COMPOSITIONS AND METHODS FOR TREATMENT OF FABRY DISEASE

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit and priority of U.S. Provisional Application No. 63/400,664, filed on August 24, 2022, and U.S. Provisional Application No. 63/484,668, filed on February 13, 2023, the contents of each of which are incorporated herein by reference in their entireties.

BACKGROUND OF THE INVENTION

[0002] Fabry disease is an incurable, progressive lysosomal storage disease characterized by mutations in the GLA gene, which results in the absence or decreased function of the encoded alpha-galactosidase A (a-GAL) enzyme, leading to the accumulation of Globotriaosylceramide (Gb3) throughout the body. The classic presentation of the disease begins with pain in the first to second decade of life followed by progressive renal, cardiac, neurologic, GI and dermal involvement. Classically affected patients typically succumb to the disease in their 50s.

[0003] Oral chaperone therapy is available to a subset of patients who have amenable GLA-mutations; however, the majority of patients are treated with enzyme replacement therapy (ERT): a bi-weekly infusion of recombinant a-GAL. a-GAL ERT therapy is a lifelong commitment typically requiring infusions that can last for several hours, frequently cause acute infusion reactions, results in highly variable plasma a-GAL concentrations due to short a-GAL half-life, and places a large burden on financial and other resources within the health care system. Due to these challenges, long-term compliance is difficult. A need for novel and more universal treatment of Fabry disease is remains.

SUMMARY OF THE INVENTION

[0004] Disclosed herein are novel compositions and methods for the treatment of Fabry disease.

[0005] In various embodiments, the invention relates to a therapeutic protein comprising a modified human a-GAL protein, wherein the modified human a-GAL protein has been modified by, a deletion of two carboxy terminal leucine residues of a wild-type human a- GAL protein; and a replacement of a signal peptide of said wild-type human a-GAL protein with an immunoglobulin(Ig) signal peptide.

[0006] In various embodiments, the signal peptide is a heavy chain Ig signal peptide. In various embodiments, the signal peptide is a light chain Ig signal peptide. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 85% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 95% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is selected from: SEQ ID Nos: 2-4. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the modified human a- GAL protein is encoded by a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence is selected from: SEQ ID Nos: 6-8, 16-17 or 20-21.

[0007] In various embodiments the invention relates to an engineered human B cell comprising a therapeutic protein, wherein the therapeutic protein comprises a modified human GLA wherein the modified human a-GAL protein has been modified by, a deletion of two carboxy terminal leucine residues of a wild-type human a-GAL protein; and a replacement of a signal peptide of said wild-type human a-GAL protein with an immunoglobulin(Ig) signal peptide.

[0008] In various embodiments, the engineered B cell further comprises a nucleic acid sequence encoding said therapeutic protein, and wherein said nucleic acid sequence has been inserted into either the AAVS1 or the human ROSA26 locus. In various embodiments, the signal peptide is a heavy chain Ig signal peptide. In various embodiments, the signal peptide is a light chain Ig signal peptide. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is at least 85% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the modified human a- GAL protein is encoded by a nucleic acid sequence that is at least 90% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is at least 95% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is selected from: SEQ ID Nos: 2-4. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the modified human a- GAL protein is encoded by a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the modified human a-GAL protein is encoded by a nucleic acid sequence that is selected from: SEQ ID Nos: 6-8, 16-17 or 20-21.

[0009] In various embodiments, the gene has been inserted into the human AAVS1 locus. In various embodiments, the gene has been inserted into the human ROSA26 locus. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein at least 20% of the population of cells express said therapeutic protein. In various embodiments said B cell is CD20+. In various embodiments said B cell is CD20-. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are CD20+. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein more than 80 percent of said cells are CD20-. In various embodiments, said B cell is a plasmablast. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasmablasts. In various embodiments, said cell is a plasma cell. In various embodiments, a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasma cells.

[0010] In various embodiments, the invention relates to a method of producing an engineered B cell expressing a therapeutic protein, the method comprising delivering to a human B cell: an RNA-guided nuclease; a gRNA targeting a locus on the human genome; and a construct comprising a nucleic acid sequence encoding a therapeutic protein, wherein the therapeutic protein comprises a human a-GAL protein.

