CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority to U.S. Provisional Patent Application No. 62/659,631, filed April 18, 2018, the disclosure of which is incorporated herein by reference in its entirety.

FIELD

[0002] The disclosures provided herein relate generally to molecular biology and medicine. More particularly, compositions, methods, and systems are provided for editing an LPA gene that encodes the apo(a) protein in a cell genome to modulate the expression, function, or activity of the lipoprotein particle lipoprotein(a) [Lp(a)] in the cell. Some embodiments relate to methods for treating a subject with high levels of Lp(a), e.g., associated with a cardiovascular disease, or risk of developing a cardiovascular disease.

BACKGROUND

[0003] Lipoprotein(a) [Lp(a)] is an atherogenic lipoprotein consisting of the protein apolipoprotein(a) [apo(a)] covalently bound to the apolipoprotein B-100 (apoB) component of a low-density lipoprotein (LDL) particle. The apo(a) protein is encoded by the LPA gene, made in hepatocytes and secreted into circulation. However, while it is known that apo(a) docks to LDL and forms a covalent disulfide bond with apoB to become Lp(a), the precise site of Lp(a) assembly is unknown. This binding of apo(a) to apoB blocks the LDL receptor binding site of apoB and therefore prevents clearance through the LDL receptor pathway. Apo(a) has evolved from the plasminogen gene and contains related protein domains. The apo(a) protein is composed of one kringle V (KV) domain, multiple copies of the kringle IV (KIV) domain, and an inactive protease-like domain, all derived from plasminogen. KIV is broken down into 10 subtypes, with KIVi and KIV3-10 present in 1 copy, and KIV ₂ present in 1 to greater than 40 copies. The size of apo(a) varies between individual humans and is proportional to the number of copies of KIV2, which is genetically determined. Plasma levels of Lp(a) are inversely correlated to the size of the apo(a) protein and this is thought to be a function of slower secretion of larger isoforms. High plasma level of Lp(a) is an independent risk factor for many cardiovascular diseases, including calcific aortic valve disease, coronary heart disease, atherosclerosis, thrombosis, and stroke (reviewed in Kronenberg, F. (2016). Cardiovasc. Drugs Ther., 30( l):87- 100).

[0004] The pathogenic mechanisms of Lp(a) is mediated through its pro-atherogenic, pro- inflammatory, and pro-thrombogenic properties. The combination of apo(a) and the LDL components of Lp(a) results in compounding effects on the cardiovascular system. LDL alone can cause immune and inflammatory responses that characterize atherosclerosis through the entry of LDL into vessel walls where the phospholipids become oxidized. Lp(a) circulates and binds to oxidized phospholipids in the plasma, which causes pro -inflammatory responses. Apo(a) itself contains sites that can bind to exposed surfaces on damaged vessel walls, mediating its entry and accumulation at those locations. Small isoforms of apo(a) have been shown to promote thrombosis by inhibiting fibrinolysis.

[0005] Plasma levels of Lp(a) have been extensively examined in relation to cardiovascular disease and multiple studies have positively associated high Lp(a) levels to higher risk of cardiovascular disease (reviewed in Kronenberg, F. (2016). Cardiovasc. Drugs Ther., 30(l):87- 100). Of interest is the range of plasma Lp(a) levels in humans, which vary by 1000-fold between individuals. This broad range suggests that it may not be detrimental to significantly reduce plasma Lp(a) and therefore potential anti-Lp(a) drugs may have a wide therapeutic window. Unlike LDL, Lp(a) levels cannot be modulated by environment, diet, or existing lipid lowering drugs like statins, making it a strictly genetically-driven disease risk factor. Antisense oligonucleotides against apo(B) were able to reduce Lp(a) by 25% (Santos. R. D. et al. (2015). Arterioscler Thromb Vase Biol, J5(3):689-699). Subsequently, an antisense therapy specifically against the apo(a) mRNA was tested in clinical trials and was shown to significantly decrease plasma Lp(a) levels by over 80% (Viney, N. J. et al. (2016). Lancet, 388(10057): 2239-2253). Unfortunately, antisense therapies require frequent dosing to be efficacious. Due to the scarcity of treatments to reliably and stably lower Lp(a) levels, a therapy that stably reduced over an extended period of time or permanently lowers Lp(a) levels is highly desirable. As hepatocytes are the main source of apo(a), a gene editing approach directed at the liver for“targeted knockout” of apo(a) is an attractive approach. SUMMARY

[0006] In one aspect, provided herein is a system comprising a) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease; and b) a guide RNA (gRNA) comprising a spacer sequence complementary to a target genomic sequence within or near an apolipoprotein(a) ( LPA ) gene, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence. In some embodiments, the gRNA comprises i) a spacer sequence complementary to a target genomic sequence within exon 3 of the LPA gene; ii) a spacer sequence complementary to a target genomic sequence within exon 2 of the LPA gene; iii) a spacer sequence complementary to a target genomic sequence within the LPA gene corresponding to a kringle IV repeat region in apo(a); or iv) a spacer sequence complementary to a target genomic sequence within a regulatory region of the LPA gene. In some embodiments, the gRNA comprises i) a spacer sequence from any one of SEQ ID NOs: 18, 13-17, and 19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 18, 13-17, and 19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20-106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19.

[0007] In some embodiments, according to any of the systems described above, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. In some embodiments, the spacer sequence comprises the nucleotide sequence of any one of SEQ ID NOs: 157-160.

[0008] In some embodiments, according to any of the systems described above, the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of generating a double-strand break at the target genomic sequence in a cell to generate a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell. [0009] In some embodiments, according to any of the systems described above, the system further comprises a donor template comprising a donor cassette comprising a nucleic acid sequence encoding one or more STOP codons, and wherein the DNA endonuclease, gRNA, and donor template are configured such that a complex formed by association of the DNA

endonuclease with the gRNA is capable of promoting targeted integration of the donor cassette into a target genomic locus comprising the target genomic sequence in a cell to generate a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the nucleic acid sequence encoding one or more STOP codons encodes three STOP codons in each of the 3 possible translation frames in the forward orientation and/or three STOP codons in each of the 3 possible translation frames in the reverse orientation.

[0010] In some embodiments, according to any of the systems described above, the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel,

Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0011] In some embodiments, according to any of the systems described above, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell.

[0012] In some embodiments, according to any of the systems described above, the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle also comprises the gRNA or nucleic acid encoding the gRNA.

[0013] In some embodiments, according to any of the systems described above, the system comprises the DNA endonuclease complexed with the gRNA in a ribonucleoprotein (RNP) complex.

[0014] In another aspect, provided herein is a method of editing a genome in a cell, the method comprising providing the following to the cell a) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease; and b) a guide RNA (gRNA) comprising a spacer sequence complementary to a target genomic sequence within or near an

apolipoprotein(a) ( LPA ) gene in the cell, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence in the cell to generate a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell.

[0015] In some embodiments, according to any of the methods of editing a genome in a cell described above, the gRNA comprises i) a spacer sequence complementary to a target genomic sequence within exon 3 of the LPA gene; ii) a spacer sequence complementary to a target genomic sequence within exon 2 of the LPA gene; iii) a spacer sequence complementary to a target genomic sequence within the LPA gene corresponding to a kringle IV repeat region in apo(a); or iv) a spacer sequence complementary to a target genomic sequence within a regulatory region of the LPA gene. In some embodiments, the gRNA comprises i) a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20-106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19.

[0016] In some embodiments, according to any of the methods of editing a genome in a cell described above, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. In some embodiments, the spacer comprises the nucleotide sequence of any one of SEQ ID NOs: 157-160.

[0017] In some embodiments, according to any of the methods of editing a genome in a cell described above, the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of generating a double-strand break at the target genomic sequence in the cell.

[0018] In some embodiments, according to any of the methods of editing a genome in a cell described above, the method further comprises providing to the cell a donor template comprising a donor cassette comprising a nucleic acid sequence encoding one or more STOP codons, and the DNA endonuclease, gRNA, and donor template are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting targeted integration of the donor cassette into a target genomic locus comprising the target genomic sequence in the cell.

[0019] In some embodiments, according to any of the methods of editing a genome in a cell described above, the nucleic acid sequence encoding one or more STOP codons encodes three STOP codons in each of the 3 possible translation frames in the forward orientation and/or three STOP codons in each of the 3 possible translation frames in the reverse orientation.

[0020] In some embodiments, according to any of the methods of editing a genome in a cell described above, the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO,

Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0021] In some embodiments, according to any of the methods of editing a genome in a cell described above, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in the cell.

[0022] In some embodiments, according to any of the methods of editing a genome in a cell described above, the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle also comprises the gRNA or nucleic acid encoding the gRNA.

[0023] In some embodiments, according to any of the methods of editing a genome in a cell described above, the method comprises providing to the cell the DNA endonuclease complexed with the gRNA in an RNP complex.

[0024] In some embodiments, according to any of the methods of editing a genome in a cell described above, one or more additional doses of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell following a first dose of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA. [0025] In some embodiments, according to any of the methods of editing a genome in a cell described above, the cell is a hepatocyte.

[0026] In another aspect, provided herein is a genetically modified cell in which the genome of the cell has been edited by any of the methods described above.

[0027] In another aspect, provided herein is a method of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease in a subject, comprising providing the following to a cell in the subject a) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease; and b) a guide RNA (gRNA) comprising a spacer sequence complementary to a target genomic sequence within or near an apolipoprotein(a) (LPA) gene in the cell, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence in the cell to generate a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell.

[0028] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the gRNA comprises i) a spacer sequence complementary to a target genomic sequence within exon 3 of the LPA gene; ii) a spacer sequence complementary to a target genomic sequence within exon 2 of the LPA gene; iii) a spacer sequence complementary to a target genomic sequence within the LPA gene corresponding to a kringle IV repeat region in apo(a); or iv) a spacer sequence complementary to a target genomic sequence within a regulatory region of the LPA gene. In some embodiments, the gRNA comprises i) a spacer sequence from any one of SEQ ID NOs: 13- 19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20-106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19.

[0029] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. In some embodiments, the spacer comprises the nucleotide sequence of any one of SEQ ID NOs: 157-160.

[0030] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of generating a double-strand break at the target genomic sequence in the cell.

[0031] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the method further comprises providing to the cell a donor template comprising a donor cassette comprising a nucleic acid sequence encoding one or more STOP codons, and wherein the DNA

endonuclease, gRNA, and donor template are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting targeted integration of the donor cassette into a target genomic locus comprising the target genomic sequence in the cell. In some embodiments, the nucleic acid sequence encoding one or more STOP codons encodes three STOP codons in each of the 3 possible translation frames in the forward orientation and/or three STOP codons in each of the 3 possible translation frames in the reverse orientation.

[0032] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0033] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in the cell. [0034] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle also comprises the gRNA or nucleic acid encoding the gRNA.

[0035] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, providing the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA to the cell comprises administering the liposome or lipid nanoparticle to the subject.

[0036] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, providing the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA to the cell comprises administering to the subject an RNP complex comprising the DNA endonuclease and the gRNA.

[0037] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, one or more additional doses of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell following a first dose of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA. In some embodiments, one or more additional doses of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell following a first dose of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA until a) a target frequency of editing the target genomic sequence in a population of cells in the subject is achieved; and/or b) a target plasma level of Lp(a) in the subject is achieved. In some embodiments, the population of cells of a) and/or b) is the hepatocytes in the subject.

[0038] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described above, the cell is a hepatocyte.

[0039] In another aspect, provided herein is a kit comprising one or more elements of the system of any one of claims 1-13, and further comprising instructions for use. [0040] In another aspect, provided herein is a gRNA comprising i) a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20-106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19. In some embodiments, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. In some embodiments, the spacer comprises the nucleotide sequence of any one of SEQ ID NOs: 157-160.

BRIEF DESCRIPTION OF THE DRAWINGS

[0041] An understanding of certain features and advantages of the present disclosure will be obtained by reference to the following detailed description that sets forth illustrative

embodiments, in which the principles of the disclosure are utilized, and the accompanying drawings of which:

[0042] FIG. 1 shows the genomic DNA sequence of human LPA exon 3, with unique gRNA spacer sequences indicated.

[0043] FIG. 2 shows INDEL analysis of 4 LPA exon 3-targeting 19 nucleotide sgRNAs in primary human hepatocyte donor HNN.

[0044] FIG. 3 shows TIDE analysis of cutting efficiency of LPA-T4-l9nt in primary human hepatocyte cells of a single donor.

[0045] FIG. 4 shows an example of a short donor DNA template containing stop codons in all three reading frames, without homology arms.

[0046] FIG. 5A shows INDEL analysis of LPA -targeting sgRNAs in primary human hepatocyte donor ONR.

[0047] FIG. 5B shows INDEL analysis of LPA-targeting sgRNAs in primary human hepatocyte donor BVI.

[0048] FIG. 5C shows INDEL analysis of LPA-targeting sgRNAs in primary human hepatocyte donor HJK. [0049] FIG. 6 shows fold-change in LPA or PLG mRNA for PHHs from donor HJK edited by L/M -targeting sgRNAs, as determined by ddPCR.

DETAILED DESCRIPTION

[0050] High levels of Lp(a) have been associated with increased risk of cardiovascular disease. The present application provides novel methods for modulating Lp(a) to reduce the risk of cardiovascular disease and/or treat cardiovascular disease. The disclosures provide, inter alia, compositions and methods for editing to modulate the expression, function or activity of

Lipoprotein(a) [Lp(a)] in a cell by genome editing. The disclosures also provide, inter alia, compositions and methods for treating a patient with a cardiovascular disease (e.g., calcific aortic valve disease).

[0051] Targeted knockout of a gene can be achieved by using a sequence specific nuclease to generate a double- stranded break in the genomic DNA. Several sequence specific nucleases with the potential to cut eukaryotic genomes, primarily at a single site, are known in the art, i.e., zinc finger nucleases, transcription activator-like effector nucleases (TALEN), MegaTal, and the CRISPR-Cas system. The CRISPR-Cas system has the advantage of enabling a large number of genomic targets to be rapidly screened to identify an optimal CRISPR-Cas design. The CRISPR- Cas system uses an RNA molecule referred to as a guide RNA (gRNA) (including, e.g., a single guide RNA (sgRNA)) that targets an associated Cas endonuclease (for example a Cas9 nuclease) to a specific sequence in DNA. This targeting occurs by Watson-Crick base pairing between the gRNA and the sequence of the genome corresponding to the approximately 20 bp targeting sequence of the gRNA, also referred to as the gRNA spacer. Once bound at a target site, a Cas endonuclease cleaves both strands of the genomic DNA, creating a double-strand break. One requirement for designing a gRNA to target a specific DNA sequence is that the target sequence must contain a protospacer adjacent motif (PAM) sequence at the 3’ end of the target site that is complementary to the gRNA spacer. In the case of a Cas9 nuclease from S. pyogenes (SpCas9), the PAM sequence is NGG (where N is any base). Therefore, gRNA molecules that target any region of the genome can be designed in silico by locating the 20 bp sequence adjacent to all PAM motifs. The NGG PAM motif occurs on average every 15 bp in the genome of eukaryotes. Because gRNAs can be rapidly synthesized in vitro, this enables the rapid screening of all potential gRNA spacer sequences in a given genomic region to identify gRNA spacers that result in efficient cutting. In silico algorithms as well as laboratory experiments can also be used to determine the off-target potential of any given gRNA spacer. While a perfect match to the 20 bp recognition sequence of a gRNA will primarily occur only once in most eukaryotic genomes, there will be a number of additional sites in the genome with 1 or more base pair mismatches to the gRNA. These sites can be cleaved at variable frequencies, which are often not predictable based on the number or location of the mismatches. Cleavage at additional off-target sites that were not identified by the in silico analysis may also occur. Thus, screening a set of gRNAs in a relevant cell type to identify gRNAs that have favorable off-target profiles is a critical component of selecting a gRNA for therapeutic use. A favorable off target profile will take into account not only the number of actual off-target sites and the frequency of cutting at these sites, but also the location in the genome of these sites. For example, off-target sites close to or within functionally important genes, particularly oncogenes or anti-oncogenes, would be considered as less favorable than sites in intergenic regions with no known function. Thus, the identification of optimal gRNAs cannot be predicted simply by in silico analysis of the genomic sequence of an organism, but requires experimental testing. While in silico analysis can be helpful in narrowing down the number of guides to test, it cannot predict guides that have high on-target cutting or predict guides with low off-target cutting. Experimental results in primary human hepatocytes indicate that the cutting efficiency of gRNAs that each has a perfect match to the genome in a region of interest (such as exon 2, exon 3, and regulatory regions of LPA ) varies from 10% to over 60% cutting (FIGS. 5A-5C) and is not predictable by any known algorithm. The ability of a given gRNA to promote cleavage by a Cas endonuclease may relate to the accessibility of that specific site in the genomic DNA, which may be determined by the chromatin structure in that region. While the majority of the genomic DNA in a quiescent, differentiated cell, such as a hepatocyte, exists in highly condensed heterochromatin, regions that are actively transcribed exist in more open chromatin states that are known to be more accessible to large molecules such as proteins like a Cas endonuclease. Even within actively transcribed genes, some specific regions of the DNA are more accessible than others due to the presence or absence of bound transcription factors or other regulatory proteins. Predicting sites in the genome or within a specific genomic locus or region of a genomic locus such as a specific exon, and such as LPA exon 3, is not possible and therefore must be determined experimentally in a relevant cell type.

[0052] When a double-strand break is generated in the genomic DNA of a living cell, the cellular machinery will attempt to repair that break in an effort to maintain genomic integrity and thus the survival of the cell. It is known that double-strand breaks occur relatively frequently and at random locations in most or all of the cells of most organisms, including humans. Most of the time, these breaks are repaired by either of two mechanisms called homology directed repair (HDR) and non-homologous end joining (NHEJ). In HDR a DNA molecule with a closely homologous DNA sequence, such as a sister chromatid, is used as a template to copy into the damaged DNA to affect a perfect correction of the double-strand break. In NHEJ the two ends are directly joined without the use of a homology template. NHEJ is an error-prone process in which a few base pairs are often added or deleted at the site of the break thereby creating changes to the original sequence that are referred to as INDELS (insertions/deletions). If

INDELS are generated within the coding sequence of a gene or within an important regulatory sequence this can result in complete loss of the expression of that gene or changes in the level of expression. However, INDELS that occur in non-coding regions that also play no role in gene regulation will have no impact on genomic function. If an exogenous DNA molecule is supplied in sufficient concentration inside the nucleus of the cell in which the double-strand break occurs, the exogenous DNA may be inserted at the double-strand break during the NHEJ repair process and thus become a permanent addition to the genome. These exogenous DNA molecules are referred to as donor templates. If the donor template contains a coding sequence for a gene of interest together with relevant regulatory sequences such as promoters, enhancers, polyA sequences and/or splice acceptor sequences the gene of interest may be expressed from the integrated copy in the genome resulting in permanent expression for the life of the cell.

Alternatively, a stop codon may be used as part of the template to create a premature stop codon to halt the translation of the gene of interest. Alternatively, a polyadenylation signal may be used as part of the template to force premature termination of transcription resulting in a mRNA that encodes only a portion of the protein coding sequence and thus result in a non-functional protein.

[0053] Particularly desirable is to create double-strand breaks to create insertions or deletions via the natural process of NHEJ and/or introduce a stop codon or a polyadenylation signal at the 5’ end of the coding sequence of the gene in order to have the largest negative impact on expression of the protein. Moreover, the INDELS and/or the integrated copy of the donor DNA template will be transmitted to the daughter cells when the cell divides such that the reduction in expression of the gene is heritable.

[0054] In vivo delivery of a gRNA (e.g., an sgRNA) and a Cas endonuclease (e.g., a Cas9 endonuclease) can be accomplished by various methods. In one method, the gRNA and Cas endonuclease are expressed from an AAV viral vector. In this case, the transcription of the gRNA is driven off a U6 promoter and the Cas mRNA transcription is driven from either a ubiquitous promoter like EF1 -alpha or a liver specific promoter and enhancer, such as the transthyretin promoter/enhancer. The size of the SpCas9 gene (4.4 Kb) precludes inclusion of the SpCas9 and the gRNA cassettes in a single AAV, thereby requiring separate AAV to deliver the gRNA and SpCas9. A disadvantage of using AAV to deliver the gRNA and Cas endonuclease is that expression of the gRNA and Cas endonuclease will be long-lived in the cells that are transduced due to the persistence of AAV genomes for several years that has been demonstrated in animals and humans. Continuous long-term expression of an active nuclease presents a significant genotoxicity safety risk due to the existence of off-target cleavage events. In addition, the AAV genome encoding the Cas9 and gRNA will be a template for genomic integration (e.g., via NHEJ) which is predicted to result in permanent, heritable expression of the Cas

endonuclease and the gRNA. While the number and frequency of off-target cleavage events can be minimized by selection of optimal gRNA sequences, the genotoxic risk from off-target cleavage is amplified by long duration of activity. One approach to prevent continuous expression of a Cas endonuclease or gRNA or both from an AAV vector is to incorporate sequence elements that promote self-inactivation of the viral genome. Including cleavage sites for the gRNA in the vector DNA will result in cleavage of the vector DNA in vivo. By including cleavage sites in locations that will block expression of the Cas endonuclease when cleaved, Cas endonuclease expression can be limited to a shorter period of time. In addition, the cleavage of the AAV episomal genome by the Cas/gRNA complex may result in degradation of the episomal AAV genomes and thus reduce the frequency at which these episomal AAV genomes are integrated into the DNA of the host cell. However, such systems are complex, requiring, for example, that expression of the gRNA and/or Cas endonuclease is blocked in the production cell line used to produce the AAV.

[0055] An alternative approach to deliver a gRNA and a Cas endonuclease to cells in vivo is by non-viral delivery methods. While several non-viral delivery methods for nucleic acids have been tested both in animal models and in humans the most well-developed system is lipid nanoparticles. Lipid nanoparticles (LNPs) are composed of an ionizable cationic lipid and 3 or more additional components, typically cholesterol, DOPE and a Polyethylene Glycol (PEG) containing lipid. The cationic lipid binds to the positively charged nucleic acid forming a dense complex that protects the nucleic from degradation. During passage through a microfluidics system the components self-assemble to form particles with diameters in the size range of 50 nM to 100 nM, in which the nucleic acid is encapsulated in the core complexed with the cationic lipid and surrounded by a lipid bilayer-like structure. After injection into the circulation these particles will generally bind to apolipoprotein E (apoE). ApoE is a ligand for the LDL receptor and mediates uptake into the hepatocytes of the liver via receptor-mediated endocytosis. LNP of this type have been shown to efficiently deliver mRNA and siRNA to the hepatocytes of the liver of rodents, primates and humans. After endocytosis, the LNP are present in endosomes. The encapsulated nucleic acid undergoes a process of endosomal escape mediated by the ionizable nature of the cationic lipid. This delivers the nucleic acid into the cytoplasm where mRNA can be translated into the encoded protein. Encapsulation of gRNA and mRNA encoding a Cas endonuclease into a LNP can efficiently deliver both components to the hepatocytes after IV injection. After endosomal escape, the Cas endonuclease mRNA is translated into Cas protein and may form a complex with the gRNA. Inclusion of one or multiple nuclear localization signals into the Cas endonuclease sequence promotes translocation of the Cas protein/gRNA complex to the nucleus. Alternatively, the small gRNA may be able to cross the nuclear pore complex and form complexes with Cas protein in the nucleus. Once in the nucleus, the gRNA/Cas endonuclease complex will scan the genome for homologous target sites and generate double-strand breaks preferentially at the desired target site in the genome. The half-life of RNA molecules in vivo is short, on the order of hours to days. Similarly, the half-life of proteins tends to be short, on the order of hours to days. Thus, delivery of the gRNA and Cas endonuclease mRNA using an LNP will result in only transient expression and activity of the gRNA/Cas endonuclease complex. This has the advantage of reducing the frequency of off-target cleavage and thus minimizes the risk of genotoxicity. Furthermore, LNPs are less immunogenic than viral particles. While many humans have preexisting immunity to AAV, there is no pre-existing immunity to LNPs. In addition, an adaptive immune response against LNPs is unlikely to occur, which enables repeat dosing of LNPs.

[0056] Several different ionizable cationic lipids have been developed for use in LNPs. These include C12-200 (Love, K. T. et al. (2010). PNAS, 107(5): 1864-1869), MC3, LN16, MD1 among others. In one type of LNP, a GalNac moiety is attached to the outside of the LNP and acts as a ligand for uptake into the liver via the asialyloglycoprotein receptor. Any of these cationic lipids may be used to formulate LNPs for delivery of gRNA and Cas endonuclease mRNA to the liver. [0057] Since there are multiple repeat kringle sequences as well as high homology to plasminogen, a cautious approach needs to be taken to ensure a safe and precise target in an LPA gene is chosen. Examination of the genomic structure of LPA suggests there are several strategies that may result in the successful functional knock out of the gene: 1) using one gRNA that targets a unique exonic sequence (non-kringle domain region) towards the beginning of an LPA gene to create an INDEL, causing a frameshift mutation resulting in a premature stop codon; 2) removing a regulatory region responsible for expression of apo(a) by using two sgRNAs flanking the regulatory region; 3) creating INDELS in multiple kringle domains by using one gRNA that is unique to the kringle domains of an LPA gene and 4) using a DNA donor template to introduce 1 or more stop codons, and ideally 3 stop codons in all three frames, or a polyadenylation signal, into an exon located at the 5’ end of an LPA gene.

DEFINITIONS

[0058] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which the claimed subject matter belongs. It is to be understood that the detailed descriptions are exemplary and explanatory only and are not restrictive of any subject matter claimed. In this application, the use of the singular includes the plural unless specifically stated otherwise. It must be noted that, as used in the specification, the singular forms“a,”“an” and“the” include plural referents unless the context clearly dictates otherwise. In this application, the use of“or” means“and/or” unless stated otherwise. Furthermore, use of the term“including” as well as other forms, such as“include”, “includes,” and“included,” is not limiting.

[0059] Although various features of the disclosures may be described in the context of a single embodiment, the features may also be provided separately or in any suitable combination.

Conversely, although the disclosures may be described herein in the context of separate embodiments for clarity, the disclosures may also be implemented in a single embodiment. Any published patent applications and any other published references, documents, manuscripts, and scientific literature cited herein are incorporated herein by reference for any purpose. In the case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[0060] As used herein, ranges and amounts can be expressed as“about” a particular value or range. About also includes the exact amount. Hence“about 5 pL” means“about 5 pL” and also “5 m L.” Generally, the term“about” includes an amount that would be expected to be within experimental error such as ± 10%.

[0061] When a range of numerical values is presented herein, it is contemplated that each intervening value between the lower and upper limit of the range, the values that are the upper and lower limits of the range, and all stated values with the range are encompassed within the disclosure. All the possible sub-ranges within the lower and upper limits of the range are also contemplated by the disclosure.

[0062] The terms“polypeptide,”“polypeptide sequence,”“peptide,”“peptide sequence,” “protein,”“protein sequence” and“amino acid sequence” are used interchangeably herein to designate a linear series of amino acid residues connected one to the other by peptide bonds, which series may include proteins, polypeptides, oligopeptides, peptides, and fragments thereof. The protein may be made up of naturally occurring amino acids and/or synthetic (e.g., modified or non-naturally occurring) amino acids. Thus“amino acid”, or“peptide residue”, as used herein means both naturally occurring and synthetic amino acids. The terms“polypeptide”,“peptide”, and“protein” includes fusion proteins, including, but not limited to, fusion proteins with a heterologous amino acid sequence, fusions with heterologous and homologous leader sequences, with or without N-terminal methionine residues; immunologically tagged proteins; fusion proteins with detectable fusion partners, e.g., fusion proteins including as a fusion partner a fluorescent protein, b-galactosidase, luciferase, and the like. Furthermore, it should be noted that a dash at the beginning or end of an amino acid sequence indicates either a peptide bond to a further sequence of one or more amino acid residues or a covalent bond to a carboxyl or hydroxyl end group. However, the absence of a dash should not be taken to mean that such peptide bond or covalent bond to a carboxyl or hydroxyl end group is not present, as it is conventional in representation of amino acid sequences to omit such.

[0063] The term“polynucleotide,”“polynucleotide sequence,”“oligonucleotide,”

“oligonucleotide sequence,”“oligomer,”“oligo,”“nucleic acid sequence” or“nucleotide sequence” used interchangeably herein, refer to a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. Thus, this term includes, but is not limited to, single-, double-, or multi- stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or a polymer having purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural, or derivatized nucleotide bases. [0064] The terms“derivative” and“variant” refer without limitation to any compound such as nucleic acid or protein that has a structure or sequence derived from the compounds disclosed herein and whose structure or sequence is sufficiently similar to those disclosed herein such that it has the same or similar activities and utilities or, based upon such similarity, would be expected by one skilled in the art to exhibit the same or similar activities and utilities as the referenced compounds, thereby also interchangeably referred to“functionally equivalent” or as “functional equivalents.” Modifications to obtain“derivatives” or“variants” may include, for example, addition, deletion and/or substitution of one or more of the nucleic acids or amino acid residues.

[0065] The functional equivalent or fragment of the functional equivalent, in the context of a protein, may have one or more conservative amino acid substitutions. The term“conservative amino acid substitution” refers to substitution of an amino acid for another amino acid that has similar properties as the original amino acid. The groups of conservative amino acids are as follows:

[0066] Conservative substitutions may be introduced in any position of a predetermined peptide or fragment thereof. It may however also be desirable to introduce non-conservative substitutions, particularly, but not limited to, a non-conservative substitution in any one or more positions. A non-conservative substitution leading to the formation of a functionally equivalent fragment of the peptide would for example differ substantially in polarity, in electric charge, and/or in steric bulk while maintaining the functionality of the derivative or variant fragment.

[0067] “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide or polypeptide sequence in the comparison window may have additions or deletions (i.e., gaps) as compared to the reference sequence (which does not have additions or deletions) for optimal alignment of the two sequences. In some cases the percentage can be calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.

[0068] The terms“identical” or percent“identity” in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (e.g., 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 99% identity over a specified region, e.g., the entire polypeptide sequences or individual domains of the polypeptides), when compared and aligned for maximum correspondence over a comparison window or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection. Such sequences are then said to be“substantially identical.” This definition also refers to the complement of a test sequence.

[0069] The term“complementary” or“substantially complementary,” interchangeably used herein, means that a nucleic acid (e.g., DNA or RNA) has a sequence of nucleotides that enables it to non-covalently bind, i.e., form Watson-Crick base pairs and/or G/U base pairs to another nucleic acid in a sequence-specific, antiparallel, manner (i.e., a nucleic acid specifically binds to a complementary nucleic acid). As is known in the art, standard Watson-Crick base-pairing includes: adenine (A) pairing with thymidine (T), adenine (A) pairing with uracil (U), and guanine (G) pairing with cytosine (C).

[0070] A DNA sequence that“encodes” a particular RNA is a DNA nucleic acid sequence that is transcribed into RNA. A DNA polynucleotide may encode an RNA (mRNA) that is translated into protein, or a DNA polynucleotide may encode an RNA that is not translated into protein (e.g., tRNA, rRNA, or a guide RNA; also called“non-coding” RNA or“ncRNA”). A“protein coding sequence or a sequence that encodes a particular protein or polypeptide, is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.

[0071] As used herein,“codon” refers to a sequence of three nucleotides that together form a unit of genetic code in a DNA or RNA molecule. As used herein the term“codon degeneracy” refers to the nature in the genetic code permitting variation of the nucleotide sequence without affecting the amino acid sequence of an encoded polypeptide. [0072] The term“codon-optimized” or“codon optimization” refers to genes or coding regions of nucleic acid molecules for transformation of various hosts, refers to the alteration of codons in the gene or coding regions of the nucleic acid molecules to reflect the typical codon usage of the host organism without altering the polypeptide encoded by the DNA. Such optimization includes replacing at least one, or more than one, or a significant number, of codons with one or more codons that are more frequently used in the genes of that organism. Codon usage tables are readily available, for example, at the“Codon Usage Database” available at

www.kazusa.or.jp/codon/. By utilizing the knowledge on codon usage or codon preference in each organism, one of ordinary skill in the art can apply the frequencies to any given polypeptide sequence, and produce a nucleic acid fragment of a codon-optimized coding region which encodes the polypeptide, but which uses codons optimal for a given species. Codon-optimized coding regions can be designed by various methods known to those skilled in the art.

