COMPOSITIONS AND METHODS FOR PROPHYLAXIS AND TREATMENT OF CELLULAR DEGENERATIVE DISORDERS

The present application relates to novel therapeutic strategies for cellular degenerative diseases, and more specifically neurodegenerative diseases. Said strategies are based on modulating one or more metabolic pathways identified by the inventors, which are correlated with the onset, development and progression of toxicity and apoptosis in cells, more specifically nerve cells, and are particularly pertinent in neurodegenerative diseases. The invention relates to a novel use of 4E-BPs modulators, and more specifically of 4E-BPs inhibitors. The modulators of the invention are useful for the preparation of pharmaceutical compositions for prophylaxis and treatment of cellular degenerative diseases, and more specifically neurodegenerative disorders. The invention relates to the use of modulators of the invention for the manufacture of a medicament giving a beneficial effect. A beneficial effect is disclosed herein or apparent to a person skilled in the art from the specification and general knowledge in the art. More specifically, the present Invention relates to compositions and methods for prophylaxis and/or treatment of cellular degenerative diseases, and more specifically neurodegenerative conditions in a mammal using a composition which comprises an effective amount of a 4E-BPs modulator. And in special embodiment, the cellular degenerative conditions of the present invention are ophthalmic degenerative diseases, and more specifically retinal degenerative diseases.

The following description is provided to aid in understanding the invention but is not admitted to be prior art to the invention

Diseases of the nervous system, including the central nervous system (CNS) and peripheral nervous system, are conditions frequently marked by a decrease in neuronal cell number and/or function. Additionally, because of the absence of endogenous repopulation, effective recovery of function following neuronal-related disease is either extremely limited or absent.

For example, one major cause of blindness is retinal degeneration, and the most common forms of retinal degeneration are retinitis pigmentosa, glaucoma and age- related macular degeneration (AMD) . Retinitis pigmentosa is affecting 1 in 4000 people worldwide and leaving more than 1.5 million people visually handicapped. First described over a hundred years ago, retinitis pigmentosa is characterized by progressive degeneration of the peripheral retina, leading to night blindness, progressive loss of the peripheral visual field, leading eventually to total blindness, abnormal electroretinogram, ophthalmoscopic changes consisting in dark mosaic like retinal pigmentation, attenuation of the retinal vessels, waxy pallor of the optic disc, and in the advanced forms, macular degeneration (Delyfer et al., 2004, Biol Cell., 96, 261-269) . The most prominent pathological finding of retinitis pigmentosa is a continuing decrease in the number of photoreceptor cells, often followed by alterations in the retinal pigmented epithelium and retinal glia with the appearance of intraretinal pigment deposits which appear around the mid-peripheral retina of individuals (Berson, 1996, PNAS, 93, 4526-4528) . Retinitis pigmentosa, which can be both sporadic and familial, is a disorder which has been linked to a number of different genes. The condition primarily affects

the rod cells of the retina, but can eventually lead to loss of peripheral vision and blindness.

Age-related macular degeneration (AMD) affects approximately 15,000,000 people in the United States. It is estimated that total blindness eventually results in 5-10% of these persons. AMD accounts for 17% of new cases of blindness in the United States annually. Because AMD is primarily a disease of individuals over 65 years old, the incidence of AMD is expected to increase as the population ages. It is characterized by a sudden worsening and distortion of central vision that progresses rapidly, typically with a course of only weeks or months. AMD is characterized by abnormalities in the macular area. The central area (or fovea) of the macula contains the highest density of cone photoreceptors in the retina and mediates high-acuity vision. The disease typically has a preclinical, asymptomatic phase, in which extracellular waste material accumulates in the space between the basement membrane (Bruch's membrane) and the epithelial layer, forming yellow-white spots known as drusen. Advanced forms of AMD includes both dry and wet (or "neovascular" ) AMD.- The dry form of AMD is far more common, but the wet form occurs simultaneously with the dry form in about 15 % of cases. Dry AMD is characterized by progressive apoptosis of cells in the epithelial layer, in the overlying photoreceptor cells and in the underlying cells in the choroidal capillary layer. Wet AMD is characterized by choroidal neovascularization with vascular leakage into subretinal spaces. AMD impairs central vision that is required for reading, driving, face recognition, and fine visual tasks.

Additionally, the retina while it is containing neuronal cells [e.g. photoreceptors (rods and cones), ganglion cells, horizontal cells, amacrine cells, bipolar cells] which can be affected by cellular degeneration process, further contains non neuronal cells (e.g. Muller cells or pigmented epithelial

cells) which can also degenerate and therefore be the target of the method and compositions of the present invention. For example, retinal pigment epithelium is an important cell types in the retina, as it is crucial to the support of the photoreceptor function. It performs several complex tasks, including phagocytosis of shed outer segments of rods and cones, vitamin A metabolism, synthesis of mucopolysaccharides involved in the metabolite exchange in the subretinal space, transport of metabolites, regulation of angiogenesis, absorption of light, enhancement of resolution of images, and the regulation of many other functions in the retina through secreted proteins such as proteases and protease inhibitors.

Today, one possible method for restoring vision, or at least for limiting its loss, in patients afflicted with a cellular (e.g. photoreceptors) degeneration disorder is through the use of a visual input which is capable of activating retinal ganglion cells. If activation by the visual input is successful, then varying degrees of vision should be restored. One suggested method for activating retinal ganglion cells through a visual input is with an electronic stimulator which electrically activates the retinal ganglion cells. Known as a "retina chip" or "silicon retina, " electronic stimulator is the focus of numerous research activities, however there remain many problems associated with the use of an electronic stimulator. For example, spatial resolution problems associated with the stimulating array may occur, as well as toxicity which often accompanies the use of a foreign object in the body. Due to these complications, use of electronic stimulators is still years away from clinical application.

Additionally, although retinitis pigmentosa was identified and classified about midway through last century, very little concrete progress has so far been achieved regarding either possible cures or understanding of the causes that determine and regulate its courses. The lines at present

most widely followed by international research are (i) the genetic approach, which seeks to identify the gene or genes responsible for the illness and thus permitting a subsequent intervention by means of modern genetic engineering techniques, (ii) the transplant approach, which aims at perfecting a technique that would make possible the transplant of retinal tissue or, at least, the grafting of healthy cells into diseased retinas, and (iii) the immunological approach, which sets out to verify some theories that assume the illness to be underlain by some alteration of the immunological system. Among known genes associated with retinal degeneration, several groups are specifically expressed in the retina and are critical for retinal cell survival and function. The most commonly seen retinitis pigmentosa mutations occur in genes important for phototransduction. These genes include rhodopsin (RHO) , the α- and β-subunits of rod cyclic guanosine monophosphate (cGMP) phosphodiesterases (PDE6A and PDE6B) , the α-subunit of rod cyclic nucleotide gated channel (CNGAl) and arrestin (SAG) . Mutations in genes important for visual cycles are also associated with photoreceptor cell degeneration. These include ATP-binding cassette transporter of rods (ABCR) , cellular retinaldehyde binding protein (CRaIBP), RPE 65 protein (RPE65) and RPE- retinal G-protein coupled receptor (RGR) , all encoding proteins that are - expressed mainly in retinal pigment epithelium (RPE) cells. These proteins are involved in recycling the rhodopsin chromophore 11-cis-retinaldehyde, which absorbs light to initiate the phototransduction cascade. Another group of genes defective in retinal degeneration code for photoreceptor cell structural proteins, including peripherin (also named retinal degeneration slow, RDS) , rod cell outer membrane protein 1 (ROMl) , retinal actin-binding protein fascin (FSCN2) and prominin like-1 (PROM-I) . In addition, genes encoding critical metabolic enzymes, such as

inosine monophosphate dehydrogenase 1 (IMPDHl) and lecithin retinol acyltransferase (LRAT) , are also important for retinal function, and mutations in these genes cause retinal degeneration.

There thus remains a strong need for a treatment for patients suffering from cellular degenerative diseases, and more specifically neurodegenerative diseases and/or degeneration of eye cells, e.g. retinal cells.

The object of the present invention is to provide a composition that will permit cellular degenerative diseases (e.g. neurodegenerative diseases) to be efficiently treated and/or prevented. According to a special embodiment, the present invention relates to prevention and/or reduction of eye cells degeneration, more specifically retinal cells degeneration, and even more specifically of photoreceptor cells degeneration.

Another purpose of the present invention is to provide a method of preventing and/or treating cellular degenerative diseases (e.g. neurodegenerative diseases), and more particularly a method of preventing and/or treating retinal degeneration that will permit for example a gradual recovery of visual acuity, or at least limit its loss, as well as limiting the loss of visual field, sharpness of images and perception of colours and an electroretinogram (ERG) decrease stabilisation and/or ERG recovery in the long run. According to one special embodiment, said retinal degeneration is photoreceptor cells degeneration.

Regulation of gene expression and protein synthesis in eukaryotes plays a critical role in development, differenciation, cell cycle, cell growth and apoptosis. mRNA translation is one step at which gene expression and protein synthesis are highly regulated. In response to physiological conditions (e.g. hormones, growth factors, cytokines or

nutrients) , animal cells generally activate mRNA translation in preparation for the cell proliferative response; while the rate of mRNA translation typically decreases under stressful conditions, such as oxidative or osmotic stress, DNA damage or nutrient withdrawal. These activation or suppression of mRNA translation in eukaryotes occur largely at the initiation level of protein synthesis, i.e. the translation initiation (for a review, see Gringas et al, 2001, Gene and Dev., 15, 807-826) .

Translation initiation involves the coordinated activities of several eukaryotic initiation factors (elFs), proteins which are classically defined by their cytoplasmic location and ability to regulate the initiation phase of protein synthesis. One of these factors, eukaryotic initiation factor 4E (eIF4E) , is present in limiting amounts relative to other initiation factors and is one component of the eIF4F initiation complex, which is also comprised of the scaffold protein eIF4G and the RNA helicase eIF4A. In the cytoplasm, eIF4E catalyzes the rate-limiting step of cap-dependent protein synthesis by specifically binding to the 5 ¹ terminal 7-methyl GpppX cap structure present on nearly all mature cellular mRNAs, which serves to deliver the mRNAs to the eIF4F complex. Once bound, the eIF4F complex scans from the 5 ¹ to the 3 ¹ end of the cap, permitting the RNA helicase activity of eIF4A to resolve any secondary structure present in the 5 ¹ untranslated region (UTR) , thus revealing the translation initiation codon and facilitating ribosome loading onto the mRNA (Strudwick and Borden, 2002, Differentiation, 70, 10-22) .

A large number of studies over recent years have identified point of regulation of the initiation of translation, such as control of availability of active eIF4E for incorporation into the eIF4E complex by (i) phosphorylation as well as by (ii) reversible sequestration by a family of small binding proteins, the 4E-BPs (Lawrence and

Abraham, 1997, Trends Biochem Sci., 22, 345-349; Gingras et al., 1999, Annu. Rev. Biochem., 68, 913-963). The eIF4E- binding proteins (also noted eIF4E-BPs or 4E-BPs ) act as effective inhibitors of cap-dependent translation by competing with eIF4G for binding to eIF4E (Haghighat et al., 1995, EMBO J., 14, 5701-5709; Ptushkina et al., 1999, Embo J., 18, 4068- 4075) . Consequently, 4E-BPs prevent eIF4E association with eIF4G to form the eIF4F complex, resulting in the subsequent inhibition of the 43S preinitiation complex binding to the mRNA. The competition between 4E-BPs and eIF4G is explained by the presence of a common eIF4E binding site in 4E-BPs and eIF4G (Mader et al.,1995, MoI. Cell. Biol., 15, 4990-4997).

Additionally, evidences suggest that the activity of eIF4E not only controls protein synthesis at the mRNA selection stage but can also contribute to the regulation of cell cycle progression and the susceptibility of cells to apoptosis induced by various agents. The sequestration of eIF4E by 4E- BPs is controlled by the state of phosphorylation of the latter. In viable growing cells, the 4E-BPs are phosphorylated at a number of sites and remain dissociated from eIF4E; in conditions that block cell proliferation or induce apoptosis, 4E-BPs phosphorylation decreases, the 4E-BPs associate with eIF4E and the availability of the later for translation initiation is reduced (for a review, see Clemens, 2001, J. Cell. MoI. Med., 5, 221-239).

Three different eIF4E-binding proteins have been identified in mammals (4E-BP1 to 3) :

(i) 4E-BP1 (also known as BP-I; PHAS-I; 4EBP1; 4E-binding protein 1; eIF4E-BPl; EIF4EBP1; MGC4316) contains 118 amino acids, with the eIF4E-binding motif located between residues 54 and 60. Association of 4E-BP1 with eIF4E is regulated by a range of stimuli for example, insulin, which activates mRNA translation, induces the phosphorylation of 4E-

BPl and its release from eIF4E, allowing the protein to bind eIF4G to form initiation factor complexes (Gingras et al., 1999, Annu. Rev. Biochem. , 68, 913-963);

4E-BP1 Protein sequence (NP_004086.1) is as follows :

MetSerGlyGlySerSerCysSerGlnThrProSerArgAlalleProAlaThrArg Arg ValValLeuGlyAspGlyValGlnLeuProProGlyAspTyrSerThrThrProGlyGly ThrLeuPheSerThrThrProGlyGlyThrArgllelleTyrAspArgLysPheLeuMet GluCysArgAsnSerProValThrLysThrProProArgAspLeuProThrlleProGly ValThrSerProSerSerAspGluProProMetGluAlaSerGlnSerHisLeuArgAsn SerProGluAspLysArgAlaGlyGlyGluGluSerGlnPheGluMetAspIle

(ii) 4E-BP2 (also known as PHAS-II; 4EBP2; 4E-binding protein 2; eIF4E-BP2; EIF4EBP2) contains 120 amino acids (Hu et al., 1994, Proc Natl Acad Sd U S A, 1994, 91, 3730-3734; Pause et al., Nature, 1994, 371, 762-767). 4E-BP2 is ubiquitously expressed in human tissues, including heart, brain, placenta, lung, liver, kidney and spleen, as well as adipose tissue and skeletal muscle, the major insulin-responsive tissues (Hu et al., Proc Natl Acad Sci USA, 1994, 91, 3730-3734; Tsukiyama- Kohara et al., Genomics, 1996, 38, 353-363). Additionally, it was clarified that 4E-BP2 exhibits the highest binding affinity for both m7GTP-bound and -unbound full-length eIF4Es when compared with 4E-BP1 and 4E-BP3 (Abiko et al., 2007, Biochem Biophys Res Commun., 2007, 355, 667-72). Two conserved motifs are present in the 4E-BP2 : the RAIP motif, which is found in the NH2-terminal region of 4E-BP2 and the TOS motif, which is formed by the last five amino acids of 4E-BP2 (Schalm and Blenis, 2002, Curr. Biol, 12, 632-639; Tee and Proud, 2002, MoI Cell Biol, 22, 1674-1683) . Like 4E-BP1, insulin stimulates the phosphorylation of 4E-BP2 in cultured cells, which promotes the release of 4E-BP2 from eIF4E and allows for cap-dependent translation to proceed (Ferguson et al., J Biol Chem, 2003, 278, 47459-47465).