[0011] In various embodiments, the RNA-guided nuclease and gRNA are delivered to the B cell as an RNP. In various embodiments, the RNA-guided nuclease and gRNA are delivered to the B cell as a nanoparticle. In various embodiments, the RNA-guided nuclease and gRNA are delivered to the B cell via electroporation. In various embodiments, the construct delivered to the B cell using a viral vector. In various embodiments, the construct delivered to the B cell as double stranded DNA. In various embodiments, the RNA-guided nuclease comprises the amino acid sequence of SEQ ID No. 14 or SEQ ID No. 24. In various embodiments, the RNA-guided nuclease comprises the amino acid sequence of SEQ ID NO. 15. In various embodiments, the targeting construct comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 9-13 18-19 and 25-29.

[0012] In various embodiments, said engineered B cell is CD20-. In various embodiments, said engineered B cell is CD20+. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are CD20-. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein more than 80 percent of said cells are CD20+. In various embodiments, said engineered B cell is a plasmablast. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasmablasts. In various embodiments, said engineered B cell is a plasma cells. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasma cells.

[0013] In various embodiments, the invention relates to a method of producing an engineered B cell expressing a therapeutic protein, the method comprising delivering to a human B cell: a RNA-guided nuclease; a gRNA targeting the AAVS1 gene, wherein the gRNA comprises the nucleic acid sequence of SEQ ID NO. 14, 15 or 24; and a construct comprising a nucleic acid sequence encoding a therapeutic protein and a left and right homology arm; wherein the construct comprises a nucleic acid sequence selected from the group consisting of SEQ ID NOs. 9-13 and 18-19, wherein said engineered B cell expresses said therapeutic protein.

[0014] In various embodiments, the invention relates to a method of treating a patient in need thereof comprising administering to said patient an engineered human B cell, wherein the engineered human B cell has been edited to express a therapeutic protein encoding a human a-GAL protein. In various embodiments, the therapeutic protein comprises a modified human a-GAL protein, wherein the two carboxy terminal leucine residues of the human a-GAL protein have been deleted; and the GLA signal peptide has been replaced by an immunoglobulin (Ig) signal peptide. In various embodiments, the signal peptide is a heavy chain Ig signal peptide. In various embodiments, the signal peptide is a light chain Ig signal peptide. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 85% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 95% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20- 21.

[0015] In various embodiments, the gene encoding the therapeutic protein has been inserted into the human AAVS1 locus. In various embodiments, the gene encoding the therapeutic protein has been inserted into the human ROSA26 locus. In various embodiments, at least 20% of the population of cells express said therapeutic protein. In various embodiments, said population of cells comprise cells that are CD20+. In various embodiments, said population of cells comprise cells that are CD20+. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells according to any one of claims 54-64, wherein a majority of said cells are CD20+. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells according to any one of claims 54-64, wherein more than 80 percent of said cells are CD20-. In various embodiments, said engineered B cell is a plasmablast. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasmablasts. In various embodiments, said engineered B cell is a plasma cells. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasma cells.

[0016] In various embodiments, the invention relates to, a method of treating a patient in need thereof comprising administering to said patient an engineered human B cell, wherein said human B cell comprises a therapeutic protein, encoded by a gene, wherein the therapeutic protein comprises a modified human a-GAL protein, wherein the two carboxy terminal leucine residues of the human GLA protein have been deleted; and the GLA signal peptide has been replaced by an immunoglobulin (Ig) signal peptide.

[0017] In various embodiments, the nucleic acid sequence encoding said therapeutic protein has been inserted into either the AAVS1 or the human ROSA26 locus. In various embodiments, the signal peptide is a heavy chain Ig signal peptide. In various embodiments, the signal peptide is a light chain Ig signal peptide. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 85% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 95% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21.