[0073] The term“recombinant” or“engineered” when used with reference, for example, to a cell, a nucleic acid, a protein, or a vector, indicates that the cell, nucleic acid, protein or vector has been modified by or is the result of laboratory methods. Thus, for example, recombinant or engineered proteins include proteins produced by laboratory methods. Recombinant or engineered proteins can include amino acid residues not found within the native (non

recombinant or wild-type) form of the protein or can be include amino acid residues that have been modified, e.g., labeled. The term can include any modifications to the peptide, protein, or nucleic acid sequence. Such modifications may include the following: any chemical

modifications of the peptide, protein or nucleic acid sequence, including of one or more amino acids, deoxyribonucleotides, or ribonucleotides; addition, deletion, and/or substitution of one or more of amino acids in the peptide or protein; and addition, deletion, and/or substitution of one or more of nucleic acids in the nucleic acid sequence.

[0074] The term“genomic DNA” or“genomic sequence” refers to the DNA of a genome of an organism including, but not limited to, the DNA of the genome of a bacterium, fungus, archea, plant or animal.

[0075] As used herein,“transgene,”“exogenous gene” or“exogenous sequence,” in the context of nucleic acid, refers to a nucleic acid sequence or gene that was not present in the genome of a cell but artificially introduced into the genome, e.g., via genome-edition. [0076] As used herein,“endogenous gene” or“endogenous sequence,” in the context of nucleic acid, refers to a nucleic acid sequence or gene that is naturally present in the genome of a cell, without being introduced via any artificial means.

[0077] The term“vector” or“expression vector” means a replicon, such as plasmid, phage, virus, or cosmid, to which another DNA segment, i.e., an“insert”, may be attached so as to bring about the replication of the attached segment in a cell.

[0078] The term“expression cassette” refers to a vector having a DNA coding sequence operably linked to a promoter.“Operably linked” refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. The terms“recombinant expression vector,” or“DNA construct” are used interchangeably herein to refer to a DNA molecule having a vector and at least one insert. Recombinant expression vectors are usually generated for the purpose of expressing and/or propagating the insert(s), or for the construction of other recombinant nucleotide sequences. The nucleic acid(s) may or may not be operably linked to a promoter sequence and may or may not be operably linked to DNA regulatory sequences.

[0079] The term "operably linked" means that the nucleotide sequence of interest is linked to regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence. The term "regulatory sequence" is intended to include, for example, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Such regulatory sequences are well known in the art and are described, for example, in Goeddel, D. V. (Ed.) (1990). Gene

Expression Technology: Methods in Enzymology, (Vol. 185) San Diego, CA: Academic Press. Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cells, and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the target cell, the level of expression desired, and the like.

[0080] A cell has been“genetically modified” or“transformed” or“transfected” by exogenous DNA, e.g., a recombinant expression vector, when such DNA has been introduced inside the cell. The presence of the exogenous DNA results in permanent or transient genetic change. The transforming DNA may or may not be integrated (covalently linked) into the genome of the cell. The genetically modified (or transformed or transfected) cells that have therapeutic activity, e.g., treating cardiovascular disease, can be used and referred to as therapeutic cells.

[0081] The term“concentration” used in the context of a molecule such as peptide fragment refers to an amount of molecule, e.g., the number of moles of the molecule, present in a given volume of solution.

[0082] The terms“individual,”“subject” and“host” are used interchangeably herein and refer to any subject for whom diagnosis, treatment or therapy is desired. In some aspects, the subject is a mammal. In some aspects, the subject is a human being. In some aspects, the subject is a human patient. In other aspects, a subject is a companion animal, such as a dog, cat, or bird while in still other aspects the subject is a farm animal, such as a horse, cow, sheep, goat, or pig. In some aspects, the subject can have or is suspected of having a cardiovascular disease and/or has one or more symptoms of a cardiovascular disease. In some aspects, the subject is a human who is diagnosed with a risk of cardiovascular disease at the time of diagnosis or later. In some cases, the diagnosis with a risk of cardiovascular disease can be determined based on the presence of one or more mutations in an endogenous apolipoprotein(a) ( LPA ) gene or genomic sequence near the LPA gene in the genome that may affect the expression of the apo(a) protein.

[0083] The term“treatment” used referring to a disease or condition means that at least an amelioration of the symptoms associated with the condition afflicting an individual is achieved, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, e.g., a symptom, associated with the condition (e.g., a cardiovascular disease) being treated. As such, treatment also includes situations where the pathological condition, or at least symptoms associated therewith, are completely inhibited, e.g., prevented from happening, or eliminated entirely such that the host no longer suffers from the condition, or at least the symptoms that characterize the condition. Thus, treatment includes: (i) prevention, that is, reducing the risk of development of clinical symptoms, including causing the clinical symptoms not to develop, e.g., preventing disease progression; (ii) inhibition, that is, arresting the development or further development of clinical symptoms, e.g., mitigating or completely inhibiting an active disease.

[0084] The terms“effective amount,”“pharmaceutically effective amount,” or“therapeutically effective amount” as used herein mean a sufficient amount of the composition to provide the desired utility when administered to a subject having a particular condition. In the context of in vivo treatment of a cardiovascular disease in a subject (e.g., patient) or genome edition done in a cell cultured in vitro, an effective amount refers to an amount of components used for genome edition such as gRNA, donor template and/or a site-directed polypeptide (e.g., DNA

endonuclease) needed to edit the genome of the cell in the subject or the cell cultured in vitro. It is understood that for any given case, an appropriate“effective amount” can be determined by one of ordinary skill in the art using routine experimentation.

[0085] The term“pharmaceutically acceptable excipient” as used herein refers to any suitable substance that provides a pharmaceutically acceptable carrier, additive or diluent for

administration of a compound(s) of interest to a subject.“Pharmaceutically acceptable excipient” can encompass substances referred to as pharmaceutically acceptable diluents, pharmaceutically acceptable additives, and pharmaceutically acceptable carriers.

SYSTEMS FOR GENOME EDITING AT AN LPA GENE

[0086] Provided herein are systems for editing an LPA gene (including, e.g., LPA gene variants associated with increased cardiovascular disease risk and/or increased Lp(a) expression) that encodes the apo(a) protein in a cell genome to modulate (e.g., decrease) the expression, function, or activity of the lipoprotein particle lipoprotein(a) [Lp(a)] in the cell. The term“LPA gene” as used herein includes the genomic region encompassing the LPA regulatory promoters and enhancer sequences as well as the coding sequence. The disclosures also provide, inter alia, systems for treating a subject having or suspected of having a disorder or health condition associated with Lp(a), employing in vivo genome editing. In some embodiments, the subject has or is suspected of having a cardiovascular disease.

[0087] In some embodiments, provided herein is a system comprising (a) a deoxyribonucleic acid (DNA) endonuclease (e.g., a Cas endonuclease, such as Cas9) or nucleic acid encoding the DNA endonuclease; and (b) a guide RNA (gRNA) comprising a spacer sequence complementary to a target genomic sequence within or near an apolipoprotein(a) (LPA) gene, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence, such as INDELs generated during repair (e.g., NHEJ-mediated repair) of a double-strand break introduced by the DNA endonuclease/gRNA complex, or integration of a heterologous sequence contained in a donor template (e.g., by HDR- or NHEJ-mediated processes). Accordingly, in some embodiments, the system further comprises a donor template comprising a nucleic acid sequence to be inserted into the LPA gene. In some embodiments, the nucleic acid sequence to be inserted encodes one or more STOP codons, and the system is configured to insert a STOP codon in-frame into an LPA gene coding sequence such that the LPA gene is rendered non-functional. In some embodiments, the gRNA targets within or near a coding sequence in the LPA gene. In some embodiments, the gRNA targets exon 1, exon 2, or exon 3 of the LPA gene. In some embodiments, the gRNA targets a sequence in the LPA gene corresponding to a kringle IV repeat region in the apo(a) protein. In some

embodiments, the gRNA targets within or near a non-coding sequence in the LPA gene. In some embodiments, the gRNA targets an LPA gene intron. In some embodiments, the gRNA targets an LPA gene regulatory region. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 1-132. In some embodiments, the DNA endonuclease is a Cas endonuclease, e.g., a Cas9 nuclease. In some embodiments, the gRNA is an sgRNA.

[0088] In some embodiments, provided herein is a system comprising (a) a DNA endonuclease (e.g., a Cas endonuclease, such as Cas9) or nucleic acid encoding the DNA endonuclease; and (b) a gRNA comprising i) a spacer sequence complementary to a target genomic sequence within exon 3 of an LPA gene; ii) a spacer sequence complementary to a target genomic sequence within exon 2 of an LPA gene; iii) a spacer sequence complementary to a target genomic sequence within an LPA gene corresponding to a kringle IV repeat region in apo(a); or iv) a spacer sequence complementary to a target genomic sequence within a regulatory region of an LPA gene, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence. In some embodiments, the gRNA comprises i) a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20- 106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19. In some embodiments, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. For example, in some embodiments, the spacer sequence is the nucleotide sequence of any one of SEQ ID NOs: 157-160. In some embodiments, the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of generating a double-strand break at the target genomic sequence. The generation of a double strand break at the target genomic sequence in a cell can lead to the generation of a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell. For example, imperfect repair (e.g., mediated by NHEJ) of the double-strand break can lead to small nucleotide insertions or deletions (INDELs) in the target genomic sequence. Introduction of INDELs into an LPA gene coding sequence can result in a frameshift mutation that renders the translation product non-functional or having reduced function as compared to the apo(a) protein encoded by the unmodified LPA gene.

[0089] In some embodiments, according to any of the systems described herein, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 14 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 15 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 18 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 19 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 19. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 19. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 19. [0090] In some embodiments, according to any of the systems described herein, the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel,

Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0091] In some embodiments, according to any of the systems described herein, the system comprises a nucleic acid encoding the DNA endonuclease. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a host cell. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in a human cell. In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA, such as a DNA plasmid. In some embodiments, the nucleic acid encoding the DNA endonuclease is RNA, such as mRNA.

[0092] In some embodiments, according to any of the systems described herein, the system further comprises a donor template comprising a sequence to be integrated at or near the target genomic sequence. In some embodiments, the donor template comprises a donor cassette comprising a nucleic acid sequence encoding one or more STOP codons. In some embodiments, the nucleic acid sequence encoding one or more STOP codons encodes three STOP codons in each of the 3 possible translation frames in the forward orientation and/or three STOP codons in each of the 3 possible translation frames in the reverse orientation. An exemplary sequence encoding three STOP codons in each of the 3 possible translation frames in both the forward and reverse orientations is provided in SEQ ID NO: 155. In some embodiments, the DNA

endonuclease, gRNA, and donor template are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting targeted integration of the donor cassette into a target genomic locus (e.g., a coding region) comprising the target genomic sequence. In some embodiments, integration of the donor cassette into the target genomic locus in a cell results in the generation of a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell. For example, integration of the donor template into an LPA gene coding sequence such that a premature STOP codon is inserted in-frame can result in a non-functional or reduced function truncated translation product as compared to the apo(a) protein encoded by the unmodified LPA gene.

[0093] In some embodiments, according to any of the systems described herein comprising a donor template, the donor template is configured such that the donor cassette is capable of being integrated into a genomic locus targeted by a gRNA in the system by homology directed repair (HDR). In some embodiments, the donor cassette is flanked on both sides by homology arms corresponding to sequences in the targeted genomic locus. In some embodiments, the homology arms are at least about 0.2 kb (such as at least about any of 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, or greater) in length. In some embodiments, the homology arms are at least about 0.4 kb, e.g., 0.45 kb, 0.6 kb, or 0.8 kb, in length. In some embodiments, the donor template is encoded in an Adeno Associated Virus (AAV) vector. In some embodiments, the AAV vector is an AAV2, AAV5, or AAV6 vector. In some embodiments, the AAV vector is an AAV6 vector.

[0094] In some embodiments, according to any of the systems described herein comprising a donor template, the donor template is configured such that the donor cassette is capable of being integrated into a genomic locus targeted by a gRNA in the system by non-homologous end joining (NHEJ). In some embodiments, the donor cassette is flanked on one or both sides by a gRNA target site. In some embodiments, the donor cassette is flanked on both sides by a gRNA target site. In some embodiments, the gRNA target site is a target site for a gRNA in the system. In some embodiments, the gRNA target site of the donor template is the reverse complement of a cell genome gRNA target site for a gRNA in the system. In some embodiments, the donor template is encoded in an Adeno Associated Virus (AAV) vector. In some embodiments, the AAV vector is an AAV2, AAV5, or AAV6 vector. In some embodiments, the AAV vector is an AAV6 vector.

[0095] In some embodiments, according to any of the systems described herein, the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle also comprises the gRNA or nucleic acid encoding the gRNA. In some embodiments, the liposome or lipid nanoparticle is a lipid nanoparticle. In some embodiments, the system comprises a lipid nanoparticle comprising nucleic acid encoding the DNA endonuclease and the gRNA. In some embodiments, the nucleic acid encoding the DNA endonuclease is an mRNA encoding the DNA endonuclease. [0096] In some embodiments, according to any of the systems described herein, the DNA endonuclease is complexed with the gRNA, forming a ribonucleoprotein (RNP) complex.

[0097] In some embodiments, according to any of the systems described herein, an LPA gene targeted for editing is a variant associated with increased cardiovascular disease risk and/or increased Lp(a) expression.

NUCLEIC ACIDS

Genome-targeting Nucleic Acid or Guide RNA

[0098] The present disclosure provides a genome-targeting nucleic acid that can direct the activities of an associated polypeptide (e.g., a site-directed polypeptide or DNA endonuclease) to a specific target sequence within a target nucleic acid. In some embodiments, the genome targeting nucleic acid is an RNA. A genome-targeting RNA is referred to as a“guide RNA” or “gRNA” herein. A guide RNA has at least i) a spacer sequence that can hybridize to a target nucleic acid sequence of interest and ii) a CRISPR repeat sequence. In Type II systems, the gRNA also has a second RNA called the tracrRNA sequence. In the Type II guide RNA (gRNA), the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex. In the Type V guide RNA (gRNA), the crRNA forms a duplex. In both systems, the duplex binds a site-directed polypeptide such that the guide RNA and site-direct polypeptide form a complex. The genome-targeting nucleic acid provides target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid thus directs the activity of the site-directed polypeptide.

[0099] In some embodiments, the genome-targeting nucleic acid is a double-molecule guide RNA. In some embodiments, the genome-targeting nucleic acid is a single-molecule guide RNA. A double-molecule guide RNA has two strands of RNA. The first strand has in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence. The second strand has a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3’ tracrRNA sequence and an optional tracrRNA extension sequence. A single-molecule guide RNA (sgRNA) in a Type II system has, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3’ tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension may have elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension has one or more hairpins. A single-molecule guide RNA (sgRNA) in a Type V system has, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence.

[0100] By way of illustration, guide RNAs used in the CRISPR/Cas/Cpfl system, or other smaller RNAs can be readily synthesized by chemical means as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 or Cpfl endonuclease, are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art.

Spacer Extension Sequence

[0101] In some embodiments of genome-targeting nucleic acids, a spacer extension sequence can modify activity, provide stability and/or provide a location for modifications of a genome targeting nucleic acid. A spacer extension sequence can modify on- or off-target activity or specificity. In some embodiments, a spacer extension sequence is provided. A spacer extension sequence can have a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides. A spacer extension sequence can have a length of about 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, or 7000 or more nucleotides. A spacer extension sequence can have a length of less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400, 1000, 2000, 3000, 4000, 5000, 6000, 7000 or more nucleotides. In some embodiments, a spacer extension sequence is less than 10 nucleotides in length. In some embodiments, a spacer extension sequence is between 10-30 nucleotides in length. In some embodiments, a spacer extension sequence is between 30-70 nucleotides in length. [0102] In some embodiments, the spacer extension sequence has another moiety (e.g., a stability control sequence, an endoribonuclease binding sequence, a ribozyme). In some embodiments, the moiety decreases or increases the stability of a nucleic acid targeting nucleic acid. In some embodiments, the moiety is a transcriptional terminator segment (i.e., a

transcription termination sequence). In some embodiments, the moiety functions in a eukaryotic cell. In some embodiments, the moiety functions in a prokaryotic cell. In some embodiments, the moiety functions in both eukaryotic and prokaryotic cells. Non-limiting examples of suitable moieties include: a 5' cap (e.g., a 7-methylguanylate cap (m7 G)), a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA demethylases, histone acetyltransferases, histone deacetylases, and the like).

Spacer Sequence

[0103] The spacer sequence hybridizes to a sequence in a target nucleic acid of interest. The spacer of a genome-targeting nucleic acid interacts with a target nucleic acid in a sequence- specific manner via hybridization (i.e., base pairing). The nucleotide sequence of the spacer thus varies depending on the sequence of the target nucleic acid of interest.

[0104] In a CRISPR/Cas system herein, the spacer sequence is designed to hybridize to a target nucleic acid that is located 5' of a PAM of a Cas endonuclease used in the system. The spacer can perfectly match the target sequence or can have mismatches. Each Cas endonuclease has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes recognizes in a target nucleic acid a PAM that has the sequence 5'-NRG-3', where R has either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

[0105] In some embodiments, the target nucleic acid sequence has 20 nucleotides. In some embodiments, the target nucleic acid has less than 20 nucleotides. In some embodiments, the target nucleic acid has more than 20 nucleotides. In some embodiments, the target nucleic acid has at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid has at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence has 20 bases immediately 5' of the first nucleotide of the PAM. For example, in a sequence having 5'- NNNNNNNNNNNNNNNNNNNNNRG- 3 ' (SEQ ID NO: 156), the target nucleic acid has the sequence that corresponds to the Ns, wherein N is any nucleotide, and the underlined NRG sequence (R is G or A) is the Streptococcus pyogenes Cas9 PAM. In some embodiments, the PAM sequence used in the compositions and methods of the present disclosure as a sequence recognized by S.p. Cas9 is NGG.

[0106] In some embodiments, the spacer sequence that hybridizes to the target nucleic acid has a length of at least about 6 nucleotides (nt). The spacer sequence can be at least about 6 nt, about 10 nt, about 15 nt, about 18 nt, about 19 nt, about 20 nt, about 25 nt, about 30 nt, about 35 nt or about 40 nt, from about 6 nt to about 80 nt, from about 6 nt to about 50 nt, from about 6 nt to about 45 nt, from about 6 nt to about 40 nt, from about 6 nt to about 35 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 19 nt, from about 10 nt to about 50 nt, from about 10 nt to about 45 nt, from about 10 nt to about 40 nt, from about 10 nt to about 35 nt, from about 10 nt to about 30 nt, from about 10 nt to about 25 nt, from about 10 nt to about 20 nt, from about 10 nt to about 19 nt, from about 19 nt to about 25 nt, from about 19 nt to about 30 nt, from about 19 nt to about 35 nt, from about 19 nt to about 40 nt, from about 19 nt to about 45 nt, from about 19 nt to about 50 nt, from about 19 nt to about 60 nt, from about 20 nt to about 25 nt, from about 20 nt to about 30 nt, from about 20 nt to about 35 nt, from about 20 nt to about 40 nt, from about 20 nt to about 45 nt, from about 20 nt to about 50 nt, or from about 20 nt to about 60 nt. In some embodiments, the spacer sequence has 20 nucleotides. In some embodiments, the spacer has 19 nucleotides. In some embodiments, the spacer has 18 nucleotides. In some embodiments, the spacer has 17 nucleotides. In some embodiments, the spacer has 16 nucleotides. In some embodiments, the spacer has 15

nucleotides.

[0107] In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 97%, at least about 98%, at least about 99%, or 100%. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at most about 30%, at most about 40%, at most about 50%, at most about 60%, at most about 65%, at most about 70%, at most about 75%, at most about 80%, at most about 85%, at most about 90%, at most about 95%, at most about 97%, at most about 98%, at most about 99%, or 100%. In some embodiments, the percent

complementarity between the spacer sequence and the target nucleic acid is 100% over the six contiguous 5'-most nucleotides of the target sequence of the complementary strand of the target nucleic acid. In some embodiments, the percent complementarity between the spacer sequence and the target nucleic acid is at least 60% over about 20 contiguous nucleotides. In some embodiments, the length of the spacer sequence and the target nucleic acid can differ by 1 to 6 nucleotides, which can be thought of as a bulge or bulges.

[0108] In some embodiments, the spacer sequence is designed or chosen using a computer program. The computer program can use variables, such as predicted melting temperature, secondary structure formation, predicted annealing temperature, sequence identity, genomic context, chromatin accessibility, % GC, frequency of genomic occurrence (e.g., of sequences that are identical or are similar but vary in one or more spots as a result of mismatch, insertion or deletion), methylation status, presence of SNPs, and the like.

Minimum CRISPR Repeat Sequence

[0109] In some embodiments, a minimum CRISPR repeat sequence is a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference CRISPR repeat sequence (e.g., crRNA from S. pyogenes).

[0110] In some embodiments, a minimum CRISPR repeat sequence has nucleotides that can hybridize to a minimum tracrRNA sequence in a cell. The minimum CRISPR repeat sequence and a minimum tracrRNA sequence form a duplex, i.e., a base-paired double-stranded structure. Together, the minimum CRISPR repeat sequence and the minimum tracrRNA sequence bind to the site-directed polypeptide. At least a part of the minimum CRISPR repeat sequence hybridizes to the minimum tracrRNA sequence. In some embodiments, at least a part of the minimum CRISPR repeat sequence has at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum tracrRNA sequence. In some embodiments, at least a part of the minimum CRISPR repeat sequence has at most about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum tracrRNA sequence.

[0111] The minimum CRISPR repeat sequence can have a length from about 7 nucleotides to about 100 nucleotides. For example, the length of the minimum CRISPR repeat sequence is from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some embodiments, the minimum CRISPR repeat sequence is approximately 9 nucleotides in length. In some

embodiments, the minimum CRISPR repeat sequence is approximately 12 nucleotides in length.

[0112] In some embodiments, the minimum CRISPR repeat sequence is at least about 60% identical to a reference minimum CRISPR repeat sequence (e.g., wild-type crRNA from S.

pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum CRISPR repeat sequence is at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical or 100% identical to a reference minimum CRISPR repeat sequence over a stretch of at least 6,

7, or 8 contiguous nucleotides.

Minimum tracrRNA Sequence

[0113] In some embodiments, a minimum tracrRNA sequence is a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., wild type tracrRNA from S. pyogenes).

[0114] In some embodiments, a minimum tracrRNA sequence has nucleotides that hybridize to a minimum CRISPR repeat sequence in a cell. A minimum tracrRNA sequence and a minimum CRISPR repeat sequence form a duplex, i.e., a base-paired double-stranded structure. Together, the minimum tracrRNA sequence and the minimum CRISPR repeat bind to a site-directed polypeptide. At least a part of the minimum tracrRNA sequence can hybridize to the minimum CRISPR repeat sequence. In some embodiments, the minimum tracrRNA sequence is at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% complementary to the minimum CRISPR repeat sequence.

[0115] The minimum tracrRNA sequence can have a length from about 7 nucleotides to about 100 nucleotides. For example, the minimum tracrRNA sequence can be from about 7 nucleotides (nt) to about 50 nt, from about 7 nt to about 40 nt, from about 7 nt to about 30 nt, from about 7 nt to about 25 nt, from about 7 nt to about 20 nt, from about 7 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt or from about 15 nt to about 25 nt long. In some embodiments, the minimum tracrRNA sequence is approximately 9 nucleotides in length. In some embodiments, the minimum tracrRNA sequence is approximately 12 nucleotides. In some embodiments, the minimum tracrRNA consists of tracrRNA nucleotides 23-48 described in Jinek, M. et al. (2012). Science, 337( 6096):816-821.

[0116] In some embodiments, the minimum tracrRNA sequence is at least about 60% identical to a reference minimum tracrRNA (e.g., wild type, tracrRNA from S. pyogenes) sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the minimum tracrRNA sequence is at least about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical or 100% identical to a reference minimum tracrRNA sequence over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[0117] In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA has a double helix. In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA has at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides. In some embodiments, the duplex between the minimum CRISPR RNA and the minimum tracrRNA has at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more nucleotides.

[0118] In some embodiments, the duplex has a mismatch (i.e., the two strands of the duplex are not 100% complementary). In some embodiments, the duplex has at least about 1, 2, 3, 4, or 5 or mismatches. In some embodiments, the duplex has at most about 1, 2, 3, 4, or 5 or mismatches. In some embodiments, the duplex has no more than 2 mismatches.

Bulges [0119] In some embodiments, there is a“bulge” in the duplex between the minimum CRISPR RNA and the minimum tracrRNA. The bulge is an unpaired region of nucleotides within the duplex. In some embodiments, the bulge contributes to the binding of the duplex to the site- directed polypeptide. A bulge has, on one side of the duplex, an unpaired 5'-XXXY-3' where X is any purine and Y has a nucleotide that can form a wobble pair with a nucleotide on the opposite strand, and an unpaired nucleotide region on the other side of the duplex. The number of unpaired nucleotides on the two sides of the duplex can be different.

[0120] In one example, the bulge has an unpaired purine (e.g., adenine) on the minimum CRISPR repeat strand of the bulge. In some embodiments, a bulge has an unpaired 5'-AAGY-3' of the minimum tracrRNA sequence strand of the bulge, where Y has a nucleotide that can form a wobble pairing with a nucleotide on the minimum CRISPR repeat strand.

[0121] In some embodiments, a bulge on the minimum CRISPR repeat side of the duplex has at least 1, 2, 3, 4, or 5 or more unpaired nucleotides. In some embodiments, a bulge on the minimum CRISPR repeat side of the duplex has at most 1, 2, 3, 4, or 5 or more unpaired nucleotides. In some embodiments, a bulge on the minimum CRISPR repeat side of the duplex has 1 unpaired nucleotide.

[0122] In some embodiments, a bulge on the minimum tracrRNA sequence side of the duplex has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. In some embodiments, a bulge on the minimum tracrRNA sequence side of the duplex has at most 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 or more unpaired nucleotides. In some embodiments, a bulge on a second side of the duplex (e.g., the minimum tracrRNA sequence side of the duplex) has 4 unpaired nucleotides.

[0123] In some embodiments, a bulge has at least one wobble pairing. In some embodiments, a bulge has at most one wobble pairing. In some embodiments, a bulge has at least one purine nucleotide. In some embodiments, a bulge has at least 3 purine nucleotides. In some

embodiments, a bulge sequence has at least 5 purine nucleotides. In some embodiments, a bulge sequence has at least one guanine nucleotide. In some embodiments, a bulge sequence has at least one adenine nucleotide.

Hairpins

[0124] In various embodiments, one or more hairpins are located 3' to the minimum tracrRNA in the 3' tracrRNA sequence.

[0125] In some embodiments, the hairpin starts at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or

20 or more nucleotides 3' from the last paired nucleotide in the minimum CRISPR repeat and minimum tracrRNA sequence duplex. In some embodiments, the hairpin can start at most about 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides 3' of the last paired nucleotide in the minimum CRISPR repeat and minimum tracrRNA sequence duplex.

[0126] In some embodiments, a hairpin has at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or 20 or more consecutive nucleotides. In some embodiments, a hairpin has at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, or more consecutive nucleotides.

[0127] In some embodiments, a hairpin has a CC dinucleotide (i.e., two consecutive cytosine nucleotides).

[0128] In some embodiments, a hairpin has duplexed nucleotides (e.g., nucleotides in a hairpin, hybridized together). For example, a hairpin has a CC dinucleotide that is hybridized to a GG dinucleotide in a hairpin duplex of the 3' tracrRNA sequence.

[0129] One or more of the hairpins can interact with guide RNA-interacting regions of a site- directed polypeptide.

[0130] In some embodiments, there are two or more hairpins, and in some embodiments there are three or more hairpins.

3 ' tracrRNA sequence

[0131] In some embodiments, a 3' tracrRNA sequence has a sequence with at least about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or 100% sequence identity to a reference tracrRNA sequence (e.g., a tracrRNA from S. pyogenes).

[0132] In some embodiments, the 3' tracrRNA sequence has a length from about 6 nucleotides to about 100 nucleotides. For example, the 3' tracrRNA sequence can have a length from about 6 nucleotides (nt) to about 50 nt, from about 6 nt to about 40 nt, from about 6 nt to about 30 nt, from about 6 nt to about 25 nt, from about 6 nt to about 20 nt, from about 6 nt to about 15 nt, from about 8 nt to about 40 nt, from about 8 nt to about 30 nt, from about 8 nt to about 25 nt, from about 8 nt to about 20 nt, from about 8 nt to about 15 nt, from about 15 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some embodiments, the 3' tracrRNA sequence has a length of approximately 14 nucleotides.

[0133] In some embodiments, the 3' tracrRNA sequence is at least about 60% identical to a reference 3' tracrRNA sequence (e.g., wild type 3' tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides. For example, the 3' tracrRNA sequence is at least about 60% identical, about 65% identical, about 70% identical, about 75% identical, about 80% identical, about 85% identical, about 90% identical, about 95% identical, about 98% identical, about 99% identical, or 100% identical, to a reference 3' tracrRNA sequence (e.g., wild type 3' tracrRNA sequence from S. pyogenes) over a stretch of at least 6, 7, or 8 contiguous nucleotides.

[0134] In some embodiments, a 3' tracrRNA sequence has more than one duplexed region (e.g., hairpin, hybridized region). In some embodiments, a 3' tracrRNA sequence has two duplexed regions.

[0135] In some embodiments, the 3' tracrRNA sequence has a stem loop structure. In some embodiments, a stem loop structure in the 3' tracrRNA has at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15 or 20 or more nucleotides. In some embodiments, the stem loop structure in the 3' tracrRNA has at most 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more nucleotides. In some embodiments, the stem loop structure has a functional moiety. For example, the stem loop structure can have an aptamer, a ribozyme, a protein-interacting hairpin, a CRISPR array, an intron, or an exon. In some embodiments, the stem loop structure has at least about 1, 2, 3, 4, or 5 or more functional moieties. In some embodiments, the stem loop structure has at most about 1, 2, 3, 4, or 5 or more functional moieties.

[0136] In some embodiments, the hairpin in the 3' tracrRNA sequence has a P-domain. In some embodiments, the P-domain has a double- stranded region in the hairpin.

tracrRNA Extension Sequence

[0137] In some embodiments, a tracrRNA extension sequence can be provided whether the tracrRNA is in the context of single-molecule guides or double-molecule guides. In some embodiments, a tracrRNA extension sequence has a length from about 1 nucleotide to about 400 nucleotides. In some embodiments, a tracrRNA extension sequence has a length of more than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, or 400 nucleotides. In some embodiments, a tracrRNA extension sequence has a length from about 20 to about 5000 or more nucleotides. In some embodiments, a tracrRNA extension sequence has a length of more than 1000 nucleotides. In some embodiments, a tracrRNA extension sequence has a length of less than 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 120, 140, 160, 180, 200, 220, 240, 260, 280, 300, 320, 340, 360, 380, 400 or more nucleotides. In some embodiments, a tracrRNA extension sequence can have a length of less than 1000 nucleotides. In some embodiments, a tracrRNA extension sequence has less than 10 nucleotides in length. In some embodiments, a tracrRNA extension sequence is 10-30 nucleotides in length. In some embodiments, tracrRNA extension sequence is 30-70 nucleotides in length.

[0138] In some embodiments, the tracrRNA extension sequence has a functional moiety (e.g., a stability control sequence, ribozyme, endoribonuclease binding sequence). In some

embodiments, the functional moiety has a transcriptional terminator segment (i.e., a transcription termination sequence). In some embodiments, the functional moiety has a total length from about 10 nucleotides (nt) to about 100 nucleotides, from about 10 nt to about 20 nt, from about 20 nt to about 30 nt, from about 30 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt, from about 15 nt to about 80 nt, from about 15 nt to about 50 nt, from about 15 nt to about 40 nt, from about 15 nt to about 30 nt, or from about 15 nt to about 25 nt. In some embodiments, the functional moiety functions in a eukaryotic cell. In some embodiments, the functional moiety functions in a prokaryotic cell. In some

embodiments, the functional moiety functions in both eukaryotic and prokaryotic cells.