4E-BP2 protein sequence (NP_004087.1) is as follows :

MetSerSerSerAlaGlySerGlyHisGlnProSerGlnSerArgAlalleProThr Arg ThrValAlalleSerAspAlaAlaGlnLeuProHisAspTyrCysThrThrProGlyGly ThrLeuPheSerThrThrProGlyGlyThrArgllelleTyrAspArgLysPheLeuLeu AspArgArgAsnSerProMetAlaGlnThrProProCysHisLeuProAsnlleProGly ValThrSerProGlyThrLeuIleGluAspSerLysValGluValAsnAsnLeuAsnAsn LeuAsnAsnHisAspArgLysHisAlaValGlyAspAspAlaGlnPheGluMetAspIle

(iii) 4E-BP3 contains 100 amino acids. 4E-BP3 is homologous to 4E-BP1 and 4E-BP2, exhibiting 57 and 59% identity, respectively. The homology is most striking in the middle region of the protein, which contains the eIF4E binding motif and residues that are phosphorylated in 4E-BP1 (Poulin et al., 1998, J Biol Chem. , 273, 14002-7).

4E-BP3 protein sequence (NP_003723.1) is as follows :

MetSerThrSerThrSerCysProIleProGlyGlyArgAspGlnLeuProAspCys Tyr SerThrThrProGlyGlyThrLeuTyrAlaThrThrProGlyGlyThrArgllelleTyr AspArgLysPheLeuLeuGluCysLysAsnSerProIleAlaArgThrProProCysCys LeuProGlnlleProGlyValThrThrProProThrAlaProLeuSerLysLeuGluGlu LeuLysGluGlnGluThrGluGluGluIleProAspAspAlaGlnPheGluMetAspIle

Patent application US 20050196787 provides compositions comprising oligonucleotides antisens targeted to nucleic acid encoding 4E-BP2 for inhibiting 4E-BP2 gene expression and method for treating metabolic disease or condition such as diabetes, metabolic syndrome X, obesity, hyperlipidemia, or elevated blood triglycerides.

In parental technical field, Graff et al., 2007, J Clin Invest., 117, 2638-2648 have demonstrated that therapeutic suppression of translation initiation factor eIF4E expression reduces tumour growth. Expression of eukaryotic translation initiation factor 4E (eIF4E) is commonly elevated in human and experimental cancers, promoting angiogenesis and tumor growth. Elevated eIF4E levels selectively increase translation of

growth factors which are important in malignancy (e.g., VEGF, cyclin Dl) and are thereby an attractive anticancer therapeutic target. The authors report development of eIF4E- specific antisense oligonucleotides (ASOs) designed to have the necessary tissue stability and nuclease resistance required for systemic anticancer therapy.

SUMMARY OF THE INVENTION

The Inventors have now surprisingly shown that 4E-BPs could be a therapeutic target for treating / preventing disorders characterized by cells (e.g. neurons) degeneration, and more particularly eye cells degeneration, even more particularly retinal cells (e.g. photoreceptor cells) degeneration.

According to a first embodiment, the Invention provides a composition comprising at least one 4E-BPs modulator for treating and/ or preventing cellular degenerative disease in a subject in need thereof. According to preferred embodiment, said composition is in combination with a pharmaceutically acceptable carrier.

As used herein throughout the entire application, the terms "a" and "an" are used in the sense that they mean "at least one", "at least a first", "one or more" or "a plurality" of the referenced compounds or steps, unless the context dictates otherwise. More specifically, "at least one" and "one or more" means a number which is one or greater than one, with a special preference for one, two or three.

The term "and/or" wherever used herein includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term" .

The term "about" or "approximately" as used herein means within 20%, preferably within 10%, and more preferably within 5% of a given value or range.

As used herein, the term "comprising", "containing" when used to define products, compositions and methods, is intended to mean that the products, compositions and methods include the referenced compounds or steps, but not excluding others.

As used herein, the term "treatment" or "treating" encompasses prophylaxis and/or therapy. Accordingly the compositions and methods of the present invention are not limited to therapeutic applications and can be used in prophylaxis ones. Therefore "treating" or "treatment" of a state, disorder or condition includes: (i) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a subject that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition, (ii) inhibiting the state, disorder or condition, i.e., arresting or reducing the development of the disease or at least one clinical or subclinical symptom thereof, or (iii) relieving the disease, i.e. causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms .

The terms "patient" or "subject in need" refer to a vertebrate, particularly a member of the mammalian species and includes, but is not limited to, domestic animals, sport animals, primates including humans. The term "patient" is in no way limited to a special disease status, it encompasses both patients who have already developed a disease of interest and patients who are not sick.

As used herein, the term "4E-BPs" is intended to designate eukaryotic translation initiation factor 4E binding proteins. In particular, this terms which encompasses both eukaryotic translation initiation factor 4E binding protein 1 (4E-BP1), eukaryotic translation initiation factor 4E binding

protein 2 (4E-BP2) and eukaryotic translation initiation factor 4E binding protein 3 (4E-BP3) , can be used herein to designate individually or collectively each of them. Synonyms of these terms have been provided above.

As used herein, the term "4E-BPs modulator" is intended to designate compound which is able to prevent or limit eIF4E sequestering property of 4E-BPs and/or able to prevent or limit 4E-BPs synthesis and/or bioavailability and/or activity.

It should be noted that the term "compound" as used herein does not intend to refer exclusively to one category of compound. It includes compounds of chemical origin, as well as compounds of biological origin (including protein and nucleic acid related compounds) .

According to one preferred embodiment, said 4E-BPs modulator is a 4E-BPs inhibitor or partial inhibitor.

According to another preferred embodiment, said inhibited or partially inhibited 4E-BPs is selected in the group consisting of 4E-BP1, 4E-BP2 and 4E-BP3.

According to an advantageous embodiment, it is 4E-BP2.

According to an advantageous embodiment, said inhibited or partially inhibited 4E-BP is specifically expressed in neural retina.

In one embodiment, it is 4E-BP1 (also known as BP-I; PHAS-I; 4EBP1; 4E-binding protein 1; eIF4E-BPl; EIF4EBP1; MGC4316) . Its protein sequence (NP_004086.1) is as follows :

MetSerGlyGlySerSerCysSerGlnThrProSerArgAlalleProAlaThrArg Arg ValValLeuGlyAspGlyValGlnLeuProProGlyAspTyrSerThrThrProGlyGly ThrLeuPheSerThrThrProGlyGlyThrArgllelleTyrAspArgLysPheLeuMet GluCysArgAsnSerProValThrLysThrProProArgAspLeuProThrlleProGly ValThrSerProSerSerAspGluProProMetGluAlaSerGlnSerHisLeuArgAsn SerProGluAspLysArgAlaGlyGlyGluGluSerGlnPheGluMetAspIle

In another embodiment, it is 4E-BP2 (also known as PHAS- II; 4EBP2; 4E-binding protein 2; eIF4E-BP2; EIF4EBP2) . Its protein sequence (NP_004087.1) is as follows:

MetSerSerSerAlaGlySerGlyHisGlnProSerGlnSerArgAlalleProThr Arg ThrValAlalleSerAspAlaAlaGlnLeuProHisAspTyrCysThrThrProGlyGly ThrLeuPheSerThrThrProGlyGlyThrArgllelleTyrAspArgLysPheLeuLeu AspArgArgAsnSerProMetAlaGlnThrProProCysHisLeuProAsnlleProGly ValThrSerProGlyThrLeuIleGluAspSerLysValGluValAsnAsnLeuAsnAsn LeuAsnAsnHisAspArgLysHisAlaValGlyAspAspAlaGlnPheGluMetAspIle

In another embodiment, it is 4E-BP3. Its protein sequence (NP_003723.1) is as follows:

MetSerThrSerThrSerCysProIleProGlyGlyArgAspGlnLeuProAspCys Tyr SerThrThrProGlyGlyThrLeuTyrAlaThrThrProGlyGlyThrArgIleIleTyr AspArgLysPheLeuLeuGluCysLysAsnSerProIleAlaArgThrProProCysCys LeuProGlnlleProGlyValThrThrProProThrAlaProLeuSerLysLeuGluGlu LeuLysGluGlnGluThrGluGluGluIleProAspAspAlaGlnPheGluMetAspIle

According to the present invention, said 4E-BPs inhibitor or partial inhibitor can be a direct inhibitor or an indirect inhibitor.

According to one special embodiment, said 4E-BPs inhibitor or partial inhibitor (including direct and indirect inhibitors) is selected in the group consisting of a small molecule, a nucleic acid molecule (e.g. an antisense to 4E-BPs -encoding nucleic acid molecules, a siRNA, a miRNA, a ribozyme, a shRNA, a nucleic acid capable of modulating 4E-BPs nucleic acid expression, a vector more particularly an expression vector expressing at least one nucleic acid capable of modulating 4E-BPs nucleic acid expression) , an anti-4E-BPs antibody.

The term "direct inhibitor" as used herein, refers to an agent able to interfere with the sequestrating activity of the 4E-BPs enzyme. It relates to an agent able to decrease (e.g.

by at least about 10%, about 20%, about 30%, about 50%, about 75%, about 85%, or about 95%) the eIF4E binding activity of at least one 4E-BPs either in vitro or in vivo after administration to a mammal, such as a human. According to a more preferred embodiment, said direct inhibitor is an agent which decreases (e.g. by at least about 10%, about 20%, about 30%, about 50%, about 75%, about 85%, or about 95%) the eIF4E binding activity of at least one 4E-BPs. Furthermore, such inhibition may be competitive, non-competitive, or uncompetitive, as described in T. F. Woolf, Handbook of Drug Metabolism, Marcel Dekker, Inc., New York, 1999. "Partial inhibitor" refers to a compound which acts as the inhibitor but that produces a weak maximum inhibitory response. This term is well known in the art. Such inhibition may be determined using in vitro or in vivo systems, or a combination of both, using methods known to those of ordinary skill in the art (see below) .

The term "indirect inhibitor" as used herein, refers according to one example to an agent able to interfere specifically with the 4E-BPs gene expression and/or 4E-BPs protein synthesis, and more particularly with the 4E-BPs mRNA. According to another preferred embodiment, said 4E-BPs inhibitor is an indirect inhibitor and is a nucleic acid that is able to modulate, preferably to reduce, the expression levels of said 4E-BPs, and more particularly the 4E-BPs mRNA level in cells (especially neuronal cells, cells of the eye, and especially retinal cells, advantageously photoreceptor cells) .

According to special embodiments, the "indirect inhibitor" of the invention is able to modulate, preferably to reduce, the expression levels of said 4E-BPs, and more particularly the 4E-BPs mRNA level in the treated cells e.g. by at least about 10%, about 20%, about 30%, about 50%, about 75%, about 85%, or about 95% (compared to the situation

without said indirect inhibitor) . In another embodiment, said indirect inhibitor is able to modulate, preferably to reduce (e.g. by at least about 10%, about 20%, about 30%, about 50%, about 75%, about 85%, or about 95%), the expression levels, and more particularly the mRNA level, of at least one 4E-BPs selected in the group consisting in 4E-BP1, 4E-BP2 and 4E-BP3. According to preferred embodiment, said indirect inhibitor is able to modulate, preferably to reduce (e.g. by at least about 10%, about 20%, about 30%, about 50%, about 75%, about 85%, or about 95%), the expression levels, and more particularly the mRNA level, of 4E-BP2. These inhibitory characterisations of the indirect inhibitor can be tested using well known molecular biology methods (e.g. QRTPCR, Western Blot,...).

The term "nucleic acid" includes, but is not limited to isolated DNA, RNA, oligonucleotides, antisense, siRNA, miRNA, ribozyme, shRNA, vectors more particularly expression vectors expressing at least one of said isolated nucleic acids (i.e. DNA, RNA, oligonucleotides, antisens, siRNA, miRNA, ribozyme, shRNA) which are capable to modulate, preferably to reduce, the expression levels of said 4E-BPs, and more precisely are capable of modulating 4E-BPs nucleic acid expression and/or level (e.g. by modulating the transcription level of mRNA, by controlling mRNA stability/degradation, etc..) . Those terms are widely used in the art and are well known from the skilled person.

It should be understood that according to the invention, the said nucleic acid can be used naked, i.e. present in the compositions of the invention or administered according to the invention, as such (e.g. DNA, RNA, oligonucleotides, antisense, siRNA, miRNA, ribozyme, shRNA), or vectorized, i.e. (i) incorporated in a vector (e.g. synthetic vectors, for example combined with substances which are known to improve the transfectional efficiency and/or stability of vectors, see below) or (ii) encoded by an expression vector (i.e. is

incorporated in the expression vector as heterologous nucleic acid) .

The term "vector" is used to refer to any molecule (e.g. chemical compounds, plasmid, yeast or virus) used to transfer heterologous nucleic acid (e.g. DNA encoding information, RNA molecule, hybrid RNA/DNA and/or nucleic acid analogs) to a host cell. As used herein, the term "expression vector" (or alternatively "recombinant vector") refers to a vector which contains heterologous nucleic acid sequences and which, when transformed or transfected into a suitable host cell, directs and/or controls the expression, transcription, and/or translation of said heterologous nucleic acid sequences that are inserted into the said vector. In preferred embodiments, the "expression vector" of the invention when transformed or transfected into a suitable host cell, is able to direct and/or control the expression and transcription of RNA molecules (including RNA, oligonucleotides, antisense, siRNA, miRNA, ribozyme, shRNA) . "Expression vector" refers to viral as well as non viral vectors, including extrachromosomal (e.g. episome) , multicopy and integrating vectors (i.e. for being incorporated into the host chromosomes). Particularly important in the context of the invention are vectors generally disclosed and used in gene therapy or vector-based therapy (i.e. which are capable of delivering a nucleic acid to a host organism) as well as expression vectors for use in various expression systems.