[0018] In various embodiments, the gene has been inserted into the human AAVS1 locus. In various embodiments, the gene has been inserted into the human ROSA26 locus. In various embodiments, at least 20% of the population of engineered B cells, express said therapeutic protein. In various embodiments, said population of cells comprise cells that are CD20+. In various embodiments, said population of cells comprise cells that are CD20-. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells wherein a majority of said cells are CD20+. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein more than 80 percent of said cells are CD20-. In various embodiments, said engineered B cell is a plasmablast. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasmablasts. In various embodiments, said engineered B cell is a plasma cells. In various embodiments, the invention relates to a population of cells comprising a plurality of engineered B cells, wherein a majority of said cells are plasma cells.

[0019] In various embodiments, the invention relates to a method of treating a patient in need thereof comprising administering to said patient a therapeutic protein comprising a modified human a-GAL protein, wherein the two carboxy terminal leucine residues have been deleted; and the GLA signal peptide has been replaced by an immunoglobulin (Ig) signal peptide.

[0020] In various embodiments, the signal peptide is a heavy chain Ig signal peptide. In various embodiments, the signal peptide is a light chain Ig signal peptide. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 85% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 90% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein comprises an amino acid sequence that is at least 95% identical to the amino acid sequence selected from: SEQ ID Nos: 2-4. In various embodiments the therapeutic protein comprises an amino acid sequence that is selected from: SEQ ID Nos: 2-4. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 90% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence that is at least 95% identical to the nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20-21. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence selected from: SEQ ID Nos: 6-8, 16-17 or 20- 21.

BRIEF DESCRIPTION OF THE FIGURES

[0021] FIG. 1 shows a schematic of two insertion sites for targeted integration as per certain embodiments of the present invention. FIG. 1 A shows insertion of the GLA gene at the human AAVS1 locus on chromosome 19. The insert size of this targeting construct is approximately 3700 bp. FIG. IB shows insertion of the GLA gene at the human ROSA26 locus on chromosome 3.

[0022] FIG. 2 shows the a-GAL activity of human B cells gene edited using Cas9-AAV6 mediated integration to express a version of the a-GAL protein (1137 = wild type (WT) GLA (SEQ ID No. 9)); 1138 = GLA with a carboxy -terminal two leucine (LL) truncation (SEQ ID No. 10); 1139 = GLA with LL truncation and an immunoglobulin kappa chain (variable 3-5) signal peptide (SEQ ID No. 13); 1140 = GLA with LL truncation and heavy chain signal peptide(SEQ ID No. 11)). FIG 2A shows a-GAL activity after insertion at the AAVS1 locus. FIG. 2B shows a-GAL activity after insertion at the ROSA26 locus. Under the culture conditions used, peripheral blood B cells become activated and some differentiate towards plasmablasts (PB) and plasma cells (PC). When compared with episomal AAV expression, peripheral blood B cells edited to express human GLA showed significantly enhanced a-GAL activity, indicating integration.

[0023] FIG. 3 shows a-GAL activity in activated B-cells and peripheral blood cells differentiated toward PBs and PCs that have been edited to express various versions of the a- GAL protein (1137 = wild type (WT) GLA (SEQ ID No. 9); 1138 = GLA with a carboxyterminal two leucine (LL) truncation (SEQ ID No. 10); 1140 = GLA with LL truncation and heavy chain signal peptide (SEQ ID No. 11); 1159 = GLA with LL truncation and light chain signal peptide). [0024] FIG. 4 shows a-GAL activity in peripheral blood cells differentiated toward PBs from five different healthy donors (Donors A-E) that have been edited to express two versions of the a-GAL protein (Donor A, 1137 = Edited Wildtype GLA (SEQ ID No. 9); Donors A-E, 1140 = Edited GLA with LL truncation and heavy chain signal peptide (SEQ ID No. 11)).

[0025] FIG. 5 shows a-GAL activity in activated B cells and peripheral blood cells differentiated toward PBs and PCs. Human B cells were activated for 3 days in a media containing CD40L, CpG, IL2, IL 10, IL 15 and IL21. Gene editing (1140 = GLA with LL truncation and heavy chain signal peptide (SEQ ID No. 11)) was performed at day 3 after isolation and cells were expanded in the same media for an additional 6 days. Subsequently, expanded B cells were culture in a media containing IL2, IL6, IL10, IL15, IL21 for 3 days, to obtain a mixture of plasmablasts and B cells. To promote PCs differentiation, cells were cultured for 3 days in a media supplemented with IL6, IL15, IL21 and IFNa2b. For this experiment, the IFNa2b concentration was 15 ng/ml and cellular density was maintained at 0.6 M/mL. Under these conditions, a-GAL activity was comparable between edited peripheral blood cells differentiated toward PBs and PCs when compared with edited activated B cells and un-edited, mock and AAV transduced cells.