[0139] Non-limiting examples of suitable tracrRNA extension functional moieties include a 3' poly-adenylated tail, a riboswitch sequence (e.g., to allow for regulated stability and/or regulated accessibility by proteins and protein complexes), a sequence that forms a dsRNA duplex (i.e., a hairpin), a sequence that targets the RNA to a subcellular location (e.g., nucleus, mitochondria, chloroplasts, and the like), a modification or sequence that provides for tracking (e.g., direct conjugation to a fluorescent molecule, conjugation to a moiety that facilitates fluorescent detection, a sequence that allows for fluorescent detection, etc.), and/or a modification or sequence that provides a binding site for proteins (e.g., proteins that act on DNA, including transcriptional activators, transcriptional repressors, DNA methyltransferases, DNA

demethylases, histone acetyltransferases, histone deacetylases, and the like). In some

embodiments, a tracrRNA extension sequence has a primer binding site or a molecular index (e.g., barcode sequence). In some embodiments, the tracrRNA extension sequence has one or more affinity tags.

Single-Molecule Guide Linker Sequence

[0140] In some embodiments, the linker sequence of a single-molecule guide nucleic acid has a length from about 3 nucleotides to about 100 nucleotides. In Jinek, M. et al. (2012). Science,

337(6096):816-821, for example, a simple 4 nucleotide "tetraloop" (-GAAA-) was used. An illustrative linker has a length from about 3 nucleotides (nt) to about 90 nt, from about 3 nt to about 80 nt, from about 3 nt to about 70 nt, from about 3 nt to about 60 nt, from about 3 nt to about 50 nt, from about 3 nt to about 40 nt, from about 3 nt to about 30 nt, from about 3 nt to about 20 nt, from about 3 nt to about 10 nt. For example, the linker can have a length from about

3 nt to about 5 nt, from about 5 nt to about 10 nt, from about 10 nt to about 15 nt, from about 15 nt to about 20 nt, from about 20 nt to about 25 nt, from about 25 nt to about 30 nt, from about 30 nt to about 35 nt, from about 35 nt to about 40 nt, from about 40 nt to about 50 nt, from about 50 nt to about 60 nt, from about 60 nt to about 70 nt, from about 70 nt to about 80 nt, from about 80 nt to about 90 nt, or from about 90 nt to about 100 nt. In some embodiments, the linker of a single-molecule guide nucleic acid is between 4 and 40 nucleotides. In some embodiments, a linker is at least about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides. In some embodiments, a linker is at most about 100, 500, 1000, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, or 7000 or more nucleotides.

[0141] Linkers can have any of a variety of sequences, although in some embodiments, the linker will not have sequences that have extensive regions of homology with other portions of the guide RNA, which might cause intramolecular binding that could interfere with other functional regions of the guide. In Jinek, M. et al. (2012). Science, 337(6096):8l6-82l, a simple

4 nucleotide sequence -GAAA- was used, but numerous other sequences, including longer sequences can likewise be used.

[0142] In some embodiments, the linker sequence has a functional moiety. For example, the linker sequence can have one or more features, including an aptamer, a ribozyme, a protein interacting hairpin, a protein binding site, a CRISPR array, an intron, or an exon. In some embodiments, the linker sequence has at least about 1, 2, 3, 4, or 5 or more functional moieties. In some embodiments, the linker sequence has at most about 1, 2, 3, 4, or 5 or more functional moieties.

[0143] In some embodiments, a genomic location targeted by gRNAs in accordance with the preset disclosure can be at, within or near the endogenous apolipoprotein(a) ( LPA ) locus in a genome, e.g., human genome. Exemplary guide RNAs targeting such locations include a spacer comprising the sequence of any one of SEQ ID NOs: 1-132. As is understood by the person of ordinary skill in the art, each guide RNA is designed to include a spacer sequence

complementary to its genomic target sequence. For example, a spacer comprising the sequence of any one of SEQ ID NOs: 1-132 can be put into a single RNA chimera or a crRNA (along with a corresponding tracrRNA). See Jinek, M. et al. (2012). Science, 337(6096):816-821 and Deltcheva, E. et al., (2011). Nature, 471:602-601.

Donor DNA or Donor Template

[0144] Site-directed polypeptides, such as a DNA endonuclease, can introduce double- strand breaks or single-strand breaks in nucleic acids, e.g., genomic DNA. The double-strand break can stimulate a cell’s endogenous DNA-repair pathways (e.g., homology-dependent repair (HDR) or non-homologous end joining or alternative non-homologous end joining (A-NHEJ) or microhomology-mediated end joining (MMEJ). NHEJ can repair cleaved target nucleic acid without the need for a homologous template. This can sometimes result in small deletions or insertions (indels) in the target nucleic acid at the site of cleavage, and can lead to disruption or alteration of gene expression. HDR, which is also known as homologous recombination (HR) can occur when a homologous repair template, or donor, is available.

[0145] The homologous donor template has sequences that are homologous to sequences flanking the target nucleic acid cleavage site. The sister chromatid is generally used by the cell as the repair template. However, for the purposes of genome editing, the repair template is often supplied as an exogenous nucleic acid, such as a plasmid, duplex oligonucleotide, single-strand oligonucleotide, double-stranded oligonucleotide, or viral nucleic acid. With exogenous donor templates, it is common to introduce an additional nucleic acid sequence (such as a transgene) or modification (such as a single or multiple base change or a deletion) between the flanking regions of homology so that the additional or altered nucleic acid sequence also becomes incorporated into the target locus. MMEJ results in a genetic outcome that is similar to NHEJ in that small deletions and insertions can occur at the cleavage site. MMEJ makes use of homologous sequences of a few base pairs flanking the cleavage site to drive a favored end joining DNA repair outcome. In some instances, it can be possible to predict likely repair outcomes based on analysis of potential microhomologies in the nuclease target regions.

[0146] Thus, in some cases, homologous recombination is used to insert an exogenous polynucleotide sequence into the target nucleic acid cleavage site. An exogenous polynucleotide sequence is termed a donor polynucleotide (or donor or donor sequence or polynucleotide donor template) herein. In some embodiments, the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of a copy of the donor polynucleotide is inserted into the target nucleic acid cleavage site. In some embodiments, the donor polynucleotide is an exogenous polynucleotide sequence, i.e., a sequence that does not naturally occur at the target nucleic acid cleavage site.

[0147] When an exogenous DNA molecule is supplied in sufficient concentration inside the nucleus of a cell in which the double-strand break occurs, the exogenous DNA can be inserted at the double-strand break during the NHEJ repair process and thus become a permanent addition to the genome. These exogenous DNA molecules are referred to as donor templates in some embodiments. Moreover, the integrated copy of the donor DNA template can be transmitted to the daughter cells when the cell divides.

[0148] In the presence of sufficient concentrations of a donor DNA template that contains flanking DNA sequences with homology to the DNA sequence either side of the double-strand break (referred to as homology arms), the donor DNA template can be integrated via the HDR pathway. The homology arms act as substrates for homologous recombination between the donor template and the sequences either side of the double- strand break. This can result in an error free insertion of the donor template in which the sequences either side of the double-strand break are not altered from that in the un-modified genome.

[0149] Supplied donors for editing by HDR vary markedly but generally contain the intended sequence with small or large flanking homology arms to allow annealing to the genomic DNA. The homology regions flanking the introduced genetic changes can be 20 bp or smaller, or as large as a multi-kilobase cassette that can contain promoters, cDNAs, etc. Both single- stranded and double- stranded oligonucleotide donors can be used. These oligonucleotides range in size from less than 100 nt to over many kb, though longer ssDNA can also be generated and used. Double-stranded donors are often used, including PCR amplicons, plasmids, and mini-circles. In general, it has been found that an AAV vector is a very effective means of delivery of a donor template, though the packaging limits for individual donors is <5kb. Active transcription of the donor increased HDR three-fold, indicating the inclusion of promoter can increase conversion. Conversely, CpG methylation of the donor can decrease gene expression and HDR.

[0150] In some embodiments, the donor DNA can be supplied with the nuclease or

independently by a variety of different methods, for example by transfection, nanoparticle, micro-injection, or viral transduction. A range of tethering options can be used to increase the availability of the donors for HDR in some embodiments. Examples include attaching the donor to the nuclease, attaching to DNA binding proteins that bind nearby, or attaching to proteins that are involved in DNA end binding or repair. [0151] In addition to genome editing by NHEJ or HDR, site-specific gene insertions can be conducted that use both the NHEJ pathway and HR. A combination approach can be applicable in certain settings, possibly including intron/exon borders. NHEJ can prove effective for ligation in the intron, while the error-free HDR can be better suited in the coding region.

Nucleic acid encoding a site-directed polypeptide or DNA endonuclease

[0152] In some embodiments, the methods of genome edition and compositions therefore can use a nucleic acid sequence (or oligonucleotide) encoding a site-directed polypeptide or DNA endonuclease. The nucleic acid sequence encoding the site-directed polypeptide can be DNA or RNA. If the nucleic acid sequence encoding the site-directed polypeptide is RNA, it can be covalently linked to a gRNA sequence or exist as a separate sequence. In some embodiments, a peptide sequence of the site-directed polypeptide or DNA endonuclease can be used instead of the nucleic acid sequence thereof.

Vectors

[0153] In another aspect, the present disclosure provides a nucleic acid having a nucleotide sequence encoding a genome-targeting nucleic acid of the disclosure, a site-directed polypeptide of the disclosure, and/or any nucleic acid or proteinaceous molecule necessary to carry out the embodiments of the methods of the disclosure. In some embodiments, such a nucleic acid is a vector (e.g., a recombinant expression vector).

[0154] Expression vectors contemplated include, but are not limited to, viral vectors based on vaccinia virus, poliovirus, adenovirus, adeno-associated virus, SV40, herpes simplex virus, human immunodeficiency virus, retrovirus (e.g., Murine Leukemia Virus, spleen necrosis virus, and vectors derived from retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, a lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus, and mammary tumor virus) and other recombinant vectors. Other vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pXTl, pSG5, pSVK3, pBPV, pMSG, and pSVLSV40 (Pharmacia). Additional vectors contemplated for eukaryotic target cells include, but are not limited to, the vectors pCTx-l, pCTx-2, and pCTx-3. Other vectors can be used so long as they are compatible with the host cell.

[0155] In some embodiments, a vector has one or more transcription and/or translation control elements. Depending on the host/vector system utilized, any of a number of suitable transcription and translation control elements, including constitutive and inducible promoters, transcription enhancer elements, transcription terminators, etc. can be used in the expression vector. In some embodiments, the vector is a self-inactivating vector that either inactivates the viral sequences or the components of the CRISPR machinery or other elements.

[0156] Non-limiting examples of suitable eukaryotic promoters (i.e., promoters functional in a eukaryotic cell) include those from cytomegalovirus (CMV) immediate early, herpes simplex virus (HSV) thymidine kinase, early and late SV40, long terminal repeats (LTRs) from retrovirus, human elongation factor-l promoter (EF1), a hybrid construct having the

cytomegalovirus (CMV) enhancer fused to the chicken beta-actin promoter (CAG), murine stem cell virus promoter (MSCV), phosphoglycerate kinase- 1 locus promoter (PGK), and mouse metallothionein-I.

[0157] For expressing small RNAs, including guide RNAs used in connection with Cas endonuclease, various promoters such as RNA polymerase III promoters, including for example U6 and Hl, can be advantageous. Descriptions of and parameters for enhancing the use of such promoters are known in art, and additional information and approaches are regularly being described; see, e.g., Ma, H. et ah, (2014). Molecular Therapy - Nucleic Acids, 3:el6l.

[0158] The expression vector can also contain a ribosome binding site for translation initiation and a transcription terminator. The expression vector can also include appropriate sequences for amplifying expression. The expression vector can also include nucleotide sequences encoding non-native tags (e.g., histidine tag, hemagglutinin tag, green fluorescent protein, etc.) that are fused to the site-directed polypeptide, thus resulting in a fusion protein.

[0159] In some embodiments, a promoter is an inducible promoter (e.g., a heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). In some embodiments, a promoter is a constitutive promoter (e.g., CMV promoter, UBC promoter). In some embodiments, the promoter is a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.). In some embodiments, a vector does not have a promoter for at least one gene to be expressed in a host cell if the gene is going to be expressed, after it is inserted into a genome, under an endogenous promoter present in the genome.

SITE-DIRECTED POLYPEPTIDE OR DNA ENDONUCLEASE

[0160] The modifications of the target DNA due to NHEJ and/or HDR can lead to, for example, mutations, deletions, alterations, integrations, gene correction, gene replacement, gene tagging, transgene insertion, nucleotide deletion, gene disruption, translocations and/or gene mutation. The process of integrating non-native nucleic acid into genomic DNA is an example of genome editing.

[0161] A site-directed polypeptide is a nuclease used in genome editing to cleave DNA. The site-directed polypeptide can be administered to a cell or a subject as either: one or more polypeptides, or one or more mRNAs encoding the polypeptide. The term“site-directed polypeptide” is used interchangeably herein with the term“Cas endonuclease.”

[0162] In the context of a CRISPR/Cas or CRISPR/Cpfl system, the site-directed polypeptide can bind to a guide RNA that, in turn, specifies the site in the target DNA to which the polypeptide is directed. In embodiments of CRISPR/Cas or CRISPR/Cpfl systems herein, the site-directed polypeptide is an endonuclease, such as a DNA endonuclease.

[0163] In some embodiments, a site-directed polypeptide has a plurality of nucleic acid cleaving (i.e., nuclease) domains. Two or more nucleic acid-cleaving domains can be linked together via a linker. In some embodiments, the linker has a flexible linker. Linkers can have 1,

2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40 or more amino acids in length.

[0164] Naturally-occurring wild-type Cas9 enzymes have two nuclease domains, a HNH nuclease domain and a RuvC domain. Herein, the“Cas9” refers to both naturally-occurring and recombinant Cas9s. Cas9 enzymes contemplated herein have a HNH or HNH-like nuclease domain, and/or a RuvC or RuvC-like nuclease domain.

[0165] HNH or HNH-like domains have a McrA-like fold. HNH or HNH-like domains has two antiparallel b-strands and an a-helix. HNH or HNH-like domains has a metal binding site (e.g., a divalent cation binding site). HNH or HNH-like domains can cleave one strand of a target nucleic acid (e.g., the complementary strand of the crRNA targeted strand).

[0166] RuvC or RuvC-like domains have an RNaseH or RNaseH-like fold. RuvC/RNaseH domains are involved in a diverse set of nucleic acid-based functions including acting on both RNA and DNA. The RNaseH domain has 5 b-strands surrounded by a plurality of a-helices. RuvC/RNaseH or RuvC/RNaseH-like domains have a metal binding site (e.g., a divalent cation binding site). RuvC/RNaseH or RuvC/RNaseH-like domains can cleave one strand of a target nucleic acid (e.g., the non-complementary strand of a double- stranded target DNA).

[0167] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to a wild-type exemplary site-directed polypeptide (e.g.,

Cas9 from S. pyogenes, US 2014/0068797 Sequence ID No. 8 or Sapranauskas, R. et al. (2011). Nucleic Acids Res., 59(21): 9275-9282, and various other site-directed polypeptides).

[0168] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 10%, at least 15%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or 100% amino acid sequence identity to the nuclease domain of a wild-type exemplary site- directed polypeptide (e.g., Cas9 from S. pyogenes, supra).

[0169] In some embodiments, a site-directed polypeptide has at least 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra ) over 10 contiguous amino acids. In some embodiments, a site-directed polypeptide has at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g.,

Cas9 from S. pyogenes, supra) over 10 contiguous amino acids. In some embodiments, a site- directed polypeptide has at least: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a HNH nuclease domain of the site-directed polypeptide. In some embodiments, a site-directed polypeptide has at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site- directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a HNH nuclease domain of the site-directed polypeptide. In some embodiments, a site-directed polypeptide has at least: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site- directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a RuvC nuclease domain of the site-directed polypeptide. In some embodiments, a site-directed polypeptide has at most: 70, 75, 80, 85, 90, 95, 97, 99, or 100% identity to a wild-type site- directed polypeptide (e.g., Cas9 from S. pyogenes, supra) over 10 contiguous amino acids in a RuvC nuclease domain of the site-directed polypeptide.

[0170] In some embodiments, the site-directed polypeptide has a modified form of a wild-type exemplary site-directed polypeptide. The modified form of the wild- type exemplary site- directed polypeptide has a mutation that reduces the nucleic acid-cleaving activity of the site- directed polypeptide. In some embodiments, the modified form of the wild-type exemplary site- directed polypeptide has less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid-cleaving activity of the wild-type exemplary site-directed polypeptide (e.g., Cas9 from S. pyogenes, supra). The modified form of the site-directed polypeptide can have no substantial nucleic acid-cleaving activity. When a site-directed polypeptide is a modified form that has no substantial nucleic acid-cleaving activity, it is referred to herein as "enzymatically inactive."

[0171] In some embodiments, the modified form of the site-directed polypeptide has a mutation such that it can induce a single-strand break (SSB) on a target nucleic acid (e.g., by cutting only one of the sugar-phosphate backbones of a double-strand target nucleic acid). In some embodiments, the mutation results in less than 90%, less than 80%, less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% of the nucleic acid-cleaving activity in one or more of the plurality of nucleic acid-cleaving domains of the wild-type site directed polypeptide (e.g., Cas9 from S. pyogenes, supra). In some embodiments, the mutation results in one or more of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the complementary strand of the target nucleic acid, but reducing its ability to cleave the non-complementary strand of the target nucleic acid. In some embodiments, the mutation results in one or more of the plurality of nucleic acid-cleaving domains retaining the ability to cleave the non-complementary strand of the target nucleic acid, but reducing its ability to cleave the complementary strand of the target nucleic acid. For example, residues in the wild-type exemplary S. pyogenes Cas9 polypeptide, such as Asp 10, His840, Asn854 and Asn856, are mutated to inactivate one or more of the plurality of nucleic acid-cleaving domains (e.g., nuclease domains). In some embodiments, the residues to be mutated correspond to residues Asp 10, His840, Asn854 and Asn856 in the wild- type exemplary S. pyogenes Cas9 polypeptide (e.g., as determined by sequence and/or structural alignment). Non-limiting examples of mutations include D10A, H840A, N854A or N856A. One skilled in the art will recognize that mutations other than alanine substitutions are suitable.

[0172] In some embodiments, a D10A mutation is combined with one or more of H840A, N854A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, a H840A mutation is combined with one or more of D10A, N854A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, a N854A mutation is combined with one or more of H840A, D10A, or N856A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. In some embodiments, a N856A mutation is combined with one or more of H840A, N854A, or D10A mutations to produce a site-directed polypeptide substantially lacking DNA cleavage activity. Site-directed polypeptides that have one substantially inactive nuclease domain are referred to as“nickases”.

[0173] In some embodiments, variants of RNA-guided endonucleases, for example Cas9, can be used to increase the specificity of CRISPR-mediated genome editing. Wild type Cas9 is typically guided by a single guide RNA designed to hybridize with a specified ~20 nucleotide sequence in the target sequence (such as an endogenous genomic locus). However, several mismatches can be tolerated between the guide RNA and the target locus, effectively reducing the length of required homology in the target site to, for example, as little as 13 nt of homology, and thereby resulting in elevated potential for binding and double-strand nucleic acid cleavage by the CRISPR/Cas9 complex elsewhere in the target genome - also known as off-target cleavage. Because nickase variants of Cas9 each only cut one strand, in order to create a double strand break it is necessary for a pair of nickases to bind in close proximity and on opposite strands of the target nucleic acid, thereby creating a pair of nicks, which is the equivalent of a double-strand break. This requires that two separate guide RNAs - one for each nickase - must bind in close proximity and on opposite strands of the target nucleic acid. This requirement essentially doubles the minimum length of homology needed for the double- strand break to occur, thereby reducing the likelihood that a double-strand cleavage event will occur elsewhere in the genome, where the two guide RNA sites - if they exist - are unlikely to be sufficiently close to each other to enable the double-strand break to form. As described in the art, nickases can also be used to promote HDR versus NHEJ. HDR can be used to introduce selected changes into target sites in the genome through the use of specific donor sequences that effectively mediate the desired changes. Descriptions of various CRISPR/Cas systems for use in gene editing can be found, e.g., in international patent application publication number WO

2013/176772, and in Sander, J. D. et al. (2014). Nature Biotechnology, 32(4):347-355, and references cited therein.

[0174] In some embodiments, the site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive site-directed polypeptide) targets nucleic acid. In some embodiments, the site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive endoribonuclease) targets DNA. In some embodiments, the site-directed polypeptide (e.g., variant, mutated, enzymatically inactive and/or conditionally enzymatically inactive endoribonuclease) targets RNA. [0175] In some embodiments, the site-directed polypeptide has one or more non-native sequences (e.g., the site-directed polypeptide is a fusion protein).

[0176] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), a nucleic acid binding domain, and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain).

[0177] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain).

[0178] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains, wherein one or both of the nucleic acid cleaving domains have at least 50% amino acid identity to a nuclease domain from Cas9 from a bacterium (e.g., S. pyogenes).

[0179] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), and non-native sequence (for example, a nuclear localization signal) or a linker linking the site-directed polypeptide to a non native sequence.

[0180] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), wherein the site-directed polypeptide has a mutation in one or both of the nucleic acid cleaving domains that reduces the cleaving activity of the nuclease domains by at least 50%.

[0181] In some embodiments, the site-directed polypeptide has an amino acid sequence having at least 15% amino acid identity to a Cas9 from a bacterium (e.g., S. pyogenes), and two nucleic acid cleaving domains (i.e., a HNH domain and a RuvC domain), wherein one of the nuclease domains has mutation of aspartic acid 10, and/or wherein one of the nuclease domains has mutation of histidine 840, and wherein the mutation reduces the cleaving activity of the nuclease domain(s) by at least 50%.

[0182] In some embodiments, the one or more site-directed polypeptides, e.g., DNA endonucleases, include two nickases that together effect one double-strand break at a specific locus in the genome, or four nickases that together effect two double-strand breaks at specific loci in the genome. Alternatively, one site-directed polypeptide, e.g., DNA endonuclease, affects one double- strand break at a specific locus in the genome.

[0183] In some embodiments, a polynucleotide encoding a site-directed polypeptide can be used to edit a cellular genome. In some of such embodiments, the polynucleotide encoding a site- directed polypeptide is codon-optimized according to methods standard in the art for expression in the cell containing the target DNA of interest. For example, if the intended target nucleic acid is in a human cell, a human codon-optimized polynucleotide encoding a Cas endonuclease is contemplated for use for producing the Cas endonuclease.

[0184] The following provides some examples of site-directed polypeptides that can be used in various embodiments of the disclosures.

CRISPR Endonuclease System

[0185] A CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) genomic locus can be found in the genomes of many prokaryotes (e.g., bacteria and archaea). In prokaryotes, the CRISPR locus encodes products that function as a type of immune system to help defend the prokaryotes against foreign invaders, such as virus and phage. There are three stages of CRISPR locus function: integration of new sequences into the CRISPR locus, expression of CRISPR RNA (crRNA), and silencing of foreign invader nucleic acid. Five types of CRISPR systems (e.g., Type I, Type II, Type III, Type U, and Type V) have been identified.

[0186] A CRISPR locus includes a number of short repeating sequences referred to as “repeats.” When expressed, the repeats can form secondary hairpin structures (e.g., hairpins) and/or have unstructured single- stranded sequences. The repeats usually occur in clusters and frequently diverge between species. The repeats are regularly interspaced with unique intervening sequences referred to as“spacers,” resulting in a repeat- spacer-repeat locus architecture. The spacers are identical to or have high homology with known foreign invader sequences. A spacer-repeat unit encodes a crisprRNA (crRNA), which is processed into a mature form of the spacer-repeat unit. A crRNA has a“seed” or spacer sequence that is involved in targeting a target nucleic acid (in the naturally occurring form in prokaryotes, the spacer sequence targets the foreign invader nucleic acid). A spacer sequence is located at the 5' or 3' end of the crRNA.

[0187] A CRISPR locus also has polynucleotide sequences encoding CRISPR Associated (Cas) genes. Cas genes encode endonucleases involved in the biogenesis and the interference stages of crRNA function in prokaryotes. Some Cas genes have homologous secondary and/or tertiary structures.

Type ll CRISPR Systems

[0188] crRNA biogenesis in a Type II CRISPR system in nature requires a trans-activating CRISPR RNA (tracrRNA). The tracrRNA is modified by endogenous RNaselll, and then hybridizes to a crRNA repeat in the pre-crRNA array. Endogenous RNaselll is recruited to cleave the pre-crRNA. Cleaved crRNAs are subjected to exoribonuclease trimming to produce the mature crRNA form (e.g., 5' trimming). The tracrRNA remains hybridized to the crRNA, and the tracrRNA and the crRNA associate with a site-directed polypeptide (e.g., Cas9). The crRNA of the crRNA-tracrRNA-Cas9 complex guides the complex to a target nucleic acid to which the crRNA can hybridize. Hybridization of the crRNA to the target nucleic acid activates Cas9 for targeted nucleic acid cleavage. The target nucleic acid in a Type II CRISPR system is referred to as a protospacer adjacent motif (PAM). In nature, the PAM is essential to facilitate binding of a site-directed polypeptide (e.g., Cas9) to the target nucleic acid. Type II systems (also referred to as Nmeni or CASS4) are further subdivided into Type II-A (CASS4) and II-B (CASS4a). Jinek, M. et al. (2012). Science, 337(6096):816-821 showed that the CRISPR/Cas9 system is useful for RNA-programmable genome editing, and international patent application publication number WO 2013/176772 provides numerous examples and applications of the CRISPR/Cas

endonuclease system for site-specific gene editing.

Type V CRISPR Systems

[0189] Type V CRISPR systems have several important differences from Type II systems. For example, Cpfl is a single RNA-guided endonuclease that, in contrast to Type II systems, lacks tracrRNA. In fact, Cpfl -associated CRISPR arrays are processed into mature crRNAS without the requirement of an additional trans-activating tracrRNA. The Type V CRISPR array is processed into short mature crRNAs of 42-44 nucleotides in length, with each mature crRNA beginning with 19 nucleotides of direct repeat followed by 23-25 nucleotides of spacer sequence. In contrast, mature crRNAs in Type II systems start with 20-24 nucleotides of spacer sequence followed by about 22 nucleotides of direct repeat. Also, Cpfl utilizes a T-rich protospacer- adjacent motif such that Cpfl-crRNA complexes efficiently cleave target DNA preceded by a short T-rich PAM, which is in contrast to the G-rich PAM following the target DNA for Type II systems. Thus, Type V systems cleave at a point that is distant from the PAM, while Type II systems cleave at a point that is adjacent to the PAM. In addition, in contrast to Type II systems, Cpfl cleaves DNA via a staggered DNA double-stranded break with a 4 or 5 nucleotide 5’ overhang. Type II systems cleave via a blunt double- stranded break. Similar to Type II systems, Cpfl contains a predicted RuvC-like endonuclease domain, but lacks a second HNH

endonuclease domain, which is in contrast to Type II systems.

Cas Genes/Polypeptides and Protospacer Adjacent Motifs

[0190] Exemplary CRISPR/Cas polypeptides include the Cas9 polypeptides in Fig. 1 of Fonfara, I. et al. (2014.) Nucleic Acids Research, 42(4):2577-2590. The CRISPR/Cas gene naming system has undergone extensive rewriting since the Cas genes were discovered. Fig. 5 of Fonfara, I. et al. (2014.) Nucleic Acids Research, 42(4):2577-2590 provides PAM sequences for Cas9 polypeptides from various species.

[0191] Complexes of a Genome-Targeting Nucleic acid and a Site-Directed Polypeptide

[0192] A genome-targeting nucleic acid interacts with a site-directed polypeptide (e.g., a nucleic acid-guided nuclease such as Cas9), thereby forming a complex. The genome-targeting nucleic acid (e.g., gRNA) guides the site-directed polypeptide to a target nucleic acid.

[0193] As stated previously, in some embodiments the site-directed polypeptide and genome targeting nucleic acid can each be administered separately to a cell or a patient. On the other hand, in some other embodiments the site-directed polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material can then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP).

METHOD OF EDITING GENOME

[0194] One approach to functionally knock-out or reduce the expression of a protein associated with a disease, such as apo(a), in an organism in need thereof is to using genome editing to target the gene in a relevant cell type in such a way that expression of the gene is functionally suppressed.

[0195] In some embodiments, provided herein is a method of genome editing, in particular, functionally knocking out or reducing the expression of an apolipoprotein(a) [apo(a)] gene in the genome of a cell. This method can be used to treat a subject, e.g., a patient with a cardiovascular disease. The chromosomal DNA of relevant cells in the subject (e.g., hepatocytes) is edited using the materials and methods described herein. In some embodiments, the cardiovascular disease is stroke, myocardial infarction, atherosclerosis, familial hypercholesterolemia, atherosclerosis, thrombosis, calcific aortic valve disease, coronary artery disease, peripheral arterial disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, congenital heart disease, or rheumatic heart disease.

[0196] In some embodiments, provided herein are methods to functionally knock-out or reduce the expression of an LPA gene in a genome of a cell. In one aspect, the present disclosure provides a method of editing a genome in a cell, the method comprising: providing the following to the cell: (a) one or two gRNA(s) according to any of the gRNAs described herein or nucleic acid encoding the gRNA(s); and/or (b) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease. In some embodiments, the method comprises providing to the cell an AAV vector comprising the nucleic acid encoding the gRNA(s) and/or the nucleic acid encoding the DNA endonuclease. In some embodiments, the method further comprises providing (c) a donor template comprising a nucleic acid sequence encoding one or more STOP codons to the cell. In some embodiments, the spacer comprises a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132. In some embodiments, the spacer is 20 nucleotides in length. In some embodiments, the spacer comprises a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132.

[0197] In some embodiments, provided herein is a method of editing a genome in a cell, comprising providing to the cell: a) a DNA endonuclease (e.g., a Cas endonuclease, such as Cas9) or nucleic acid encoding the DNA endonuclease; and b) a gRNA comprising a spacer sequence complementary to a target genomic sequence within or near an endogenous apolipoprotein(a) (LPA) gene in the cell, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence in the cell to generate a genetically modified cell with reduced expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the cell prior to carrying out the method is an input cell that expresses apo(a) at a level greater than a reference level for the expression of apo(a) in the input cell type. In some embodiments, the genetically modified cell has reduced functional expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the genetically modified cell has no functional expression of apo(a). In some embodiments, the method further comprises providing to the cell a donor template comprising a nucleic acid sequence to be inserted into the LPA gene. In some embodiments, the nucleic acid sequence to be inserted encodes one or more STOP codons, and the system is configured to insert a STOP codon in-frame into an LPA gene coding sequence such that the LPA gene is rendered non-functional. In some embodiments, the gRNA targets within or near a coding sequence in the LPA gene. In some embodiments, the gRNA targets exon 1, exon 2, or exon 3 of the LPA gene. In some embodiments, the gRNA targets a sequence in the LPA gene

corresponding to a kringle IV repeat region in the apo(a) protein. In some embodiments, the gRNA targets within or near a non-coding sequence in the LPA gene. In some embodiments, the gRNA targets an LPA gene intron. In some embodiments, the gRNA targets an LPA gene regulatory region. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 1-132. In some embodiments, the DNA endonuclease is a Cas endonuclease, e.g., a Cas9 endonuclease. In some embodiments, the gRNA is an sgRNA.

