of an anti-inflammatory agent and/or between 1 mg to 500 mg, between 1 mg and 400 mg, between 1 mg and 300 mg, between 1 mg and 250 mg, between 1 mg and 200 mg, between 1 mg and 100 mg, and between 1 mg and 50 mg of an additional muscle disorder therapeutic agent and/or an additional muscle-promoting neutraceutical.

Also provided herein are kits that contain at least one dose of any of the compositions described herein. In some embodiments, the kits can further include an item for use in administering a composition (e.g., any of the compositions described herein) to the mammal or avian (e.g., a syringe, e.g., a pre-filled syringe). In some embodiments, the kits contain one or more doses (e.g., at least two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, twenty, thirty, or forty doses) (e.g., oral or subcutaneous doses) of any of the compositions described herein. In some embodiments, the kit further contains instructions for administering the composition (or a dose of the composition) to a mammal or avian (e.g., a mammal or avian having any of the muscle disorders described herein).

In some embodiments, the kits contain a composition containing at least one type of oligonucleotide that decreases the expression of Map4k4 mRNA in a mammalian or avian myoblast or mammalian or avian myocyte (e.g., any of the oligonucleotides described herein), and a composition containing at least one additional muscle disorder therapeutic agent (e.g., any of the muscle disorder therapeutic agents described herein) and/or a muscle- promoting neutraceutical (e.g., any of the muscle-promoting neutraceuticals described herein or known in the art). In some embodiments, the kit further contains instructions for performing any of the methods described herein.

Screening Methods

Also provided herein are methods of identifying a candidate agent useful for inducing muscle formation in a mammal or avian. These methods include providing a mammalian (e.g., human) or avian myoblast or myocyte, contacting the mammalian or avian myoblast or myocyte with a candidate agent, determining a test level of Map4k4 expression in the mammalian or avian myoblast or myocyte, comparing the test level of Map4k4 expression in the mammalian (e.g., human) or avian myoblast or myocyte to a reference level of Map4k4 expression in a control mammalian (e.g., human) or avian myoblast or myocyte untreated with the candidate agent, and identifying a candidate agent that results in a test level of Map4k4 expression that is lower than the reference level of Map4k4 expression as being useful for inducing muscle formation in a mammal or avian.

In some embodiments, the mammalian (e.g., human) or avian myoblast or myocyte is in vitro. Some embodiments where the mammalian or avian myoblast or myocyte is in vitro further include administering the selected candidate agent to an animal or avian model of a muscle disorder (e.g., any of the animal models of muscle disorders described herein or known in the art). Non-limiting examples of animal models of muscle disorders are described in Acherman, Curr. Rheumatol. Rep. 14:257-263, 2012 (e.g., describing animal models of inflammatory myopathies), and Collins et al, Int. J. Exp. Pathol. 84: 165-172, 2003, and Willmann et al, Neuromuscular Disord. 19:241-249, 2009 (e.g., describing models for Duchenne muscular dystrophy).

In some embodiments, the mammalian or avian myoblast or myocyte is in a mammal or avian, and the contacting is performed by administering the candidate agent to the mammal or avian (e.g., by oral, subcutaneous, intravenous, intraarterial, intraperitoneal, intramuscular, perimuscular, interlymphatic, or intrathecal administration).

In some embodiments, the test level and the reference level of Map4k4 expression is a level of Map4k4 protein (e.g., SEQ ID NO: 1, 3, 5, 7, 9, 11, or 13). In some embodiments, the test level and the reference level of Map4k4 expression is a level of Map4k4 mRNA (mRNA encoding Map4k4 protein, e.g., SEQ ID NO: 2, 4, 6, 8, 10, 12, or 14).

In some embodiments, the reference level of Map4k4 expression is a level of Map4k4 expression of a control, in vitro, mammalian or avian myoblast or myocyte untreated with the candidate agent. In some embodiments, the reference level of Map4k4 expression is a level of Map4k4 expression of a control in vivo mammalian or avian myoblast or myocyte untreated with the candidate agent.