[0026] FIG. 6 shows a-GAL activity in edited human peripheral blood cells differentiated toward PBs. When compared with episomal (AAV) expression, B cells edited to express human GLA (labeled in FIG. 6 as “Edited” followed by the construct number) showed significantly enhanced a-GAL activity. Codon optimized constructs 1509 (SEQ ID No. 18) and 1510 (SEQ ID No. 19) showed significantly enhanced a-GAL activity over other human a-GAL expressing constructs (1501= GLA with 4 amino acids truncation at the C-terminal and heavy chain signal peptide; 1509 (SEQ ID No. 18), 1510 (SEQ ID No. 19), 1511 (SEQ ID No. 23) = 3 different codon optimizations of GLA sequence with LL truncation and heavy chain signal peptide).

[0027] FIG. 7A shows the mechanism by which a-GAL enters cells. Phosphorylated a- GAL binds to M6P receptors (M6P-R) and is internalized in the lysosome. FIG. 7B shows restoration of intracellular a-GAL levels in fibroblasts derived from Fabry patients. Fibroblasts cultured with concentrated supernatant from 293 cells secreting either WT (1002, SEQ ID No. 5) a-GAL or truncated a-GAL (1067, SEQ ID No. 7) showed increased a-GAL activity when compared with both WT and Fabry fibroblasts alone.

[0028] FIG. 8 shows expression of a-GAL protein from edited B cells in vivo. NSG mice were humanized via adoptive transfer of 3xl0 ⁶ total CD4+ T cells. Five days post CD4+ T cells transfer, 30xl0 ⁶ activated edited B cells (1140 = GLA with LL truncation and heavy chain signal peptide (SEQ ID No. 11)) were infused into the humanized mice. FIG. 8 A shows a-GAL enzyme activity measured from plasma samples collected 3 days after B cells transfer and every 10 days up to 100 days. FIG. 8B shows a-GAL protein expression using an ELISA from plasma taken from the same NSG mice on days 3, 10 and 20.

[0029] FIG. 9 shows gene editing efficiency (FIG. 9A) and on-target GLA integration (FIG. 9B in peripheral blood human B cells gene edited using a Ribonucleoproteins (RNP) targeting an AAV1 locus delivered into B cells via nucleofection and GLA cDNA via recombinant AAV6 (rAAV6) transduction. Engineered B cells were cultured using the methods described below and genomic DNA was extracted to measure the efficiency of sitespecific mutations (FIG. 9A) and targeted integration frequency, using digital PCR assays (FIG. 9B) (n=3 health donors).

[0030] FIG. 10 shows that optimized single guide RNA mediate efficient on-target gene editing with no off-target events. RNPs targeting an AAV1 locus were delivered into B cells via nucleofection and genomic DNA was extracted to measure efficiency of site-specific mutations using a digital PCR assay. Efficiency was measured using initially designed sgRNA (FIG. 10 A, n=4, SEQ ID No. 14 GGGGCCACTAGGGACAGGAT) and optimized sgRNA (FIG. 10B, n= 3, SEQ ID No. 24, CCTCTAAGGTTTGCTTACGA).

[0031] FIG. 11 shows the effect of codon optimization on a-GAL activity in vitro. Human B cells were edited using various GLA-cDNA sequences (FIG. 11 A (SEQ ID No. 11) and FIG. 1 IB (SEQ ID No. 25)) and cultured for 12 days. At 9 and 12 days, cell culture supernatants were collected, and cell counts and viability were assessed. Functional, secreted a-GAL was quantified using an activity assay and results were normalized to cell counts.

[0032] FIG. 12 shows a guide-SEQ analysis of genomic DNA isolated from Human B cells. Guide-SEQ analysis of genomic DNA isolated from human B cells treated with safe harbor specific RNPs. On-target/off-target sites were identified by incorporation of doublestranded oligodeoxynucleotides (dsODNs).