The vector which can be of plasmid or viral origin, can where appropriate be naked or combined with one or more substances which improve the transfectional efficiency and/or stability of the vector. These substances are widely documented in the literature available to the skilled man (see, for example, Feigner et al., 1987, Proc. West. Pharmacol. Soc. 32, 115-121; Hodgson and Solaiman, 1996, Nature Biotechnology 14, 339-342; Remy et al., 1994,

Bioconjugate Chemistry, 5, 647-654). By way of non-limiting illustration, said substances can be polymers, lipids, in particular cationic lipids, liposomes, nuclear proteins or neutral lipids. These substances can be used alone or in combination. A combination which can be envisaged is that of a recombinant plasmid vector which is combined with cationic lipids (DOGS, DC-CHOL, spermine-chol, spermidine-chol, etc.), lysophospholipides (for example Hexadecylphosphocholine) and neutral lipids (DOPE) .

The choice of the "plasmids" (non viral vectors) which can be used within the context of the present invention is huge. They are known to the skilled man and, while a number of them are available commercially, it is also possible to construct them or to modify them using the techniques of genetic manipulation. Examples which may be mentioned are the plasmids which are derived from pBR322 (Gibco BRL) , pUC (Gibco BRL), pBluescript (Stratagene) , pREP4, pCEP4 (Invitrogene) , pCI (Promega), pCDM8 (Seed, 1987, Nature 329, 840), pVAX , pgWiz (Gene Therapy System Inc; Himoudi et al., 2002, J. Virol. 76, 12735-12746) or p Poly (Lathe et al., 1987, Gene 57, 193-201) . Preferably, a plasmid which is used .in the context of the present invention contains an origin of replication which ensures that replication is initiated in a producer cell and/or a host cell (for example, the CoIEl origin will be chosen for a plasmid which is intended to be produced in E. coli and the oriP/EBNAl system will be chosen if it desired that the plasmid should be self-replicating in a mammalian host cell, Lupton and Levine, 1985, MoI. Cell. Biol. 5, 2533-2542; Yates et al., Nature 313, 812-815). The plasmid can additionally comprise a selection gene which enables the transfected cells to be selected or identified (complementation of an auxotrophic mutation, gene encoding resistance to an antibiotic, etc.). Naturally, the plasmid can contain additional elements which improve its maintenance

and/or its stability in a given cell (e.g. cer sequence, which promotes maintenance of a plasmid in monomeric form (Summers and Sherrat, 1984, Cell 36, 1097-1103), sequences for integration into the cell genome.

Suitable "viral vectors" which can be used within the context of the present invention may be derived from a variety of different viruses (e.g. retrovirus, adenovirus, AAV, poxvirus, herpes virus, measle virus, foamy virus and the like) . As used herein, the term "viral vector" encompasses vector DNA/RNA as well as viral particles generated thereof. Viral vectors can be replication-competent, or can be genetically disabled so as to be replication-defective or replication-impaired. The term "replication-competent" as used herein encompasses replication-selective and conditionally- replicative viral vectors which are engineered to replicate better or selectively in specific host cells.

In one aspect, the recombinant vector in use in the invention is a recombinant adenoviral vector (for a review, see "Adenoviral vectors for gene therapy", 2002, Ed D. Curiel and J. Douglas, Academic Press) . It can be derived from a variety of human or animal (canine, avian, bovine, murine, ovine, porcine, simian, etc.) sources and any serotype can be employed from the adenovirus serotypes 1 through 51. More particular mention may be made of the CAV-I or CAV-2 adenoviruses of canine origin, of the DAV adenovirus of avian origin or of the Bad type 3 adenovirus of bovine origin (Zakharchuk et al., 1993, Arch. Virol., 128: 171-176; Mittal et al., 1995, J. Gen. Virol., 76: 93-102). However, preference will be given to an adenoviral vector of human origin which is preferably derived from a serotype C-adenovirus, in particular human adenoviruses 2 (Ad2), 5 (Ad5) , 6 (Ad6) , 11 (AdIl), 24 (Ad24) and 35 (Ad35) . Nevertheless, three serotypes D- adenoviruses (Ad8, Adl9, and Ad37) have been shown to cause a severe ocular disease, epidemic keratoconjunctivitis (EKC)

(Ford et al., 1987, Epidemiol. Rev., 9,244-261), and natural tropism of Ad37 has already been explored as adenovirus vectors for therapy of ocular diseases (US 20020193327); these adenoviruses strains with natural tropism for eye are preferred. Such adenoviruses are available from the American Type Culture Collection (ATCC, Rockville, Md.), and have been the subject of numerous publications describing their sequence, organization and methods of producing, allowing the artisan to apply them (see for example US 6,133,028; US 6,110,735; WO 02/40665; WO 00/50573; EP 1016711; Vogels et al., 2003, J. Virol. 77, 8263-8271). The adenoviral vector in use in the present invention can be replication-competent. Numerous examples of replication-competent adenoviral vectors are readily available to those skill in the art (see, for example, Hernandez-Alcoceba et al., 2000, Human Gene Ther. 11, 2009-2024; Nemunaitis et al., 2001, Gene Ther. 8, 746-759). For example, they can be engineered from a wild-type adenovirus genome by deletion in the ElA CR2 domain (see for example WO00/24408) and/or by replacement of the native El and/or E4 promoters with heterologous promoter (constitutive promoter, tissue- or cell-specific promoter or inducible promoter) Alternatively, the adenoviral vector in use in the invention is replication-defective (see for example WO94/28152; Lusky et al., 1998, J. Virol 72, 2022-2032). Preferred replication-defective adenoviral vectors are El- defective (see for example US 6,136,594 and US 6,013,638), with an El deletion extending from approximately positions 459 to 3328 or from approximately positions 459 to 3510 (by reference to the sequence of the human adenovirus type 5 disclosed in the GeneBank under the accession number M 73260 and in Chroboczek et al., 1992, Virol. 186, 280-285). The cloning capacity can further be improved by deleting additional portion (s) of the adenoviral genome (all or part of the non essential E3 region or of other essential E2, E4

regions) . Insertion of a nucleic acid in any location of the adenoviral vector can be performed through homologous recombination as described in Chartier et al. (1996, J. Virol. 70, 4805-4810) .

According to another embodiment, the expression vector is an Adeno-associated virus (AAV), i.e. a viral vector system based on a non pathogenic and replication-defective virus. The AAV genome is a linear, single-stranded DNA molecule containing about 4681 nucleotides. The AAV genome generally comprises an internal non repeating genome flanked on each end by inverted terminal repeats (ITRs) . The ITRs are approximately 145 base pairs (bp) in length. The ITRs have multiple functions, including as origins of DNA replication, and as packaging signals for the viral genome. The internal non repeated portion of the genome includes two large open reading frames, known as the AAV replication (rep) and capsid (cap) genes. The rep and cap genes code for viral proteins that allow the virus to replicate and package into a virion. In particular, one family of at least four viral proteins are expressed from the AAV rep region, Rep 78, Rep 68, Rep 52, and Rep 40, named according to their apparent molecular weight. The AAV cap region encodes at least three proteins, VPl, VP2 and VP3. AAV has been engineered to deliver genes of interest by deleting the internal non repeating portion of the AAV genome (i.e. the rep and cap genes) and inserting a heterologous gene between the ITRs. The heterologous nucleic acid sequence is typically functionally linked to a heterologous promoter (constitutive promoter, tissue- or cell- specific promoter or inducible promoter) capable of driving gene expression in the patient's target cells under appropriate conditions. Termination signals, such as polyadenylation sites, can also be included. AAV is a helper- dependent virus; that is, it requires coinfection with a helper virus, or triple transfection with plasmids expressing

viral proteins (e.g. adenovirus, herpesvirus or vaccinia), in order to form AAV virions. In the absence of coinfection with a helper virus, AAV establishes a latent state in which the viral genome inserts into a host cell chromosome, but infectious virions are not produced. Subsequent infection by a helper virus "rescues" the integrated genome, allowing it to replicate and package its genome into an infectious AAV virion. While AAV can infect cells from different species, the helper virus must be of the same species as the host cell. Thus, for example, human AAV will replicate in canine cells coinfected with a canine adenovirus. Interestingly, several publications (Reichel et al., 1996, Hum MoI Genet 5, 591-594; Reichel et al., 1998, Hum Gene Ther, 9, 81-86 ; Bennett and Maguire, 1999, Proc Natl Acad Sci, 96, 9920-9925) have shown that in the retina, following subretinal delivery, AAV-2 vectors transduce retinal pigmented epithelium and photoreceptor cells, and were successful in delivering ribozymes, photoreceptor genes, and neurotrophic factors in mice and rat models of retinal degeneration (AIi et al., 2000, Nat. Genet., 25, 306-310 ; Lau et al. 2000, Invest Ophthalmol Vis Sci., 41, 3622-3633; LaVail et al. , 2000, Proc Natl Acad Sci USA, 97, 11488-93 ; Green et al., 2001, MoI. Ther., 3, 507-515 ; Liang et al, . 2001, MoI. Ther., 3, 241-248). Visual function was restored in a canine model of childhood blindness using a rAAV-2 carrying a wtRPE65 gene (Acland et al . 2001, Nat Genet 28, 92-95; WO 02/082904) . Furthermore, it was recently demonstrated that a subretinal injection in two retinal degenerative rat models, with AAV5 expressing the anti-apoptotic factor XIAP provides an efficient protection against photoreceptor loss and consecutive blindness (Leonard K. C. et al. 2007, PLOS One, 3, 1-8) . Taken together these publications provide critical preclinical data supporting the use of said vectors for therapeutic applications, especially in humans. Recent data confirmed that sub-retinal injection of

AAV2 and 5 target RPE and photoreceptor cells in mice (Pang et al. 2007 Vis res. Epub ahead of print) as well as in non-human primates using opsin promoters (see below) (Mancuso et al., 2007, J Opt Soc Am A Opt Image Sci Vis., 24, 1411-6). rAAV chimeric serotypes wherein the vector is flanked by AAV-2 ITRs but encapsidated in an AAV-I, 2, 3, 4 or -5 capsid have been studied (Auricchio et al., 2001, Hum MoI Genet 10, 3075-81,; Rabinowitz et al., 2002, J Virol 76, 791-801; Yang et al. , 2002, J Virol 76, 7651-60) . It was shown that their subretinal delivery resulted in a quantitative heterologous gene expression hierarchy with rAAV-4 and -5 capsids being the most efficient. More recently, it was shown that AAV2.8 or AAV2.9 (first number corresponds to genome serotype and second number to the capsid) are six to eightfold more efficient to transduce photoreceptors in rodent models, than AAV2.5 (Auricchio et al . , 2007, J. virol. 81, 20, 11372-11380). Thus these special AAV vectors are vectors of choice for the present invention. The inventors of US 20040208847 have further demonstrated that a recombinant AAV of serotype 4 delivered in the subretinal space of a non human primate leads to exclusive transduction of retinal pigment epithelial (RPE) cells. Since the primate eye is anatomically very similar to the human eye, rAAV-mediated nucleic acid transfer in the eye of non human primates is highly relevant with respect to future clinical development in humans. Recently, phase I human clinical trials have been successfully performed by three groups of laboratories, in Leber Congenital Amaurosis patients harbouring RPE65 mutation. Retina transduction with AAV2-4 expressing RPE65 normal gene gave significative functional vision rescue (Bainbridge JW et al., N Engl J Med. 2008 May 22;358 (21) :2231-9, Maguire AM et al. N Engl J Med. 2008 May 22;358 (21) :2240-8, Hauswirth W et al. Hum Gene Ther. 2008 Sep 7.) Therefore, according to the present invention, its is further possible to deliver the nucleic acid (i.e. DNA, RNA,

RNAi, ribozyme, oligonucleotides, antisense, siRNA, miRNA, shRNA, etc..) specifically to retinal cells by using an AAV capsid protein (or an expression vector, including AAV recombinant vector, engineered to express such an AAV capsid on its surface) as targeting molecule. In special embodiment, said AAV capsid can have a structure similar to that of a natural AAV or with a few changes, such as, for example, VPl, VP2 and VP3 coming from more than one single AAV serotype, or such as a capsid made of an AAV capsid protein in which one or several amino acid have been deleted, added or modified. For example, it is possible to derive an AAV capside by replacing part of it with a sequence from the AAV-5, 8 or 9 capsid protein, in such a way that the expressed proteins are able to form a capsid which retains the natural tropism of AAV-5, 8 or 9 towards retinal cells, and thus allows to target the delivery of the nucleic acid to this special type of cells such as photoreceptors. Therefore, the present invention concerns nucleic acids (including both viral and non viral expression vectors) which are characterized by the fact that they exhibit an AAV-5, 8 or 9 capsid protein. This means that at least one of VPl, VP2 and VP3 of AAV-5, 8 or 9 are part of the vector, in such a way that they are exposed at its surface, thereby enabling the targeting of retinal cells, and more specifically of photoreceptor cells. The AAV-5, 8 or 9 capsid protein can be integrated into the viral particle (for example, in the case of a native or chimeric AAV capsid) , or simply bound to the particle, by any physical means (for example, in the case of a non-viral vector) .