Methods for determining the level of Map4k4 protein expression are known in the art. For example, levels of Map4k4 protein expression can be determined using an antibody or an antigen-binding antibody fragment that binds to a Map4k4 protein (e.g., anti-MAP4K4 antibody from Abeam, Cambridge, MA; and MAP4K4 antibody from Epitomics,

Burlingame, CA). In some embodiments, the amount of Map4k4 protein expression can be determined using an antibody or antigen-binding antibody fragment that binds to Map4k4 protein in an enzyme-linked immunosorbent assay (ELISA).

Methods for determining the level of Map4k4 mRNA expression are also known in the art. For example, levels of Map4k4 mRNA expression can be determined using polymerase chain reaction (PCR) techniques, including reverse transcriptase (RT)-PCR and real-time RT-PCR using primers that are complementary to a Map4k4 mRNA (see, e.g., the examples of Map4k4 mRNAs described herein, e.g., SEQ ID NO: 2, 4, 6, 8, or 10).

Additional sequences for mammalian and avian Map4k4 mRNAs are known in the art.

Some embodiments of these methods further include generating a pharmaceutical composition for inducing muscle formation or treating a muscle disorder or frailty syndrome that includes the candidate agent.

The invention is further described in the following examples, which do not limit the scope of the invention described in the claims.

EXAMPLES

Example 1. Map4k4 is a Regulator of Skeletal Muscle Differentiation and Myotube Formation

Experiments were performed to determine the role of Map4k4 expression and activity on myoblast differentiation into a myocyte, and the formation of myotubes from myocytes and/or myoblasts. These experiments used mouse C2C12 myoblasts as an in vitro model of muscle cell differentiation and myotube formation.

Materials and Methods

Cell culture and transfection. Mouse C2C12 myoblasts (American Type Culture

Collection, Manassas, VA) were cultured in growth medium (GM) consisting of Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin at 37 °C with 5% CO ₂ . Ninety-five percent confluent cells were placed in differentiation medium (DM) consisting of DMEM with 2% horse serum in order to induce differentiation. Multi-nucleated myotubes were evident after 3 days of differentiation. For siRNA transfection, C2C12 myoblasts cultured in growth medium were transfected with 50 pmol siRNA using Lipofectatmine RNAiMAX (Invitrogen) according to the

manufacturer's instructions for reverse transfection in 12-well plates. Twenty-four hours later, the cells were switched to DM and cultured for indicated times before harvesting. To transfect siRNA in differentiated myotubes, siRNA/endoporter complexes were used as described previously (Tesz et al, Biochem. J. 436:351-362, 201 1). Briefly, 50 pmol of siRNA was incubated with 2.5 nmol of endoporter (Gene Tools) in phosphate buffered saline (PBS) for 15 minutes and added to cells in 12-well plates. All siRNA was purchased from Dharmacon (Lafayette, CO). The Map4k4 siRNA used in the experiments was

GACCAACTCTGGCTTGTTATT (SEQ ID NO: 21) and the scrambled control siRNA used in the experiments was CAGTCGCGTTTGCGACTGGTT (SEQ ID NO: 26).

Adenovirus infection. C2C12 myoblasts were grown until 90% confluent, and then infected with GFP control virus, Map4k4 wild type virus, or Map4k4 D 152N virus in the dose of 10 ⁴ virus particles per cell for 18 hours in GM before differentiation. Seventy -two hours post-differentiation, the cells were fixed for immunofluorescence staining or harvested for Western blotting.

Myotube analysis. To analyze myotube nuclei number, the nuclei were counted in approximately 100 randomly-chosen MyHC-positive cells containing three or more nuclei. The myotubes were categorized into three groups (3-6 nuclei, 7-15 nuclei, and more than 15 nuclei per myotube), and the percentage of myotubes with the indicated number of nuclei were calculated. The fusion index was calculated as the ratio of nuclei in MyHC-positive myotubes compared to the total number of nuclei in the field in five random fields. To analyze myotube diameter, five fields were chosen randomly, and three myotubes were measured per field. The average diameter per myotube was calculated as the mean of three measurements taken along the long axis of the myotube.