[0033] FIG. 13 A shows an overview of various ex vivo B cell engineering and culture procedures. FIG. 13B shows the kinetics of unedited B cell numbers monitored every 2 days (n= 4 healthy donors).

[0034] FIG. 14 shows B cell lineages after in vitro conditioning. FIG. 14A shows various cell populations, memory B cells (CD27+IgD-), plasmablasts (PBs) (CD27+CD38+ CD20-), and plasma cells (PCs) (CD27+CD38+ CD20- CD 138+) populations monitored using Flow cytometry. FIG. 14B shows PrimeFlow analysis of GLA transcripts in B cell populations.

[0035] FIG. 15 shows sustained, supraphysiologic a-GAL plasma levels in vivo. Human B cells were engineered and cultured as described. GLA-edited B cells were adoptively transferred into NSG mice pre-conditioned with adoptive transfer of CD4+ T cells prior to adoptive transfer of GLA-edited B cells. Circulating a-GAL levels were monitored every 7- 10 days via an enzymatic activity assay on plasma samples (n= 2 healthy donors).

[0036] FIG. 16 shows adoptively transferred genetically engineered B cells engrafted in mice in vivo. Engineered human B cells were adoptively transferred into CD4+ T cell humanized NSG mice. Representative luciferase image shows early engraftment of the engineered cells primarily in the bone marrow (FIG. 16A). Engrafted B cells were isolated from multiple murine tissues and the cell phenotype was assessed using Flow cytometry and relative proportions plotted (n=4 mice) (FIG. 16B).

[0037] FIG. 17 shows characterization of the effect of editing on patient-derived engineered B cells from Fabry patient’s PBMCs. B cells were isolated from Fabry patient’s PBMCs via CD 19+ positive selection, and activated for 3 days in media containing CD40L, CpG, IL-2, IL- 10, IL- 15 and IL-21. Gene editing was performed on day 3 of culture using Cas9/sgRNA delivered via electroporation and by transduction via AAV6 of active enzyme GLA (1606) followed by an additional 7 days of culture. Engineered B cells were expanded in the same media described above for an additional 7 days. FIG. 17A shows that the Fabry edited B cells were capable of expansion and growth. FIG. 17B shows that the Fabry B cell had successful integration. FIG. 17C shows that GLA-Edited Fabry cells showed increased secretion of a-GAL active enzyme when compared to non-edited controls. [0038] FIG. 18 shows systemic levels of a-GAL increase over time in both total CD4+ and memory CD4+ T cells mouse models. NSG mice were humanized via adoptive transfer of either total human CD4+ cells or memory human CD4+ cells together with edited B cells (1140, SEQ ID No. 11) and a-GAL activity was assessed. Peripheral blood B cells edited to express human GLA showed significantly enhanced a-GAL activity in both mouse models (Memory CD4+ and Total CD4+) when compared to mice injected with saline.

[0039] FIG. 19 shows memory CD4+ T cells mouse model does not show any symptoms of GvHD. NSG mice were humanized as described in FIG 18 were assessed for bodyweight and GVHD symptoms e.g., hair loss, redness ears/extremities, hunched posture). Compared with saline treated mice (FIG. 19A), mice infused with Memory CD4+ T cells together with edited B cells (1140, SEQ ID No. 11) (FIG. 19B) showed no difference in body weight or GVHD symptoms. In contrast, mice infused with Total CD4+ T cells together with edited B cells (1140, SEQ ID No. 11) showed reduction in body weight and/or exhibited GVHD symptoms (FIG. 19C).

[0040] FIG. 20 shows a-GAL activity in edited human PBs using various codon optimized constructs in activated B cells and peripheral blood cells differentiated toward PBs in Donor 1 (FIG. 20A) and Donor 2 (FIG. 20B). When compared with episomal (AAV) expression, B cells edited to express human GLA (“Edited”) showed significantly enhanced a-GAL activity. Construct 1482 is the original cDNA sequence (1140, SEQ ID No. 11). Of the five codon optimized constructs (1588, 1598, 1599, 1600 and 1606), construct 1606 and 1599 showed enhanced a-GAL activity in PB cells when compared to activated B cells and compared to construct 1482.