In another aspect, the vector in use in the invention is a poxviral vector (see for example Cox et al. in "Viruses in Human Gene Therapy" Ed J. M. Hos, Carolina Academic Press) . According to special embodiment it is selected in the group consisting of vaccinia virus, suitable vaccinia viruses include without limitation the Copenhagen strain (Goebel et

al., 1990, Virol. 179, 247-266 and 517-563; Johnson et al., 1993, Virol. 196, 381-401), the Wyeth strain and the highly attenuated virus derived thereof including MVA (for review see Mayr, A., et al., 1975, Infection 3, 6-14) and derivates thereof (such as MVA vaccinia strain 575 (ECACC V00120707 - US 6,913,752), NYVAC (see WO 92/15672). Determination of the complete sequence of the MVA genome and comparison with the Copenhagen VV genome has allowed the precise identification of the seven deletions (I to VII) which occurred in the MVA genome (Antoine et al., 1998, Virology 244, 365-396), any of which can be used to insert the nucleic acid of interest. The vector may also be obtained from any other member of the poxviridae, in particular fowlpox (e.g. TROVAC, see Paoletti et al, 1995, Dev Biol Stand., 84, 159-163); canarypox (e.g. ALVAC, WO 95/27780); pigeonpox; swinepox and the like. By way of example, persons skilled in the art may refer to WO 92/15672 which describes the production of expression vectors based on poxviruses capable of expressing such heterologous nucleotide sequence. The basic technique for inserting the nucleic acid in a poxviral genome is described in numerous documents accessible to the man skilled in the art (Paul et al., 2002, Cancer gene Ther. 9, 470-477; Piccini et al., 1987, Methods of Enzymology 153, 545-563) . Usually, one proceed through homologous recombination between overlapping sequences (i.e. desired insertion site) present both in the viral genome and a plasmid carrying the nucleic acid to insert. When using the Copenhagen vaccinia virus, the nucleic acid is preferably inserted in the thymidine kinase gene (tk) . However, other insertion sites are also appropriate, e.g. in the hemagglutinin gene (Guo et al., 1989, J. Virol. 63, 4189- 4198), in the KlL locus, in the u gene (Zhou et al., 1990, J. Gen. Virol. 71, 2185-2190) or at the left end of the vaccinia virus genome where a variety of spontaneous or engineered deletions have been reported in the literature. When using

MVA, the heterologous nucleic acid can be inserted in anyone of the identified deletions I to VII as well as in the D4R locus, but insertion in deletion II or III is preferred (Meyer et al., 1991, J. Gen. Virol. 72, 1031-1038 ; Sutter et al., 1994, Vaccine 12, 1032-1040) . When using fowlpox virus, although insertion within the thymidine kinase gene may be considered, the heterologous nucleic acid is preferably introduced in the intergenic region situated between ORFs 7 and 9 (see for example EP 314 569 and US 5,180,675).

According to another embodiment, the viral vector according to the invention derives from retroviruses which have the property of infecting, and in most cases integrating into, dividing cells and in this regard are particularly appropriate for use in relation to cancer. A recombinant retrovirus according to the invention generally contains the LTR sequences, an encapsidation region and the nucleotide sequence according to the invention, which is placed under the control of the retroviral LTR or of an internal promoter such as those described below. The recombinant retrovirus can be derived from a retrovirus of any origin (murine, primate, feline, human, etc.) and in particular from the MOMuLV (Moloney murine leukemia virus), MVS (Murine sarcoma virus) or Friend murine retrovirus (Fb29) . It is propagated in an encapsidation cell line which is able to supply in trans the viral polypeptides gag, pol and/or env which are required for constituting a viral particle. Such cell lines are described in the literature (PA317, Psi CRIP GP + Am-12 etc.). The retroviral vector according to the invention can contain modifications, in particular in the LTRs (replacement of the promoter region with a eukaryotic promoter) or the encapsidation region (replacement with a heterologous encapsidation region, for example the VL3O type) (see FR9408300 and FR9705203) .

Preferably, the nucleic acid in use in the invention is in a form suitable for its expression in a host cell or organism, which means that the nucleic acid (encoding more specifically RNA) are placed under the control of one or more regulatory sequences necessary for its expression in the host cell or organism. According to preferred embodiment, "expression in a host cell or organism" means at least RNA (including RNA, oligonucleotides, antisense, siRNA, miRNA, ribozyme, shRNA) synthesis into the said host cell or organism. As used herein, the term "regulatory sequence" refers to any sequence that allows, contributes or modulates the expression of a nucleic acid in a given host cell, including replication, duplication, transcription, splicing, translation, stability and/or transport of the nucleic acid or one of its derivative (i.e. RNA, oligonucleotides, antisense, siRNA, miRNA, ribozyme, shRNA ...) into the host cell. It will be appreciated by those skilled in the art that the choice of the regulatory sequences can depend on factors such as the host cell, the vector and the level of gene expression desired. The regulatory sequences may, for example, be a mammalian or viral promoter, such as a constitutive, regulable or cell/tissue specific promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPRT) , adenosine deaminase, pyruvate kinase, b-actin promoter and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV) , simian virus (e.g., SV40) , papilloma virus, adenovirus, human immunodeficiency virus (HIV) , Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The

promoters useful as gene expression sequences of the invention also include regulable promoters. Regulable promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art. According to preferred embodiment, the promoter will be selected in order to be cell or tissue specific (e.g. retinal cell-specific promoter, photoreceptor- specific promoter, retinal ganglion cell or retinal pigmented epithelium specific promoter etc... ) .

Photoreceptor-specific promoters include, for example, beta-subunit of cGMP phosphodiesterase (beta-PDE) promoter

(Lerner et al., 2002, J. Biol. Chem. , 277, 25877-25883), interphotoreceptor retinoid-binding protein (IRBP) promoter

(Glushakova et al. MoI. Vis. 2006 :12, 298-309), rhodopsin

Kinase (Young et al. 2005, MoI. Vis., 11, 1041-1051, Young et al. 2007 Genomics, 90, 236-248, Sharhrockh C. et al., 2007,

IOVS, 48,9,3954-3961), rhodopsin promoter (Lewin et al. 1998,

Nat. Med., 4, 967-971, Gouras et al. 1994, Vis. Neurosci, 11,

1227-1231, Woodford et al. 1994, Exp Eye Res., 58, 631-635,

Glushakova et al. MoI. Vis. 2006, 12, 298-309), peripherin/rds

(Moritz et al., 2002, Gene, 298,173-182), guanylate cyclase-E

(Dude et al., 1998, MoI Cell Biochem. , 189,63-70; Johnston et al., 1997, Gene 193, 219-227), alpha subunit of rod transducin

(Ahmad et al . , 1994, J Neurochem. , 62, 396-399), arrestin

(Mani et al., 1999, J Biol Chem. 274, 15590-15597 ; Kikuchi et al. 1993, MoI Cell Biol. 13, 4400-4408, cone-specific promoters such as promoter sequences of red and green visual pigment (Wang et al. 1992, Neuron, 9; 429-440; Shaaban and

Deeb,1998, Invest .Ophthalmol . Vis. Sci . 39, 885-896, Alexander et al. 2007, Nat. Med, 13, (6) 685-687, Mancuso et al. 2007 J

Opt Soc Am A Opt Image Sci Vis., 24, 1411-6, Li et al. 2007,

Cone-specific expression using a human red opsin promoter in

recombinant AAV, Sep 28; Vision Res. [Epub ahead of print] ), blue opsin (Chen et al. 1994, PNAS, 91, 2611-2615, Glushakova et al., 2006, Invest Ophthalmol Vis Sci., 47, 3505-13), or cone I arrestin (Zhu et al., 2002, FEBS Lett., 524, 116-122).

In general, the gene expression sequence shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined nucleic acid. The gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired. Those skilled in the art will appreciate that the regulatory elements controlling the expression of the nucleic acid molecule of the invention may further comprise additional elements for proper initiation, regulation and/or termination of transcription (e.g. polyA transcription termination sequences), mRNA transport (e.g. nuclear localization signal sequences), processing (e.g. splicing signals), and stability (e.g. introns and non-coding 5' and 3' sequences), translation (e.g. peptide signal, propeptide, tripartite leader sequences, ribosome binding sites, Shine-Dalgarno sequences, etc.) into the host cell or organism.

One special class of indirect inhibitor that may be used in conjunction with the present invention is antisense nucleic acid molecules that can hybridize to, or are complementary to, the nucleic acid molecule, nucleotide sequence, or fragments, analogs or derivatives thereof. An "antisense" nucleic acid comprises a nucleotide sequence that is complementary to a "sense" nucleic acid encoding a protein (e.g. complementary to the coding strand of a double-stranded cDNA molecule or complementary to an mRNA sequence) . In one embodiment, an

antisense nucleic acid molecule is antisense to a "coding region" of the coding strand of a nucleotide sequence encoding a 4E-BPs (or fragments or fragment combination thereof) . The term "coding region" refers to the region of the nucleotide sequence comprising codons that are translated into amino acid residues. In another embodiment, the antisense nucleic acid molecule is antisense to an "untranslated region" of the coding strand of a nucleotide sequence encoding a 4E-BPs. The term "untranslated region" refers to 5' and 3 ¹ sequences that flank the coding region and that are not translated into amino acids. Given the coding strand sequences encoding 4E-BPs disclosed herein, antisense nucleic acids of the invention can be designed according to the rules of Watson and Crick or Hoogsteen base pairing. The antisense nucleic acid molecule can be complementary to the entire coding region of a 4E-BPs mRNA, but more preferably is an oligonucleotide that is antisense to only a portion of the coding or noncoding region of 4E-BPs mRNA. For example, the antisense oligonucleotide can be complementary to the region surrounding the translation start site of 4E-BPs mRNA. An antisense oligonucleotide can be, for example, about 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 nucleotides in length. An antisense nucleic acid of the invention can be constructed using chemical synthesis or enzymatic ligation reactions using procedures known in the art. For example, an antisense nucleic acid (e.g. an antisense oligonucleotide) can be chemically synthesized using naturally-occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed between the antisense and sense nucleic acids (e.g. phosphorothioate derivatives and acridine substituted nucleotides can be used) . Examples of modified nucleotides that can be used to generate the antisense nucleic acid include: 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-

iodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5 carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1- methylguanine, 1-methylinosine, 2, 2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5- methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, 5 methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5' methoxycarboxymethyluracil, 5- methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil 5- oxyacetic acid (v) , wybutoxosine, pseudouracil, queosine, 2- thiocytosine, 5-methyl-2 thiouracil, 2-thiouracil, A- thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v) , 5-methyl-2- thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2, 6-diaminopurine . Alternatively, the antisense nucleic acid can be produced biologically in situ using an expression vector into which a nucleic acid has been subcloned in an antisense orientation (i.e. RNA transcribed from the inserted nucleic acid will be of an antisense orientation to a target nucleic acid of interest, described further in the following section) . The antisense nucleic acid molecules of the invention are typically administered to a subject or generated in situ after administration of an expression vector as indicated above, such that they hybridize with or bind to cellular mRNA and/or genomic DNA encoding 4E-BPs to thereby inhibit expression of the protein (e.g. by inhibiting transcription and/or translation) . The hybridization can be by conventional nucleotide complementarily to form a stable duplex, or, for example, in the case of an antisense nucleic acid molecule that binds to DNA duplexes, through specific interactions in the major groove of the double helix. An example of a route of administration of antisense nucleic acid molecules of the invention includes direct injection at a

tissue site. Alternatively, antisense nucleic acid molecules can be modified to target selected cells and then administered systemically . For example, for systemic administration, antisense molecules can be modified such that they specifically bind to receptors or antigens expressed on a selected cell surface (e.g. by linking the antisense nucleic acid molecules to peptides or antibodies that bind to cell surface receptors or antigens).

Examples of antisense nucleic acid molecules according to the present invention are those disclosed in WO2007062380, the content of which is hereby incorporated by reference. In one embodiment the compound has at least 80% complementarity to a nucleic acid molecule encoding eiEF4E-BP2 and comprising at least an 8-nucleobase portion of SEQ ID NO 29, 30, 31, 32, 33, 35, 36, 37, 40, 41, 42, 43, 46, 48, 49, 50, 51, 52, 53, 54, 55, 56, 58, 59, 60, 61, 62, 64, 65, 66, 61, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 81, 83, 88, 89, 92, 93, 95, 96, 98, 100, 101, 104, 105, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 173, 175, 176, 177, 178, 179, 182,183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 200, 201, 202, 204, 205, 206, 207, 208, 209, 210, 211, 213, 214, 215, 218, 219, 220, 221, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257 or 258 as disclosed in WO2007062380. In some embodiments, the antisense compound is at least 70%, at least 80%, at least 90%, at least 95%, at least 99% or 100% complementary to a nucleic acid molecule encoding eIF4E-BP2.

According to another special class of indirect inhibitor, the invention relates to short interfering nucleic acid (siNA) such as short interfering RNA (siRNA), double- stranded RNA (dsRNA) , micro-RNA (miRNA) , and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against 4E-BPs genes expression. "RNA interference or RNAi" refers to sequence specific inhibition of gene expression mediated by RNA molecule, that preferably is at least partly be double-stranded and that contains a portion that is substantially complementary to a target gene (e.g. to an mRNA transcribed from the target gene) . RNAi can occur via selective intracellular degradation of RNA and/or by translational repression. "Molecules capable of mediating RNA interference" refers to RNA molecules, preferably at least partly double-stranded RNA molecule, optionally including one or more nucleotide analogs or modifications, having a structure characteristic of molecules that can mediate inhibition of gene expression through RNAi. These molecules include a portion that is substantially complementary to a target gene. These molecules can be used as such (i.e. naked or vectorized (see above). In one embodiment, the invention features an expression vector comprising a nucleic acid sequence encoding at least one of the said siNA molecule of the invention in a manner which allows expression of the active siNA molecule (i.e. capable of mediating RNA interference (RNAi) against 4E-BPs genes expression) . For example, the vector can contain sequence (s) encoding both strands of a siNA molecule comprising a duplex. The vector can also contain sequence (s) encoding a single nucleic acid molecule that is self-complementary and thus forms a siNA molecule (e.g. at least partly double-stranded RNA molecule). Non-limiting examples of such expression vectors have been provided above.