Western blotting. Cells were solubilized with ice-cold lysis buffer (20 mM HEPES, pH 7.2, 100 mM NaCl, 1 mM EDTA, 100 mM PMSF, 0.01% Triton X-100, 1% SDS, and Halt Protease and Phosphatase Inhibitor Cocktail, EDTA-free (Thermo Scientific)) and protein concentrations was assessed by bicinchoninic acid (BCA) assay (Thermo Scientific). Equal amounts of protein were loaded on 8.5% SDS-polyacrylamide gels, and transferred to nitrocellulose membranes. The following antibodies were used to develop the immunoblot: anti-Map4k4 (Bethal), anti-My£5 (sc-20, Santa Cruz), anti-MyoD (BD Biosciences), anti- Mef2C (Cell Signaling), myogenin F5D (Developmental Studies Hybridoma Bank (DSHB), University of Iowa), sarcomeric myosin heavy chain (MHC) MF20 (DSHB, University of Iowa), anti-phospho-p38 (Cell Signaling), anti-total p38a (Cell Signaling), anti-phospho- p44/42 MAPK (Erkl/2) (Thr202/Tyr204) (Cell Signaling), anti-p44/42 MAPK (Erkl/2) (Santa Cruz), anti-phospho-SAPK/J K (Thrl 83/Tyrl85) (Cell Signaling), and anti-SAPK/ J K (Cell Signaling).

Immunofluorescence microscopy. Cells grown on glass coverslips were fixed with

4% formaldehyde and blocked in PBS containing 2% goat serum (Invitrogen), 1% bovine serum albumin (Sigma), 0.1% Tween 20, and 0.05% Triton X-100 (American Bioanalytical) for 1 hour at room temperature. The cells were then incubated with MF20 mAb against MHC (1 :40, DSHB) for 2.5 hours and subsequently with Alexa 488 or Alexa 594-conjugated secondary antibody (1 :200, Invitrogen) for 1 hour at room temperature. The cells were mounted with ProLong Gold antifade reagent with DAPI (Invitrogen). The images were obtained using a Zeiss Axiovert 200 inverted microscope equipped with a Zeiss AxioCam HR CCD camera.

Creatine kinase activity assay. The cells were lysed in ice-cold lysis buffer. The lysates were centrifuged at 14000xg for 10 minutes at 4°C, and the supernatants were used immediately to perform a creatine kinase (CK) activity assay. CK activity was measured using a spectrophotometric -based kit (Stanbio Laboratory, Boerne, TX, USA) according to the manufacturer's instructions. Specific CK activity was calculated by normalizing the data to the total protein content in the sample.

Statistics. The statistical significance of the differences in the means of experimental groups was determined by two-tailed student's ?-test using Microsoft EXCEL. The data were presented as the means ± standard error of the mean. A p value of < 0.05 was considered significant. Results

Silencing of Map4k4 promotes skeletal muscle differentiation. To explore the function of Map4k4 in myogenic differentiation, Map4k4 expression was decreased in C2C12 myoblasts and the cells were monitored for morphological differences during cell differentiation. siRNA -mediated Map4k4 suppression resulted in significant sustained reduction of Map4k4 protein throughout differentiation, and the formation of larger myotubes was observed as early as 48 hours in differentiation medium (DM) (Figures 1 and 2).

Enhanced muscle cell fusion was also observed in Map4k4-silenced cells on day 3 of differentiation, as there was a shift toward myotubes containing higher numbers of nuclei per myotube (Figure 3), and an increased fusion index (Figure 4). Map4k4 silencing also resulted in a 70% increase of cell diameter in day 3 myotubes (Figure 5), likely due to enhanced myoblast fusion. In addition, myoblast proliferation was not affected by Map4k4 depletion, as indicated by similar nuclei numbers in random microscopic fields, and no change in the percentage of EdU-positive cells when Map4k4 was silenced in myoblasts. These data excludes the possibility that the hypernucleated myotubes with increased size result from an increased number of undifferentiated myoblasts available for the fusion process.

Additional experiments were performed to study the expression of different muscle differentiation markers in cells treated with Map4k4 siRNA. No significant change in the protein level of MyoD was detected in Map4k4-silenced cells when compared to a scrambled siRNA-transfected control during differentiation (Figure 6). However, significant transient increases in myogenin and Mef2C expression were detected in Map4k4-silenced cells at 16 hours and 48 hours of differentiation respectively. The expression of MyHC starts in a certain population of mononuclear myoblasts and rapidly increases with the initiation of myoblast fusion at the late stage of myogenesis (Figure 2). Map4k4 silencing enhanced MyHC expression during C2C12 late differentiation, although the increase was only significant at 48 hours of differentiation with trends toward increased expression observed at later time points (Figures 6 and 7). The activity of MCK, a later marker of skeletal muscle cell differentiation, was increased 45% in Map4k4-silenced cells at day 3 of differentiation (Figure 8). These data suggest that silencing of Map4k4 increases the fusion of myoblasts and promotes skeletal myogenic differentiation.