[0198] In some embodiments, provided herein is a method of editing a genome in a cell, comprising providing to the cell: a) a DNA endonuclease (e.g., a Cas endonuclease, such as Cas9) or nucleic acid encoding the DNA endonuclease; and b) a gRNA comprising i) a spacer sequence complementary to a target genomic sequence within exon 3 of an LPA gene; ii) a spacer sequence complementary to a target genomic sequence within exon 2 of an LPA gene; iii) a spacer sequence complementary to a target genomic sequence within an LPA gene

corresponding to a kringle IV repeat region in apo(a); or iv) a spacer sequence complementary to a target genomic sequence within a regulatory region of an LPA gene, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence in the cell to generate a genetically modified cell with reduced expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the gRNA comprises i) a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20- 106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19. In some embodiments, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. For example, in some embodiments, the spacer sequence is the nucleotide sequence of any one of SEQ ID NOs: 157-160. In some embodiments, the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of generating a double-strand break at the target genomic sequence.

[0199] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13- 19. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 14 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 15 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 18 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 19 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 19. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 19. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 19.

[0200] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the DNA endonuclease is a Cas endonuclease. In some embodiments, the DNA endonuclease is a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2,

Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, or Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is a Cas9 endonuclease. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9).

[0201] In some embodiments, a DNA sequence that is transcribed to the nucleic acid encoding the DNA endonuclease is codon optimized. In some embodiments, the nucleic acid sequence encoding one or more STOP codons is codon optimized. In some embodiments, the nucleic acid sequence encoding one or more STOP codons does not comprise CpG dinucleotides. In some embodiments, the nucleic acid encoding the DNA endonuclease comprises a 5’ CAP structure and 3’ polyA tail. In some embodiments, the nucleic acid encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0202] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the method comprises providing to the cell a nucleic acid encoding the DNA endonuclease. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon- optimized for expression in the cell. In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA, such as a DNA plasmid. In some embodiments, the nucleic acid encoding the DNA endonuclease is RNA, such as mRNA.

[0203] In some embodiments, the nucleic acid sequence encoding one or more STOP codons is inserted into a genomic sequence of the cell. In some embodiments, the insertion is at, within, or near the endogenous apolipoprotein(a) ( LPA ) gene or LPA gene regulatory elements in the genome of the cell. In some embodiments, the donor template comprising a nucleic acid sequence encoding one or more STOP codons comprises three STOP codons in each of the 3 translation frames present in succession in the donor DNA sequence. In some embodiments, the donor DNA is delivered as a double-stranded or single-stranded oligonucleotide. In some embodiments, the single- stranded or double-stranded donor DNA contains homology arms composed of the sequences of 20 bp to 1000 bp, or more, flanking each side of the sgRNA cut site. [0204] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the method further comprises providing to the cell a donor template comprising a sequence to be integrated at or near the target genomic sequence. In some embodiments, the donor template comprises a donor cassette comprising a nucleic acid sequence encoding one or more STOP codons. In some embodiments, the nucleic acid sequence encoding one or more STOP codons encodes three STOP codons in each of the 3 possible translation frames in the forward orientation and/or three STOP codons in each of the 3 possible translation frames in the reverse orientation. An exemplary sequence encoding three STOP codons in each of the 3 possible translation frames in both the forward and reverse orientations is provided in SEQ ID NO: 155. In some embodiments, the DNA endonuclease, gRNA, and donor template are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting targeted integration of the donor cassette into a target genomic locus (e.g., a coding region) comprising the target genomic sequence. In some embodiments, integration of the donor cassette into the target genomic locus in the cell results in the generation of a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell. For example, integration of the donor template into an LPA gene coding sequence such that a premature STOP codon is inserted in-frame can result in a non functional or reduced function truncated translation product as compared to the apo(a) protein encoded by the unmodified LPA gene.

[0205] In some embodiments, according to any of the methods of editing a genome in a cell described herein employing a donor template, the donor template is configured such that the donor cassette is capable of being integrated into a genomic locus targeted by the gRNA by homology directed repair (HDR). In some embodiments, the donor cassette is flanked on both sides by homology arms corresponding to sequences in the targeted genomic locus. In some embodiments, the homology arms are at least about 0.2 kb (such as at least about any of 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, or greater) in length. In some embodiments, the homology arms are at least about 0.4 kb, e.g., 0.45 kb, 0.6 kb, or 0.8 kb, in length. In some embodiments, the donor template is encoded in an Adeno Associated Virus (AAV) vector. In some embodiments, the AAV vector is an AAV2, AAV5, or AAV6 vector. In some

embodiments, the AAV vector is an AAV6 vector.

[0206] In some embodiments, according to any of the methods of editing a genome in a cell described herein employing a donor template, the donor template is configured such that the donor cassette is capable of being integrated into a genomic locus targeted by the gRNA by non- homologous end joining (NHEJ). In some embodiments, the donor cassette is flanked on one or both sides by a gRNA target site. In some embodiments, the donor cassette is flanked on both sides by a gRNA target site. In some embodiments, the gRNA target site is a target site for the gRNA targeting the LPA gene. In some embodiments, the gRNA target site of the donor template is the reverse complement of the cell genome gRNA target site. In some embodiments, the donor template is encoded in an Adeno Associated Virus (AAV) vector. In some embodiments, the AAV vector is an AAV2, AAV5, or AAV6 vector. In some embodiments, the AAV vector is an AAV6 vector.

[0207] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle also comprises the gRNA or nucleic acid encoding the gRNA. In some

embodiments, the liposome or lipid nanoparticle is a lipid nanoparticle. In some embodiments, the system comprises a lipid nanoparticle comprising nucleic acid encoding the DNA

endonuclease and the gRNA. In some embodiments, the nucleic acid encoding the DNA endonuclease is an mRNA encoding the DNA endonuclease.

[0208] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the DNA endonuclease is pre-complexed with the gRNA, forming a

Ribonucleoprotein (RNP) complex, prior to the provision to the cell. In some embodiments, where the method employs a donor template, the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell after the donor template is provided to the cell. In some embodiments, the DNA

endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell about 1 to 14 days after the donor template is provided to the cell.

[0209] In some embodiments, according to any of the methods of editing a genome in a cell described herein, one or more (such as any of one, two, three, four, five, or more) additional doses of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell following a first dose of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA. [0210] In some embodiments, according to any of the methods of editing a genome in a cell described herein, one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near (for example, within any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from) exon 1, 2, or 3 of the LPA gene are provided to the cell. In some embodiments, the spacer(s) are complementary to a genomic sequence within or near (for example, within any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from) exon 3 of the LPA gene. In some embodiments, the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0211] In some embodiments, according to any of the methods of editing a genome in a cell described herein, two gRNAs comprising spacers complementary to a genomic sequence within a transcriptional regulatory sequence of the LPA gene are provided to the cell. In some embodiments, the transcriptional regulatory sequence comprises a promoter or enhancer. In some embodiments, the gRNAs are any two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 20-106 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 20-106.

[0212] In some embodiments, according to any of the methods of editing a genome in a cell described herein, a gRNA comprising a spacer complementary to a genomic sequence encoding a kringle domain in an apo(a) protein is provided to the cell. In some embodiments, the gRNA comprises a spacer selected from the group consisting of SEQ ID NOs: 107-132 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 107-132.

[0213] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the cell prior to carrying out the method is an input cell that expresses apo(a).

In some embodiments, the input cell expresses apo(a) at a level greater than a reference level for the expression of apo(a) in the input cell type. In some embodiments, the genetically modified cell has reduced functional expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the genetically modified cell has no functional expression of apo(a). In some embodiments, the input cell is a hepatocyte.

[0214] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the endogenous LPA gene is a variant associated with increased cardiovascular disease risk and/or increased Lp(a) expression. [0215] In some embodiments, according to any of the methods of editing a genome in a cell described herein, the method is an in vivo method, and the cell is a cell in a subject. In some embodiments, the subject is human.

TARGET SEQUENCE SELECTION

[0216] In some embodiments, shifts in the location of the 5' boundary and/or the 3' boundary relative to particular reference loci are used to facilitate or enhance particular applications of gene editing, which depend in part on the endonuclease system selected for the editing, as further described and illustrated herein.

[0217] In a first, non-limiting aspect of such target sequence selection, many endonuclease systems have rules or criteria that guide the initial selection of potential target sites for cleavage, such as the requirement of a PAM sequence motif in a particular position adjacent to the DNA cleavage sites in the case of CRISPR Type II or Type V endonucleases.

[0218] In another, non-limiting aspect of target sequence selection or optimization, the frequency of“off-target” activity for a particular combination of target sequence and gene editing endonuclease (i.e., the frequency of DSBs occurring at sites other than the selected target sequence) is assessed relative to the frequency of on-target activity. In some cases, cells that have been correctly edited at the desired locus can have a selective advantage relative to other cells. Illustrative, but non-limiting, examples of a selective advantage include the acquisition of attributes such as enhanced rates of replication, persistence, resistance to certain conditions, enhanced rates of successful engraftment or persistence in vivo following introduction into a patient, and other attributes associated with the maintenance or increased numbers or viability of such cells. In other cases, cells that have been correctly edited at the desired locus can be positively selected for by one or more screening methods used to identify, sort or otherwise select for cells that have been correctly edited. Both selective advantage and directed selection methods can take advantage of the phenotype associated with the correction. In some

embodiments, cells can be edited two or more times in order to create a second modification that creates a new phenotype that is used to select or purify the intended population of cells. Such a second modification could be created by adding a second gRNA for a selectable or screenable marker. In some cases, cells can be correctly edited at the desired locus using a DNA fragment that contains the cDNA and also a selectable marker. [0219] In embodiments, whether any selective advantage is applicable or any directed selection is to be applied in a particular case, target sequence selection is also guided by consideration of off-target frequencies in order to enhance the effectiveness of the application and/or reduce the potential for undesired alterations at sites other than the desired target. As described further and illustrated herein and in the art, the occurrence of off-target activity is influenced by a number of factors including similarities and dissimilarities between the target site and various off-target sites, as well as the particular endonuclease used. Bioinformatics tools are available that assist in the prediction of off-target activity, and frequently such tools can also be used to identify the most likely sites of off-target activity, which can then be assessed in experimental settings to evaluate relative frequencies of off-target to on-target activity, thereby allowing the selection of sequences that have higher relative on-target activities. Illustrative examples of such techniques are provided herein, and others are known in the art.

[0220] Another aspect of target sequence selection relates to homologous recombination events. Sequences sharing regions of homology can serve as focal points for homologous recombination events that result in deletion of intervening sequences. Such recombination events occur during the normal course of replication of chromosomes and other DNA sequences, and also at other times when DNA sequences are being synthesized, such as in the case of repairs of double-strand breaks (DSBs), which occur on a regular basis during the normal cell replication cycle but can also be enhanced by the occurrence of various events (such as UV light and other inducers of DNA breakage) or the presence of certain agents (such as various chemical inducers). Many such inducers cause DSBs to occur indiscriminately in the genome, and DSBs are regularly being induced and repaired in normal cells. During repair, the original sequence can be reconstructed with complete fidelity, however, in some cases, small insertions or deletions (referred to as“indels”) are introduced at the DSB site.

[0221] DSBs can also be specifically induced at particular locations, as in the case of the endonucleases systems described herein, which can be used to cause directed gene modification events at selected chromosomal locations. The tendency for homologous sequences to be subject to recombination in the context of DNA repair (as well as replication) can be taken advantage of in a number of circumstances, and is the basis for one application of gene editing systems, such as CRISPR, in which homology directed repair is used to insert a sequence of interest, provided through use of a“donor” polynucleotide, into a desired chromosomal location. [0222] Regions of homology between particular sequences, which can be small regions of “microhomology” that can have as few as ten base pairs or less, can also be used to bring about desired deletions. For example, a single DSB is introduced at a site that exhibits microhomology with a nearby sequence. During the normal course of repair of such DSB, a result that occurs with high frequency is the deletion of the intervening sequence as a result of recombination being facilitated by the DSB and concomitant cellular repair process.

[0223] In some circumstances, however, selecting target sequences within regions of homology can also give rise to much larger deletions, including gene fusions (when the deletions are in coding regions), which can or cannot be desired given the particular circumstances.

[0224] The examples provided herein further illustrate the selection of various target regions for the creation of DSBs, as well as the selection of specific target sequences within such regions that are designed to minimize off-target events relative to on-target events.

TARGETED INTEGRATION

[0225] The CRISPR-Cas system used in some embodiments has the advantage that a large number of genomic targets can be rapidly screened to identify an optimal CRISPR-Cas design. The CRISPR-Cas system uses a RNA molecule called a single guide RNA (sgRNA) that targets an associated Cas endonuclease (for example a Cas9 nuclease) to a specific sequence in DNA. This targeting occurs by Watson-Crick based pairing between the sgRNA and the sequence of the genome within the approximately 20 bp targeting sequence of the sgRNA. Once bound at a target site, a Cas endonuclease cleaves both strands of the genomic DNA creating a double strand break. The only requirement for designing a sgRNA to target a specific DNA sequence is that the target sequence must contain a protospacer adjacent motif (PAM) sequence at the 3’ end of the sgRNA sequence that is complementary to the genomic sequence. In the case of a Cas9 nuclease from Streptococcus pyogenes, the PAM sequence is NRG (where R is A or G and N is any base), or the more restricted PAM sequence NGG. Therefore, sgRNA molecules that target any region of the genome can be designed in silico by locating the 20 bp sequence adjacent to all PAM motifs. PAM motifs occur on average very 15 bp in the genome of eukaryotes. However, sgRNA designed by in silico methods will generate double-strand breaks in cells with differing efficiencies and it is not possible to predict the cutting efficiencies of a series of sgRNA molecule using in silico methods. Because sgRNA can be rapidly synthesized in vitro this enables the rapid screening of all potential sgRNA sequences in a given genomic region to identify the sgRNA that results in the most efficient cutting. Typically when a series of sgRNA within a given genomic region are tested in cells a range of cleavage efficiencies between 0 and 90% is observed. In silico algorithms as well as laboratory experiments can also be used to determine the off-target potential of any given sgRNA. While a perfect match to the 20 bp recognition sequence of a sgRNA will primarily occur only once in most eukaryotic genomes there will be a number of additional sites in the genome with 1 or more base pair mismatches to the sgRNA. These sites can be cleaved at variable frequencies which are often not predictable based on the number or location of the mismatches. Cleavage at additional off-target sites that were not identified by the in silico analysis can also occur. Thus, screening a number of sgRNA in a relevant cell type to identify sgRNA that have the most favorable off-target profile is a critical component of selecting an optimal sgRNA for therapeutic use. A favorable off target profile will take into account not only the number of actual off-target sites and the frequency of cutting at these sites, but also the location in the genome of these sites. For example, off-target sites close to or within functionally important genes, particularly oncogenes or anti-oncogenes would be considered as less favorable than sites in intergenic regions with no known function. Thus, the identification of an optimal sgRNA cannot be predicted simply by in silico analysis of the genomic sequence of an organism but requires experimental testing. While in silico analysis can be helpful in narrowing down the number of guides to test it cannot predict guides that have high on target cutting or predict guides with low desirable off-target cutting. Experimental data indicates that the cutting efficiency of sgRNA that each has a perfect match to the genome in a region of interest varies significantly and is not predictable by any known algorithm. The ability of a given sgRNA to promote cleavage by a Cas enzyme can relate to the accessibility of that specific site in the genomic DNA which can be determined by the chromatin structure in that region. While the majority of the genomic DNA in a quiescent differentiated cell, such as a hepatocyte, exists in highly condensed heterochromatin, regions that are actively transcribed exists in more open chromatin states that are known to be more accessible to large molecules such as proteins a Cas endonuclease. Even within actively transcribed genes some specific regions of the DNA are more accessible than others due to the presence or absence of bound transcription factors or other regulatory proteins. Predicting sites in the genome or within a specific genomic locus or region of a genomic locus, is not possible and therefore would need to be determined experimentally in a relevant cell type. Once some sites are selected as potential sites for insertion, it can be possible to add some variations to such a site, e.g., by moving a few nucleotides upstream or downstream from the selected sites, with or without experimental tests.

[0226] In some embodiments, gRNAs that can be used in the methods disclosed herein include gRNAs comprising a spacer comprising the polynucleotide sequence of any one of SEQ ID NOs: 1-132 or any derivatives thereof having at least about 85% nucleotide sequence identity to the polynucleotide sequence of any one of SEQ ID NOs: 1-132.

NUCLEIC ACID MODIFICATIONS

[0227] In some embodiments, polynucleotides introduced into cells have one or more modifications that can be used individually or in combination, for example, to enhance activity, stability or specificity, alter delivery, reduce innate immune responses in host cells, or for other enhancements, as further described herein and known in the art.

[0228] In certain embodiments, modified polynucleotides are used in the CRISPR/Cas9/Cpfl system, in which case the guide RNAs (either single-molecule guides or double-molecule guides) and/or a DNA or an RNA encoding a Cas or Cpfl endonuclease introduced into a cell can be modified, as described and illustrated below. Such modified polynucleotides can be used in the CRISPR/Cas9/Cpfl system to edit any one or more genomic loci.

[0229] Using the CRISPR/Cas9/Cpfl system for purposes of non-limiting illustrations of such uses, modifications of guide RNAs can be used to enhance the formation or stability of the CRISPR/Cas9/Cpfl genome editing complex having guide RNAs, which can be single-molecule guides or double-molecule, and a Cas or Cpfl endonuclease. Modifications of guide RNAs can also or alternatively be used to enhance the initiation, stability or kinetics of interactions between the genome editing complex with the target sequence in the genome, which can be used, for example, to enhance on-target activity. Modifications of guide RNAs can also or alternatively be used to enhance specificity, e.g., the relative rates of genome editing at the on-target site as compared to effects at other (off-target) sites.

[0230] Modifications can also or alternatively be used to increase the stability of a guide RNA, e.g., by increasing its resistance to degradation by ribonucleases (RNases) present in a cell, thereby causing its half-life in the cell to be increased. Modifications enhancing guide RNA half- life can be particularly useful in embodiments in which a Cas or Cpfl endonuclease is introduced into the cell to be edited via an RNA that needs to be translated in order to generate

endonuclease, because increasing the half-life of guide RNAs introduced at the same time as the RNA encoding the endonuclease can be used to increase the time that the guide RNAs and the encoded Cas or Cpfl endonuclease co-exist in the cell.

[0231] Modifications can also or alternatively be used to decrease the likelihood or degree to which RNAs introduced into cells elicit innate immune responses. Such responses, which have been well characterized in the context of RNA interference (RNAi), including small-interfering RNAs (siRNAs), as described below and in the art, tend to be associated with reduced half-life of the RNA and/or the elicitation of cytokines or other factors associated with immune responses.

[0232] One or more types of modifications can also be made to RNAs encoding an

endonuclease that are introduced into a cell, including, without limitation, modifications that enhance the stability of the RNA (such as by increasing its degradation by RNAses present in the cell), modifications that enhance translation of the resulting product (i.e., the endonuclease), and/or modifications that decrease the likelihood or degree to which the RNAs introduced into cells elicit innate immune responses.

[0233] Combinations of modifications, such as the foregoing and others, can likewise be used. In the case of CRISPR/Cas9/Cpfl, for example, one or more types of modifications can be made to guide RNAs (including those exemplified above), and/or one or more types of modifications can be made to RNAs encoding Cas endonuclease (including those exemplified above).

[0234] By way of illustration, guide RNAs used in the CRISPR/Cas9/Cpfl system, or other smaller RNAs can be readily synthesized by chemical means, enabling a number of

modifications to be readily incorporated, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating chemically- modified RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 endonuclease, are more readily generated enzymatically. While fewer types of modifications are generally available for use in

enzymatically produced RNAs, there are still modifications that can be used to, e.g., enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described further below and in the art; and new types of modifications are regularly being developed. [0235] By way of illustration of various types of modifications, especially those used frequently with smaller chemically synthesized RNAs, modifications can have one or more nucleotides modified at the 2' position of the sugar, in some embodiments a 2'-0-alkyl, 2'-0- alkyl-O-alkyl, or 2'-fluoro-modified nucleotide. In some embodiments, RNA modifications include 2'-fluoro, 2'-amino or 2' O-methyl modifications on the ribose of pyrimidines, a basic residues, or an inverted base at the 3' end of the RNA. Such modifications are routinely incorporated into oligonucleotides and these oligonucleotides have been shown to have a higher Tm (i.e., higher target binding affinity) than 2'-deoxyoligonucleotides against a given target.

[0236] A number of nucleotide and nucleoside modifications have been shown to make the oligonucleotide into which they are incorporated more resistant to nuclease digestion than the native oligonucleotide; these modified oligos survive intact for a longer time than unmodified oligonucleotides. Specific examples of modified oligonucleotides include those having modified backbones, for example, phosphorothioates, phosphotriesters, methyl phosphonates, short chain alkyl or cycloalkyl intersugar linkages or short chain heteroatomic or heterocyclic intersugar linkages. Some oligonucleotides are oligonucleotides with phosphorothioate backbones and those with heteroatom backbones, particularly CH ₂ -NH-O-CH2, CH,~N(CH ₃ )~0~CH ₂ (known as a methylene(methylimino) or MMI backbone), CH2 -O-N (CH ₃ )-CH2, Cth -N (CH ₃ )-N (CH ₃ )-CH2 and O-N (CH ₃ )- Cth -CH2 backbones, wherein the native phosphodiester backbone is represented as O- P- O- CH,); amide backbones (see De Mesmaeker, A. et al. (1995). Acc. Chem. Res., 28(9):366-374); morpholino backbone structures (see Summerton and Weller, U.S. Pat. No. 5,034,506); peptide nucleic acid (PNA) backbone (wherein the phosphodiester backbone of the oligonucleotide is replaced with a polyamide backbone, the nucleotides being bound directly or indirectly to the aza nitrogen atoms of the polyamide backbone, see Nielsen, P. E. et al. (1991). Science, , 254(5037): 1497-1500). Phosphorus -containing linkages include, but are not limited to, phosphorothioates, chiral phosphorothioates, phosphorodithioates,

phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates having 3'alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates having 3'- amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates,

thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'- 5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'; see US patent nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925;

5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050.

[0237] Morpholino-based oligomeric compounds are described in Braasch, D. A. et al. (2002). Biochemistry, 4i(l4):4503-45l0; Genesis, Volume 30, Issue 3, (2001); Heasman, J. (2002). Dev. Biol., 243( 2):209-2l4; Nasevicius, A. et al. (2000). Nature Genetics, 26: 216-220; Lacerra, G. et al., (2000). PNAS, 97(17): 9591-9596; and U.S. Pat. No. 5,034,506, issued Jul. 23, 1991.

[0238] Cyclohexenyl nucleic acid oligonucleotide mimetics are described in Wang, J. et al. (2000). JAm Chem Soc, 722(36):8595-8602.

[0239] Modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl intemucleoside linkages, mixed heteroatom and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These have those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S, and CH ₂ component parts; see US patent nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086;

5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312;

5,633,360; 5,677,437; and 5,677,439, each of which is herein incorporated by reference.

[0240] One or more substituted sugar moieties can also be included, e.g., one of the following at the 2' position: OH, SH, SCH ₃ , F, OCN, OCH ₃ , OCH3 0(CH ₂ ) _n CH ₃ , 0(CH ₂ )„ NH ₂ , or 0(CH ₂ ) _n CH3, where n is from 1 to about 10; Cl to C 10 lower alkyl, alkoxyalkoxy, substituted lower alkyl, alkaryl or aralkyl; Cl; Br; CN; CF3; OCF3; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; SOCH3; S0 ₂ CH3; ON0 ₂ ; N0 ₂ ; N3; NH ₂ ; heterocycloalkyl; heterocycloalkaryl;

aminoalkylamino; polyalkylamino; substituted silyl; an RNA cleaving group; a reporter group; an intercalator; a group for improving the pharmacokinetic properties of an oligonucleotide; or a group for improving the pharmacodynamic properties of an oligonucleotide and other substituents having similar properties. In some embodiments, a modification includes 2'- methoxyethoxy (2'-0-CH ₂ CH ₂ 0CH ₃ , also known as 2'-0-(2-methoxyethyl)) (Martin, P. et al. (1995). Helv. Chim. Acta, 78(2):486-504). Other modifications include 2'-methoxy (2'-0-CH ₃ ), 2'-propoxy (2'-OCH ₂ CH2CH3) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the oligonucleotide, particularly the 3' position of the sugar on the 3' terminal nucleotide and the 5' position of 5' terminal nucleotide. Oligonucleotides can also have sugar mimetics, such as cyclobutyls in place of the pentofuranosyl group.

[0241] In some embodiments, both a sugar and an intemucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, for example, an

aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative United States patents that teach the preparation of PNA compounds have, but are not limited to, US patent Nos.

5,539,082; 5,714,331; and 5,719,262. Further teaching of PNA compounds can be found in Nielsen, P. E. et al. (1991). Science, 254(5037):l497-l500.

[0242] In some embodiments, guide RNAs can also include, additionally or alternatively, nucleobase (often referred to in the art simply as“base”) modifications or substitutions. As used herein,“unmodified” or“natural” nucleobases include adenine (A), guanine (G), thymine (T), cytosine (C), and uracil (U). Modified nucleobases include nucleobases found only infrequently or transiently in natural nucleic acids, e.g., hypoxanthine, 6-methyladenine, 5-Me pyrimidines, particularly 5-methylcytosine (also referred to as 5-methyl-2' deoxycytosine and often referred to in the art as 5-Me-C), 5-hydroxymethylcytosine (HMC), glycosyl HMC and gentobiosyl HMC, as well as synthetic nucleobases, e.g., 2-aminoadenine, 2-(methylamino)adenine, 2- (imidazolylalkyl)adenine, 2-(aminoalklyamino)adenine or other heterosubstituted alkyladenines, 2-thiouracil, 2-thiothymine, 5-bromouracil, 5-hydroxymethyluracil, 8-azaguanine, 7- deazaguanine, N6 (6-aminohexyl)adenine, and 2,6-diaminopurine. See, for example, Kornberg, A., (1980). DNA Replication, San Francisco, CA: W. H. Freeman & Co., pp. 75-77; and

Gebeyehu, G. et al. (1987). Nucl. Acids Res., 75(11), 4513-4534. A“universal” base known in the art, e.g., inosine, can also be included. 5-Me-C substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C. (Sanghvi, Y. S. et al. (Eds.) (1993). Antisense

Research and Applications, (pp. 276-278), Boca Raton, FL:CRC Press) and are embodiments of base substitutions. [0243] In some embodiments, modified nucleobases include other synthetic and natural nucleobases, such as 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2- propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2- thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudo-uracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8- thioalkyl, 8- hydroxyl and other 8-substituted adenines and guanines, 5-halo particularly 5- bromo, 5- trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylquanine and 7- methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-deazaadenine, and 3- deazaguanine and 3-deazaadenine.

[0244] Further, nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in Kroschwitz, J. I. (Ed.) (1990). The Concise Encyclopedia of Polymer Science and Engineering , (pp. 858-859). Hoboken, N. J.: John Wiley & Sons, those disclosed in

Englisch, U. et al., (1991). Angewandte Chemie International Edition, 30(6):6l3-722, and those disclosed in Sanghvi, Y. S. (1993). Chapter 15, Antisense Research and Applications, (pp. 289- 302), Crooke, S. T. and Lebleu, B. (Eds), Boca Raton, FL:CRC Press. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the disclosure. These include 5-substituted pyrimidines, 6-azapyrimidines and N- 2, N-6 and 0-6 substituted purines, having 2-aminopropyladenine, 5-propynyluracil and 5- propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2 °C (Sanghvi, Y. S. (1993). Antisense Research and Applications, (pp. 276-278). Crooke, S.T . and Lebleu, B., (Eds.), Boca Raton, FL: CRC Press) and are

embodiments of base substitutions, even more particularly when combined with 2'-0- methoxyethyl sugar modifications. Modified nucleobases are described in US patent nos.

3,687,808, as well as 4,845,205; 5,130,302; 5,134,066; 5,175,273; 5,367,066; 5,432,272;

5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,596,091;

5,614,617; 5,681,941; 5,750,692; 5,763,588; 5,830,653; 6,005,096; and U.S. Patent Application Publication 2003/0158403.

[0245] In some embodiments, the guide RNAs and/or mRNA (or DNA) encoding an endonuclease are chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Such moieties include, but are not limited to, lipid moieties such as a cholesterol moiety (Letsinger, R. L. et al. (1989). PNAS, 86(Y1)\ 6553-6556); cholic acid (Manoharan, M. et al. (1994). Bioorg. Med. Chem. Let., 4(8): 1053-1060); a thioether, e.g., hexyl-S- tritylthiol (Manoharan, M. et al. (1992). Ann. N. Y. Acad. ScL, 660( l):306-309 and Manoharan, M. et al. (1993). Bioorg. Med. Chem. Let.,

3( l2):2765-2770); a thiocholesterol (Oberhauser, B. et al. (1992). Nucleic Acids Research, 20(3):533-538); an aliphatic chain, e.g., dodecandiol or undecyl residues (Kabanov, A. V. et al. (1990). FEBS Letters, 259(2):327-330 and Svinarchuk, F. P. et al. (1993). Biochimie, 75(l-2):49- 54); a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium l,2-di-0-hexadecyl- rac-glycero-3-H-phosphonate (Manoharan, M. et al. (1995). Tetrahedron Letters, J6(21 ):3651 - 3654 and Shea, R. G. et al. (1990). Nucleic Acids Research 78(l3):3777-3783); a polyamine or a polyethylene glycol chain (Manoharan, M. et al. (1995). Nucleosides and Nucleotides, 14(3- 5):969-973); adamantane acetic acid (Manoharan, M. et al. (1995). Tetrahedron Letters,

36( 2l):3651-3654); a palmityl moiety ((Mishra, R. K. et al. (1995). Biochimica Biophysica Acta, 1264(2):229-231); or an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety (Crooke, S. T. et al. (1996). Journal of Pharmacology and Experimental Therapeutics,

277(2):923-937). See also US Patent Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465;

5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124;

5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044;

4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582;

4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022;

5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723;

5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142;

5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599, 928 and 5,688,941.

[0246] In some embodiments, sugars and other moieties can be used to target proteins and complexes having nucleotides, such as cationic polysomes and liposomes, to particular sites. For example, hepatic cell directed transfer can be mediated via asialoglycoprotein receptors

(ASGPRs); see, e.g., Hu, J. et al., (2014). Protein Pept. Lett., 2i(l0):l025-l030. Other systems known in the art and regularly developed can be used to target biomolecules of use in the present case and/or complexes thereof to particular target cells of interest.

[0247] In some embodiments, these targeting moieties or conjugates can include conjugate groups covalently bound to functional groups, such as primary or secondary hydroxyl groups. Conjugate groups of the disclosure include intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers. Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. Groups that enhance the pharmacodynamic properties, in the context of this disclosure, include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence- specific hybridization with the target nucleic acid. Groups that enhance the pharmacokinetic properties, in the context of this disclosure, include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present disclosure. Representative conjugate groups are disclosed in International Patent Application No. PCT/US92/09196, filed Oct. 23, 1992, and U.S. Pat. No. 6,287,860, which are incorporated herein by reference. Conjugate moieties include, but are not limited to, lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl- 5 -tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl-rac- glycerol or triethylammonium l,2-di-0-hexadecyl-rac- glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxy cholesterol moiety. See, e.g., U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045;

5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025;

4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830;

5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506;

5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463;

5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371;

5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941.

[0248] Longer polynucleotides that are less amenable to chemical synthesis and are typically produced by enzymatic synthesis can also be modified by various means. Such modifications can include, for example, the introduction of certain nucleotide analogs, the incorporation of particular sequences or other moieties at the 5' or 3' ends of molecules, and other modifications. By way of illustration, the mRNA encoding Cas9 is approximately 4 kb in length and can be synthesized by in vitro transcription. Modifications to the mRNA can be applied to, e.g., increase its translation or stability (such as by increasing its resistance to degradation with a cell), or to reduce the tendency of the RNA to elicit an innate immune response that is often observed in cells following introduction of exogenous RNAs, particularly longer RNAs such as that encoding Cas9.