DETAILED DESCRIPTION

[0041] Disclosed herein are novel methods for the treatment of Fabry disease. Various embodiments disclosed herein provide for autologous human B-cells that have been gene- edited to express a functional a-GAL protein and will provide long-term stable expression of the enzyme in vivo. The advantages of such a cellular therapy include: (i) decreased frequency of infusion (e.g., every 12 months instead of every two weeks); (ii) decreased rate and severity of acute infusion reactions; (iii) improved steady state expression of enzyme which may reduce the risk of immunogenicity and enable better clinical outcome; (iv) potential improved patient compliance and therefore better clinical outcome. I. Definitions

[0042] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including but not limited to patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose. As utilized in accordance with the present disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings:

[0043] In this application, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including”, as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit unless specifically stated otherwise.

[0044] The term “polynucleotide”, “nucleotide”, or “nucleic acid” includes both singlestranded and double-stranded nucleotide polymers. The nucleotides comprising the polynucleotide can be ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. Said modifications include base modifications such as bromouridine and inosine derivatives, ribose modifications such as 2’, 3 ’-dideoxyribose, and internucleotide linkage modifications such as phosphorothioate, phosphorodithioate, phosphoroselenoate, phosphoro-diselenoate, phosphoro-anilothioate, phoshoraniladate and phosphoroamidate.

[0045] The term “oligonucleotide” refers to a polynucleotide comprising 200 or fewer nucleotides. Oligonucleotides can be single stranded or double stranded, e.g., for use in the construction of a mutant gene. Oligonucleotides can be sense or antisense oligonucleotides. An oligonucleotide can include a label, including a radiolabel, a fluorescent label, a hapten or an antigenic label, for detection assays. Oligonucleotides can be used, for example, as PCR primers, cloning primers or hybridization probes.

[0046] The term “control sequence” refers to a polynucleotide sequence that can affect the expression and processing of coding sequences to which it is ligated. The nature of such control sequences can depend upon the host organism. In particular embodiments, control sequences for prokaryotes can include a promoter, a ribosomal binding site, and a transcription termination sequence. For example, control sequences for eukaryotes can include promoters comprising one or a plurality of recognition sites for transcription factors, transcription enhancer sequences, and transcription termination sequence. Control sequences can include leader sequences (signal peptides) and/or fusion partner sequences.

[0047] As used herein, “operably linked” means that the components to which the term is applied are in a relationship that allows them to carry out their inherent functions under suitable conditions.

[0048] The term “vector” means any molecule or entity (e.g., nucleic acid, plasmid, bacteriophage or virus) used to transfer protein coding information into a host cell. The term “expression vector” or “expression construct” refers to a vector that is suitable for transformation of a host cell and contains nucleic acid sequences that direct and/or control (in conjunction with the host cell) expression of one or more heterologous coding regions operatively linked thereto. An expression construct can include, but is not limited to, sequences that affect or control transcription, translation, and, if introns are present, affect RNA splicing of a coding region operably linked thereto.

[0049] The term “host cell” refers to a cell that has been transformed, or is capable of being transformed, with a nucleic acid sequence and thereby expresses a gene of interest. The term includes the progeny of the parent cell, whether or not the progeny is identical in morphology or in genetic make-up to the original parent cell, so long as the gene of interest is present.

[0050] The term “transformation” refers to a change in a cell’s genetic characteristics, and a cell has been transformed when it has been modified to contain new DNA or RNA. For example, a cell is transformed where it is genetically modified from its native state by introducing new genetic material via transfection, transduction, or other genetic engineering techniques. Following transfection or transduction, the transforming DNA can recombine with that of the cell by physically integrating into a chromosome of the cell, or can be maintained transiently as an episomal element without being replicated, or can replicate independently as a plasmid. A cell is considered to have been “stably transformed” when the transforming DNA is replicated with the division of the cell.

[0051] The term “transfection” refers to the uptake of foreign or exogenous DNA by a cell. A number of transfection techniques are well known in the art and are disclosed herein. See, e.g., Graham et al., 1973, Virology, 1973, 52:456; Sambrook et al., Molecular Cloning: A Laboratory Manual, 2001, supra; Davis et al., Basic Methods in Molecular Biology, 1986, Elsevier; Chu c/ a/., 1981, Gene, 13: 197.