Inhibition of myogenic differentiation by Map4k4 requires its kinase activity.

Since suppression of Map4k4 expression enhanced skeletal muscle differentiation, the overexpression of Map4k4 was expected to have the opposite effect. To test this hypothesis, adenoviruses expressing GFP control (AdGFP) or wildtype (wt) Map4k4 (AdMap4k4 wt) (Baumgartner et al, Proc. Natl. Acad. Sci. U.S.A. 103 : 13391-13396, 2006) were used to infect C2C12 myoblasts for 18 hours prior to differentiation. Overexpression of wt Map4k4 impeded the formation of MyHC-positive myotubes and myoblast fusion (Figure 9) within 72 hours of placement in differentiation medium. Western blot analysis confirmed that the expression of late myogenic differentiation marker gene MyHC was inhibited in wt Map4k4- overexpressing cells. The effect of a Map4k4 kinase-inactive mutant on myogenic differentiation was also tested. In these experiments, C2C12 myoblasts were infected with adenovirus expressing Map4k4 D152N, a kinase-inactive mutant of Map4k4 (AdMap4k4 D152N) (Baumgartner et al, supra) and induced to differentiate into myotubes for 72 hours. Interestingly, the overexpression of Map4k4 D152N caused the formation of larger myotubes and a substantial increase in myoblast fusion (Figure 9), similar to the results of Map4k4 silencing experiments (Figures 1, 2, and 4). A modest increase in MyHC expression was also observed in Map4k4 D152N-overexpressing cells. These data suggest that the Map4k4 kinase-inactive mutant functions as a dominant-negative mutant possibly by competing with the functional endogenous Map4k4 in C2C12 cells, and that Map4k4 kinase activity is required to repress skeletal muscle differentiation.

Map4k4 does not regulate myogenic differentiation through canonical MAPK signaling pathways. In other systems Map4k4 has been described as an upstream effector in ΓΝΚ, Erk, and p38 signaling pathways. These pathways are also reportedly involved in skeletal muscle differentiation, thus it is possible that Map4k4k regulates myogenic differentiation through these canonical MAPK pathways. To determine the role of these signaling pathways in Map4k4's role in myoblast differentiation and myotube formation, the expression of MAPKs was suppressed by RNAi separately or in combinations of two MAPK isoforms in C2C12 myoblasts, and the myogenic differentiation in these cells was visualized by the formation of MyHC-positive myotubes. If Map4k4 functions upstream in the respective signaling pathway to regulate myogenesis, then silencing of the downstream effectors would result in a similar phenotype as Map4k4 silencing. However, depletion of p38a abolished myogenic differentiation, since few p38a-silencing cells fused into multinuclear myotubes (Figure 10), consistent with the conclusion derived from previous studies that p38a is critical for skeletal myogenesis (Cuenda et al., J. Biol. Chem. 274:4341- 4346, 1999).

Other reports have shown that basal ΓΝΚ activity is essential for the regulation skeletal muscle differentiation, and that inhibition of TNK activation inhibited myogenesis by inducing apoptosis of myoblasts (Khurana et al, J. Muscle Res. Cell Motil. 25:645-655, 2004). ΓΝΚ1 silencing in myoblasts had a minimal effect on myotube formation. However, silencing of J K2 or JNKl/2 in combination inhibited myogenic differentiation as shown by reduced myotube formation (Figure 10). Erkl/2 is essential for myoblast proliferation, is inhibitory to differentiation, and is also required for myocyte fusion. Inhibition of ERK activity early in myogenesis promotes differentiation, whereas later inhibition impedes differentiation (Wu et al, Mol. Cell Biol. 20:3951-3964, 2000). In the present studies, Erkl silencing in C2C12 myoblasts promoted myotube formation, while knockdown of Erk2 resulted in the formation of smaller myotubes. Myotubes differentiated from Erkl and Erk2 double knock-down myoblasts had modestly decreased size compared to the ones differentiated from the scrambled siRNA transfected control (Figure 10). These data show that Map4k4 does not regulate myogenic differentiation through the canonical MAPK pathways. This conclusion was further confirmed by measurement of phosphorylation levels of the MAPKs during differentiaiton. No significant change in phosphorylation of p38a, Erkl/2, or JNKl/2 was observed in Map4k4-silenced cells (Figure B), indicating that Map4k4 failed to regulate their activities during C2C12 differentiation.