According to one embodiment of the present invention, the said 4E-BPs inhibitor or partial inhibitor is a 4E-BPs siRNA. The term "siRNA" refers to small inhibitory RNA duplexes that induce the RNA interference (RNAi) pathway. These molecules can vary in length and contain varying degrees of complementarity to their target mRNA in the antisense strand. Some, but not all, siRNA have unpaired overhanging bases on the 5' or 3' end of the sense strand and/or the antisense strand. The term "siRNA" includes duplexes of two separate strands (sens and antisens strands), as well as single strands that can form hairpin structures comprising a duplex region. siRNA may be divided into five groups (non-functional, semifunctional, functional, highly functional, and hyper- functional) based on the level or degree of silencing that they induce in cultured cell lines. As used herein, these definitions are based on a set of conditions where the siRNA is transfected into said cell line at a concentration from 1OnM to 100 nM and the level of silencing is tested at a time of roughly 24 hours after transfection, and not exceeding 72 hours after transfection. In this context, "non-functional siRNA" are defined as those siRNA that induce less than 50% (<50%) target silencing. "Semi-functional siRNA" induce 50-79% target silencing. "Functional siRNA" are molecules that induce 80-95% gene silencing. "Highly-functional siRNA" are molecules that induce greater than 95% gene silencing. "Hyperfunctional siRNA" are a special class of molecules which are defined as those molecules that (1) induce greater than 95% silencing of a specific target when they are transfected at subnanomolar concentrations (i.e., less than one nanomolar); and/or (2) induce functional (or better) levels of silencing for greater than 96 hours. These relative functionalities (though not intended to be absolutes) may be used to compare siRNAs to a particular target for applications such as functional genomics, target identification and therapeutics. The methods

of the invention comprise administering the 4E-BPs-specific siRNA to a mammal in an amount and for a period of time sufficient to indirectly inhibit or reduce 4E-BPs expression, and preferably inhibit or reduce 4E-BPs mRNA level. siRNAs are usually 21-23 nucleotides long (but may be longer or shorter) and lead to post-transcriptional silencing of the mRNA to which they are homologous. RNA interference or siRNA is a method based on small-interfering RNAs that can lead to the specific silencing of genes. RNA interference technology is well known in the art and is described for example in US20020162126, or Hannon et al., 2002, Nature, 11, 418, 244- 251. It has been shown that siRNA is mediated by RNA-induced silencing complex or RISC, which is a sequence specific, multi-component nuclease that degrades mRNAs and contains short RNAs. Complementary portions of siRNA that hybridize to form the double-stranded structure, typically have substantial or complete identity. The double-stranded structure may be formed by a single self-complementary RNA strand or two complementary RNA strands. siRNAs of the invention may comprise one or more strands of polymerized ribonucleotide and may include modifications to either the phosphate-sugar backbone or the nucleoside. Likewise, bases may be modified to block the activity of enzyme adenosine deaminase, an enzyme that plays a role in RNA-editing. RNA duplex formation can be initiated either before or after administration into a host organism or cell for effective inhibition of or reduction in the expression of the target gene. In the methods of the invention, siRNAs are complementary to certain portions of a particular mRNA, e.g., a target gene. The sequence of a siRNA of the invention can correspond to the entire length of or only a portion of a target gene. In one embodiment the length of the siRNA, i.e. the length of each individual strand of the double-stranded structure, as well as the length of the duplex, comprises 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or

25 nucleotides. In another embodiment, the length of the siRNA is about 25-50 nucleotides. In yet another embodiment, the length of the siRNA is greater than 50 nucleotides. Based on the mRNA sequence encoding 4E-BPs of the present invention (see below), it is possible to use specific algorithm (siRNA Finder computer program, "BLOCK-iT™ RNAi Designer" Invitrogen, "HP Flexible siRNA Design" Qiagen) to design siRNA sequences. The mRNA sequence encoding 4E-BPs of the invention can be determined for example according to the rules of degenerative code or based on the nucleic acid sequences provided herein. As described for antisense nucleic acids, the siRNA can be administered to a subject or generated in situ using an expression vector into which a nucleic acid has been subcloned which encodes the said siRNA.

According to special preferred embodiment, siRNA of the present invention is selected in the group consisting in (from 5' to 3' ) :

- for E4BP1

AGGATCATCTATGACCGGAAA GAGCCACCUGCGCAAUAGC GCGGCACGCTCTTCAGCACCA GCCCUUCCAGUGAUGAGCC

CAGTTTGAGATGGACATTTAA GCCAGCCAGAGCCACCUGC ACAGTTTGAGATGGACATTTA GCAGAUACCUCCUUGUGCC GCCACCUGCGCAAUAGCCC CAGGAAGTGGACAAGAACGAA GAACGAACCCUUCCUUCCG CAGGCGGTGAAGAGTCACAAT CAGGATCATCTATGACCGGAA GAUACCUCCUUGUGCCUCC GCGCACAGGAGACCAUGUC CACCTGCGCAATAGCCCAGAA GCAGAUACCUCCUUGUGCC GAGCCACCUGCGCAAUAGC CACCAGCCAGGCCTTATGAAA GAACGAACCCUUCCUUCCG GCCCUUCCAGUGAUGAGCC TCGGAACTCACCTGTGACCAA GAUACCUCCUUGUGCCUCC GCCAGCCAGAGCCACCUGC GCGCAATAGCCCAGAAGATAA CAGGATTATCTATGACCGGAA GCCACCUGCGCAAUAGCCC

and complementary strands.

- for E4BP2

CTGTCAGATAATGCCTAAGAA CAAAGTAGAAGTAAACAATTT TTCAAATTTACATCAAAGATA CTGACTCTCCTGCAAGGATTA AAACAATTTGAACAACTTGAA ACCTGAAGTGTTGGTATCTGA CTCCTGCAAGGATTAGAAGAA GCCAATAGGATCAACAGTGAA TCATAGTATTCTGTCAGATAA

AAGTAGAAGTAAACAATTTGA TTAAGATGACTACAGACCTAT GUUUCUGUUGGAUCGUCGC CTGAAGAACGTTGACCCATTT GACAGAAGAGGCAAUACCA AAAGTAGAAGTGAACAACTTA TCCAAAGTAGAAGTAAACAAT GAUGAGCUUCAUCUGACCA AAGTGTTGGTATCTGAGAATA GAGGCAAUACCAGCAGUCC GCGCACAGGAGACCAUGUC AGCCCTGGCACCTTAATTGAA ACGAATCATTTATGACCGAAA GAGCCACCUGCGCAAUAGC CTGGGAATTTCTGGTTGGATT GACUCCAAAGUAGAAGUAA GCCCUUCCAGUGAUGAGCC TAAGATGACTACAGACCTATT GCUACCUCAUGACUAUUGC GCCAGCCAGAGCCACCUGC AAGATGACTACAGACCTATTT GCCAGAGCCGCGCCAUCCC GCCACCUGCGCAAUAGCCC TTTAAGATGACTACAGACCTA GCGACGCCGCGCAGCUACC

and complementary strands.

-for E4BP3:

CAGGATCATCTACGACCGAAA ACCTTCTGACTGCTTAGTAAA GGAAGAGAUACCCGAUGAC CACCTTCTGACTGCTTAGTAA GAGGCAGCTAGACCAGGGATA GACAGAGGAAGAGAUACCC CCCGATGACGCACAATTTGAA GGCCAGCTGGCCTCATCTAAT GUUCCUGCUGGAGUGCAAG CTGGAAGGGAGTGACTTGTTA AACTCACCCATTGCCCGGACA GCUGGAGGAGCUGAAGGAG CAGGAGACAGAGGAAGAGATA TGAGGCAGCTAGACCAGGGAT GCUGCCCGACUGCUACAGC AAGGAGCAGGAGACAGAGGAA AGGCAGCTAGACCAGGGATAG GAGAUACCCGAUGACGCAC CAATTTGAAATGGACATCTAA GUCACCUUCUGACUGCUUA GAACUCACCCAUUGCCCGG ACAATTTGAAATGGACATCTA GGCCAGCUGGCCUCAUCUA CAGTTTGAAATGGACATGTAA CTGGCCTCATCTAATCTGGAA GAUGACCUGGCAUGUGGAG GCGCACAGGAGACCAUGUC CGGAGGCACCAGGATCATCTA GUUCUGAGGCAGCUAGACC GAGCCACCUGCGCAAUAGC ACCAGGGATAGGAGTGGGCAA CAGGATCATCTACGACAGAAA GCCCUUCCAGUGAUGAGCC CCGATGACGCACAATTTGAAA GAUACCCGAUGACGCACAA GCCAGCCAGAGCCACCUGC CTTAGTAAACATTCAAAGAAA GGAGCAGGAGACAGAGGAA GCCACCUGCGCAAUAGCCC

and complementary strands.

According to a more preferred embodiment, siRNA of the present invention is selected in the group consisting in :

- for E4BP1 :

GCGGCACGCTCTTCAGCACCA GAACGAACCCUUCCUUCCG GAUACCUCCUUGUGCCUCC GCAGAUACCUCCUUGUGCC GAACGAACCCUUCCUUCCG GAUACCUCCUUGUGCCUCC

and complementary strands.

- for E4BP2 :

TAAGATGACTACAGACCTATT

AAGATGACTACAGACCTATTT

TTTAAGATGACTACAGACCTA

TTAAGATGACTACAGACCTAT

GACAGAAGAGGCAAUACCA

GAUGAGCUUCAUCUGACCA

GAGGCAAUACCAGCAGUCC

and complementary strands

-for E4BP3 :

GAGGCAGCTAGACCAGGGATA

GGCCAGCTGGCCTCATCTAAT

AACTCACCCATTGCCCGGACA

TGAGGCAGCTAGACCAGGGAT

AGGCAGCTAGACCAGGGATAG

GUCACCUUCUGACUGCUUA

GGCCAGCUGGCCUCAUCUA

GAUGACCUGGCAUGUGGAG

GUUCUGAGGCAGCUAGACC

and complementary strands,

- for E4BP1 or E4BP2 or E4BP3

GCGCACAGGAGACCAUGUC GAGCCACCUGCGCAAUAGC GCCCUUCCAGUGAUGAGCC GCCAGCCAGAGCCACCUGC GCCACCUGCGCAAUAGCCC

and complementary strands.

Other examples of siRNA of the present invention are selected in the group consisting in the siRNA (sense and antisense) sequences disclosed in Figure 1 (4EBP1), Figure 2 (4EBP2) and Figure 3 (4EBP3) .

In another embodiment, the said 4E-BPs inhibitor or partial inhibitor is an 4E-BPs miRNA (microRNA) . While the term "miRNA" is usually used to refer to endogenous RNAs that are naturally expressed, similar molecules or precursors thereof that either mimic the sequence of naturally occurring miRNAs or are specifically designed to hybridize to a target transcript so as to result in a duplex structure containing one or more bulges can be introduced into, and expressed within, cells and can cause translational repression. Thus either double-stranded duplex molecule structurally similar or identical to siRNAs, or hairpin precursors that can be processed intracellularly in a similar manner to naturally occurring miRNA precursors, can be introduced into cells and can mediate RNAi via translational repression (see, Doench, J., et al., 2003, Genes and Dev., 17, 438-442). An RNAi- inducing entity that mediates RNAi by repressing translation of a target transcript, and that consists of or comprises a strand that binds to a target transcript to form a duplex containing one or more bulges, is said herein to act via an miRNA translational repression pathway, and the strand that binds to the target may be referred to as an miRNA-like molecule. A binding site with which a small, single-stranded RNA can hybridize to form a duplex structure containing a bulge, such that the transcript containing the binding site (or multiple copies thereof) , is subject to RNAi via translational repression, is referred to herein as an miRNA binding site. Endogenous miRNAs can also mediate cleavage of RNA targets (i.e., they can act in an siRNA-like manner) if they have sufficient complementarity to the target. Further description of miRNAs and the mechanism by which they are

believed to mediate silencing is found in Bartel, 2004, Cell, 116:281-297, 2004.

According to special embodiment, miRNA of the present invention are defined by using the sequences provided above for siRNA.

In another embodiment, the said 4E-BPs inhibitor or partial inhibitor may have a short hairpin structure having a sticky portion at the 3' terminus and is an 4E-BPs shRNA (short hairpin RNA) . As used herein, the term "shRNA" refers to short hairpin RNA which functions as RNAi and/or siRNA species but differs in that shRNA species are double stranded hairpin-like structure for increased stability. shRNA are molecule of about 20 or more base pairs in which a single- stranded RNA partially contains a palindromic base sequence and forms a double-strand structure therein (i.e., a hairpin structure) . Such palindromic sequence is composed of a antisense sequence (that anneals to the target mRNA) in 5' to 3' (sequence a) orientation and an sense sequence in reverse orientation (3' to 5' ) (sequence b) separated by a linker sequence or loop sequence (that is unrelated to the target mRNA). shRNA may preferably have a 3' protruding end. The length of the double-stranded portion is not particularly limited, but is preferably about 10 or more nucleotides, and more preferably about 20 or more nucleotides. The 3 ¹ protruding end may be preferably DNA, more preferably DNA of at least 2 nucleotides in length, and even more preferably DNA of 2-4 nucleotides in length.

According to special embodiment, the "sequence a" and "sequence b" are selected in the group consisting in the siRNA sequences listed above.

According to special embodiment, the said hairpin loop sequence of the present invention is selected in the group consisting in :

AUG (Sui et al., 2002, Proc. Natl. Acad. Sci. USA, 99, 5515-5520), CCC or CCACC or CCACACC (Paul et al., 2002, Nature Biotechnology, 20, 505-508), UUCG (Lee et al., 2002, Nature Biotechnology, 20, 500-505) , CTCGAG or AAGCUU (Editors of Nature Cell Biology 2003 Nat Cell Biol., 5, 489-490), , UUCAAGAGA (Yu et al., 2002, Proc. Natl. Acad. Sci. USA, 99, 6047-6052), TTCAAGAGA (Brummelkamp et al., 2002, Science, 296, 550-553), AAGTTCTCT (Promega) , TTTGTGTAG (Scherr, et al., 2003 Cell Cycle, 2, 251-7), CTTCCTGTCA (Schwarz et al. 2003 Cell. 17; 115 (2) : 199-208. ), GUUUUGGCCACUGACUGAC (Invitrogen) .

According to special embodiment, shRNA of the present invention is selected in the group consisting in all combinations of antisense sequences (a or b) with each hairpin loop sequence described above and sense sequence (b or a) corresponding to the said antisenses, therefore forming a group of palindromic sequences.

According to another embodiment of the present invention, the said 4E-BPs inhibitor or partial inhibitor is a 4E-BPs- specific ribozyme having specificity for a 4E-BPs-encoding nucleic acid. It can include one or more sequences complementary to the nucleotide sequence of a 4E-BPs cDNA and a sequence having known catalytic sequence responsible for mRNA cleavage (see US 5,093,246 or Haselhoff and Gerlach, 1988, Nature, 334, 585-591) . 4E-BPs gene expression can further be inhibited by targeting nucleotide sequences complementary to the regulatory region of the 4E-BPs (e.g. the 4E-BPs promoter and/or enhancers) to form triple helical structures that prevent transcription of the 4E-BPs gene in target cells (Helene, 1991, Anticancer Drug Des., 6, 569-84; Maher, 1992, Bioassays, 14, 807-15) .

The nucleic acid sequences encoding 4E-BPs are known in the art and thus are available to the skilled man : see for example references (Pause, A. et al., 1994, Nature 371 (6500),

762-767); Poulin F, et al., 1998, J Biol Chem. ; 273 (22) : 14002- 7) .