[0249] Numerous such modifications have been described in the art, such as polyA tails, 5' cap analogs (e.g., Anti Reverse Cap Analog (ARCA) or m7G(5’)ppp(5’)G (mCAP)), modified 5' or 3' untranslated regions (UTRs), use of modified bases (such as Pseudo-UTP, 2-Thio-UTP, 5- methylcytidine-5'-triphosphate (5-methyl-CTP) or N6-methyl-ATP), or treatment with phosphatase to remove 5' terminal phosphates. These and other modifications are known in the art, and new modifications of RNAs are regularly being developed.

[0250] There are numerous commercial suppliers of modified RNAs, including for example, TriLink Biotech, AxoLabs, Bio-Synthesis Inc., Dharmacon and many others. As described by TriLink, for example, 5-methyl-CTP can be used to impart desirable characteristics, such as increased nuclease stability, increased translation or reduced interaction of innate immune receptors with in vitro transcribed RNA. 5-Methylcytidine-5'-triphosphate (5-methyl-CTP), N6- methyl-ATP, as well as pseudo-UTP and 2-thio-UTP, have also been shown to reduce innate immune stimulation in culture and in vivo while enhancing translation, as illustrated in publications by Kormann et al. and Warren et ah, referred to below.

[0251] It has been shown that chemically modified mRNA delivered in vivo can be used to achieve improved therapeutic effects; see, e.g., Kormann, M. S. D. et al. (2011). Nature

Biotechnology 29.T54-157. Such modifications can be used, for example, to increase the stability of the RNA molecule and/or reduce its immunogenicity. Using chemical modifications such as pseudo-U, N6-methyl-A, 2-Thio-U and 5-methyl-C, it was found that substituting just one quarter of the uridine and cytidine residues with 2-thio-U and 5-methyl-C respectively resulted in a significant decrease in toll-like receptor (TLR) mediated recognition of the mRNA in mice. By reducing the activation of the innate immune system, these modifications can be used to effectively increase the stability and longevity of the mRNA in vivo, see, e.g., Kormann, M. S. D. et al. (2011). Nature Biotechnology 29.T54- 157.

[0252] It has also been shown that repeated administration of synthetic messenger RNAs incorporating modifications designed to bypass innate anti-viral responses can reprogram differentiated human cells to pluripotency. See, e.g., Warren, L. et al. (2010). Cell Stem Cell, 7(5):6l8-630. Such modified mRNAs that act as primary reprogramming proteins can be an efficient means of reprogramming multiple human cell types. Such cells are referred to as induced pluripotency stem cells (iPSCs), and it was found that enzymatically synthesized RNA incorporating 5-Methyl-CTP, Pseudo-UTP and an Anti Reverse Cap Analog (ARC A) could be used to effectively evade the cell’s antiviral response; see, e.g., Warren, L. et al. (2010). Cell Stem Cell, 7(5):6l8-630.

[0253] Other modifications of polynucleotides described in the art include, for example, the use of polyA tails, the addition of 5' cap analogs (such as m7G(5’)ppp(5’)G (mCAP)), modifications of 5' or 3' untranslated regions (UTRs), or treatment with phosphatase to remove 5' terminal phosphates - and new approaches are regularly being developed.

[0254] A number of compositions and techniques applicable to the generation of modified RNAs for use herein have been developed in connection with the modification of RNA interference (RNAi), including small-interfering RNAs (siRNAs). siRNAs present particular challenges in vivo because their effects on gene silencing via mRNA interference are generally transient, which can require repeat administration. In addition, siRNAs are double- stranded RNAs (dsRNA) and mammalian cells have immune responses that have evolved to detect and neutralize dsRNA, which is often a by-product of viral infection. Thus, there are mammalian enzymes such as PKR (dsRNA-responsive kinase), and potentially retinoic acid-inducible gene I (RIG-I), that can mediate cellular responses to dsRNA, as well as Toll-like receptors (such as TLR3, TLR7 and TLR8) that can trigger the induction of cytokines in response to such molecules; see, e.g., the reviews by Angart, P. et al. (2013). Pharmaceuticals, 6( 4):440-468; Kanasty, R. L. et al. (2012). Molecular Therapy, 20(3): 513-524; Burnett, J. C. et al. (2011). Biotechnol. J., 6(9): 1130- 1146; Judge, A. et al. (2008). Hum. Gene Ther., (2) : 111 - 124 ; and references cited therein.

[0255] A large variety of modifications have been developed and applied to enhance RNA stability, reduce innate immune responses, and/or achieve other benefits that can be useful in connection with the introduction of polynucleotides into human cells, as described herein; see, e.g., the reviews by Whitehead, K. A. et al., (2011). Annual Review of Chemical and

Biomolecular Engineering, 2:77-96; Gaglione, M. et al. (2010). Mini Rev. Med. Chem.,

70(7):578-595; Chernolovskaya, E. L. et al. (2010). Curr. Opin. Mol. Ther., 72(2):158-167; Deleavey, G. F. et al. (2009). Curr. Protoc. Nucleic Acid. Chem., 39(1): 16.3.1-13.3.22 ; Behlke, M. A. (2008). Oligonucleotides, 78(4):305-3l9; Fucini, R. V. et al. (2012). Nucleic Acid Ther., 22(3): 205-210; Bremsen, J. B. et al. (2012). Front Genet., 3:154.

[0256] As noted above, there are a number of commercial suppliers of modified RNAs, many of which have specialized in modifications designed to improve the effectiveness of siRNAs. A variety of approaches are offered based on various findings reported in the literature. For example, Dharmacon notes that replacement of a non-bridging oxygen with sulfur

(phosphorothioate, PS) has been extensively used to improve nuclease resistance of siRNAs, as reported by Kole, R. et al. (2012). Nature Reviews Drug Discovery, 77:125-140. Modifications of the 2'-position of the ribose have been reported to improve nuclease resistance of the intemucleotide phosphate bond while increasing duplex stability (Tm), which has also been shown to provide protection from immune activation. A combination of moderate PS backbone modifications with small, well-tolerated 2'-substitutions (2'-0-methyl, 2'-fluoro, 2'-hydro) have been associated with highly stable siRNAs for applications in vivo , as reported by Soutschek, J. et al. (2004). Nature, 432: 173-178; and 2'-0-methyl modifications have been reported to be effective in improving stability as reported by Volkov, A. A. et al. (2009). Oligonucleotides, 79:191-202. With respect to decreasing the induction of innate immune responses, modifying specific sequences with 2'-0-methyl, 2'-fluoro, 2'-hydro have been reported to reduce

TLR7/TLR8 interaction while generally preserving silencing activity; see, e.g., Judge, A. D. et al. (2006). Mol. Ther., 73:494-505; and Cekaite, L. et al., (2007). J. Mol. Biol., 3<55(l):90-l08. Additional modifications, such as 2-thiouracil, pseudouracil, 5-methylcytosine, 5-methyluracil, and N6-methyladenosine have also been shown to minimize the immune effects mediated by TLR3, TLR7, and TLR8; see, e.g., Kariko, K. et al. (2005). Immunity, 23(2): 165- 175.

[0257] As is also known in the art, and commercially available, a number of conjugates can be applied to polynucleotides, such as RNAs, for use herein that can enhance their delivery and/or uptake by cells, including for example, cholesterol, tocopherol and folic acid, lipids, peptides, polymers, linkers and aptamers; see, e.g., the review by Winkler, J. (2013). Ther. Deliv.,

4(7):791 -809, and references cited therein.

DELIVERY

[0258] In some embodiments, any nucleic acid molecules used in the methods provided herein, e.g., a nucleic acid encoding a genome-targeting nucleic acid of the disclosure and/or a site- directed polypeptide are packaged into or on the surface of delivery vehicles for delivery to cells. Delivery vehicles contemplated include, but are not limited to, nanospheres, liposomes, quantum dots, nanoparticles, polyethylene glycol particles, hydrogels, and micelles. As described in the art, a variety of targeting moieties can be used to enhance the preferential interaction of such vehicles with desired cell types or locations. [0259] Introduction of the complexes, polypeptides, and nucleic acids of the disclosure into cells can occur by viral or bacteriophage infection, transfection, conjugation, protoplast fusion, lipofection, electroporation, nucleofection, calcium phosphate precipitation, polyethyleneimine (PEI) -mediated transfection, DEAE-dextran mediated transfection, liposome-mediated transfection, particle gun technology, calcium phosphate precipitation, direct micro-injection, nanoparticle-mediated nucleic acid delivery, and the like.

[0260] In embodiments, guide RNA polynucleotides (RNA or DNA) and/or endonuclease polynucleotide(s) (RNA or DNA) can be delivered by viral or non- viral delivery vehicles known in the art. Alternatively, endonuclease polypeptide(s) can be delivered by viral or non-viral delivery vehicles known in the art, such as electroporation or lipid nanoparticles. In some embodiments, the DNA endonuclease can be delivered as one or more polypeptides, either alone or pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA.

[0261] In embodiments, polynucleotides can be delivered by non-viral delivery vehicles including, but not limited to, nanoparticles, liposomes, ribonucleoproteins, positively charged peptides, small molecule RNA-conjugates, aptamer-RNA chimeras, and RNA-fusion protein complexes. Some exemplary non-viral delivery vehicles are described in Peer, D. et al. (2011). Gene Therapy, 78:1127-1133 (which focuses on non-viral delivery vehicles for siRNA that are also useful for delivery of other polynucleotides).

[0262] In embodiments, polynucleotides, such as guide RNA, sgRNA, and mRNA encoding an endonuclease, can be delivered to a cell or a patient by a lipid nanoparticle (LNP).

[0263] While several non-viral delivery methods for nucleic acids have been tested both in animal models and in humans the most well developed system is lipid nanoparticles. Lipid nanoparticles (LNP) are generally composed of an ionizable cationic lipid and 3 or more additional components, typically cholesterol, DOPE and a polyethylene glycol (PEG) containing lipid, see, e.g., Example 3 A. The cationic lipid can bind to the positively charged nucleic acid forming a dense complex that protects the nucleic from degradation. During passage through a micro fluidics system the components self-assemble to form particles in the size range of 50 to 150 nM in which the nucleic acid is encapsulated in the core complexed with the cationic lipid and surrounded by a lipid bilayer like structure. After injection into the circulation of a subject these particles can bind to apolipoprotein E (apoE). ApoE is a ligand for the LDL receptor and mediates uptake into the hepatocytes of the liver via receptor mediated endocytosis. LNP of this type have been shown to efficiently deliver mRNA and siRNA to the hepatocytes of the liver of rodents, primates and humans. After endocytosis, the LNP are present in endosomes. The encapsulated nucleic acid undergoes a process of endosomal escape mediate by the ionizable nature of the cationic lipid. This delivers the nucleic acid into the cytoplasm where mRNA can be translated into the encoded protein. Thus, in some embodiments encapsulation of gRNA and mRNA encoding a Cas endonuclease (e.g., a Cas9 endonuclease) into a LNP is used to efficiently deliver both components to the hepatocytes after IV injection. After endosomal escape the Cas endonuclease mRNA is translated into the Cas endonuclease and can form a complex with the gRNA. In some embodiments, inclusion of a nuclear localization signal into the Cas endonuclease sequence promotes translocation of the Cas endonuclease/gRNA complex to the nucleus. Alternatively, the small gRNA crosses the nuclear pore complex and forms complexes with Cas endonuclease in the nucleus. Once in the nucleus, the gRNA/Cas endonuclease complexes scan the genome for homologous target sites and generate double-strand breaks preferentially at the desired target site in the genome. The half-life of RNA molecules in vivo is short on the order of hours to days. Similarly, the half-life of proteins tends to be short, on the order of hours to days. Thus, in some embodiments, delivery of gRNA and Cas endonuclease mRNA using an LNP can result in only transient expression and activity of the gRNA/Cas endonuclease complex. This can provide the advantage of reducing the frequency of off-target cleavage and thus minimize the risk of genotoxicity in some embodiments. LNPs are generally less immunogenic than viral particles. While many humans have preexisting immunity to AAV there is no pre-existing immunity to LNPs. In addition, an adaptive immune response against LNPs is unlikely to occur, which enables repeat dosing of LNPs.

[0264] Several different ionizable cationic lipids have been developed for use in LNPs. These include C12-200 (Love, K. T. et al (2010). PNAS 107(5): 1864-1869), MC3, LN16, MD1 among others. In one type of LNP, a GalNac moiety is attached to the outside of the LNP and acts as a ligand for uptake into the liver via the asialyloglycoprotein receptor. Any of these cationic lipids can be used to formulate LNPs for delivery of gRNA and Cas endonuclease mRNA to the liver.

[0265] In some embodiments, an LNP has a diameter of less than 1000 nm, 500 nm, 250 nm, 200 nm, 150 nm, 100 nm, 75 nm, 50 nm, or 25 nm. Alternatively, a nanoparticle can range in size from 1-1000 nm, 1-500 nm, 1-250 nm, 25-200 nm, 25-100 nm, 35-75 nm, or 25-60 nm.

[0266] LNPs can be made from cationic, anionic, or neutral lipids. Neutral lipids, such as the fusogenic phospholipid DOPE or the membrane component cholesterol, can be included in LNPs as 'helper lipids' to enhance transfection activity and nanoparticle stability. Limitations of cationic lipids include low efficacy owing to poor stability and rapid clearance, as well as the generation of inflammatory or anti-inflammatory responses. LNPs can also have hydrophobic lipids, hydrophilic lipids, or both hydrophobic and hydrophilic lipids.

[0267] Any lipid or combination of lipids that are known in the art can be used to produce a LNP. Examples of lipids used to produce LNPs are: DOTMA, DOSPA, DOTAP, DMRIE, DC- cholesterol, DOTAP-cholesterol, GAP-DMORIE-DPyPE, and GL67A-DOPE-DMPE- polyethylene glycol (PEG). Examples of cationic lipids are: 98N12-5, C 12-200, DLin-KC2- DMA (KC2), DLin-MC3 -DMA (MC3), XTC, MD1, and 7C1. Examples of neutral lipids are: DPSC, DPPC, POPC, DOPE, and SM. Examples of PEG-modified lipids are: PEG-DMG, PEG- CerCl4, and PEG-CerC20.

[0268] In embodiments, the lipids can be combined in any number of molar ratios to produce a LNP. In addition, the polynucleotide(s) can be combined with lipid(s) in a wide range of molar ratios to produce a LNP.

[0269] In embodiments, the site-directed polypeptide and genome-targeting nucleic acid can each be administered separately to a cell or a patient. On the other hand, the site-directed polypeptide can be pre-complexed with one or more guide RNAs, or one or more crRNA together with a tracrRNA. The pre-complexed material can then be administered to a cell or a patient. Such pre-complexed material is known as a ribonucleoprotein particle (RNP).

[0270] RNA is capable of forming specific interactions with RNA or DNA. While this property is exploited in many biological processes, it also comes with the risk of promiscuous interactions in a nucleic acid-rich cellular environment. One solution to this problem is the formation of ribonucleoprotein particles (RNPs), in which the RNA is pre-complexed with an endonuclease. Another benefit of the RNP is protection of the RNA from degradation.

[0271] In some embodiments, the endonuclease in the RNP can be modified or unmodified. Likewise, the gRNA, crRNA, tracrRNA, or sgRNA can be modified or unmodified. Numerous modifications are known in the art and can be used.

[0272] The endonuclease and sgRNA can be generally combined in a 1:1 molar ratio.

Alternatively, the endonuclease, crRNA and tracrRNA can be generally combined in a 1:1:1 molar ratio. However, a wide range of molar ratios can be used to produce a RNP.

[0273] In some embodiments, a recombinant adeno-associated virus (AAV) vector can be used for delivery. Techniques to produce rAAV particles, in which an AAV genome to be packaged that includes the polynucleotide to be delivered, rep and cap genes, and helper virus functions are provided to a cell are standard in the art. Production of rAAV requires that the following components are present within a single cell (denoted herein as a packaging cell): a rAAV genome, AAV rep and cap genes separate from (i.e., not in) the rAAV genome, and helper virus functions. The AAV rep and cap genes can be from any AAV serotype for which recombinant virus can be derived, and can be from a different AAV serotype than the rAAV genome ITRs, including, but not limited to, AAV serotypes AAV-l, AAV-2, AAV-3, AAV-4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAV-l 1, AAV-12, AAV-13 and AAV rh.74. Production of pseudotyped rAAV is disclosed in, for example, international patent application publication number WO 01/83692. See Table 1.

Table 1. AAV serotype and Genbank Accession No. of some selected AAVs.

[0274] In some embodiments, a method of generating a packaging cell involves creating a cell line that stably expresses all of the necessary components for AAV particle production. For example, a plasmid (or multiple plasmids) having a rAAV genome lacking AAV rep and cap genes, AAV rep and cap genes separate from the rAAV genome, and a selectable marker, such as a neomycin resistance gene, are integrated into the genome of a cell. AAV genomes have been introduced into bacterial plasmids by procedures such as GC tailing (Samulski, R. J. et al.

(1982). PNAS, 79(6):2077-208l), addition of synthetic linkers containing restriction

endonuclease cleavage sites (Laughlin, C. A. et al. (1983). Gene, 23(l):65-73) or by direct, blunt-end ligation (Senapathy, P. et al. (1984). J. Biol. Chem., 259:4661-4666). The packaging cell line is then infected with a helper virus, such as adenovirus. The advantages of this method are that the cells are selectable and are suitable for large-scale production of rAAV. Other examples of suitable methods employ adenovirus or baculovirus, rather than plasmids, to introduce rAAV genomes and/or rep and cap genes into packaging cells.

[0275] General principles of rAAV production are reviewed in, for example, Carter, B. J. (1992). Current Opinion in Biotechnology, 3(5):533-539; and Muzyczka, M. (1992). Currents Topics in Microbiology and Immunology, 158:91-129. Various approaches are described in Tratschin, J. D. et al. (1984). Mol. Cell. Biol., 4(l0):2072-208l; Hermonat, P. L. et al. (1984). PNAS, 8i(20):6466-6470; Tratschin, J. D. et al. (1985). Mol. Cell. Biol., 5(l l):325l-3260; McLaughlin, S. K. et al. (1988). /. Virol., 62(6): 1963-1973; Lebkowski, J. S. et al. (1988) Mol. Cell. Biol., 8(l0):3988-3996; Samulski, R. J. et al. (1989). J. Virol., 63(9):3822-3828; U.S.

Patent No. 5,173,414; WO 95/13365 and corresponding U.S. Patent No. 5,658.776; WO

95/13392; WO 96/17947; PCT/US98/18600; WO 97/09441 (PCT/US 96/ 14423); WO 97/08298 (PCT/US96/13872); WO 97/21825 (PCT/US96/20777); WO 97/06243 (PCT/FR96/01064); WO 99/11764; Perrin, P. et al. (1995). Vaccine, 73(13):1244-1250; Paul, R. W. et al. (1993). Human Gene Therapy, 4(5):609-6l5; Clark, K. R. et al. (1996). Gene Therapy, 3(12): 1124- 1132; U.S. Patent. No. 5,786,211; U.S. Patent No. 5,871,982; and U.S. Patent. No. 6,258,595.

[0276] AAV vector serotypes can be matched to target cell types. For example, the following exemplary cell types can be transduced by the indicated AAV serotypes among others. For example, the serotypes of AAV vectors suitable to liver tissue/cell type include, but not limited to, AAV3, AAV5, AAV8 and AAV9. [0277] In addition to adeno-associated viral vectors, other viral vectors can be used. Such viral vectors include, but are not limited to, lentivirus, alphavirus, enterovirus, pestivirus, baculovirus, herpesvirus, Epstein Barr virus, papovavirusr, poxvirus, vaccinia virus, and herpes simplex virus.

[0278] In some embodiments, Cas9 mRNA, sgRNA targeting one or two loci in an LPA gene, and donor DNA are each separately formulated into lipid nanoparticles, or are all co-formulated into one lipid nanoparticle, or co-formulated into two or more lipid nanoparticles.

[0279] In some embodiments, Cas endonuclease (e.g., Cas9 endonuclease) mRNA is formulated in a lipid nanoparticle, while gRNA (e.g., sgRNA) and DNA donor are delivered in an AAV vector. In some embodiments, Cas endonuclease mRNA and gRNA are co-formulated in a lipid nanoparticle, while donor DNA is delivered in an AAV vector.

[0280] Options are available to deliver a Cas endonuclease as a DNA plasmid, as mRNA or as a protein. A guide RNA can be expressed from the same DNA, or can also be delivered as an RNA. The RNA can be chemically modified to alter or improve its half-life, or decrease the likelihood or degree of immune response. The endonuclease protein can be complexed with the gRNA prior to delivery. Viral vectors allow efficient delivery; split versions of a Cas

endonuclease and smaller Cas endonuclease orthologs can be packaged in AAV, as can donors for HDR. A range of non- viral delivery methods also exist that can deliver each of these components, or non- viral and viral methods can be employed in tandem. For example, nanoparticles can be used to deliver a Cas endonuclease and guide RNA, while AAV can be used to deliver a donor DNA.

[0281] In some embodiments, a CRISPR-Cas system described herein comprises a gRNA (e.g., an sgRNA) directed to a DNA sequence within or near (for example, within any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from) an LPA gene together with a Cas endonuclease (e.g., a Cas9 endonuclease). In some embodiments, the Cas endonuclease is delivered as an mRNA encoding the Cas endonuclease operably fused to one or more nuclear localization signals (NLS). In some embodiments, the gRNA and Cas endonuclease mRNA are delivered to hepatocytes by packaging into a lipid nanoparticle. In some embodiments, the lipid nanoparticle contains the lipid C 12-200 (Love, K. T. et al. (2010). PNAS, 107(5): 1864-1869). In some embodiments, the ratio of the gRNA to the Cas endonuclease mRNA that is packaged in the LNP is 1:1 (mass ratio) to result in maximal DNA cleavage in vivo in mice. In alternative embodiments, different mass ratios of the gRNA to the Cas endonuclease mRNA that is packaged in the LNP can be used, for example, 10:1, 9:1, 8:1, 7:1, 6:1, 5:1, 4:1, 3:1 or 2:1 or reverse ratios. In some embodiments, the Cas endonuclease mRNA and the gRNA are packaged into separate LNP formulations and the Cas endonuclease mRNA-containing LNP is delivered to a subject about 1 to about 8 hours before the LNP containing the gRNA to allow time for the Cas endonuclease mRNA to be translated prior to delivery of the gRNA.

[0282] In some embodiments, an LNP formulation encapsulating a gRNA (e.g., sgRNA) and a Cas endonuclease (e.g., Cas9 endonuclease) mRNA (an“LNP-nuclease formulation”) is administered to a subject, e.g., a patient, that previously was administered a DNA donor template packaged into an AAV. In some embodiments, the LNP-nuclease formulation is administered to the patient within 1 day to 28 days, within 7 days to 28 days, or within 7 days to 14 days after administration of the AAV-donor DNA template. The optimal timing of delivery of the LNP- nuclease formulation relative to the AAV-donor DNA template can be determined using the techniques known in the art, e.g., studies done in animal models including mice and monkeys.

[0283] In some embodiments, a DNA donor template that encodes a series of stop codons or a polyadenylation signal is delivered to hepatocytes of a subject, e.g., a patient, using a non- viral delivery method. While some subjects (generally 30%) have pre-existing neutralizing antibodies directed to most commonly used AAV serotypes that prevents efficacious gene delivery by the AAV, this is not a barrier for non-viral delivery methods. Several non-viral delivery

methodologies are known in the field. In particular, lipid nanoparticles (LNPs) are known to efficiently deliver their encapsulated cargo to the cytoplasm of hepatocytes after intravenous injection in animals and humans. These LNPs are actively taken up by the liver through a process of receptor mediated endocytosis, resulting in preferential uptake into the liver.

[0284] In some embodiments, in order to promote nuclear localization of a donor template, a DNA sequence that can promote nuclear localization of plasmids, e.g., a 366 bp region of the simian virus 40 (SV40) origin of replication and early promoter, can be added to the donor template. Other DNA sequences that bind to cellular proteins can also be used to improve nuclear entry of DNA.

[0285] In some embodiments, the level of Lp(a) is measured in the blood of a subject, e.g., a patient, following the first administration of an LNP-nuclease formulation, e.g., containing gRNA and Cas9 nuclease, with the goal of reducing the levels of Lp(a) . If the reduction in the levels of Lp(a) is not deemed sufficient to have a clinical benefit, for example, reducing LP(a) levels to less than 55 mg/dL, then a second or third administration of the LNP-nuclease formulation can be given to promote additional targeted disruption of the LPA gene. The feasibility of using multiple doses of the LNP-nuclease formulation to obtain the desired reduction in levels of Lp(a)can be tested and optimized using techniques known in the field, e.g., tests using animal models, including mouse models and non-human primate models.

THERAPEUTIC APPROACH

[0286] In one aspect, provided herein is a gene therapy approach for treating a cardiovascular disease in a patient or reducing the risk of developing a cardiovascular disease in a patient by editing the genome of the patient. In some embodiments, the gene therapy approach functionally knocks out an LPA gene in the genome of a relevant cell type in patients and this can provide a permanent cure for the cardiovascular disease by permanently reducing the levels of Lp(a) in the blood. In some embodiments, a cell type subject to the gene therapy approach in which to functionally knock out an LPA gene is the hepatocyte because these cells express and secrete apo(a). In addition, this approach using hepatocytes can be considered for pediatric patients whose livers are not fully grown because the functional gene knockout would be transmitted to the daughter cells as the hepatocytes divide. In some embodiments, the cardiovascular disease is stroke, myocardial infarction, atherosclerosis, familial hypercholesterolemia, atherosclerosis, thrombosis, calcific aortic valve disease, coronary artery disease, peripheral arterial disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, congenital heart disease, or rheumatic heart disease.

[0287] In another aspect, provided herein are cellular and in vivo methods for using genome engineering tools to create permanent changes to the genome by functionally knocking-out an LPA gene in the genome of a cell. Such methods use endonucleases, such as CRISPR-associated (CRISPR/Cas9, Cpfl and the like) nucleases, to permanently delete, insert, edit, correct, or replace any sequences from a genome or insert an exogenous sequence. In this way, the examples set forth in the present disclosure functionally knockout an LPA gene with a single treatment or a limited number of treatments (such as 2, 3, 4, 5, 6, 7, 8, 9, or 10 treatments, rather than requiring repetitive therapies for the lifetime of the patient).

[0288] In some embodiments, an in vivo based therapy is employed. In this method, the chromosomal DNA of the cells in the patient is edited using the materials and methods described herein. In some embodiments, the cells are hepatocytes. [0289] In one aspect, the present disclosure provides a method of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease in a subject in need thereof comprising: providing (i) a gRNA according to any of the gRNAs described herein or nucleic acid encoding the gRNA; and (ii) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease to a cell in the subject, thereby genetically modifying the cell.

In some embodiments, the method comprises providing to the cell an AAV vector comprising the nucleic acid encoding the gRNA and/or nucleic acid encoding the DNA endonuclease. In some embodiments, the subject is a patient having or is suspected of having cardiovascular disease. In some embodiments, the subject is diagnosed with a risk of cardiovascular disease. In some embodiments, the cell is a hepatocyte. In some embodiments, the cardiovascular disease is selected from the group consisting of stroke, myocardial infarction, atherosclerosis, familial hypercholesterolemia, atherosclerosis, thrombosis, calcific aortic valve disease, coronary artery disease, peripheral arterial disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, congenital heart disease, and rheumatic heart disease. In some embodiments, the subject is human.

[0290] In some embodiments, provided herein is a method of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease in a subject, comprising providing to a cell in the subject: a) a DNA endonuclease (e.g., a Cas endonuclease, such as Cas9) or nucleic acid encoding the DNA endonuclease; and b) a gRNA comprising a spacer sequence

complementary to a target genomic sequence within or near an endogenous apolipoprotein(a)

( LPA ) gene in the cell, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence in the cell to generate a genetically modified cell with reduced expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the cell prior to carrying out the method is an input cell that expresses apo(a) at a level greater than a reference level for the expression of apo(a) in the input cell type. In some embodiments, the genetically modified cell has reduced functional expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the genetically modified cell has no functional expression of apo(a). In some embodiments, the method further comprises providing to the cell a donor template comprising a nucleic acid sequence to be inserted into the LPA gene. In some embodiments, the nucleic acid sequence to be inserted encodes one or more STOP codons, and the system is configured to insert a STOP codon in-frame into an LPA gene coding sequence such that the LPA gene is rendered non functional. In some embodiments, the gRNA targets within or near a coding sequence in the LPA gene. In some embodiments, the gRNA targets exon 1, exon 2, or exon 3 of the LPA gene. In some embodiments, the gRNA targets a sequence in the LPA gene corresponding to a kringle IV repeat region in the apo(a) protein. In some embodiments, the gRNA targets within or near a non-coding sequence in the LPA gene. In some embodiments, the gRNA targets an LPA gene intron. In some embodiments, the gRNA targets an LPA gene regulatory region. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 1-132. In some embodiments, the DNA endonuclease is a Cas endonuclease, e.g., a Cas9 endonuclease. In some embodiments, the gRNA is an sgRNA.

[0291] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the subject has a cardiovascular disease, and the method is a method of treating the cardiovascular disease.

In some embodiments, the subject is diagnosed with or suspected of having the cardiovascular disease.

[0292] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the subject is at risk for developing a cardiovascular disease, and the method is a method of reducing the risk of the subject developing the cardiovascular disease. In some embodiments, the subject is diagnosed with or suspected of being at risk for developing the cardiovascular disease.

[0293] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the endogenous LPA gene is a variant associated with increased cardiovascular disease risk and/or increased Lp(a) expression.

[0294] In some embodiments, provided herein is a method of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease in a subject, comprising providing to a cell in the subject: a) a DNA endonuclease (e.g., a Cas endonuclease, such as Cas9) or nucleic acid encoding the DNA endonuclease; and b) a gRNA comprising i) a spacer sequence complementary to a target genomic sequence within exon 3 of an LPA gene; ii) a spacer sequence complementary to a target genomic sequence within exon 2 of an LPA gene; iii) a spacer sequence complementary to a target genomic sequence within an LPA gene corresponding to a kringle IV repeat region in apo(a); or iv) a spacer sequence complementary to a target genomic sequence within a regulatory region of an LPA gene, or nucleic acid encoding the gRNA, wherein the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting editing of the target genomic sequence in the cell to generate a genetically modified cell with reduced expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the gRNA comprises i) a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19; ii) a spacer sequence from any one of SEQ ID NOs: 1-12 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 1-12; iii) a spacer sequence from any one of SEQ ID NOs: 107-132 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 107-132; or iv) a spacer sequence from any one of SEQ ID NOs: 20-106 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 20- 106. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 14, 15, 18, and 19. In some embodiments, the spacer sequence is 19 nucleotides in length and does not include the nucleotide at position 1 of the sequence from which it is selected. For example, in some embodiments, the spacer sequence is the nucleotide sequence of any one of SEQ ID NOs: 157-160. In some embodiments, the DNA endonuclease and gRNA are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of generating a double-strand break at the target genomic sequence.

[0295] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 13-19 or a variant thereof having no more than 3 mismatches compared to any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer sequence from any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of any one of SEQ ID NOs: 13-19. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 14 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 14. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 15 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 15. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 18 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 18. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 19 or a variant thereof having no more than 3 mismatches compared to SEQ ID NO: 19. In some embodiments, the gRNA comprises a spacer sequence from SEQ ID NO: 19. In some embodiments, the gRNA comprises a spacer having the nucleotide sequence of SEQ ID NO: 19.

[0296] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the spacer comprises a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132. In some embodiments, the spacer is 20 nucleotides in length. In some embodiments, the spacer comprises a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132.

[0297] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near (for example, within any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from) exon 1, 2, or 3 of the LPA gene are provided to the cell. In some embodiments, the spacer(s) are complementary to a genomic sequence within or near (for example, within any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more bases from) exon 3 of the LPA gene. In some

embodiments, the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0298] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, two gRNAs comprising spacers complementary to a genomic sequence within a transcriptional regulatory sequence of the LPA gene are provided to the cell. In some embodiments, the transcriptional regulatory sequence comprises a promoter or enhancer. In some embodiments, the gRNAs are any two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 20-106 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 20-106.

[0299] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, a gRNA comprising a spacer complementary to a genomic sequence encoding a kringle domain in an apo(a) protein is provided to the cell. In some embodiments, the gRNA comprises a spacer selected from the group consisting of SEQ ID NOs: 107-132 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 107-132.