Map4k4 mainly functions at early stages of myogenic differentiation. To investigate the stages of myogenic differentiation in which Map4k4 functions, C2C12 cells were transfected with scrambled siRNA or siRNA targeting Map4k4 at multiple stages of differentiation and for variable periods of time, and myotube formation was assessed on day 4 by measuring the fusion index. Ninety percent of Map4k4 proteins were depleted in day 4 myotubes in which Map4k4 siRNA was transfected at different time points. Map4k4 silencing in myoblasts provoked the most robust myotube formation, as the fusion index in Map4k4-silenced cells was 60% higher than in the control cells on day 4 (Figure 12).

Map4k4 suppression in myocytes that are about to enter the late stage of differentiation (day 1) still resulted in larger myotubes and increased myoblast fusion compared to the control cells. However, the promotion of myotube formation was less than that resulted from Map4k4 silencing earlier in myoblasts (Figure 12). When siRNA against Map4k4 was transfected into day 2 myotubes, coincident with onset of terminal differentiation, the myotubes showed even smaller changes in size or fusion compared to the results obtained from Map4k4 suppression in myoblasts and day 1 myocytes (Figure 12). These data indicate that Map4k4 functions in multiple stages of muscle differentiation, but the enhanced myotube formation observed in Map4k4-silenced cells at later stages of differentiation mainly results from an early role that Map4k4 plays at the onset of myogenic differentiation. Map4k4 regulates myogenic differentiation in a Myf 5 -dependent manner. Among the four myogenic regulatory factors, Myf5 and MyoD regulate the early stage of skeletal muscle differentiation. Because no change in MyoD expression was detected in Map4k4-silenced cells during differentiation (Figure 6), we examined the expression of Myf5 by Western blot. Protein levels of Myf5 in cells treated with scrambled siRNA increased in early

differentiation, peaked at 24 hours, and then decreased subsequently. However, silencing of Map4k4 significantly enhanced Myf5 protein expression in undifferentiated myoblasts and myocytes at the early stage of differentiation (Figure 13).

Double knockdown experiments were performed to determine whether the increase in Myf5 protein levels is essential for the enhanced myogenic differentiation that is observed after Map4k4 depletion. In these experiments, Map4k4 and Myf5 expression were simultaneously suppressed in C2C12 myoblasts, and the cellular differentiation was followed by microscopy analysis and Western blot. As expected, single knockdown of Map4k4 promoted myogenic differentiation and Myf5 protein expression (Figure 14). In contrast, Myf5 silencing alone impeded myogenic differentiation as shown by reduced myotube formation, decreased myoblast fusion (Figure 14), and lower expression of myogenin, Mef2C and MyHC during differentiation. Importantly, when compared to Map4k4 suppression alone, smaller myotubes with less fusion and expression of myogenic differentiation factors were observed when Map4k4 and Myf5 were silenced simultaneously (Figure 14), indicating that reduced levels of Myf5 expression partially inhibit Map4k4 silencing-induced myogenic differentiation. These data indicate that Map4k4 regulates skeletal myogenesis at least partially through regulation of expression levels of Myf5.

An additional microarray experiment was performed to determine what other muscle- related genes would be upregulated in response to down-regulation of Map4k4 expression in a myoblast. The resulting data show that down-regulation of Map4k4 expression (through the use of a Map4k4 siRNA) results in an increase in several muscle contraction genes and muscle differentiation genes (Figure 15). These data further indicate that decreasing the expression of Map4k4 in a myoblast can promote differentiation of the myoblast into a myocyte, and the formation of a myotube from a population of myocytes. OTHER EMBODIMENTS

It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.