More specifically, cDNA nucleic acid sequence encoding 4E-BP1 (NM_004095.3) is :

GGGGCGAGGCGGAGCGAGGCTGGAGGCGCGGGAGGGCAGCGAGAGGTTCGCGGGTGC AGCGC

ACAGGAGA

CCATGTCCGGGGGCAGCAGCTGCAGCCAGACCCCAAGCCGGGCCATCCCCGCCACTC GCCGG

GTGGTGCT

CGGCGACGGCGTGCAGCTCCCGCCCGGGGACTACAGCACGACCCCCGGCGGCACGCT CTTCA

GCACCACC

CCGGGAGGTACCAGGATCATCTATGACCGGAAATTCCTGATGGAGTGTCGGAACTCA CCTGT

GACCAAAA

CACCCCCAAGGGATCTGCCCACCATTCCGGGGGTCACCAGCCCTTCCAGTGATGAGC CCCCC

ATGGAAGC

CAGCCAGAGCCACCTGCGCAATAGCCCAGAAGATAAGCGGGCGGGCGGTGAAGAGTC ACAGT

TTGAGATG

GACATTTAAAGCACCAGCCATCGTGTGGAGCACTACCAAGGGGCCCCTCAGGGCCTT CCTGG

GAGGAGTC

CCACCAGCCAGGCCTTATGAAAGTGATCATACTGGGCAGGCGTTGGCGTGGGGTCGG ACACC

CCAGCCCT

TTCTCCCTCACTCAGGGCACCTGCCCCCTCCTCTTCGTGAACACCAGCAGATACCTC CTTGT

GCCTCCAC

TGATGCAGGAGCTGCCACCCCAAGGGGAGTGACCCCTGCCAGCACACCCTGCAGCCA AGGGC

CAGGAAGT

GGACAAGAACGAACCCTTCCTTCCGAATGATCAGCAGTTCCAGCCCCTCGCTGCTGG GGGCG

CAACCACC

CCTTCCTTAGGTTGATGTGCTTGGGAAAGCTCCCTCCCCCTCCTTCCCCAAGAGAGG AAATA

AAAGCCAC CTTCGCCCTAGGGCCAAGAAAAAAAAAAAAAAAAAAA cDNA nucleic acid sequence encoding 4E-BP2 (NM_004096.3) is :

CGCTGCTGCCGCTGCTGTTGCTCCTGAGGCTGCTGGCTGAGGCCGGAGGATCGAGCG GCGGC GGCGGCGG CGGCTGAGAGGGCGGCGGCGGGAGCGGAGCGGGACGAGGGAACGGGAGGAAGCGAGCGAG GA

GCGCGCAG

AGCGCGCTTTTCCGTCCGCCTGAGGAGCCGAAGCAGCCCCGGCCCCGCCGCCGCCGC CTGCC

CGCCGGAC

AAAGCCGAGAGCCCGCGCCCACAGCCATGTCCTCGTCAGCCGGCAGCGGCCACCAGC CCAGC

CAGAGCCG

CGCCATCCCCACCCGCACCGTGGCCATCAGCGACGCCGCGCAGCTACCTCATGACTA TTGCA

CCACGCCC

GGGGGGACGCTCTTCTCCACCACACCGGGAGGAACTCGAATCATTTATGACAGAAAG TTTCT

GTTGGATC

GTCGCAATTCTCCCATGGCTCAGACCCCACCCTGCCACCTGCCCAATATCCCAGGAG TCACT

AGCCCTGG

CACCTTAATTGAAGACTCCAAAGTAGAAGTAAACAATTTGAACAACTTGAACAATCA CGACA

GGAAACAT

GCAGTTGGGGATGATGCTCAGTTCGAGATGGACATCTGACTCTCCTGCAAGGATTAG AAGAA

AAGCAGCA

ACACTGATACTTGTGTGCACCTGATTTGGCCAATAGGATCAACAGTGAAAAGACAGA AGAGG

CAATACCA

GCAGTCCCCATTACAGTCTCCACCTCCCCGTCTTCCTCTGGGTGCCAAATGATGGGA AGATG

AGCTTCAT

CTGACCATTTCTTCTCCCTGTCTCCTGTTCCCCTTCCCAGTTAAACAGGTTAGATTG AAGGC

CCTTGCTG

TATTTCTGTAGAGCTAAGCAGCCCTTAGAGGAAAACAGTTCAACTCTGACTTTCCTA GTTGT

TTTTTTAT

TGAGAGCCACCCTCATACCCTGTAATTTTGTCCCAAATCAAATATCAACCTACCAAC AACTG

CCTGGCTG

GGAAGTCTGGGGAAGGGATACAGAGCTTGGTGGGCCTAACACCATTCATATTCCTTA CCCTC

TGTCTCTC

CTCCCTGTATCCCACCTATGGTTCAGTGTTGCAAGAGTCTGGGCTTGGGGTCTTTAA AACCA

GCAGGGGG

AAATGATAAAAAGAGAGCTGCTTTCCCTTTTACCTTGAGGTATTCGTCCCTCGGGAC AGAGC

ACAGCTTG

TGCAACTCTGGTAGCGTTACCCTGTGACACTGTTTTGAGGTCCACTTCCTTTCTTTC CTCTG

GGAGGAAT

GTCTTCTGTCTTTGGTATTATAGTTCATCTTCCCATTCTTTTACTTAGTGCATTTGT GCAGA

TATTTTTA

ACTCTGTACATCAGAAGAGAGCCCTTGGTAACCAGTTTTGCTCTTCTTCTGCCACTC CTCCC

TGCTTGCA

TCTCGTTGCTGGCAGAGTCCTCTTGTACTTCAAGAAAGCAAAGTGATTTTGTCTGCT CCTAG

AGCAGGTC

CATACCAAGTAATAGAGGCACTTTAGCTTCCACTTGGTGGGTAAGGCCTGATCATAG TATTC

TGTCAGAT

AATGCCTAAGAATGACCGCTGAAGAACGTTGACCCATTTGAGTACCCGGTCTCAGTC GTCAT

TTTTAAGT

CCAGTGAGCATTGTGGTAGTTGTTCTTAGATTGCAGTTTCTTATGTTTTGAGTTTGA AGTTG

ATTTTCAG

AATGTTCTTAGAAAAGAACTGCATTTTTTTCCTTTGTGGATCTGCTTTGTTTGGCTG CTGGG

ATAGATAA

GCATGGGCTTAAAAAATGTGTTCCTCCCAGTTTTCTTGCCTTTCCTGTTGTACTCTG AATTT

CTCTCCCT

ACCTCCCTCACTTTCTTCCTCTCTCCTTCCTTTCCTTCCTTTTTCTCTACCAGGCCA TTTTT

CAAATTTA

CATCAAAGATACCTGAAGTGTTGGTATCTGAGAATATCTGTCACTCCTCTTATCTGA GAAGT

GACCTTTT

ATTTTTAAGATGACTACAGACCTATTTTTAGATATGTTTTCAGTACAATTTTGAACA GCAAC

TTTTTAAT

TAAACATCTTCCAGTGTTAGGAAGTTGAGAAACGTTCATAGGCAAGTCTGCTGTTCT ATGTC

ACCATCTT

TTGTCTCCCCTAGTCCCCCAGGAGCTCTTTCCTTTCCCCTCTAGTTTTGGGTGTGCA TGTTT

GGAGTTTG

TAGTGGGTGGTTTGTAAAACTGGACCATTCTGCCTTGCTATGGGTTGTTCAAGAAAG CCTCA

TTCTTTTC

TGTGACCCTTTCGCTTTTGCATTCACCCTCCTTCCCACCTACCTGTCCTGGGGCTGT TGAGC

AGCATAAT

AATCCCGGGAGAATGATTCCCCTCATAGAAAGACAAAAGCATCCATCCCCTCATAGT TAAGT

AGCCACTG

GTGTCCTGGGAATTTCTGGTTGGATTTGGTGCCCTGAACTTTTTTATTAAGAAATCA GATCC

CAGGGTGA

GAGTAACAGGCCATTTGGCCAAGAAAGAAACCTGTTTGTTTTTCTTTTGAACTATGA AAAGA

CCCTGTTT

GTGAATATATTTTAGAAAGAGAGGAAGGATGTCTGCAGAACTTTGTTCTGTTTTCTG CCACA

AAAATGTG

AATAGTTCAGAGTGAAAACCTTTTGTGATGGTTGATGTCTCAGGAATAAGCTGGATC TCCAA

TGTTTTGG

GGATGCTTTGAGTCTCAAAAAAAATTGATAATCAGAAAAGTAATTTTTGTTTGTTTG TTTAA

TGTATCCC

TGTTCTGTTTTTAATTAAACTCCAAGTCTCATTTTAAAAAAAAAAAAAAAAA cDNA nucleic acid sequence encoding 4E-BP3 (NM_003732.2) is :

CCGCCTCAGACTCAGAGCTGCGCTCCTCGACCTCAACGCCAGGCGGTTACTTTGCTG CTCCT CCCGCTCG

CTATGTCAACGTCCACTAGCTGCCCGATTCCCGGGGGCCGGGACCAGCTGCCCGACT GCTAC AGCACCAC

GCCGGGGGGCACGCTATACGCCACTACCCCCGGAGGCACCAGGATCATCTACGACCG AAAGT TCCTGCTG

GAGTGCAAGAACTCACCCATTGCCCGGACACCCCCCTGCTGCCTCCCTCAGATTCCC GGGGT CACAACTC

CTCCAACAGCCCCTCTCTCCAAGCTGGAGGAGCTGAAGGAGCAGGAGACAGAGGAAG AGATA CCCGATGA

CGCACAATTTGAAATGGACATCTAATCCAGTGCAGATGACCTGGCATGTGGAGTTAC AGAGG GATCCCTC

ATGCCACTGCTGCCACCACCTCTTCCTGGGGCATCCAAAGGCCAGCTGGCCTCATCT AATCT GGAAGGGA

GTGACTTGTTAGTTCCAGGCCTCCTTTAGTTCTGAGGCAGCTAGACCAGGGATAGGA GTGGG CAACTTGC

CAAGCCCTTAACTCTACTTCCTCTTCAGTCTGTGGTACTCCTCCTAACCCTAAACCC TCTAT GCTCAGGG

GCTGGAACTGGGGAATGGAGTAAGTCACCTTCTGACTGCTTAGTAAACATTCAAAGA AATGA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA.

Figure 4 provides a table with correspondences between sequence from nucleic acid and corresponding polypeptides.

According to another embodiment, the term "indirect inhibitor" as used herein, refers to an anti-4E-BPs antibody. The term "antibody" as used herein refers to an immunoglobulin molecule or immunologically active portion thereof, i. e., an antigen-binding portion. Examples of immunologically active portions of immunoglobulin molecules include scFV and dcFV fragments, Fab and F (ab ¹ ) 2 fragments which can be generated by treating the antibody with an enzyme such as papain or pepsin, respectively. The antibody can be a polyclonal, monoclonal, recombinant, e.g. a chimeric or humanized, fully human, non-human, e.g. murine or single chain antibody. The antibody can be coupled to a toxin or imaging agent. A full- length 4E-BPs protein or, antigenic peptide fragment of 4E-BPs can be used as an immunogen or can be used to identify anti- 4E-BPs antibodies made with other immunogens, e. g. , cells, membrane preparations, and the like. The antigenic peptide of 4E-BPs should include at least 8 amino acid residues of the 4E-BPs amino acid sequence (see for example: YDRKFLL (TyrAspArgLysPheLeuLeu) in 4E-BP2 and 4E-BP3 YDRKFLM (TyrAspArgLysPheLeuMet) in 4E-BP1, and encompasses an epitope of 4E-BPs. Preferably, the antigenic peptide includes at least 10 amino acid residues, more preferably at least 15 amino acid residues, even more preferably at least 20 amino acid residues, and most preferably at least 30 amino acid residues. Preferred epitopes encompassed by the antigenic peptide are regions of 4E-BPs located on the surface of the protein, e. g., hydrophilic regions, as well as regions with high antigenicity. Additionally, chimeric, humanized, and completely human antibodies are also within the scope of the invention. Chimeric, humanized, but most preferably, completely human antibodies are desirable for applications which include repeated administration, e. g., therapeutic

treatment of human patients. These terms and methods for producing these antibodies by recombinant DNA techniques are widely known in the art (see for example EP184187, EP171496, EP173494, WO 86/01533, US4816567).

According to another embodiment, the term "indirect inhibitor" as used herein, refers to anti-4E-BPs inhibitory peptides, such as for example "RIIYDRKFLMEC" peptide (ArgllelleTyrAspArgLysPheLeuMetGluCys) , corresponding to the eiF4E binding sequence on the human 4EBP1 protein, plays and inhibitor role on 4EBP1 binding to eiF4E (Salaum et al. 2005 J. Cell Sci. 118, 1385-1394, Herbert et al. 2000 Cur. biol. 10: 793-796) .

The invention provides methods (also referred to herein as "screening assays") for identifying modulators of the present invention (especially 4E-BPs inhibitors, including 4E- BPs partial inhibitors), i.e. candidate or test compounds or agents (e.g. proteins, peptides, peptidomimetics, peptoids, small molecules, nucleic acids, oligonucleotides or any other drugs) which have a modulating effect on 4E-BPs activity, and more specifically an inhibitory effect on 4E-BPs activity (direct inhibitors) or on 4E-BPs expression (indirect inhibitors) . According to the present invention, "candidate or compounds or agents" are synonyms.

Measurement of 4EBP activity can be done by methods well known in the art such as the followings : by quantification of 4EBPs phosphorylation: A quantification of phosphorylated 4EBP1 is possible using antibodies recognising phosphorylated forms of 4EBP1 on residues S64, T36, T45, T46, T70 (Abeam or Cell signalling, by comparing to 4EBP1 level of expression (antibody Cell signalling) or ELISA kits (Invitrogen) .

- by quantification of total 4E-BP1 using a solid phase sandwich Enzyme Linked-Immuno-Sorbent Assay

(ELISA) (Invitrogen) . A mouse monoclonal antibody specific for 4E-BP1 (regardless of phosphorylation state) is coated onto the wells of the microtiter strips provided. Samples, including a standard containing 4E-BP1, control specimens, and unknowns, are pipetted into these wells. During the first incubation, the 4E-BP1 antigen binds to the immobilized (capture) antibody. After washing, a rabbit antibody specific for 4E-BP1 is added to the wells. Another ELISA kit can be used for detection of phosphor Threonine 46 in 4EBP, that is part of the eif4E binding site (Invitrogen) . eiF4E is active when uncoupled from 4EBPs, upon 4EBPs inhibition, eiF4E should be released from the complex.