[0300] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof. In some embodiments, the DNA endonuclease is Cas9. In some embodiments, the Cas9 endonuclease is from Streptococcus pyogenes (SpyCas9). In some embodiments, the Cas9 endonuclease is from Staphylococcus lugdunensis (SluCas9). In some embodiments, a DNA sequence that is transcribed to the nucleic acid encoding the DNA endonuclease is codon optimized. In some embodiments, the nucleic acid encoding the DNA endonuclease comprises a 5’ CAP structure and 3’ polyA tail. In some embodiments, the nucleic acid encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0301] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the method comprises providing to the cell a nucleic acid encoding the DNA endonuclease. In some embodiments, the nucleic acid encoding the DNA endonuclease is codon-optimized for expression in the cell. In some embodiments, the nucleic acid encoding the DNA endonuclease is DNA, such as a DNA plasmid. In some embodiments, the nucleic acid encoding the DNA endonuclease is RNA, such as mRNA. [0302] In some embodiments, the method further comprises providing (iii) a donor template comprising a nucleic acid sequence encoding one or more STOP codons. In some embodiments, the donor template comprising a nucleic acid sequence encoding one or more STOP codons comprises three STOP codons in each of the 3 translation frames present in succession in the donor DNA sequence. In some embodiments, the nucleic acid sequence encoding one or more STOP codons is codon optimized. In some embodiments, the nucleic acid sequence encoding one or more STOP codons does not comprise CpG dinucleotides.

[0303] In some embodiments, the nucleic acid sequence encoding one or more STOP codons is inserted into a genomic sequence of the cell. In some embodiments, the insertion is at, within, or near the endogenous apolipoprotein(a) ( LPA ) gene or LPA gene regulatory elements in the genome of the cell. In some embodiments, the donor DNA is delivered as a double-stranded or single-stranded oligonucleotide. In some embodiments, the single- stranded or double- stranded donor DNA contains homology arms composed of the sequences of 20 bp to 1000 bp, or more, flanking each side of the sgRNA cut site.

[0304] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the method further comprises providing to the cell a donor template comprising a sequence to be integrated at or near the target genomic sequence. In some embodiments, the donor template comprises a donor cassette comprising a nucleic acid sequence encoding one or more STOP codons. In some embodiments, the nucleic acid sequence encoding one or more STOP codons encodes three STOP codons in each of the 3 possible translation frames in the forward orientation and/or three STOP codons in each of the 3 possible translation frames in the reverse orientation. An exemplary sequence encoding three STOP codons in each of the 3 possible translation frames in both the forward and reverse orientations is provided in SEQ ID NO: 155. In some embodiments, the DNA endonuclease, gRNA, and donor template are configured such that a complex formed by association of the DNA endonuclease with the gRNA is capable of promoting targeted integration of the donor cassette into a target genomic locus (e.g., a coding region) comprising the target genomic sequence. In some embodiments, integration of the donor cassette into the target genomic locus in the cell results in the generation of a genetically modified cell with reduced functional expression of apo(a) as compared to a corresponding unmodified cell. For example, integration of the donor template into an LPA gene coding sequence such that a premature STOP codon is inserted in-frame can result in a non-functional or reduced function truncated translation product as compared to the apo(a) protein encoded by the unmodified LPA gene.

[0305] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein employing a donor template, the donor template is configured such that the donor cassette is capable of being integrated into a genomic locus targeted by the gRNA by homology directed repair (HDR). In some embodiments, the donor cassette is flanked on both sides by homology arms corresponding to sequences in the targeted genomic locus. In some embodiments, the homology arms are at least about 0.2 kb (such as at least about any of 0.3 kb, 0.4 kb, 0.5 kb, 0.6 kb, 0.7 kb, 0.8 kb, 0.9 kb, 1 kb, or greater) in length. In some embodiments, the homology arms are at least about 0.4 kb, e.g., 0.45 kb, 0.6 kb, or 0.8 kb, in length. In some embodiments, the donor template is encoded in an Adeno Associated Virus (AAV) vector. In some embodiments, the AAV vector is an AAV2, AAV5, or AAV6 vector. In some embodiments, the AAV vector is an AAV6 vector.

[0306] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein employing a donor template, the donor template is configured such that the donor cassette is capable of being integrated into a genomic locus targeted by the gRNA by non-homologous end joining (NHEJ). In some embodiments, the donor cassette is flanked on one or both sides by a gRNA target site. In some embodiments, the donor cassette is flanked on both sides by a gRNA target site. In some embodiments, the gRNA target site is a target site for the gRNA targeting the LPA gene. In some embodiments, the gRNA target site of the donor template is the reverse complement of the cell genome gRNA target site. In some embodiments, the donor template is encoded in an Adeno Associated Virus (AAV) vector. In some embodiments, the AAV vector is an AAV2, AAV5, or AAV6 vector. In some embodiments, the AAV vector is an AAV6 vector.

[0307] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the DNA endonuclease or nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle. In some embodiments, the liposome or lipid nanoparticle also comprises the gRNA or nucleic acid encoding the gRNA. In some embodiments, the liposome or lipid nanoparticle is a lipid nanoparticle. In some embodiments, the system comprises a lipid nanoparticle comprising nucleic acid encoding the DNA endonuclease and the gRNA. In some embodiments, the nucleic acid encoding the DNA endonuclease is an mRNA encoding the DNA endonuclease.

[0308] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the DNA endonuclease is pre-complexed with the gRNA, forming a Ribonucleoprotein (RNP) complex, prior to the provision to the cell. In some embodiments, where the method employs a donor template, the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell after the donor template is provided to the cell. In some embodiments, the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell about 1 to 14 days after the donor template is provided to the cell.

[0309] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, one or more (such as any of one, two, three, four, five, or more) additional doses of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell following a first dose of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA. In some

embodiments, one or more additional doses of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA are provided to the cell following a first dose of the DNA endonuclease or nucleic acid encoding the DNA endonuclease and the gRNA or nucleic acid encoding the gRNA until a) a target frequency of editing the target genomic sequence in a population of cells in the subject is achieved; and/or b) a target plasma level of Lp(a) in the subject is achieved. In some embodiments, the population of cells of a) is the hepatocytes in the subject.

[0310] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the cell prior to carrying out the method is an input cell that expresses apo(a). In some embodiments, the input cell expresses apo(a) at a level greater than a reference level for the expression of apo(a) in the input cell type. In some embodiments, the genetically modified cell has reduced functional expression of apo(a) as compared to a corresponding unmodified cell. In some embodiments, the genetically modified cell has no functional expression of apo(a). In some embodiments, the input cell is a hepatocyte. [0311] An advantage of in vivo gene therapy is the ease of therapeutic production and administration. The same therapeutic approach and therapy can be used to treat more than one patient, for example a number of patients who share the same or similar genotype or allele. In contrast, ex vivo cell therapy typically uses a patient’s own cells, which are isolated, manipulated and returned to the same patient.

[0312] In some embodiments, the subject has high levels of Lp(a) (e.g., plasma Lp(a)). A subject with high levels of Lp(a) can include, e.g., subjects with greater Lp(a) levels than 90% of the human population. In some embodiments, the subject has symptoms of a cardiovascular disease. In some embodiments, the subject does not have symptoms of a cardiovascular disease. In some embodiments, the subject is at risk of developing a cardiovascular disease. In some embodiments, the subject is suspected of having a cardiovascular disease. In some embodiments, the subject has plasma Lp(a) levels in excess of about 30 mg/dL (such as in excess of about any of 40 mg/dL, 50 mg/dL, 60 mg/dL, 70 mg/dL, 80 mg/dL, 100 mg/dL, 200 mg/dL, 300 mg/dL, or greater). In some embodiments, the subject has one or more genetic markers (e.g., deletion, insertion, and/or mutation) in the endogenous LPA gene or its regulatory sequences such that the activity, including the expression level or functionality, of the apo(a) protein is substantially increased compared to a normal, healthy subject.

[0313] In some embodiments, the subject who is in need of the treatment method accordance with the disclosures is a patient having high levels of Lp(a) as defined as Lp(a) levels higher than 90% of the human population (e.g., higher than 60 mg/dL) and symptoms of a cardiovascular disease. In some embodiments, the subject can be a human suspected of having the

cardiovascular disease. Alternatively, the subject can be a human diagnosed with a risk of the cardiovascular disease due to the presence of Lp(a) levels in excess of 60 mg/dL or 70 mg/dL or 80 mg/dL or 100 mg/dL or 200 mg/dL or 300 mg/dL. In some embodiments, the subject who is in need of the treatment can have one or more genetic differences (e.g., deletion, insertion and/or mutation) in the endogenous LPA gene or its regulatory sequences such that the activity including the expression level or functionality of the apo(a) protein is substantially increased compared to a normal, healthy subject.

[0314] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the frequency of editing the target genomic sequence in a population of cells in the subject is greater than about 10% (such as greater than about any of 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or greater). In some embodiments, the population of cells in the subject is the liver cells in the subject. In some embodiments, the population of cells in the subject is the hepatocytes in the subject.

[0315] In some embodiments, according to any of the methods of treating a cardiovascular disease or reducing the risk of developing a cardiovascular disease described herein, the plasma Lp(a) level in the subject following carrying out the method is reduced to about 50 mg/dL or lower (such to about any of 40 mg/dL, 30 mg/dL, 20 mg/dL, or lower). In some embodiments, the plasma Lp(a) level in the subject following carrying out the method is reduced to about 40 mg/dL or lower. In some embodiments, the plasma Lp(a) level in the subject following carrying out the method is reduced to about 30 mg/dL or lower. In some embodiments, the plasma Lp(a) level in the subject following carrying out the method is reduced to about 20 mg/dL or lower.

[0316] In some embodiments, according to any of the methods described herein, the subject is human.

COMPOSITION

[0317] In one aspect, the present disclosure provides compositions for carrying out the methods disclosed herein. A composition can include one or more of the following: a genome targeting nucleic acid (e.g., gRNA); a site-directed polypeptide (e.g., DNA endonuclease) or a nucleotide sequence encoding the site-directed polypeptide; and a polynucleotide to be inserted (e.g., a donor template) to affect the desired genetic modification of the methods disclosed herein.

[0318] In some embodiments, a composition has a nucleotide sequence encoding a genome targeting nucleic acid (e.g., gRNA).

[0319] In some embodiments, a composition has a site-directed polypeptide (e.g., DNA endonuclease). In some embodiments, a composition has a nucleotide sequence encoding the site-directed polypeptide.

[0320] In some embodiments, a composition has a polynucleotide (e.g., a donor template) to be inserted into a genome.

[0321] In some embodiments, a composition has (i) a nucleotide sequence encoding a genome targeting nucleic acid (e.g., gRNA) and (ii) a site-directed polypeptide (e.g., DNA endonuclease) or a nucleotide sequence encoding the site-directed polypeptide. [0322] In some embodiments, a composition has (i) a nucleotide sequence encoding a genome targeting nucleic acid (e.g., gRNA) and (ii) a polynucleotide (e.g., a donor template) to be inserted into a genome.

[0323] In some embodiments, a composition has (i) a site-directed polypeptide (e.g., DNA endonuclease) or a nucleotide sequence encoding the site-directed polypeptide and (ii) a polynucleotide (e.g., a donor template) to be inserted into a genome.

[0324] In some embodiments, a composition has (i) a nucleotide sequence encoding a genome targeting nucleic acid (e.g., gRNA), (ii) a site-directed polypeptide (e.g., DNA endonuclease) or a nucleotide sequence encoding the site-directed polypeptide and (iii) a polynucleotide (e.g., a donor template) to be inserted into a genome.

[0325] In some embodiments of any of the above compositions, the composition has a single molecule guide genome-targeting nucleic acid. In some embodiments of any of the above compositions, the composition has a double-molecule genome-targeting nucleic acid. In some embodiments of any of the above compositions, the composition has two or more double molecule guides or single-molecule guides. In some embodiments, the composition has a vector that encodes the nucleic acid targeting nucleic acid. In some embodiments, the genome-targeting nucleic acid is a DNA endonuclease, in particular, Cas9.

[0326] In some embodiments, a composition can contain composition that includes one or more gRNA that can be used for genome-edition. The gRNA for the composition can target a genomic site at, within, or near the endogenous LPA gene. Therefore, in some embodiments, the gRNA can have a spacer sequence complementary to a genomic sequence at, within, or near the LPA gene.

[0327] In some embodiments, a gRNA for a composition comprises a spacer comprising the sequence of any one of SEQ ID NOs: 1-132 and variants thereof having at least about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90% or about 95% identity or homology to the sequence of any one of SEQ ID NOs: 1-132. In some embodiments, the variants of the spacer have at least about 85% homology to the sequence of any one of SEQ ID NOs: 1-132.

[0328] In some embodiments, a gRNA for a composition has a spacer that is complementary to a target site in the genome. In some embodiments, the spacer sequence is 15 bases to 20 bases in length. In some embodiments, a complementarity between the spacer sequence to the genomic sequence is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or at least 100%.

[0329] In some embodiments, a composition can have a DNA endonuclease or an

oligonucleotide encoding the DNA endonuclease and/or a donor template comprising multiple stop codons and a functional polyadenylation signal. In some embodiments, the DNA

endonuclease is Cas9. In some embodiments, the oligonucleotide encoding the DNA

endonuclease is DNA or RNA.

[0330] In some embodiments, one or more of any oligonucleotides or nucleic acid sequences for the kit can be encoded in an Adeno Associated Virus (AAV) vector. Therefore, in some embodiments, a gRNA can be encoded in an AAV vector. In some embodiments, a nucleic acid encoding a DNA endonuclease can be encoded in an AAV vector. In some embodiments, a donor template can be encoded in an AAV vector. In some embodiments, two or more oligonucleotides or nucleic acid sequences can be encoded in a single AAV vector. Thus, in some embodiments, a gRNA sequence and a DNA endonuclease-encoding nucleic acid can be encoded in a single AAV vector.

[0331] In some embodiments, a composition can have a liposome or a lipid nanoparticle.

Therefore, in some embodiments, any compounds (e.g., a DNA endonuclease or a nucleic acid encoding the DNA endonuclease, gRNA and donor template) of the composition can be formulated in a liposome or lipid nanoparticle. In some embodiments, one or more such compounds are associated with a liposome or lipid nanoparticle via a covalent bond or non- covalent bond. In some embodiments, any of the compounds can be separately or together contained in a liposome or lipid nanoparticle. Therefore, in some embodiments, each of a DNA endonuclease or a nucleic acid encoding the DNA endonuclease, gRNA and donor template is separately formulated in a liposome or lipid nanoparticle. In some embodiments, a DNA endonuclease is formulated in a liposome or lipid nanoparticle with gRNA. In some

embodiments, a DNA endonuclease or a nucleic acid encoding the DNA endonuclease, gRNA and donor template are formulated in a liposome or lipid nanoparticle together.

[0332] In some embodiments, a composition described above further has one or more additional reagents, where such additional reagents are selected from a buffer, a buffer for introducing a polypeptide or polynucleotide into a cell, a wash buffer, a control reagent, a control vector, a control RNA polynucleotide, a reagent for in vitro production of the polypeptide from DNA, adaptors for sequencing and the like. A buffer can be a stabilization buffer, a reconstituting buffer, a diluting buffer, or the like. In some embodiments, a composition can also include one or more components that can be used to facilitate or enhance the on-target binding or the cleavage of DNA by the endonuclease, or improve the specificity of targeting.

[0333] In some embodiments, any components of a composition are formulated with pharmaceutically acceptable excipients such as carriers, solvents, stabilizers, adjuvants, diluents, etc., depending upon the particular mode of administration and dosage form. In embodiments, guide RNA compositions are generally formulated to achieve a physiologically compatible pH, and range from a pH of about 3 to a pH of about 11, about pH 3 to about pH 7, depending on the formulation and route of administration. In some embodiments, the pH is adjusted to a range from about pH 5.0 to about pH 8. In some embodiments, the composition has a therapeutically effective amount of at least one compound as described herein, together with one or more pharmaceutically acceptable excipients. Optionally, the composition can have a combination of the compounds described herein, or can include a second active ingredient useful in the treatment or prevention of bacterial growth (for example and without limitation, anti-bacterial or anti microbial agents), or can include a combination of reagents of the disclosure. In some

embodiments, gRNAs are formulated with one or more other nucleic acids, e.g., nucleic acid encoding a DNA endonuclease and/or a donor template. Alternatively, nucleic acid encoding a DNA endonuclease and a donor template, separately or in combination with other

oligonucleotides, are formulated with the method described above for gRNA formulation.

[0334] Suitable excipients can include, for example, carrier molecules that include large, slowly metabolized macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, and inactive virus particles. Other exemplary excipients include antioxidants (for example and without limitation, ascorbic acid), chelating agents (for example and without limitation, EDTA), carbohydrates (for example and without limitation, dextrin, hydroxyalkylcellulose, and hydroxyalkylmethylcellulose), stearic acid, liquids (for example and without limitation, oils, water, saline, glycerol and ethanol), wetting or emulsifying agents, pH buffering substances, and the like.

[0335] In some embodiments, any compounds (e.g., a DNA endonuclease or a nucleic acid encoding encoding the DNA endonuclease, gRNA and donor template) of a composition can be delivered via transfection such as electroporation. In some exemplary embodiments, a DNA endonuclease can be precomplexed with a gRNA, forming a Ribonucleoprotein (RNP) complex, prior to the provision to the cell and the RNP complex can be electroporated. In such embodiments, the donor template can be delivered via electroporation.

[0336] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH value, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes. Liquid compositions can also contain liquid phases in addition to and to the exclusion of water. Exemplary of such additional liquid phases are glycerin, vegetable oils such as cottonseed oil, and water-oil emulsions. The amount of an active compound used in the cell compositions that is effective in the treatment of a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques.

KIT

[0337] Some embodiments provide a kit that contains any of the above-described

compositions, e.g., a composition for genome edition or a therapeutic cell composition and one or more additional components.

[0338] In some embodiments, a kit can have one or more additional therapeutic agents that can be administered simultaneously or in sequence with the composition for a desired purpose, e.g., genome edition or cell therapy.

[0339] In some embodiments, a kit can further include instructions for using the components of the kit to practice the methods. The instructions for practicing the methods are generally recorded on a suitable recording medium. For example, the instructions can be printed on a substrate, such as paper or plastic, etc. The instructions can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof (i.e., associated with the packaging or subpackaging), etc. The instructions can be present as an electronic storage data file present on a suitable computer readable storage medium, e.g., CD-ROM, diskette, flash drive, etc. In some instances, the actual instructions are not present in the kit, but means for obtaining the instructions from a remote source (e.g., via the Internet), can be provided. An example of this embodiment is a kit that includes a web address where the instructions can be viewed and/or from which the instructions can be downloaded. As with the instructions, this means for obtaining the instructions can be recorded on a suitable substrate.

OTHER POSSIBLE THERAPEUTIC APPROACHES

[0340] Gene editing can be conducted using nucleases engineered to target specific sequences. To date there are four major types of nucleases: meganucleases and their derivatives, zinc finger nucleases (ZFNs), transcription activator like effector nucleases (TALENs), and CRISPR-Cas9 nuclease systems. The nuclease platforms vary in difficulty of design, targeting density and mode of action, particularly as the specificity of ZFNs and TALENs is through protein-DNA interactions, while RNA-DNA interactions primarily guide Cas9. Cas9 cleavage also requires an adjacent motif, the PAM, which differs between different CRISPR systems. Cas9 from

Streptococcus pyogenes cleaves using a NRG PAM, CRISPR from Neisseria meningitidis can cleave at sites with PAMs including NNNNGATT, NNNNNGTTT and NNNNGCTT. A number of other Cas9 orthologs target protospacer adjacent to alternative PAMs.

[0341] CRISPR endonucleases, such as a Cas9 endonuclease, can be used in various embodiments of the methods of the disclosure. However, the teachings described herein, such as therapeutic target sites, could be applied to other forms of endonucleases, such as ZFNs, TALENs, HEs, or MegaTALs, or using combinations of nucleases. However, in order to apply the teachings of the present disclosure to such endonucleases, one would need to, among other things, engineer proteins directed to the specific target sites.

[0342] Additional binding domains can be fused to a Cas endonuclease (e.g., a Cas9 endonuclease) to increase specificity. The target sites of these constructs would map to the identified gRNA target site, but would require additional binding motifs, such as for a zinc finger domain. In the case of Mega-TAL, a meganuclease can be fused to a TALE DNA-binding domain. The meganuclease domain can increase specificity and provide the cleavage. Similarly, inactivated or dead Cas (dCas) can be fused to a cleavage domain and require the sgRNA/Cas target site and adjacent binding site for the fused DNA-binding domain. This likely would require protein engineering of the dCas (e.g., dCas9), in addition to the catalytic inactivation, to decrease binding without the additional binding site.

[0343] In some embodiments, the compositions and methods of editing a genome in accordance with the present disclosures can utilize or be done using any of the following approaches. Zinc Finger Nucleases

[0344] Zinc finger nucleases (ZFNs) are modular proteins having an engineered zinc finger DNA binding domain linked to the catalytic domain of the type II endonuclease Fokl. Because Fokl functions only as a dimer, a pair of ZFNs must be engineered to bind to cognate target “half-site” sequences on opposite DNA strands and with precise spacing between them to enable the catalytically active Fokl dimer to form. Upon dimerization of the Fokl domain, which itself has no sequence specificity per se, a DNA double-strand break is generated between the ZFN half- sites as the initiating step in genome editing.

[0345] The DNA binding domain of each ZFN typically has 3-6 zinc fingers of the abundant Cys2-His2 architecture, with each finger primarily recognizing a triplet of nucleotides on one strand of the target DNA sequence, although cross-strand interaction with a fourth nucleotide also can be important. Alteration of the amino acids of a finger in positions that make key contacts with the DNA alters the sequence specificity of a given finger. Thus, a four-finger zinc finger protein will selectively recognize a 12 bp target sequence, where the target sequence is a composite of the triplet preferences contributed by each finger, although triplet preference can be influenced to varying degrees by neighboring fingers. An important aspect of ZFNs is that they can be readily re-targeted to almost any genomic address simply by modifying individual fingers, although considerable expertise is required to do this well. In most applications of ZFNs, proteins of 4-6 fingers are used, recognizing 12-18 bp respectively. Hence, a pair of ZFNs will typically recognize a combined target sequence of 24-36 bp, not including the 5-7 bp spacer between half-sites. The binding sites can be separated further with larger spacers, including 15- 17 bp. A target sequence of this length is likely to be unique in the human genome, assuming repetitive sequences or gene homologs are excluded during the design process. Nevertheless, the ZFN protein-DNA interactions are not absolute in their specificity so off-target binding and cleavage events do occur, either as a heterodimer between the two ZFNs, or as a homodimer of one or the other of the ZFNs. The latter possibility has been effectively eliminated by

engineering the dimerization interface of the Fokl domain to create“plus” and“minus” variants, also known as obligate heterodimer variants, which can only dimerize with each other, and not with themselves. Forcing the obligate heterodimer prevents formation of the homodimer. This has greatly enhanced specificity of ZFNs, as well as any other nuclease that adopts these Fokl variants. [0346] A variety of ZFN-based systems have been described in the art, modifications thereof are regularly reported, and numerous references describe rules and parameters that are used to guide the design of ZFNs; see, e.g., Segal, D. J. et al. (1999). PNAS, 96( 6):2758-2763; Dreier, B. et al. (2000). J. Mol. Biol., 303( 4):489-502; Liu, Q. et al. (2002). J. Biol. Chem., 277(6):3850- 3856; Dreier, B. et al. (2005). J. Biol. Chem., 26Y/ (42 ) : 35588 - 35597 ; and Dreier, B. et al. (2001). /. Biol. Chem., 276(31):29466-29478.

Transcription Activator-Like Effector Nucleases (TALENs)

[0347] TALENs represent another format of modular nucleases whereby, as with ZFNs, an engineered DNA binding domain is linked to the Fokl nuclease domain, and a pair of TALENs operate in tandem to achieve targeted DNA cleavage. The major difference from ZFNs is the nature of the DNA binding domain and the associated target DNA sequence recognition properties. The TALEN DNA binding domain derives from TALE proteins, which were originally described in the plant bacterial pathogen Xanthomonas sp. TALEs have tandem arrays of 33-35 amino acid repeats, with each repeat recognizing a single base pair in the target DNA sequence that is typically up to 20 bp in length, giving a total target sequence length of up to 40 bp. Nucleotide specificity of each repeat is determined by the repeat variable diresidue (RVD), which includes just two amino acids at positions 12 and 13. The bases guanine, adenine, cytosine and thymine are predominantly recognized by the four RVDs: Asn-Asn, Asn-Ile, His-Asp and Asn-Gly, respectively. This constitutes a much simpler recognition code than for zinc fingers, and thus represents an advantage over the latter for nuclease design. Nevertheless, as with ZFNs, the protein-DNA interactions of TALENs are not absolute in their specificity, and TALENs have also benefitted from the use of obligate heterodimer variants of the Fokl domain to reduce off- target activity.

[0348] Additional variants of the Fokl domain have been created that are deactivated in their catalytic function. If one half of either a TALEN or a ZFN pair contains an inactive Fokl domain, then only single-strand DNA cleavage (nicking) will occur at the target site, rather than a DSB. The outcome is comparable to the use of CRISPR/Cas9/Cpfl“nickase” mutants in which one of the Cas cleavage domains has been deactivated. DNA nicks can be used to drive genome editing by HDR, but at lower efficiency than with a DSB. The main benefit is that off-target nicks are quickly and accurately repaired, unlike the DSB, which is prone to NHEJ-mediated mis-repair. [0349] A variety of TALEN-based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., Boch, J. (2009). Science, 326( 5959): 1509-1512; Mak et al. (2012). Science, 335(6069):716-719 (2012); and Moscou, M. J. et al. (2009). Science, 32<5(5959):l50l. The use of TALENs based on the "Golden Gate" platform, or cloning scheme, has been described by multiple groups; see, e.g., Cermak, T. et al. (2011). Nucleic Acids

Research, 39(l2):e82; Li, T. et al. (2011). Nucleic Acids Research, 39(l4):6315-6325; Weber, E. et al. (2011). PLoS One, <5(2):el6765; Wang, S. et al. (2014). Journal of Genetics and Genomics, 41{ 6):339-347; and Cermak, T. et al. (2014). Methods in Molecular Biology, 7239:133-159.

Homing Endonucleases

[0350] Homing endonucleases (HEs) are sequence- specific endonucleases that have long recognition sequences (14-44 base pairs) and cleave DNA with high specificity - often at sites unique in the genome. There are at least six known families of HEs as classified by their structure, including LAGLIDADG, GIY-YIG, His-Cis box, H-N-H, PD-(D/E)xK, and Vsr-like that are derived from a broad range of hosts, including eukarya, protists, bacteria, archaea, cyanobacteria and phage. As with ZFNs and TALENs, HEs can be used to create a DSB at a target locus as the initial step in genome editing. In addition, some natural and engineered HEs cut only a single strand of DNA, thereby functioning as site-specific nickases. The large target sequence of HEs and the specificity that they offer have made them attractive candidates to create site-specific DSBs.

[0351] A variety of HE -based systems have been described in the art, and modifications thereof are regularly reported; see, e.g., the reviews by Steentoft, C. et al. (2014). Glycobiology, 24{ 8):663-680; Belfort, M. et al. (2014). Methods in Molecular Biology, 7723:1-26; Hafez, M. et al. (2012). Genome, 55(8):553-569; and references cited therein.

MegaTAL / Tev-mTALEN / MegaTev

[0352] As further examples of hybrid nucleases, the MegaTAL platform and Tev-mTALEN platform use a fusion of TALE DNA binding domains and catalytically active HEs, taking advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of the HE; see, e.g., Boissel, S. et al. (2014). Nucleic Acids Research,

42{ 4):259l-260l; Kleinstiver, B. P. et al. (2014). G3: Genes, Genomes, Genetics, 4(6):l l55- 1165; and Boissel, S. et al. (2015). Methods in Molecular Biology, 7239:171-196. [0353] In a further variation, the MegaTev architecture is the fusion of a meganuclease (Mega) with the nuclease domain derived from the GIY-YIG homing endonuclease I-Tevl (Tev). The two active sites are positioned ~30 bp apart on a DNA substrate and generate two DSBs with non-compatible cohesive ends; see, e.g., Wolfs, J. M. et al. (2014). Nucleic Acids Research, 42(13): 8816-8829. It is anticipated that other combinations of existing nuclease-based approaches will evolve and be useful in achieving the targeted genome modifications described herein. dCas9-FokI or dCpfl -Fokl and Other Nucleases

[0354] Combining the structural and functional properties of the nuclease platforms described above offers a further approach to genome editing that can potentially overcome some of the inherent deficiencies. As an example, the CRISPR genome editing system typically uses a single Cas9 endonuclease to create a DSB. The specificity of targeting is driven by a nucleotide sequence in the guide RNA that undergoes Watson-Crick base-pairing with the target DNA (plus an additional 2 bases in the adjacent NAG or NGG PAM sequence in the case of Cas9 from S. pyogenes). Such a sequence is long enough to be unique in the human genome, however, the specificity of the RNA/DNA interaction is not absolute, with significant promiscuity sometimes tolerated, particularly in the 5’ half of the target sequence, effectively reducing the number of bases that drive specificity. One solution to this has been to completely deactivate a Cas9 or Cpf 1 catalytic function - retaining only the RNA-guided DNA binding function - and instead fusing a Fokl domain to the deactivated Cas9; see, e.g., Tsai, S. Q. et al. (2014). Nature

Biotechnology, 32:569-576; and Guilinger, J. P. et al. (2014). Nature Biotechnology, 32:511- 582. Because Fokl must dimerize to become catalytically active, two guide RNAs are required to tether two Fokl fusions in close proximity to form the dimer and cleave DNA. This essentially doubles the number of bases in the combined target sites, thereby increasing the stringency of targeting by CRIS PR-based systems.

[0355] As a further example, fusion of the TALE DNA binding domain to a catalytically active HE, such as I-Tevl, takes advantage of both the tunable DNA binding and specificity of the TALE, as well as the cleavage sequence specificity of I-Tevl, with the expectation that off-target cleavage can be further reduced.

[0356] The details of one or more embodiments of the disclosure are set forth in the accompanying description below. Any materials and methods similar or equivalent to those described herein can be used in the practice or testing of the present disclosure. Other features, objects and advantages of the disclosure will be apparent from the description. In the description, the singular forms also include the plural unless the context clearly dictates otherwise. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. In the case of conflict, the present description will control.

Additional Embodiments

[0357] Embodiment 1. A guide RNA (gRNA) comprising a spacer that is complementary to a genomic sequence within or near an endogenous apolipoprotein(a) ( LPA ) gene locus.

[0358] Embodiment 2. The gRNA of embodiment 1, wherein the spacer comprises a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132.

[0359] Embodiment 3. The gRNA of embodiment 2, wherein the spacer is 20 nucleotides in length.

[0360] Embodiment 4. The gRNA of embodiment 2, wherein the spacer comprises a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132.

[0361] Embodiment 5. A composition comprising one or two of the gRNAs of any one of embodiments 1-4 or nucleic acid encoding the one or two gRNAs.

[0362] Embodiment 6. The composition of embodiment 5, comprising an Adeno Associated Virus (AAV) vector comprising the nucleic acid encoding the one or two gRNAs.

[0363] Embodiment 7. The composition of embodiment 5, further comprising a

deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease.

[0364] Embodiment 8. The composition of embodiment 7, comprising an AAV vector comprising the nucleic acid encoding the DNA endonuclease.

[0365] Embodiment 9. The composition of embodiment 7, comprising an AAV vector comprising the nucleic acid encoding the one or two gRNAs and the nucleic acid encoding the DNA endonuclease.

[0366] Embodiment 10. The composition of any one of embodiments 7-9, further comprising a donor template comprising a nucleic acid sequence encoding one or more STOP codons. [0367] Embodiment 11. The composition of any one of embodiments 7-10, wherein the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof.

[0368] Embodiment 12. The composition of any one of embodiments 7-11, wherein the DNA endonuclease is Cas9.

[0369] Embodiment 13. The composition of any one of embodiments 7-12, wherein the nucleic acid encoding the DNA endonuclease is codon optimized.

[0370] Embodiment 14. The composition of any one of embodiments 10-13, wherein the nucleic acid sequence encoding one or more STOP codons is codon optimized.

[0371] Embodiment 15. The composition of any one of embodiments 10-14, wherein the nucleic acid sequence encoding one or more STOP codons does not comprise CpG dinucleotides.

[0372] Embodiment 16. The composition of any one of embodiments 10-15, wherein the nucleic acid encoding the DNA endonuclease is a deoxyribonucleic acid (DNA) sequence.

[0373] Embodiment 17. The composition of any one of embodiments 7-15, wherein the nucleic acid encoding the DNA endonuclease is a ribonucleic acid (RNA) sequence.

[0374] Embodiment 18. The composition of embodiment 17, wherein the RNA sequence encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0375] Embodiment 19. The composition of any one of embodiments 5-18, further comprising a liposome or lipid nanoparticle.

[0376] Embodiment 20. The composition of any one of embodiments 7-19, wherein the nucleic acid encoding the DNA endonuclease is formulated in a liposome or lipid nanoparticle.

[0377] Embodiment 21. The composition of embodiment 20, wherein the liposome or lipid nanoparticle encapsulates the gRNA.

[0378] Embodiment 22. The composition of any one of embodiments 5-21, wherein the DNA endonuclease is pre-complexed with the gRNA, forming a Ribonucleoprotein (RNP) complex.

[0379] Embodiment 23. The composition of any one of embodiments 5-22, wherein the composition comprises one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near exon 1, 2, or 3 of the LPA gene. [0380] Embodiment 24. The composition of embodiment 23, wherein the gRNA(s)

individually comprise a spacer complementary to a genomic sequence within or near exon 3 of the LPA gene.

[0381] Embodiment 25. The composition of embodiment 23 or embodiment 24, wherein the gRNA(s) are any one or two gRNA(s) comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacer(s) of SEQ ID NOs: 1-19.

[0382] Embodiment 26. The composition of any one of embodiments 5-22, wherein the composition comprises two gRNAs comprising spacers complementary to a genomic sequence within a transcriptional regulatory sequence of the LPA gene.

[0383] Embodiment 27. The composition of embodiment 26, wherein the transcriptional regulatory sequence comprises a promoter or enhancer.

[0384] Embodiment 28. The composition of embodiment 26 or embodiment 27, wherein the gRNAs are any two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 20-106 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 20-106.

[0385] Embodiment 29. The composition of any one of embodiments 5-22, wherein the composition comprises a gRNA comprising a spacer complementary to a genomic sequence encoding a kringle domain in an apo(a) protein.

[0386] Embodiment 30. The composition of embodiment 29, wherein the gRNA comprises a spacer selected from the group consisting of SEQ ID NOs: 107-132 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 107-132.

[0387] Embodiment 31. The composition of any one of embodiments 10-22, wherein the donor template comprising a nucleic acid sequence encoding one or more STOP codons comprises three STOP codons in each of the 3 translation frames present in succession in the donor DNA sequence.

[0388] Embodiment 32. The composition of embodiment 31, wherein the donor DNA is delivered as a double-stranded or single-stranded oligonucleotide.

[0389] Embodiment 33. The composition of embodiment 32, wherein the single- stranded or double-stranded donor DNA contains homology arms composed of the sequences of 20 bp to 1000 bp, or more, flanking each side of the sgRNA cut site. [0390] Embodiment 34. The composition of any one of embodiments 31-33, wherein the composition comprises one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near exon 1, 2, or 3 of the LPA gene.

[0391] Embodiment 35. The composition of embodiment 34, wherein the spacer(s) are complementary to a genomic sequence within or near exon 3 of the LPA gene.

[0392] Embodiment 36. The composition of embodiment 34 or embodiment 35, wherein the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0393] Embodiment 37. A kit comprising the composition of any one of embodiments 5-36, further comprising instructions for use.

[0394] Embodiment 38. A method of editing a genome in a cell, the method comprising: providing the following to the cell:

(a) one or two of the gRNA(s) of any one of embodiments 1-4 or nucleic acid encoding the gRNA(s); and/or

(b) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA

endonuclease.

[0395] Embodiment 39. The method of embodiment 38, comprising providing to the cell an AAV vector comprising the nucleic acid encoding the gRNA(s) and/or the nucleic acid encoding the DNA endonuclease.

[0396] Embodiment 40. The method of embodiment 38 or embodiment 39, further comprising providing (c) a donor template comprising a nucleic acid sequence encoding one or more STOP codons to the cell.

[0397] Embodiment 41. The method of any one of embodiments 38-40, wherein the spacer comprises a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132.

[0398] Embodiment 42. The method of embodiment 41, wherein the spacer is 20 nucleotides in length.

[0399] Embodiment 43. The method of embodiment 41, wherein the spacer comprises a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132.

[0400] Embodiment 44. The method of any one of embodiments 38-43, wherein the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease; or a functional derivative thereof.

[0401] Embodiment 45. The method of any one of embodiments 38-44, wherein the DNA endonuclease is Cas9.

[0402] Embodiment 46. The method of any one of embodiments 38-45, wherein a DNA sequence that is transcribed to the nucleic acid encoding the DNA endonuclease is codon optimized.

[0403] Embodiment 47. The method of any one of embodiments 38-46, wherein the nucleic acid sequence encoding one or more STOP codons is codon optimized.

[0404] Embodiment 48. The method of any one of embodiments 38-47, wherein the nucleic acid sequence encoding one or more STOP codons does not comprise CpG dinucleotides.

[0405] Embodiment 50. The method of any one of embodiments 38-48, wherein the nucleic acid encoding the DNA endonuclease comprises a 5’ CAP structure and 3’ polyA tail.

[0406] Embodiment 51. The method of any one of embodiments 38-49, wherein the nucleic acid encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0407] Embodiment 52. The method of any one of embodiments 40-51, wherein one or more of (a), (b) and (c) are formulated in a liposome or lipid nanoparticle.

[0408] Embodiment 53. The method of any one of embodiments 38-52, wherein the DNA endonuclease is formulated in a liposome or lipid nanoparticle.

[0409] Embodiment 54. The method of embodiment 53, wherein the liposome or lipid nanoparticle encapsulates the gRNA.

[0410] Embodiment 55. The method of any one of embodiments 38-54, wherein the DNA endonuclease is pre-complexed with the gRNA, forming a Ribonucleoprotein (RNP) complex, prior to the provision to the cell.

[0411] Embodiment 56. The method of any one of embodiments 40-55, wherein (a) and (b) are provided to the cell after (c) is provided to the cell. [0412] Embodiment 57. The method of any one of embodiments 40-55, wherein (a) and (b) are provided to the cell about 1 to 14 days after (c) is provided to the cell.

[0413] Embodiment 58. The method of any one of embodiments 40-57, wherein the nucleic acid sequence encoding one or more STOP codons is inserted into a genomic sequence of the cell.

[0414] Embodiment 59. The method of embodiment 58, wherein the insertion is at, within, or near the endogenous apolipoprotein(a) ( LPA ) gene or LPA gene regulatory elements in the genome of the cell.

[0415] Embodiment 60. The method of embodiment 58 or embodiment 59, wherein the donor template comprising a nucleic acid sequence encoding one or more STOP codons comprises three STOP codons in each of the 3 translation frames present in succession in the donor DNA sequence.

[0416] Embodiment 61. The method of any one of embodiments 58-60, wherein the donor DNA is delivered as a double-stranded or single-stranded oligonucleotide.

[0417] Embodiment 62. The method of embodiment 61, wherein the single- stranded or double-stranded donor DNA contains homology arms composed of the sequences of 20 bp to 1000 bp, or more, flanking each side of the sgRNA cut site.

[0418] Embodiment 63. The method of any one of embodiments 58-62, wherein one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near exon 1, 2, or 3 of the LPA gene are provided to the cell.

[0419] Embodiment 64. The method of embodiment 63, wherein the spacer(s) are

complementary to a genomic sequence within or near exon 3 of the LPA gene.

[0420] Embodiment 65. The method of embodiment 63 or embodiment 64, wherein the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0421] Embodiment 66. The method of any one of embodiments 38 or 41-55, wherein one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near exon 1, 2, or 3 of the LPA gene are provided to the cell.

[0422] Embodiment 67. The method of embodiment 66, wherein the spacer(s) are

complementary to a genomic sequence within or near exon 3 of the LPA gene. [0423] Embodiment 68. The method of embodiment 66 or embodiment 67, wherein the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0424] Embodiment 69. The method of any one of embodiments 38 or 41-55, wherein two gRNAs comprising spacers complementary to a genomic sequence within a transcriptional regulatory sequence of the LPA gene are provided to the cell.

[0425] Embodiment 70. The method of embodiment 69, wherein the transcriptional regulatory sequence comprises a promoter or enhancer.

[0426] Embodiment 71. The method of embodiment 69 or embodiment 70, wherein the gRNAs are any two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 20-106 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 20-106.

[0427] Embodiment 72. The method of any one of embodiments 38 or 41-55, wherein a gRNA comprising a spacer complementary to a genomic sequence encoding a kringle domain in an apo(a) protein is provided to the cell.

[0428] Embodiment 73. The method of embodiment 72, wherein the gRNA comprises a spacer selected from the group consisting of SEQ ID NOs: 107-132 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 107-132.

[0429] Embodiment 74. The method of any one of embodiments 38-73, wherein the cell is a hepatocyte.

[0430] Embodiment 75. A genetically modified cell wherein the genome of the cell is edited by the method of any one of embodiments 38-74.

[0431] Embodiment 76. A genetically modified cell, wherein the cell comprises a non functional apolipoprotein(a) (LPA) gene.

[0432] Embodiment 77. The cell of embodiment 76, wherein the LPA gene (i) lacks a nucleic acid encoding an exon or (ii) comprises a missense or nonsense mutation in an exon.

[0433] Embodiment 78. The cell of embodiment 77, wherein the exon is the third exon.

[0434] Embodiment 79. The cell of any one of embodiments 75-78, wherein the LPA gene comprises one or more premature STOP codons.

[0435] Embodiment 80. The cell of embodiment 79, wherein the LPA gene comprises a premature STOP codon in the third exon. [0436] Embodiment 81. The cell of embodiment 76, wherein the promoter of the LPA gene comprises one or more non-functional transcriptional regulatory elements.

[0437] Embodiment 82. The cell of embodiment 81, wherein the transcriptional regulatory elements comprise a promoter or an enhancer.

[0438] Embodiment 83. The cell of embodiment 76, wherein the LPA gene lacks one or more nucleic acid sequences encoding one or more kringle domains of the apo(a) protein.

[0439] Embodiment 84. The cell of any one of embodiment 76-83, wherein the cell is a hepatocyte.

[0440] Embodiment 85. A method of treating a cardiovascular disease in a subject in need thereof comprising: administering the genetically modified cell of any one of embodiments 75- 84 to the subject.

[0441] Embodiment 86. The method of embodiment 85, wherein the subject is a patient having or is suspected of having cardiovascular disease.

[0442] Embodiment 87. The method of embodiment 85, wherein the subject is diagnosed with a risk of cardiovascular disease.

[0443] Embodiment 88. The method of any one of embodiments 85-87, wherein the genetically modified cell is autologous.

[0444] Embodiment 89. The method of any one of embodiments 85-87, wherein the genetically modified cell is allogenic.

[0445] Embodiment 90. The method of any one of embodiments 85-89, wherein the cell is a hepatocyte.

[0446] Embodiment 91. The method of any one of embodiments 85-89, further comprising: obtaining a biological sample from the subject wherein the biological sample comprises a cell; and editing the genome of the cell according to the method of any one of embodiments 36-71, thereby producing the genetically modified cell.

[0447] Embodiment 92. The method of embodiment 81, wherein the cell is a hepatocyte.

[0448] Embodiment 93. A method of treating a cardiovascular disease in a subject in need thereof comprising:

(a) providing (i) the gRNA of any one of embodiments 1-4 or nucleic acid encoding the gRNA; and (ii) a deoxyribonucleic acid (DNA) endonuclease or nucleic acid encoding the DNA endonuclease to a cell derived from a biological sample obtained from the subject, thereby producing a genetically modified cell; and (b) administering the genetically modified cell to the subject.

[0449] Embodiment 94. The method of embodiment 93, comprising providing to the cell an AAV vector comprising the nucleic acid encoding the gRNA and/or the nucleic acid encoding the DNA endonuclease.

[0450] Embodiment 95. The method of embodiment 93 or embodiment 94, wherein the method further comprises providing (iii) a donor template comprising a nucleic acid sequence encoding one or more STOP codons.

[0451] Embodiment 96. The method of any one of embodiments 93-95, wherein the subject is a patient having or is suspected of having cardiovascular disease.

[0452] Embodiment 97. The method of any one of embodiments 93-95, wherein the subject is diagnosed with a risk of cardiovascular disease.

[0453] Embodiment 98. The method of any one of embodiments 93-97, wherein the genetically modified cell is autologous.

[0454] Embodiment 99. The method of any one of embodiments 93-97, wherein the genetically modified cell is allogenic.

[0455] Embodiment 100. The method of any one of embodiments 93-99, wherein the spacer comprises a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a contiguous sequence at least 19 nucleotides in length from any one of SEQ ID NOs: 1-132.

[0456] Embodiment 101. The method of embodiment 100, wherein the spacer is 20 nucleotides in length.

[0457] Embodiment 102. The method of embodiment 100, wherein the spacer comprises a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132 and variants thereof having at least 85% homology to a polynucleotide sequence from position 2 to position 20 of any one of SEQ ID NOs: 1-132.

[0458] Embodiment 103. The method of any one of embodiments 93-102, wherein the DNA endonuclease is selected from the group consisting of a Casl, CaslB, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csnl and Csxl2), CaslOO, Csyl, Csy2, Csy3, Csel, Cse2, Cscl, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmrl, Cmr3, Cmr4, Cmr5, Cmr6, Csbl, Csb2, Csb3, Csxl7, Csxl4, CsxlO, Csxl6, CsaX, Csx3, Csxl, Csxl5, Csfl, Csf2, Csf3, Csf4, and Cpfl endonuclease, or a functional derivative thereof. [0459] Embodiment 104. The method of any one of embodiments 93-103, wherein the DNA endonuclease is Cas9.

[0460] Embodiment 105. The method of any one of embodiments 93-104, wherein a DNA sequence that is transcribed to the nucleic acid encoding the DNA endonuclease is codon optimized.

[0461] Embodiment 106. The method of any one of embodiments 95-105, wherein the nucleic acid sequence encoding one or more STOP codons is codon optimized.

[0462] Embodiment 107. The method of any one of embodiments 95-106, wherein the nucleic acid sequence encoding one or more STOP codons does not comprise CpG dinucleotides.

[0463] Embodiment 108. The method of any one of embodiments 93-107, wherein the nucleic acid encoding the DNA endonuclease comprises a 5’ CAP structure and 3’ polyA tail.

[0464] Embodiment 109. The method of any one of embodiments 93-107, wherein the nucleic acid encoding the DNA endonuclease is linked to the gRNA via a covalent bond.

[0465] Embodiment 110. The method of any one of embodiments 95-106, wherein one or more of (i), (ii) and (ii) are formulated in a liposome or lipid nanoparticle.

[0466] Embodiment 111. The method of any one of embodiments 93-110, wherein the DNA endonuclease is formulated in a liposome or lipid nanoparticle.

[0467] Embodiment 112. The method of embodiment 111, wherein the liposome or lipid nanoparticle encapsulates the gRNA.

[0468] Embodiment 113. The method of any one of embodiments 93-112, wherein the DNA endonuclease is precomplexed with the gRNA, forming a Ribonucleoprotein (RNP) complex, prior to the provision to the cell.

[0469] Embodiment 114. The method of any one of embodiments 93-113, wherein (i) and (ii) are provided to the cell after (iii) is provided to the cell.

[0470] Embodiment 115. The method of any one of embodiments 114, wherein (i) and (ii) are provided to the cell about 1 to 14 days after (iii) is provided to the cell.

[0471] Embodiment 116. The method of any one of embodiments 95-115, wherein the nucleic acid sequence encoding one or more STOP codons is inserted into a genomic sequence of the cell.

[0472] Embodiment 117. The method of embodiment 116, wherein the insertion is at, within, or near the endogenous apolipoprotein(a) ( LPA ) gene or LPA gene regulatory elements in the genome of the cell. [0473] Embodiment 118. The method of any one of embodiments 95-117, wherein the donor template comprising a nucleic acid sequence encoding one or more STOP codons comprises three STOP codons in each of the 3 translation frames present in succession in the donor DNA sequence.

[0474] Embodiment 119. The method of any one of embodiments 93-118, wherein the donor DNA is delivered as a double-stranded or single-stranded oligonucleotide.

[0475] Embodiment 120. The method of embodiment 93-119, wherein the single- stranded or double-stranded donor DNA contains homology arms composed of the sequences of 20 bp to 1000 bp, or more, flanking each side of the sgRNA cut site.

[0476] Embodiment 121. The method of any one of embodiments 93-120, wherein one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near exon 1, 2, or 3 of the LPA gene are provided to the cell.

[0477] Embodiment 122. The method of embodiment 121, wherein the spacer(s) are complementary to a genomic sequence within or near exon 3 of the LPA gene.

[0478] Embodiment 123. The method of embodiment 121 or embodiment 122, wherein the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0479] Embodiment 124. The method of any one of embodiments 93-94 or 96-113, wherein one or two gRNA(s) individually comprising a spacer complementary to a genomic sequence within or near exon 1, 2, or 3 of the LPA gene are provided to the cell.

[0480] Embodiment 125. The method of embodiment 124, wherein the spacer(s) are complementary to a genomic sequence within or near exon 3 of the LPA gene.

[0481] Embodiment 126. The method of embodiment 124 or embodiment 125, wherein the gRNA(s) are any one or two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 1-19 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 1-19.

[0482] Embodiment 127. The method of any one of embodiments 93-94 or 96-113, wherein two gRNAs comprising spacers complementary to a genomic sequence within a transcriptional regulatory sequence of the LPA gene are provided to the cell.

[0483] Embodiment 128. The method of embodiment 127, wherein the transcriptional regulatory sequence comprises a promoter or enhancer. [0484] Embodiment 129. The method of embodiment 127 or embodiment 128, wherein the gRNAs are any two gRNAs comprising spacers selected from the group consisting of SEQ ID NOs: 20-106 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 20-106.

[0485] Embodiment 130. The method of any one of embodiments 93-94 or 96-113, wherein a gRNA comprising a spacer complementary to a genomic sequence encoding a kringle domain in an apo(a) protein is provided to the cell.

[0486] Embodiment 131. The method of embodiment 130, wherein the gRNA comprises a spacer selected from the group consisting of SEQ ID NOs: 107-132 or variants thereof having at least 85% homology to the spacers of SEQ ID NOs: 107-132.

[0487] Embodiment 132. The method of any one of embodiments 93-131, wherein the cardiovascular disease is selected from the group consisting of stroke, myocardial infarction, atherosclerosis, familial hypercholesterolemia, atherosclerosis, thrombosis, calcific aortic valve disease, coronary artery disease, peripheral arterial disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, congenital heart disease, and rheumatic heart disease.

[0488] Embodiment 133. The method of any one of embodiments 93-132, wherein the subject is human.

[0489] Embodiment 134. A syringe comprising the genetically modified cell of any one of embodiments 75-84.

[0490] Embodiment 135. A catheter comprising the genetically modified cell of any one of embodiments 75-84.

[0491] Embodiment 136. A method of treating a cardiovascular disease in a subject in need thereof comprising: administering the gRNA of any one of embodiments 1-4 or the composition of any one of embodiments 5-36 to the subject.

[0492] Embodiment 137. The method of embodiment 136, wherein the cardiovascular disease is selected from the group consisting of stroke, myocardial infarction, atherosclerosis, familial hypercholesterolemia, atherosclerosis, thrombosis, calcific aortic valve disease, coronary artery disease, peripheral arterial disease, cerebrovascular disease, renal artery stenosis, aortic aneurysm, cardiomyopathy, hypertensive heart disease, heart failure, pulmonary heart disease, congenital heart disease, and rheumatic heart disease. [0493] Embodiment 138. The method of embodiment 136 or embodiment 137, wherein the subject is human.

[0494] It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.

[0495] Some embodiments of the disclosures provided herewith are further illustrated by the following non-limiting examples.

EXAMPLES

Example 1: In si/ ^' ico identification of guide RNA spacers targeting the LPA gene to achieve functional reduction of apo(a) protein

[0496] To identify guide RNA (gRNA) spacer sequences that target Cas9-mediated cleavage at the human LPA gene, an in silico algorithm based upon the CCTop algorithm (Stemmer, M. et al. (2015). PLoS ONE, /0(4):c0124633) was used to identify all possible gRNA target sites for Cas endonucleases that utilize a PAM with the sequence NGG (NGG PAM) in the -200,000 bp region on chromosome 6q25.3-q26 that includes the immediate upstream region of the LPA gene, the entire LPA gene, and the immediate downstream region of the LPA gene. The term “LPA gene” as used herein includes the genomic region encompassing the LPA regulatory promoters and enhancer sequences as well as the coding sequence. The in silico analysis resulted in identification of over 20,000 candidate spacers. Sequence homology of candidate spacers to other sites in the human reference genome was also provided by the analysis algorithm and non unique spacer sequences with at least one perfect match to a different site in the human genome were removed from the list of candidates.

Example 1A: Identification of guide RNA spacers targeting exon 3 of the LPA gene

[0497] Applicant predicted that targeting LPA coding sequences proximal to the start codon would yield a high probability of functional knock down of apo(a) protein expression and/or function. Spacers that target within the first three exons of the LPA gene corresponding to the N- terminal portion of the apo(a) protein preceding the kringle repeats were selected for further analysis (19 spacers in total after removal of non-unique spacers, i.e., spacers with at least one perfect match to a different site in the human genome). These spacers are referred to herein as Exonl-3Gs. Seven of these spacers targeted exon 3 (the first exon encoding the mature protein, see FIG. 1), and are also referred to herein as Exon3Gs. Four Exon3Gs were 100% homologous to Macaca fascicularis (a non-human primate model suitable for use in pre-clinical studies) (Table 2).

Table 2: Sequences of four Exon3Gs that do not have perfect matches to other sites in the human genome, and have a perfect match in the LPA gene of non-human primate Macaca fascicularis.

1: MM, Mismatch. Refers to the number of sites in the genome with either 0, 1, 2, 3, or 4 mismatches to the spacer.

[0498] An initial analysis of sgRNA/Cas9-mediated editing by measuring the frequency of introduction of small insertions and deletions (INDELs) was performed using sgRNAs containing one of the 4 unique spacers from Table 2 and Cas9 from S. pyogenes (SpCas9). The sgRNAs contained the respective spacer sequence followed by the tracrRNA scaffold sequence of SEQ ID NO: 161

(GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGA

A A A AGU GGC ACC G AGU C GGU GCUUUU) . The same tracrRNA sequence was used for all sgRNAs described in Examples 1-6. To determine the effect of shortening 20-nt sgRNA spacers by removing the nucleotide at their 5’ end, four sgRNAs with l9-nt versions of the four

Exon3Gs of LPA shown in Table 2 (T1-19 (SEQ ID NO: 157), T2-19 (SEQ ID NO: 158), T4-19

(SEQ ID NO: 159), and T5-19 (SEQ ID NO: 160)), were tested in primary human hepatocytes from a single donor, designated HNN. Briefly, cryopreserved primary hepatocytes were plated at a density of 3.5 x 10 ⁵ cells per well in a 24-well collagen I-coated plate. The cells were cultured in InVitroGRO™ CP Medium supplemented with Torpedo™ Antibiotic Mix (Bio IVT). Cells were washed twice at between four to six hours after plating, then transfected with 0.6 pg Cas9 mRNA (TriLink Biotechnologies) and 0.2 pg sgRNA (Synthego) using Lipofectamine® MessengerMAX® (ThermoFisher Scientific). Cells were washed and re-fed the next morning with complete media then harvested 42 hours after transfection. Genomic DNA was extracted from the cells and purified using the Qiagen DNeasy® kit (cat 69506). To evaluate the frequency of sgRNA/Cas9-mediated cutting at the target site in exon 3 of LPA, a pair of primers (LPAF; 5’- GCACGTCTGTCTGCCTGCTAA-3’ (SEQ ID NO: 135) and LPAR; 5’- CTTCCTGGCAACCCGTATTCCTTC-3’ (SEQ ID NO: 136)) flanking the target site was used in a polymerase chain reaction (PCR) using a 55 °C annealing temperature to amplify an 812 bp region from the genomic DNA. The PCR product was purified and sequenced using Sanger sequencing with a sequencing primer (LPA TIDE F; 5’- CAAGAGAAGAGAATGGTCG-3’ (SEQ ID NO: 137)). The sequence data was analyzed by an algorithm called Tracking of Indels by Decomposition (TIDE) to determine the frequency of insertions and deletions (INDELs) present at the predicted cut sites for each of the sgRNA/Cas9 complexes (Brinkman el al.

Nucleic Acids Res. 2014 Dec l6;42(22):el68. doi:l0.l093/nar/gku936 6). The overall frequencies of INDEL generation for the four sgRNA/Cas9 complexes were between 10% and 30% (FIG. 2). These results demonstrate that these sgRNAs were able to direct SpCas9- mediated double- strand breaks in exon 3 of the LPA gene within the genome of primary human hepatocytes. An example of TIDE analysis in primary human hepatocyte cells transfected to express an sgRNA/Cas9 complex having an sgRNA with the l9-nt version of the T4 spacer (T4- 19) is shown in FIG. 3. The most common INDEL is a 1 bp insertion, which would result in a frame shift and create a stop codon at a location downstream of the gRNA cut site and thus result in the edited LPA gene encoding a predicted truncated apo(a) protein. The 20-nt spacer forms of these four sgRNAs were tested in the same experimental system to determine if a longer form of the sgRNA spacer results in improved on-target cutting (Example 4A).

Example IB: Identification of guide RNA spacers targeting regulatory regions and exon 2 of the LPA gene

[0499] One approach to downregulate apo(a) expression involves the use of two gRNAs with target sites in the LPA gene that flank one or more positive regulatory regions, such as an enhancer or promoter, or portions thereof to delete the intervening region between the target sites. A set of unique gRNA spacers (SEQ ID NOs: 20-106) for the purpose of removing or otherwise mutating a regulatory region or portion thereof was identified by narrowing down the set of unique gRNA spacers described above to only the gRNA spacers that target the 4000 bp region upstream of the transcription initiation site of the LPA gene. This set of spacers is referred to herein as regulatory LPA spacers, or RegGs. Additionally, disruption of the 5’ untranslated region (5’ UTR) and the start of the signal peptide that are located around exon 2 by unique gRNA spacers (SEQ ID NOs: 1-12), also referred to herein as Exon2Gs, may also result in a functional reduction in apo(a) expression.

Example 1C: Identification of guide RNA spacers targeting kringle domains of the LPA gene [0500] A single gRNA that targets a repetitive kringle domain can be used to target multiple Cas-mediated double-strand breaks at the LPA locus, potentially resulting in deletion of the regions between the double-strand breaks that leads to functional reduction in apo(a) expression. A set of gRNA spacers (SEQ ID NOs: 107-132) that are unique to the LPA kringle domains was identified by narrowing down the set of unique gRNA spacers described above to only the gRNA spacers that target the kringle domains of LPA and that have low predicted off-target cleavage in other regions of the genome. This set of guides is referred to herein as kringle-domain guides (KDGs)

Example ID: Introduction of stop codons in the LPA gene

[0501] Functional reduction of apo(a) may also be achieved by introducing into a coding region of the LPA gene (e.g., by NHEJ or HDR) a short DNA donor template that codes for one or more stop codons (e.g., three or more stop codons in each of the three translation frames present in one or both of the forward and reverse orientations). The N-terminal exonic region of the LPA gene targeted in Example 1A one can be used. For example, gRNAs having any one of the four gRNA spacers identified in Example 1A that are unique to LPA exon 3 (Tl, T2, T4, and T5) are used. The DNA donor template is delivered as a double- stranded or single- stranded oligonucleotide, and can be configured for integration by NHEJ or HDR. The single-stranded or double-stranded donor DNA may contain homology arms corresponding to sequences from about 20 bp to about 1000 bp, or more, flanking each side of the sgRNA cut site. When a sequence present in the DNA donor template having stop codons in each of the three translation frames in both orientations is integrated at the cut site, early termination of translation will result even after a random INDEL event. An example of such a DNA donor template is shown in FIG. 4. EXAMPLE 2: In vitro validation of LPA -targeted gRNA spacers

[0502] To evaluate the ability of gRNAs to affect targeted cleavage, sequences representing all 140 spacer sequences described above from the in silico analysis (Examples 1A-1C) were synthesized by in vitro transcription (IVT gRNA) and evaluated in a system using transfection into a human embryonic kidney (HEK) cell line engineered to constitutively express the SpCas9 nuclease. The cleavage efficiency at the on-target site for each gRNA was measured using the TIDES protocol (Brinkman, E. K. et al. (2014). Nucleic Acids Research, 42( 22):el68), in which PCR primers flanking the predicted cleavage site are used to amplify the genomic DNA from treated cells, followed by Sanger sequencing of the PCR product. When a double-strand break is created in the genome of a cell, the cell attempts to repair the double-strand break. This repair process is error prone, which can result in the deletion or insertion of nucleotides at the site of the double-strand break. Because breaks that are perfectly repaired are re-cleaved by the Cas9 nuclease, whereas insertion or deletion of nucleotides will prevent Cas9 cleavage, there will be an accumulation of insertions and deletions that are representative of the cutting efficiency. The sequencing chromatogram data were then analyzed using a computer algorithm that calculates the frequency of inserted or deleted bases at the predicted cleavage site. The frequency of inserted or deleted bases (INDELs) was used to calculate the overall cleavage frequency.

However, due to the repetitive nature of some of the kringle IV regions, PCR amplification was not possible. For these guide RNA targets, INDELs could not be assayed using this method. The results from the IVT gRNA experiment in HEK cells are shown in Table 3, where the gRNAs are ranked according to their observed cutting efficiencies.

Table 3: Cleavage efficiency of guide RNA molecules targeting the LPA gene in HEK cells

1 : Refers to the specific region of the LPA gene that was PCR -amplified from genomic DNA using different pairs of primers and subsequently used for TIDES analysis of the corresponding gRNA. Note that PCR 7 tol3 amplify different areas in the repeat regions of the apo(a) kringle IV domain. The guide RNA molecules that target this region will have multiple cut sites.

2: NHP = non-human primate; Y = 100% match to Macaca fascicularis .

[0503] The cutting efficiency of the sgRNAs ranged from 0% to 30%. Eighteen of the sgRNA spacer sequences have 100% identity with the LPA gene sequence of non-human primate (Macaca fascicularis). This is important because non-human primates (NHP) are used for a number of experiments in testing gene therapies for use in humans. Moreover, rodent species (mice and rats) lack a LPA gene and therefore don’t make the apo(a) protein, precluding their use as models for evaluating knockdown of apo(a), whereas NHP are known to express the LPA gene and have circulating Lp(a).

[0504] The INDEL frequency estimated from this experiment may be an underestimate because the experiment was performed using sgRNA molecules synthesized by in vitro transcription wherein the amount of full-length, high-quality sgRNA molecules may be suboptimal. The top seven performing sgRNAs were chemically synthesized with the base modifications described in Example 1A (Synthego Corp, Menlo Park, CA), and cleavage efficiency was assessed in the human liver cell line, HepG2. The average result of three experiments show two- to six-fold higher INDEL frequency compared to the experiment done in HEK cells using IVT guide RNA molecules (Table 4). These better editing results of synthetic gRNA delivered to HepG2 cells compared to the IVT gRNA experiment done in HEK cells may be due to a combination of higher quality synthetic gRNA molecules as well as HepG2 being a liver cell line where the chromatin around the liver- specific LPA gene is more open and accessible to Cas9 nuclease.