-by quantification of free/active pool of eiF4E by pulldown assays using 7-methyl-GTP sepharose 4B beads, followed by immuno blotting using an antibody directed against eif4E protein, is compared to the total amount of eiF4E present in cell lysate quantified by immunoprecipitation (Hu et al. 2007 Cancer res. 67(8): 3569-3573).

-by Translation assays using cell extracts transfected by pcDNA-Luciferase, and normalized by protein concentration, with or witout treatment by 4EBP modulator, allow to quantify translation efficacy (Hu et al . 2007 Cancer res. 67(8): 3569- 3573. by quantifying 4EBP mRNA expression by Qantitative RTPCR

In urchin embryo, first mitotic division following fertilization is dependant upon 4EBP release from eiF4E. Injecting 4EBP modulators in urchin embryos prior to division following fertilisation is an in vivo assay of 4EBP activity (Salaum et al. 2005 J. Cell Sci. 118, 1385-1394).

In yet another embodiment, an in vivo assay is provided in which the capacity of test substance to reduce photoreceptor induced degeneration in vivo is quantified after intra vitreal

injection of the test substance. Mouse animal models can display a photoreceptor degeneration induced by different mutations, e.g. rdl mouse mutated in Phospho-di-esterase (Bowes et al., 1993, PNAS, 90, 2955-2959); Zaprinast induced photoreceptor degeneration (Vallaza-Deschamps et al., 2005, Eur. J. Neuroscience, 22, 1013-1022); Rhodopsin P23H mutated mouse or rat (Ollson, 1992, Neuron, 9, 815-830 and Lewin, 1998, Nat. Med., 4, 967-971). Photoreceptor survival quantification is assessed by histological section, co- labelling with photoreceptor specific marker (rhodopsin) , outer nuclear layer thickness quantification and cell counting. Electroretinogram is used to assess functionality of surviving photoreceptors (Frasson et al., 1999, Nat Med., 5, 1183-7) .

The present invention also provides methods of screening for modulators (more specifically inhibitors) of 4E-BPs comprising the steps of (a) contacting a cell or cell component expressing 4E-BPs polypeptide in the presence and absence of a test substance; (b) measuring 4E-BPs expression or activity in the presence and absence of the test substance; and (c) selecting a test substance that reduces 4E-BPs expression or activity. In one embodiment, the cell is recombinantly modified to express elevated levels of 4E-BPs polynucleotide or polypeptide. In another embodiment, the cell is transformed or transfected with a polynucleotide encoding 4E-BPs and wherein the cell expresses 4E-BPs messenger RNA or polypeptide encoded by the polynucleotide. In a further embodiment, the 4E-BPs polypeptide comprises an amino acid sequence at least 90% identical to the 4E-BPs amino acid sequence as disclosed above.

More specifically, modulators (more specifically inhibitors) of 4E-BPs expression are identified. For example, a cell or cell free mixture is contacted with a test substance and the expression of 4E-BPs mRNA or protein evaluated

relative to the level of expression of 4E-BPs mRNA or protein in the absence of the test substance. When expression of 4E- BPs mRNA or protein is greater in the presence of the test substance than in its absence, the test substance is identified as a stimulator of 4E-BPs mRNA or protein expression. Alternatively, when expression of 4E-BPs mRNA or protein is less (statistically significantly less) in the presence of the test substance than in its absence, the candidate compound is identified as an inhibitor of 4E-BPs mRNA or protein expression. The level of 4E-BPs mRNA or protein expression can be determined by quantitative RTPCR or Western-blotting respectively using an antibody specific to 4E-BPs (Abnova, Evertest Biotech) .

The sources for test substances to be screened include natural sources, such as a cell extract (e.g., invertebrate cells including, but not limited to, bacterial, fungal, algal, and plant cells) and synthetic sources, such as chemical compound libraries or biological libraries such as antibody substance or peptide libraries. Agents are screened for the ability to either stimulate or inhibit the activity. There are a number of different libraries used for the identification of small molecule modulators, including: (i) chemical libraries, (ii) natural product libraries, and (iii) combinatorial libraries comprised of random peptides, oligonucleotides or organic molecules Chemical libraries consist of random chemical structures, or analogs of known compounds, or analogs of compounds that have been identified as "hits" or "leads" in prior drug discovery screens, some of which may be derived from natural products or from non-directed synthetic organic chemistry. Natural product libraries are collections of microorganisms, animals, plants, or marine organisms which are used to create mixtures for screening by: (1) fermentation and extraction of broths from soil, plant or marine microorganisms or (2) extraction of plants or marine organisms. Natural

product libraries include polyketides, non-ribosomal peptides, and variants (non-naturally occurring) thereof. Combinatorial libraries are composed of large numbers of peptides, oligonucleotides, or organic compounds as a mixture. These libraries are relatively easy to prepare by traditional automated synthesis methods, PCR, cloning, or synthetic methods. Of particular interest are non-peptide combinatorial libraries. Still other libraries of interest include peptide, protein, peptidomimetic, multiparallel synthetic collection, recombinatorial, and polypeptide libraries. Identification of modulators through use of the various libraries described herein permits modification of the candidate "hit" (or "lead") to optimize the capacity of the "hit" to modulate activity.

In one aspect, the methods of the invention comprise steps of culturing a neuronal cell in the presence and absence of the modulators as set out above; measuring and comparing cell growth or survival or differentiation in the presence and absence of the modulator; and selecting a modulator that promotes increased survival or growth or differentiation of said neuronal cell. In a certain embodiment, the cell is selected from the group consisting of a hippocampal neuron or neural stem cell, a subventricular neuron or neuron stem cell, a cortical neuron or neuron stem cell, and a neuroblastoma cell. In another embodiment, the neuronal cell is a retinal cell selected from the group consisting of photoreceptors (rods and cones) , ganglion cells, horizontal cells, amacrine cells, bipolar cells. Alternatively, the methods of the invention comprise steps of culturing a non neuronal retinal cell in the presence and absence of the modulators as set out above; "measuring and comparing cell growth or survival or differentiation in the presence and absence of the modulator; and selecting a modulator that promotes increased survival or growth or differentiation of said cell. In this special

embodiment, the cell is selected from the group consisting Muller cells and pigmented epithelial cells.

In another aspect, the invention pertains to a combination of two or more of the assays described herein. For example, a modulating (activator or inhibitor) agent of the invention can be identified using a cell-based or a cell free assay, and the ability of the said agent to (i) inhibit the activity or expression of a 4E-BPs protein and/or (ii) reduce the 4E-BPs mRNA levels can be confirmed in vivo, e. g., in an animal such as a mouse model (e.g., animal models of retinal degeneration disclosed above such as P23H rat, P23H mouse or rdl mouse) .

This invention further pertains to novel compounds identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein (e.g., a 4E-BPs direct inhibitor, a 4E-BPs indirect inhibitor) in an appropriate animal model to determine the efficacy, toxicity, side effects, or mechanism of action, of treatment with such an agent. Furthermore, novel compounds identified by the above-described screening assays can be used for treatments as described herein.

According to another special embodiment, said 4E-BPs inhibitor is an indirect inhibitor and is a nucleic acid (including expression vector disclosed above) .

The (4E-BPs) modulator themselves also are aspects of the invention, as are mixtures of these modulators; mixtures of modulators with any other neurotropic factors; and pharmaceutical compositions comprising the modulators in pharmaceutically acceptable carriers. Non limiting examples of neurotropic factors according to the invention are NGF, BDNF, NT-3, 4, 5, or 6, CNTF, IGFI, IGFII, GDNF, GPA, bFGF, TGFB, and apolipoprotein E.

Pharmaceutical compositions are within the scope of the present invention. Such pharmaceutical compositions are compositions as disclosed above admixed with pharmaceutically or physiologically acceptable formulations. More particularly, the compositions of the present invention are comprising the 4E-BPs modulator of the Invention combined with further ingredients that are physiologically tolerable and do not typically produce adverse reactions when administered to a subject in need thereof (e.g. human). These ingredients are preferably "pharmaceutically or physiologically acceptable" as approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia or other generally recognized pharmacopoeias for use in mammals, and more particularly in humans. Further, the present invention relates to a composition containing an effective non-toxic dose of the compounds of the present invention (i.e. the 4E- BPs modulator) as well as pharmaceutically acceptable carriers or solvents. The pharmaceutical compositions are obtained by blending a therapeutically active amount of at least one compound of the present invention with a pharmaceutically acceptable carrier, which may have different forms depending on the desired administration route. The term "carrier" applied to pharmaceutical compositions of the invention refers to a diluent, excipient, or vehicle with which an active compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water, saline solutions, aqueous dextrose solutions, aqueous glycerol solutions, and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E. W. Martin, 18th Edition. According to one embodiment of the present invention carriers are suitable for immediate-release, i.e., release of most or all of the active ingredients over a

short period of time, such as 60 minutes or less, and make rapid absorption of the drug possible.

According to preferred embodiment, the composition of the invention is delivered to areas within the eye, most preferably in the vicinity of the retina. It can be accomplished by injection, canula or other invasive device designed to introduce precisely metered amounts of a desired ophthalmic composition to a particular compartment or tissue within the eye (e.g. posterior chamber or retina) . An intraocular injection may be into the vitreous (intravitreal) , or under the conjunctiva (subconjunctival) , or behind the eye (retrobulbar) , into the sclera, or under the Capsule of Tenon (sub- Tenon) , and may be in a depot form. Other intraocular routes of administration and injection sites and forms are also contemplated and are within the scope of the invention. In preferred embodiment the combination product of the invention will be delivered by sub-retinal or intra-vitreal injection.

In one embodiment, the composition of the invention is intraocularly injected (e.g. into the vitreous or sub retinal) to treat or prevent an ophthalmic condition related to cellular degenerative conditions, and more specifically retinal degenerative diseases. When administering the ophthalmic composition by intraocular injection, the active agents should be concentrated to minimise the volume for injection. Preferably, the volume for injection is less than about 5 ml. Volumes such as this may require compensatory drainage of the vitreous fluid to prevent increases in intraocular pressure and leakage of the injected fluid through the opening formed by the delivery needle. More preferably, the volume injected is between about 1.0 ml and 0.05 ml. Most preferably, the volume for injection is approximately 0.1 ml.

For injection, a concentration of the compound of the present invention less than about 20 mg/ml may be injected. Preferably a dose of about 10 mg/ml is administered. Sample concentrations include, but are not limited to, about 5 μg/ml to about 50 μg/ml; about 25 μg/ml to about 100 μg/ml; about 100 μg/ml to about 200 μg/ml; about 200 μg/ml to about 500 μg/ml; about 500 μg/ml to about 750 μg/ml; about 500 μg/ml up to 1 mg/ml etc. preferred 50mg/ml. For viral injections with viruses expressing shRNA, sample concentrations include, but are not limited to, 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ , 10 ¹⁰ 10 ¹¹ to 10 ¹² genome copy/ml.

Intraocular injection may be achieved by a variety of methods well known in the art. For example, the eye may be washed with a sterilising agent such as Betadine® and the pharmaceutical composition of the Invention is injected in an appropriate carrier with a fine gauge needle (e.g. 27 gauge) at a position in the eye such that the compound will settle to the posterior pole towards the ventral surface. It may be necessary to prepare the eye for injection by application of positive pressure prior to injection. In some cases, preliminary vitrectomy may be necessary. Local anaesthetic or general anaesthetic may be necessary.

The syringe used in practicing the method of this invention is suitably one which can accommodate a 21 to 40 gauge needle and is preferably of a small volume, for example 1.5 ml, or more preferably 0.1 ml. Although it is possible that the needle and syringe may be of the type where the needle is removable from the syringe, it is preferred that the arrangement is of a unitary syringe/needle construction. This would clearly limit the possibility of disengagement of the needle from the syringe. It is also preferred that the arrangement be tamper evident. The pharmaceutical composition of the present invention may therefore be provided in the form of a single unit dose, or separated unit doses each containing

part of the combination product, in a pre-prepared syringe ready for administration.

A suitable style of syringe is, for example, sold under the name of Uniject® manufactured by Becton Dickinson and Company. In this style of syringe, the material is expelled through the needle into the eye by pressure applied to the sides of a pliable reservoir supplying the needle, rather than by a plunger. As the name implies, the construction of the reservoir and needle forms a single unit.

Topical application of composition of the invention for the treatment or prevention of disorders according to the present invention may be as ointment, gel or eye drops. The topical ophthalmic composition may further be an in situ gellable aqueous formulation. Such a formulation comprises a gelling agent in a concentration effective to promote gelling upon contact with the eye or with lacrimal fluid in the exterior of the eye. Suitable gelling agents include, but are not limited to, thermosetting polymers such as tetra- substituted ethylene diamine block copolymers of ethylene oxide and propylene oxide (e.g., poloxamine) ; polycarbophil; and polysaccharides such as gellan, carrageenan (e.g., kappa- carrageenan and iota-carrageenan) , chitosan and alginate gums.

The phrase "in situ gellable" as used herein embraces not only liquids of low viscosity that form gels upon contact with the eye or with lacrimal fluid in the exterior of the eye, but also more viscous liquids such as semi-fluid and thixotropic gels that exhibit substantially increased viscosity or gel stiffness upon administration to the eye.

To prepare a topical ophthalmic composition for the treatment of disorders as disclosed herein, a therapeutically effective amount of the composition of the invention is placed in an ophthalmological vehicle as is known in the art. For example, topical ophthalmic formulations containing steroids

are disclosed in US 5,041,434, whilst sustained release ophthalmic formulations of an ophthalmic drug and a high molecular weight polymer to form a highly viscous gel have been described in US 4,271,143 and US 4,407,792. Further GB 2007091 describes an ophthalmic composition in the form of a gel comprising an aqueous solution of a carboxyvinyl polymer, a water-soluble basic substance and an ophthalmic drug. Alternatively, US 4,615,697, discloses a controlled release composition and method of use based on a bioadhesive and a treating agent, such as an anti- inflammatory agent.

The composition of the invention may be also administered as a slow release formulation, with a carrier formulation such as microspheres, microcapsules, liposomes, etc., as a topical ointment or solution, an intravenous solution or suspension, or in an intraocular injection, as known to one skilled in the art to treat or prevent ophthalmic disorders. By "slow release", "time-release", "sustained release" or "controlled release" is meant that the therapeutically active component is released from the formulation at a controlled rate such that therapeutically beneficial levels (but below toxic levels) of the component are maintained over an extended period of time ranging from e.g., about 12 to about 24 hours, thus, providing, for example, a 12 hour or a 24 hour dosage form. A time-release drug delivery system may be administered intraocularly to result in sustained release of the combination product over a period of time. The composition may be in the form of a vehicle, such as a micro- or macro-capsule or matrix of biocompatible polymers such as polycaprolactone, polyglycolic acid, polylactic acid, polyanhydrides, polylactide-co-glycolides, polyamino acids, polyethylene oxide, acrylic terminated polyethylene oxide, polyamides, polyethylenes, polyacrylonitriles, polyphosphazenes, poly(ortho esters), sucrose acetate isobutyrate (SAIB), and other polymers such as those disclosed in US Patents Nos.

6,667,371; 6,613,355; 6,596,296; 6,413,536; 5,968,543; 4,079, 038; 4,093,709; 4,131,648; 4,138,344; 4,180,646; 4,304,767; 4,946,931, each of which is expressly incorporated by reference herein in its entirety, or lipids that may be formulated as microspheres or liposomes. A microscopic or macroscopic ophthalmic composition may be administered through a needle, or may be implanted by suturing within the eye, eg intravitreal cavity or sub-retinal space. Delayed or extended release properties may be provided through various formulations of the vehicle (coated or uncoated microsphere, coated or uncoated capsule, lipid or polymer components, unilamellar or multilamellar structure, and combinations of the above, etc.). The formulation and loading of microspheres, microcapsules, liposomes, etc and their ocular implantation are standard techniques known by one skilled in the art.

The invention also provides a method for the treatment or prophylaxis of ophthalmic disorders, said method comprising the step of administering a composition of the Invention in a biocompatible, biodegradable matrix, for example in the form of a gel or polymer which is preferably suited for insertion into the retina or into a cavity of the eye, anterior or posterior, as an implant. In the case that the pharmaceutical composition is delivered as an implant, it may be incorporated in any known biocompatible biodegradable matrix as a liquid, or in the form, for example, of a micelle using known chemistry or as microparticles .

Slow or extended-release delivery systems include any of a number of biopolymers (biological-based systems) , systems employing liposomes, colloids, resins, and other polymeric delivery systems or compartmentalized reservoirs, can be utilized with the compositions described herein to provide a continuous or long term source of therapeutic compound (i.e. the 4EBPs modulator) .

In one form, implants used in the method of the present invention are formulated with composition of the invention entrapped within the bio-erodible polymer matrix. Release of the therapeutic compounds is achieved by erosion of the polymer followed by exposure of previously entrapped compound to the vitreous, and subsequent dissolution and release of compound. The release kinetics achieved by this form of drug release are different than that achieved through formulations which release drug through polymer swelling, such as with hydrogels such as methylcellulose . In that case, the therapeutic compound is not released through polymer erosion, but through polymer swelling, which releases active compound as liquid diffuses through the pathways exposed. The parameters which determine the release kinetics include the size of the therapeutic compound particles, the water solubility of the active compound, the ratio of active compound to polymer, the method of manufacture, the surface area exposed, and the erosion rate of the polymer.

Exemplary biocompatible, non-biodegradable polymers of particular interest include polycarbamates or polyureas, particularly polyurethanes, polymers which may be cross-linked to produce non- biodegradable polymers such as cross-linked poly (vinyl acetate) and the like. Also of particular interest are ethylene-vinyl ester copolymers having an ester content of 4% to 80% such as ethylene-vinyl acetate (EVA) copolymer, ethylene-vinyl hexanoate copolymer, ethylene-vinyl propionate copolymer, ethylene-vinyl butyrate copolymer, ethylene-vinyl pentantoate copolymer, ethylene-vinyl trimethyl acetate copolymer, ethylene-vinyl diethyl acetate copolymer, ethylene- vinyl 3-methyl butanoate copolymer, ethylene-vinyl 3-3- dimethyl butanoate copolymer, and ethylene-vinyl benzoate copolymer .

Additional exemplary naturally occurring or synthetic non- biodegradable polymeric materials include

poly (methylmethacrylate) , poly (butylmethacrylate) , plasticized poly (vinylchloride) , plasticized poly (amides) , plasticized nylon, plasticized soft nylon, plasticized poly (ethylene terephthalate) , natural rubber, silicone, poly (isoprene) , poly (isobutylene) , poly (butadiene) , poly (ethylene) , poly (tetrafluoroethylene) , poly (vinylidene chloride), poly (acrylonitrile, cross-linked poly (vinylpyrrolidone) , poly (trifluorochloroethylene) , chlorinated poly (ethylene) , poly (4,4'- isopropylidene diphenylene carbonate), vinylidene chloride-acrylonitrile copolymer, vinyl chloridediethyl fumarate copolymer, silicone, silicone rubbers (especially the medical grade), poly (dimethylsiloxanes) , ethylene- propylene rubber, silicone-carbonate copolymers, vinylidene chloride- vinyl chloride copolymer, vinyl chloride-acrylonitrile copolymer, vinylidene chloride-acrylonitrile copolymer, poly (olefins) , poly (vinyl- olefins), poly (styrene) , poly(halo- olefins) , poly (vinyls) , poly (acrylate) , poly (methacrylate) , poly (oxides) , poly (esters) , poly (amides) , and poly (carbonates) .

Diffusion of the composition from the implant may also be controlled by the structure of the implant. For example, diffusion of the pharmaceutical composition from, the implant may be controlled by means of a membrane affixed to the polymer layer comprising the drug. The membrane layer will be positioned intermediate to the polymer layer comprising the pharmaceutical composition and the desired site of therapy.

The skilled reader will appreciate that the duration over which any of the composition used in the method of the invention will dwell in the ocular environment will depend, inter alia, on such factors as the physicochemical and/or pharmacological properties of the compounds employed in the formulation, the concentration of the compound employed, the bioavailability of the compound, the disease to be treated, the mode of administration and the preferred longevity of the

treatment. Where that balance is struck will often depend on the longevity of the effect required in the eye and the ailment being treated.

The frequency of treatment according to the method of the invention is determined according to the disease being treated, the deliverable concentration of the composition and the method of delivery. If delivering the combination product by intravitreal injection, the dosage frequency may be monthly. Preferably, the dosage frequency is every three months. The frequency of dosage may also be determined by observation, with the dosage being delivered when the previously delivered combination product is visibly cleared. In general, an effective amount of the compound is that which provides either subjective relief of symptoms or an objectively identifiable improvement as noted by the clinician or other qualified observer.

Compositions prepared for used in the method of the present invention to prevent or treat ophthalmic disorders will preferably have dwell times from hours to many months and possibly years, although the latter time period requires special delivery systems to attain such duration and/or alternatively requires repetitive administrations. Most preferably the combination product for use in the method of the invention will have a dwell time (ie duration in the eye) of hours (i.e. 1 to 24 hours), days (i.e. 1, 2, 3, 4, 5, 6 or 7 days) or weeks (i.e. 1, 2, 3, 4 weeks) . Alternatively, the combination product will have a dwell time of at least a few months such as, 1 month, 2 months, 3 months, with dwell times of greater than 4, 5, 6, 7 to 12 months being achievable.

If desired, the method or use of the invention can be carried out alone, or in conjunction with one or more conventional therapeutic modalities (such as photodynamic therapy, laser surgery, laser photocoagulation or one or more

biological or pharmaceutical treatments. These methods are well known from the skilled man in the art and widely disclosed in the literature) . The use of multiple therapeutic approaches provides the patient with a broader based intervention. In one embodiment, the method of the invention can be preceded or followed by a surgical intervention. In another embodiment, it can be preceded or followed by photodynamic therapy, laser surgery, laser photocoagulation. Those skilled in the art can readily formulate appropriate therapy protocols and parameters which can be used.

The present Invention further concerns a method for improving the treatment of a patient which is undergoing one or more conventional treatment as listed above, which comprises co-treatment of said patient along with at least one 4E-BPs modulator of the present invention.

The present invention further concerns a method for treating cell degenerative conditions, and related diseases, said method comprising administering to a subject in need of such treatment a therapeutically effective amount of at least one 4E-BPs modulator of the present invention.

The present Invention further concerns a method for improving the treatment of a patient which is undergoing one or more conventional treatment as listed above, which comprises co-treatment of said patient along with at least one 4E-BPs inhibitor of the present invention, and preferably said inhibitor is an indirect inhibitor.

The present invention further concerns a method for treating cell degenerative conditions, and related diseases, said method comprising administering to a subject in need of such treatment a therapeutically effective amount of at least one 4E-BPs inhibitor of the present invention, and preferably said inhibitor is an indirect inhibitor.

The present invention further concerns the use of any of the composition of the Invention for the preparation of pharmaceutical preparation for implementation in methods of treatment and/or improvement listed above.

According to the invention, said treatment results in neurological regeneration. The term "neurological regeneration" includes CNS regeneration or neuroregeneration and refers to one of several types of events that lead to functional improvement of the CNS. The term "central nervous system" or "CNS" includes the brain, spinal cord, and retina. CNS improvement can manifest itself as an improvement, stabilization, or slowed-down deterioration of functions such as cognition, vision, etc. The cellular basis for neuroregeneration can be e.g. increased proliferation (or slower death) of neural stem cells; generation of new neurons and/or glial cells (referred to as neurogenesis and gliogenesis, respectively) ; formation of new, or stabilization of the existing, neuronal synapses (synaptic regeneration); or re-growth of severed axons (axonal regeneration) .

The present invention further concerns a method for treating cell degenerative conditions, and related diseases, said method comprising administering to a subject in need of such treatment a therapeutically effective amount of at least one 4E-BPs modulator of the present invention (preferably an indirect 4E-BPs inhibitor) , effective to limit cellular degeneration, and more preferably neuron degeneration, more preferably retinal cell degeneration, and most preferably photoreceptor cell degeneration.

The term "therapeutically effective amount" in the context of neurodegenerative diseases or conditions described herein refers to an amount effective to achieve measurable improvement (compared to an untreated control) as assessed by

any relevant medical parameter used to evaluate subjects receiving treatment for the disease or condition.

According to a first embodiment, the term "cell degenerative conditions, and related diseases" relates to a disorder characterized by retinal cell degeneration, i.e. degeneration affecting one or more of retinal cells, including photoreceptors (rods and cones) , ganglion cells, horizontal cells, amacrine cells, Muller cells, bipolar cells and pigmented epithelial cells.

According to another embodiment, the term "cell degenerative conditions, and related diseases" relates more specially to a disorder characterized by photoreceptor cell degeneration. It is defined herein as any condition marked by a decrease in photoreceptor cell number and/or function. In one embodiment of the invention, the disorder is age-related macular degeneration. As used herein, "age-related macular degeneration" is defined as an age-related disorder which causes a decrease in visual acuity and possible loss of central vision. In another embodiment of the invention, the disorder is retinitis pigmentosa. Other _. disorders characterized by photoreceptor cell degeneration according to the invention include edema (e.g. macular and retinal edema), ischemic conditions and uveitis.

According to another embodiment, the term "cell degenerative conditions, and related diseases" relates to a disorder characterized by neuron degeneration, including Alzheimer's disease, Parkinson's disease, Huntington's disease, the prion diseases, Motor Neurone Disease (MND) , and Amyotrophic Lateral Sclerosis (ALS) , lesions due to ischaemia and reperfusion, traumatic brain lesions, neuropathy due to HIV, Down's syndrome, diabetic polyneuropathy, muscular dystrophy, multiple sclerosis, late dyskinesia, tauopathy and demyelinating pathologies.

In a further aspect, a mammalian subject is treated with a therapeutically effective amount of a modulator of the invention, which is an amount that is sufficient to induce a desired response in the treated subject. Thus, a biologically or therapeutically effective amount of a modulator may be the amount that interferes with physiological activity of the treated mammal in a non-lethal manner. For the purpose of diagnosing the illness or of evaluating the treatment efficacy of disorder characterized by retinal cell degeneration, it is usual to rely on such tests as examination of the fundus of the eye, examination of the visual field, electroretinograms, fluorangiography, and visus examination: examination of the fundus of the eye aims at assessing the condition of the retina and to look for the presence of the characteristic pigment spots on the retinal surface, which in the illness assume a characteristic "osteoblast-like" appearance; examination of the visual field makes it possible to evaluate the sensitivity of the various parts of the retina to light stimuli; visual fields can be measured by means of microperimetry, Goldmann dynamic perimetry, and photopic and scotopic (dark-adapted) automated static perimetry.

electroretinogram (ERG) consists of recording the electrical activity of the retina in response to particular light stimuli, thus making possible distinct valuations of the functionality of the two different types of photoreceptors (i.e. cone cells and rod cells) . The electroretinogram is a very important examination for diagnosing retinitis pigmentosa, because, even when the illness is in its initial stages, the resulting trace is almost always either very flat or altogether absent; Even more

importantly, multi-focal ERG make it possible to detect defects and benefits on few photoreceptors.

Retinal thickness is determined by optical coherence tomography.

fluorangiography is performed by means of the intravenous injection of a fluorescent substance and subsequent photography of the retina at different times. Due to blood circulation, in fact, the fluorescent substance arrives at the retina, where it colours the arteries, the capillaries and the veins and thus renders them visible, as also the functional state of their walls; visus examination permits a valuation of visual acuity and consists of the patient reading letters of different sizes at a distance of three metres.

According to another embodiment, the compound or composition of the present invention allows to improve at least one disease related parameter selected in the group of parameters measured by examination of the fundus of the eye, examination of the visual field, electroretinograms, fluorangiography, and visus examination.

The term subject in need thereof as used- herein refers to a mammal preferably a human.

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. The invention includes all such variation and modifications. The invention also includes all of the steps, features, formulations and compounds referred to or indicated in the specification, individually or collectively and any and all combinations or any two or more of the steps or features.

Each document, reference, patent application or patent cited in this text is expressly incorporated herein in their entirety by reference, which means that it should be read and considered by the reader as part of this text. That the document, reference, patent application or patent cited in this text is not repeated in this text is merely for reasons of conciseness.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally equivalent products, formulations and methods are clearly within the scope of the invention as described herein.

The invention described herein may include one or more range of values (e.g. size, concentration, etc). A range of values will be understood to include all values within the range, including the values defining the range, and values adjacent to the range which lead to the same or substantially the same outcome as the values immediately adjacent to that value which defines the boundary to the range.