Table 4: Cleavage efficiency of high INDEL-generating sgRNA molecules targeting the LPA gene in HepG2 cells.

1: Average and standard deviation of 3 experiments.

EXAMPLE 3A: Evaluation of cleavage efficiency of LPA gRNA in vivo in mice

[0505] To deliver Cas9 and the gRNA molecules targeting human LPA to the hepatocytes of mice engrafted with primary human hepatocytes (e.g., obtained from Phoenix Bio), a lipid nanoparticle (LNP) delivery vehicle is used. The gRNA is chemically synthesized incorporating chemically modified nucleotides to improve resistance to nucleases. The SpCas9 mRNA is designed to encode the SpCas9 protein fused to a nuclear localization domain (NLS) that is required to transport the SpCas9 protein into the nuclear compartment where cleavage of genomic DNA can occur. Additional components of the Cas9 mRNA include a KOZAK sequence at the 5’ end prior to the first codon to promote ribosome binding, and a polyA tail at the 3’ end composed of a series of A residues. An example of the sequence of an SpCas9 mRNA with NLS sequences is provided in SEQ ID NO: 138.

[0506] The mRNA can be produced by different methods well known in the art. One of such methods used herein is in vitro transcription using T7 polymerase in which the sequence of the mRNA is encoded in a plasmid that contains a T7 polymerase promoter. Briefly, upon incubation of the plasmid in an appropriate buffer containing T7 polymerase and ribonucleotides a RNA molecule is produced that encodes the amino acid sequence of the desired protein. Either natural ribonucleotides or chemically modified ribonucleotides in the reaction mixture are used to generate mRNA molecules with either natural chemical structure or with modified chemical structures that may have advantages in terms of expression, stability or immunogenicity. In addition, the sequence of the SpCas9 coding sequence can be optimized for codon usage by utilizing the most frequently used codon for each amino acid. Additionally, the coding sequence can be optimized to remove cryptic ribosome binding sites and upstream open reading frames in order to promote the most efficient translation of the mRNA into SpCas9 protein.

[0507] A primary component of an LNP used in these studies is the lipid C 12-200 (Love, K. T. et al (2010). PNAS, 107(5):1864-1869). The C12-200 lipid forms a complex with the highly- charged RNA molecules. The C 12-200 is combined with L2-dioleoyI-sn-glycero-3- phosphoethano!arnine (DOPE), DMPE-mPEG2000 and cholesterol. When mixed under controlled conditions, for example, in a NanoAssemblr device (Precision NanoSystems) with nucleic acids such as gRNA and mRNA, self-assembly of LNP occurred in which the nucleic acid is encapsulated inside the LNP.

[0508] To assemble the gRNA and the Cas9 mRNA in the LNP, ethanol and lipid stocks are pipetted into glass vials as appropriate. The ratio of C 12-200 to DOPE, DMPE-mPEG2000 and cholesterol is adjusted to optimize the formulation. A typical ratio is composed of C 12-200, DOPE, cholesterol and mPEG2000-DMG at a molar ratio of 50:10:38.5:1.5. The gRNA and mRNA are diluted in 100 mM Na citrate pH 3.0 and 300 mM NaCl in RNase free tubes. The NanoAssemblr cartridge (Precision NanoSystems) is washed with ethanol on the lipid side and with water on the RNA side. The working stock of lipids is pulled into a syringe, air removed from the syringe and the working stock is inserted in the cartridge. The same procedure is used for loading a syringe with the mixture of gRNA and Cas9 mRNA. The Nanoassemblr run is then performed under standard conditions. The LNP suspension is then dialyzed using a 20 Kd cutoff dialysis cartridges in 4 liters of PBS for four hours and then concentrated using centrifugation through 20 Kd cutoff spin cartridges (Amicon) including washing three times in PBS during centrifugation. Finally, the LNP suspension is sterile filtered through 0.2 mM syringe filter. Endotoxin levels are checked using commercial endotoxin kit (LAL assay) and particle size distribution is determined by dynamic light scattering. The concentration of encapsulated RNA is determined using a RiboGreen assay (Thermo Fisher). Alternatively, the gRNA and the Cas9 mRNA are formulated separately into LNP and then mixed together prior to treatment of cells in culture or injection into animals. Using separately formulated gRNA and Cas9 mRNA allows specific ratios of gRNA and Cas9 mRNA to be tested. For example, LNP encapsulating the gRNA molecule and Cas9 mRNA are mixed at a 1:1 mass ratio of the RNA. Alternative LNP formulations that utilized alternative cationic lipid molecules are also used for in vivo delivery of the gRNA and Cas9 mRNA.

[0509] Freshly prepared LNP encapsulating the gRNA molecule and Cas9 mRNA are injected into the tail vein (TV injection) of humanized liver mice. Alternatively, the LNP is dosed by retro orbital (RO) injection. The dose of LNP given to mice ranges from 0.5 to 2 mg of RNA per kg of body weight. Human LP(a) levels and/or apo(a) levels are monitored in the serum before and after treatment. Successive dosing regimens of LNP can be used to increase the percentage of hepatocytes that have been gene edited and thus increase the degree of reduction in LP(a) levels.

[0510] After injection of the LNP (e.g., three days post- injection) the mice are sacrificed and a piece of the left and right lobes of the liver and a piece of the spleen are collected and genomic DNA is purified from each. The genomic DNA is then subjected to TIDES analysis to measure the cutting frequency and cleavage profile at the target site in the LPA gene.

EXAMPLE 3B: Evaluation of cleavage efficiency of apo(a) gRNA in vivo in non-human primates

[0511] To deliver Cas9 and the gRNA molecules targeting exon 3 of human LPA, or other regions of the LPA gene, to the hepatocytes of non-human primates that express apo(a), such as Macaca fascicularis , a lipid nanoparticle (LNP) delivery vehicle is used as described in Example 3A. [0512] Freshly prepared LNP encapsulating the gRNA molecule and Cas9 mRNA are injected into the non-human primate. Lp(a) levels are monitored in the plasma or serum before and after treatment. Successive dosing regimens of LNP can be used to increase the percentage of hepatocytes that have been gene edited.

EXAMPLE 4: Evaluation of on-target cleavage by gRNA/Cas9 in human primary hepatocytes

[0513] Human liver cell lines derived from tumors are convenient cell culture models for evaluating different gRNA molecules, yet these cells contain numerous genetic changes compared to normal hepatocytes. While the gene expression profile of liver cancer cell lines such as HuH7 and HepG2 generally reflect those of normal hepatocytes, there are numerous differences. In particular, differences in the chromatin organization of cancer cell lines compared to normal tissues is to be expected and may influence the accessibility of Cas9 to genomic targets. To select gRNA sequences to be used in humans, a normal human cell representative of the cell type being targeted may be used where possible. In the case of the gene editing strategy described herein, one of the most relevant cell types is normal hepatocytes obtained from humans. Such cells are referred to as primary human hepatocytes and are obtained from individual donors.

[0514] Primary human hepatocytes are one of the most relevant cell types for evaluation of potency and off-target cleavage of a gRNA/Cas9 that will be delivered to the liver of patients. These cells are grown in culture as adherent monolayers for a limited duration. Methods have been established for transfection of adherent cells with mRNA, for example MessengerMax™ (Invitrogen, cat # LMRNA0015). After transfection with a mixture of Cas9 mRNA and gRNA the on-target cleavage efficiency is measured using TIDES analysis.

[0515] Cryopreserved human hepatocytes are plated on tissue culture plates in optimized media and transfected the same day with a mixture of Cas9 mRNA and synthetic gRNA using the MessengerMax™ reagent (Invitrogen, cat # LMRNA0015). Genomic DNA is extracted from the cells 48 hours later and the on-target cutting frequency is measured by determining the INDEL frequency using TIDES analysis. Using this approach additional guides can be identified that are candidates for gene editing at the LPA gene in vivo in patients. Example 4A: Evaluation of on-target cleavage at exon 3 of the human EPA gene by gRNA/Cas9 in human primary hepatocytes

[0516] Five Exon3Gs with human target sequences that are 100% homologous to the corresponding NHP target sequences (Tl, T2, T3894, T4 and T5) were tested in PHH.

Cryopreserved PHH from three different donors (ONR, BVI, and HJK) were plated on tissue culture plates coated with collagen type I (Corning; Corning, NY; cat # 354408) in optimized media (BioIVT; Westbury, NY; cat # INVITROGRO CP) and transfected the same day with a mixture of 0.6 pg Cas9 mRNA (TriLink BioTechnologies; San Diego, CA; cat # L-7206) and 0.2 pg of synthetic guide RNA (Synthego Corp) using the lipid-based MessengerMax™ reagent (Invitrogen, cat # LMRNA0015). The chemically synthesized sgRNAs contained base-specific 2’-0-methyl and 3’ phosphorothioate modifications in the first and last 3 nucleotides that provided enhanced stability, that may enable improved editing efficiency. Genomic DNA was extracted from the cells 48 hours later and the on-target cutting frequency was measured by determining the INDEL frequency using TIDES analysis. The PCR primers used to amplify the genomic DNA for TIDE analysis of the five sgRNAs are shown in Table 5.

Table 5: Sequences of PCR primers used to perform TIDE analysis of the L/ -targeting sgRNAs with spacers Tl, T2, T3894, T4 and T5

[0517] The INDEL frequency of the five tested sgRNA molecules with 20-nt spacer sequences targeting human EPA (Tl, T2, T3894, T4 and T5) ranged from 9% to 45% in PHH cells from three donors (FIGS. 5A-5C and summarized in Table 6). The corresponding sgRNAs with l9-nt spacer sequences (T1-19, T2-19, T4-19 and T5-19) exhibited lower INDEL frequencies ranging from 10-30% (FIG. 2 and summarized in Table 6), indicating that for these sgRNAs, a one nucleotide shorter spacer sequence was less efficient.

[0518] These data indicate that gRNAs with spacers Tl, T2, T4 and T5 can be useful in therapeutic applications. Furthermore, these methods and data provide guidance for designing additional gRNAs targeting the human EPA gene using spacers selected from Table 2. Using this approach, additional gRNAs that are useful for reducing the level of Lp(a) protein may be identified.

Table 6: Cleavage efficiency of Exon3Gs in PHH. Guides are sorted by 5’ to 3’ location in the gene

1: Average and standard deviation of at least 3 experiments.

Example 4B: Evaluation of on-target cleavage at regulatory regions, exon 2, and kringle IV repeat regions of the human LPA gene by gRNA/Cas9 in human primary hepatocytes

[0519] An additional 12 RegGs, Exon2Gs and KDGs were tested in PHH as described above. The PCR primers used to amplify the genomic DNA for TIDE analysis of the sgRNAs are shown in Table 7.

Table 7: Sequences of PCR primers and sequencing primer (referred to as“TIDE primer F”) used to perform TIDE analysis of the LPA sgRNAs targeting regulatory regions, exon 2, and kringle IV repeat regions

[0520] The INDEL frequency of the RegGs, Exon2Gs and KDGs ranged from 8% to 62% in PHH from several donors (FIGS. 5A-5C, Table 8). Apart from the sgRNA with spacer T221, for which the INDEL frequency was 8%, the other RegGs, Exon2Gs and KDGs in this example resulted in INDEL frequencies that were generally higher than Exon3Gs (Example 4A-4C), suggesting that the frequency of DNA disruption is higher using individual guides from the RegGs, Exon2Gs and KDGs that target LPA regulatory regions, exon 2, or kringle IV repeats, respectively. These higher frequencies of DNA disruption from using the RegGs, Exon2Gs and KDGs may result in a higher chance of functional knockdown of apo(a) protein.

Table 8: Cleavage efficiency of sgRNAs targeting regulatory regions, exon 2, and kringle IV repeat regions of the LPA gene in PHH. Guides are sorted by 5’ to 3’ location on the gene

1: Average and standard deviation of at least 3 experiments.

Example 5: Evaluation of mRNA changes after genomic DNA disruption at the LPA gene.

[0521] Mutations in DNA may affect the levels of messenger RNA (mRNA) via the nonsense- mediated decay mechanism, which detects premature stop codons and other disruptions in mRNA and tags it for degradation (Isken, O., & Maquat, L. E. (2007). Genes &

development , 27(15), 1833-3856). Additionally, mutations in the transcriptional regulatory regions (promoters and enhancers) could decrease the levels of mRNA (Tugrul, M. et al. (2015). PLoS genetics , 77(11), el005639).

[0522] To investigate the mRNA changes after editing at the LPA gene using the Exon3Gs or the RegGs, Exon2Gs and KDGs, the LPA mRNA levels in PHHs from donor HJK were assessed by Droplet Digital™ PCR (ddPCR™). Briefly, PHHs were edited as described in Example 4 A, then total RNA was extracted 48 hours after transfection using the MagMAX™ mirVana™ Total RNA Isolation Kit (Applied Biosystems, cat # A27828). The RNA was converted to cDNA using the Superscript™ IV First Strand Synthesis system (ThermoFisher Scientific, cat#

18091050). ddPCR™, an advanced microfluidic based technology that achieves partitioning of samples at a massive scale, was performed using the Bio-Rad QX200 Droplet Digital PCR System. The Qx200 System consists of two instruments: a droplet generator and a droplet reader. The automated droplet generator creates about 20,000 highly uniform nanoliter- sized droplets per sample. The nucleic acid, along with the primer and probes, is distributed randomly in the droplets. The droplets are then subjected to the manufacturer’s optimized end-point PCR in a PCR plate using a deep well thermocycler. The L/ -specific region on the cDNA was amplified using primers TTTCTGAACAAGCACCAACG (SEQ ID NO: 162) and

AACAGTGGTGGAGAATGAG (SEQ ID NO: 163) and detected using the probe

CCCACAGTCCAGGACTGCTA (SEQ ID NO: 164). The PrimePCR™ ddPCR™ Expression Probe Assay detecting the human gene HPRT1 was used as a sample reference control (BioRad, cat # dHsaCPE5192872). As a control to evaluate the specificity of the guides, changes in the levels of mRNA encoding plaminogen ( PLG ), a gene which contains greater than 85% sequence homology to LPA was performed. The PrimePCR™ ddPCR™ Expression Probe Assay detecting the human PLG gene was used (Biorad, cat # dHsaCPE503l038). PHH samples edited with an unrelated sgRNA spacer sequence GGGGCCACTAGGGACAGGAT (SEQ ID NO: 165) targeting the Adeno-associated virus integration site 1 (AAVS1) locus in the first intron of the protein phosphatase 1 regulatory subunit 12C gene were used as controls for LPA and PLG mRNA expression changes. The PCR plate was transferred to a droplet reader where the positive and negative droplets for the probes against LPA, PLG and HPRT were read and analyzed using the QuantaSoft™ Software. To account for sample- specific variations, the ratio of positive LPA or PLG readings to the positive readings of the reference control HPRT1 were calculated. The LPA to HPRT1 or PLG to HPRT1 ratios of samples edited with the ZT -specific gRNA spacers were then divided by the LPA to HPRT1 or PLG to HPRT1 ratios of the samples edited with the AAVS 1 gRNA spacer to get LPA or PLG mRNA fold change data. These data are plotted on two graphs in FIG. 6. mRNA levels of PHHs treated with RegGs and Exon3Gs showed no significant change in LPA mRNA while samples edited with Exon2Gs and KDGs had significant decreases in LPA mRNA (FIG. 6). On the other hand, only one sample, T10461, had significantly decreased PLG mRNA levels (FIG. 6). These data indicate the ability of some gRNAs with spacers targeted to LPA to decrease the resulting mRNA levels without generally affecting the related PLG mRNA. For those samples that did not have significant changes in LPA mRNA (RegGs and Exon3Gs), either the genomic DNA editing events did not cause a downregulation event or a disruptive mutation to the translation and transcription mechanism, or the disruptions were not detectable by the ddPCR™ assay described above.

Example 6: Evaluation of off-target cleavage of selected guide RNA molecules targeting the human LPA gene

[0523] An additional criterion for the selection of a gRNA for therapeutic use is determination of off-target sites and frequencies. While in silico prediction algorithms can be helpful in identifying potential gRNA molecules, data generated in a relevant cell may be more

meaningful. In the case of the gene editing strategies described herein, relevant cell systems for evaluation of off-target cleavage include HepG2 cells and primary human hepatocytes (PHHs). HepG2 cells can be nucleofected with the selected guide RNA and Cas9 protein in a

ribonucleoprotein (RNP) complex, resulting in on-target cleavage. One approach for identifying potential off-target sites is GUIDE-seq (Tsai, S. Q. et al. (2015). Nature Biotechnology,

33(2): 187-197), in which a double-stranded oligonucleotide is co-nucleofected into the HepG2 cells together with the gRNA/Cas9 RNP. Other methods include deep sequencing, whole genome Sequencing, ChIP-seq (Crosetto, N. et al. (2013). Nature Methods, 10: 361-365), high- throughput, genome-wide, translocation sequencing (HTGTS) as described in Frock, R. L. et al. (2015). Nature Biotechnology, 33:179-186, Digenome-seq (Kim, E. et al. (2015). Nature Methods, 12: 237-243), and IDLV (Wang, X. et al. (2015). Nature Biotechnology, 33:175-178).

[0524] At between two and three days after transfection, genomic DNA is isolated from the cells and on-target cleavage is measured using the same TIDES-based methodology described above. The same genomic DNA is subjected to the GUIDE-seq analysis approach (described in Tsai, S. Q. et al. (2015). Nature Biotechnology, 33: 187-197). This method relies on the integration of the double- stranded oligonucleotide at sites of double-strand breaks. After random shearing of the genomic DNA and ligation of linkers, PCR using primers complementary to the linker and the integrated oligonucleotide is used to amplify the integration sites which are then sequenced. Once the sites of double-strand breaks at off-target sites are identified, whole genome sequencing can be performed to determine the frequency of off-target cleavage at each of these sites.

Example 6A: Analysis of off-target sites for LPA-targeted gRNAs in human cells

[0525] Off-target sites for human L/ -targeting sgRNAs with spacers Tl, T2, T4, and T5 were evaluated in the human liver cell line HepG2 using the GUIDE-seq method. GUIDE-seq (Tsai, S. Q. et al. (2015). Nature Biotechnology, 33(2): 187- 197) is an empirical method used to identify cleavage sites. GETIDE-seq relies on the spontaneous capture of an oligonucleotide at the site of a double-strand break in chromosomal DNA. In brief, following transfection of cells with a guide RNA/Cas9 RNP complex and double- stranded oligonucleotide, genomic DNA is purified from the cells, sonicated, and a series of adapter ligations are performed to create a library. The oligonucleotide-containing libraries are subjected to high-throughput DNA sequencing, and the output is processed using the default GETIDE-seq software to identify sites of oligonucleotide capture.

[0526] In these experiments, the double-stranded GETIDE-seq oligonucleotide (GETIDE-seq ODN) was generated by annealing two complementary single-stranded oligonucleotides by heating to 95 °C then cooling slowly to room temperature. RNPs were prepared by mixing 240 pmol of sgRNA (Synthego Corp) and 48 pmol of 20 mM Cas9 TrueCut V2 (Invitrogen, cat # A36498) in a final volume of 4.8 pl. In a separate tube, 4 pl of the 10 mM GETIDE-seq ODN was mixed with 1.2 mΐ of the RNP mix, then added to a nucleofection cassette (Lonza). HepG2 cells grown as adherent cultures were treated with trypsin to release them from the plate, the trypsin was deactivated, cells were pelleted and resuspended at 12.5 x 10 ⁶ cells/ml in SF Cell Line Nucleofector™ Solution (Lonza, cat # V4XC-2032), and 20 mΐ cell suspension (2.5 x 10 ⁵ cells) was added to each nucleofection cuvette. Nucleofection was performed with the EH- 100 cell program in the 4-D Nucleofector™ Unit (Lonza). After incubation at room temperature for ten minutes, 80 mΐ of complete HepG2 medium was added and the cell suspension was placed in a well of a 48-well plate and incubated at 37 °C in 5% C0 ₂ for 48 hours. The cells were released with trypsin, pelleted by centrifugation (300 g, ten minutes), then genomic DNA was extracted using the MagMAX™ DNA Multi-Sample Ultra 2.0 Kit (Applied Biosystems). The human LPA exon 3 region was PCR amplified using pairs of primers shown in Table 5 that flank the location of the on-target site for each of the four tested sgRNAs.

[0527] The PCR reactions were performed with the Platinum PCR SuperMix High Fidelity reagent (Invitrogen), using 35 cycles of PCR and an annealing temperature of 55 °C. PCR products were first analyzed by agarose gel electrophoresis to confirm that the correct products were generated, then directly sequenced using the TIDE primer shown in Table 5 located at the 5’ end of the PCR product. Sequence data were then analyzed using Tsunami, a modified version of the TIDES algorithm (Brinkman, E. K. et al. (2014). Nucleic Acids Research, 42(22):el68). This determined the frequency of INDELs present at the predicted cut site for the guide

RNA/Cas9 complex. Compared to the protocol described by Tsai, S. Q. et al. (2014). Nature Biotechnology, 32:569-576, GUIDE-seq was performed with 40 pmol (-1.67 mM) of the GUIDE-seq ODN to increase the sensitivity of off-target cleavage site identification. The capture of the GUIDE-seq ODN at the on-target sites in HepG2 cells as measured by TIDE analysis is shown in Table 9. The average INDEL frequency ranged from about 20% up to greater than about 50%, and average GUIDE-seq oligo integration rates ranged from about 3% up to about 30%.

Table 9: Frequency of total INDEL and capture of the GUIDE-seq ODN at the on-target site for human L/ -targeting sgRNAs with spacers Tl, T2, T4 and T5 in HepG2 cells

The R ² value is a measure of the quality of the TIDES analysis with higher values indicative of higher quality data. R ² values above 0.95 are considered to be of high quality, and therefore guide RNA molecules with high cutting efficiencies and R ² values above 0.95 can be useful in protocols for cleavage of the human LPA gene.

[0528] To achieve a sensitivity of approximately 0.01% (ability to detect one integration event per 10,000 genomes) requires a minimum of 10,000 unique on-target sequence reads per transfection. Samples without transfection of RNP containing SpCas9 and the sgRNA were processed in parallel. Sites (+/-1 kb) found in both RNP-containing and RNP-naive samples were excluded from further analysis. [0529] GUIDE-seq was performed in the human hepatoma cell line HepG2. The Y-adapter was prepared by annealing the Common Adapter to each of the sample barcode adapters (A01 - A 16) that contain the 8-mer molecular index. Genomic DNA extracted from the HepG2 cells that were nucleofected with RNP and the GUIDE-seq ODN was quantified using a Qubit fluorometer (ThermoFisher Scientific) and all samples were normalized to 400 ng in 120 pl volume of TE buffer. The genomic DNA was sheared to an average length of 200 bp according to the standard operating procedure for the Covaris S220 sonicator. To confirm average fragment length, 1 pl of the sample was analyzed on a TapeStation (Agilent) according to manufacturer’s protocol.

Samples of sheared DNA were cleaned using AMPure XP SPRI beads according to the manufacturer’s protocol and eluted in 17 pl of TE buffer. The end repair reaction was performed on the genomic DNA by mixing 1.2 pl of dNTP mix (5 mM each dNTP), 3 mΐ of 10 x T4 DNA ligase buffer, 2.4 pl of End-Repair Mix, 2.4 pl of lOx Platinum Taq Buffer (Mg ²⁺ free), and 0.6 pl of Taq Polymerase (non-hotstart) and 14 pl sheared DNA sample (from previous step) for a total volume of 22.5 mΐ per tube and incubated in a thermocycler (12 °C, 15 minutes; 37 °C, 15 minutes; 72 °C, 15 minutes; 4 °C hold). To this was added 1 pl annealed Y Adapter (10 mM) and 2 pl T4 DNA ligase, and the mixture was incubated in a thermocycler (16 °C, 30 minutes; 22 °C, 30 minutes; 4 °C hold). The sample was cleaned using AMPure XP SPRI beads according to manufacturer’s protocol and eluted in 23 mΐ of TE Buffer. One pl of sample was run on a TapeStation according to manufacturer’s protocol to confirm ligation of adapters to fragments.

To prepare the GUIDE-seq library a reaction was prepared containing 14 pl nuclease-free H ₂ 0, 3.6 mΐ 10 x Platinum Taq Buffer, 0.7 pl dNTP mix (10 mM each), 1.4 pl MgCl ₂ , 50 mM, 0.36 mΐ Platinum Taq Polymerase, 1.2 pl sense or antisense gene specific primer (10 pM), 1.8 mΐ TMAC (0.5 M), 0.6 mΐ P5_l (10 mM) and 10 mΐ of the sample from the previous step. This mix was incubated in a thermocycler (95 °C, 5 minutes, then 15 cycles of 95 °C, 30 seconds; 70 °C (minus 1 °C per cycle) for 2 minutes; 72 °C, 30 seconds; followed by 10 cycles of 95 °C, 30 seconds; 55 °C, 1 minute; 72 °C, 30 seconds; followed by 72 °C, 5 minutes). The PCR reaction was cleaned using AMPure XP SPRI beads according to manufacturer protocol and eluted in 15 pl of TE Buffer. 1 pl of sample was checked on TapeStation according to manufacturer’s protocol to track sample progress. A second PCR was performed by mixing 6.5 mΐ Nuclease-free H ₂ 0, 3.6 mΐ lOx Platinum Taq Buffer (Mg ²⁺ free), 0.7 pl dNTP mix (10 mM each), 1.4 pl MgCl ₂ (50 mM), 0.4 pl Platinum Taq Polymerase, 1.2 pl of Gene Specific Primer (GSP) 2 (sense: +, or antisense: -), 1.8 mΐ TMAC (0.5 M), 0.6 mΐ P5_2 (10 mM) and 15 mΐ of the PCR product from the previous step.

[0530] If GSP1+ was used in the first PCR then GSP2+ was used in PCR2. If GSP1- primer was used in the first PCR reaction, then GSP2- primer was used in this second PCR reaction. After adding 1.5 mΐ of P7 (10 mM) the reaction was incubated in a thermocycler with the following program: 95 °C, 5 minutes; then 15 cycles of 95 °C, 30 seconds; 70 °C (minus 1 °C per cycle) for 2 minutes; 72 °C, 30 seconds; followed by 10 cycles of 95 °C, 30 seconds; 55 °C,

1 minute; 72 °C, 30 seconds; followed by 72 °C, 5 minutes. The PCR reaction was cleaned up using AMPure XP SPRI beads according to manufacturer protocol and eluted in 30 mΐ of TE Buffer and 1 mΐ analyzed on a TapeS tation according to manufacturer protocol to confirm amplification. The library of PCR products was quantitated using Kapa Biosystems kit for Illumina Library Quantification, according to manufacturer supplied protocol and subjected to next generation sequencing on the Illumina system to determine the sites at which the oligonucleotide had become integrated.

[0531] GUIDE-seq was completed on three independent cell sample replicates (from three independent transfections) for each sgRNA and the results are shown in Tables 10 and 11. The GETIDE-seq approach resulted in a 3% to 30% frequency of on-target oligo capture (Table 9) in HepG2 cells for sgRNAs with spacers Tl, T2, T4, and T5, indicating that this method is appropriate in this cell type. On-target read counts met the internal pre-set criteria of 10,000 on- target reads for all four spacers.

Table 10: Summary of GETIDE-seq results for sgRNAs with spacers Tl, T2, T4, and T5 in HepG2 cells

Table 11: Details of the off-target sites detected by GUIDE-seq in at least 2 of the cell sample replicates

1. Position refers to the genomic location in Genome Reference Consortium Human Build 38 (hg38). The NCBI Genome Data Viewer was used to annotate each position

(www.ncbi.nlm.nih.gov/genome/gdv)·

2. The mismatch score is the sum of each non-complementary Watson-Crick nucleotide pair or gap where a nucleotide residue is missing in either the off-target site or the on-target site. The mismatch score provides an indication of the degree of homology of the guide spacer target sequence to the off-target site in the genome, with higher numbers indicating less homology. [0532] While the percentage of off-target to on-target reads provides an overall representation of whether a gRNA is specific to its intended target, other factors may be involved. For example, an off-target site for a candidate gRNA in an exon of an essential gene required for survival of an organism could render the gRNA unsuitable for use in the clinic. On the other hand, an off-target site in a non-coding or intronic region may pose less concern. Considerations useful for evaluating a gRNA intended for therapeutic use include 1) the number of off-target sites, 2) the location of the off-target sites, 3) the frequency of off-target editing compared to on-target editing, and 4) the degree of homology of the off-target site to the gRNA spacer sequence.

[0533] Potential off-target sites were validated by reproducing the experiment in cell sample replicates. Accordingly, applicant conducted experiments to identify potential off-target sites in cells edited using sgRNAs targeting LPA sequences. Off-target sites that were detected in at least two of the three cell sample replicates are reported in Table 11. Comparison of the read counts for each off-target site to the on-target site in GUIDE-seq provides an estimate of the off-target frequencies of the off-target sites for each sgRNA. These data are summarized in Table 11 along with information on the genomic site and whether the off-target site lies within the coding region of a gene. A spacer seed sequence consisting of the seven nucleotides of the spacer

corresponding to the target sequence adjacent to the protospacer adjacent motif (PAM) has been shown by Zheng, T. et al. to be sensitive to mismatches (Zheng, T. et al. (2017). Scientific reports , 7, 40638.). Predicted off-target sites with mismatches corresponding to the sgRNA spacer seed sequence would not be expected to be edited efficiently. Such off-target sites with mismatches in this seed region are likely to be false positives. True off-target frequencies can be confirmed by deep sequencing methods such as amplicon sequencing (see Medinger, R. et al. (2010). Molecular ecology, 19, 32-40).

[0534] For the sgRNA with spacer Tl, 16 off-target sites were identified by GUIDE-seq, with read counts ranging from 2.55% to 0.02% relative to the on-target read count. Most off-target sites identified for this sgRNA were located in either intergenic or intronic locations, with three sites located in exonic regions. One of the three exonic regions was exon 29 of the LPA gene.

The off-target sequences on chr 12: 107027942 and chr2:213057028 have high mismatches to the Tl spacer sequence, with six and three mismatches in the seven-nucleotide seed region, respectively (Table 11), indicative that these off-target sites are artifactual.

[0535] For the sgRNA with spacer T2, nine off-target sites were identified by GUIDE-seq, with read counts ranging from 4.74 % to 0.08% relative to the on-target read count. All but one of the off-target sites were in intergenic or intronic regions. The single exonic region identified by GUIDE-seq is in an uncharacterized gene. Off-targets sites on chr3: 139269184 and chr6:55058060 had high mismatch scores as well as general lack of homology to the T2 target sequence seed region (Table 11).

[0536] For the gRNA with spacer T4, a single off-target site was identified by GUIDE-seq with a read count of 0.46% relative to the on-target read count. The off-target site was in a region encoding a transcript of unknown function referred to as AC104389.4. However, this site is highly likely to be a false positive site as there appears to be no PAM and homology to the T4 target sequence is poor (Table 11).

[0537] For the sgRNA with spacer T5, no off-target sites were identified by GUIDE-seq.

[0538] Overall, the results from the GUIDE-seq analysis in HepG2 cells demonstrate that selection of a gRNA spacer with high specificity for the on-target site cannot be predicted by in silico analysis alone. Of the four sgRNAs profiled by GUIDE-seq, those with spacers T4 and T5 exhibited few to no predicted off-target sites, and thus these spacers are good candidates for therapeutic use.

[0539] Screening of additional gRNAs with target sites in the human LPA gene for their on- target/off-target profile in human cells using the GUIDE-seq methodology described herein is contemplated as an approach to identify additional gRNA molecules that could be used to target disruption of the LPA gene for the purpose of creating a functional reduction of apo(a).

[0540] While the present disclosure has been described at some length and with some particularity with respect to the several described embodiments, it is not intended that it should be limited to any such particulars or embodiments or any particular embodiment, but it is to be construed with references to the appended claims so as to provide the broadest possible interpretation of such claims in view of the prior art and, therefore, to effectively encompass the intended scope of the disclosure.

SEQUENCE LISTING