[0052] The term “transduction” refers to the process whereby foreign DNA is introduced into a cell via viral vector. See, e.g., Jones et al., Genetics: Principles and Analysis, 1998, Boston: Jones & Bartlett Publ.

[0053] The terms “polypeptide” or “protein” refer to a macromolecule having the amino acid sequence of a protein, including deletions from, additions to, and/or substitutions of one or more amino acids of the native sequence. The terms “polypeptide” and “protein” specifically encompass antigen-binding molecules, antibodies, or sequences that have deletions from, additions to, and/or substitutions of one or more amino acid of antigenbinding protein. The term “polypeptide fragment” refers to a polypeptide that has an aminoterminal deletion, a carboxyl-terminal deletion, and/or an internal deletion as compared with the full-length native protein. Such fragments can also contain modified amino acids as compared with the native protein. Useful polypeptide fragments include immunologically functional fragments of antigen-binding molecules.

[0054] A “variant” of a polypeptide (e.g., an antigen-binding molecule) comprises an amino acid sequence wherein one or more amino acid residues are inserted into, deleted from and/or substituted into the amino acid sequence relative to another polypeptide sequence. Variants include fusion proteins.

[0055] The term “identity” refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. “Percent identity” means the percent of identical residues between the amino acids or nucleotides in the compared molecules and is calculated based on the size of the smallest of the molecules being compared. For these calculations, gaps in alignments (if any) are preferably addressed by a particular mathematical model or computer program (i.e., an “algorithm”).

[0056] To calculate percent identity, the sequences being compared are typically aligned in a way that gives the largest match between the sequences. One example of a computer program that can be used to determine percent identity is the GCG program package, which includes GAP (Devereux et al., Nucl. Acid Res., 1984, 12, 387; Genetics Computer Group, University of Wisconsin, Madison, Wis.). The computer algorithm GAP is used to align the two polypeptides or polynucleotides for which the percent sequence identity is to be determined. The sequences are aligned for optimal matching of their respective amino acid or nucleotide (the “matched span”, as determined by the algorithm). In certain embodiments, a standard comparison matrix (see, e.g., Dayhoff et al., 1978, Atlas of Protein Sequence and Structure, 5:345-352 for the PAM 250 comparison matrix; Henikoff et al., 1992, Proc. Natl. Acad. Sci. U.S.A., 89, 10915-10919 for the BLO-SUM 62 comparison matrix) is also used by the algorithm.

[0057] As used herein, the twenty conventional (e.g., naturally occurring) amino acids and their abbreviations follow conventional usage. See, e.g., Immunology A Synthesis (2nd Edition, Golub and Green, Eds., Sinauer Assoc., Sunderland, Mass. (1991)), which is incorporated herein by reference for any purpose. Stereoisomers (e.g., D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as alpha-, alpha-di substituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids can also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4-hydroxyproline, gamma-carboxy-glutamate, epsilon- N,N,N-trimethyllysine, e-N-acetyllysine, O-phosphoserine, N-acetylserine, N- formylmethionine, 3-methylhistidine, 5-hydroxylysine, sigma. -N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide notation used herein, the left-hand direction is the amino terminal direction and the right-hand direction is the carboxy-terminal direction, in accordance with standard usage and convention.

[0058] Conservative amino acid substitutions can encompass non-naturally occurring amino acid residues, which are typically incorporated by chemical peptide synthesis rather than by synthesis in biological systems. These include peptidomimetics and other reversed or inverted forms of amino acid moieties. Naturally occurring residues can be divided into classes based on common side chain properties: a) hydrophobic: norleucine, Met, Ala, Vai, Leu, He; b) neutral hydrophilic: Cys, Ser, Thr, Asn, Gin; c) acidic: Asp, Glu; d) basic: His, Lys, Arg; e) residues that influence chain orientation: Gly, Pro; and f) aromatic: Trp, Tyr, Phe.

[0059] For example, non-conservative substitutions can involve the exchange of a member of one of these classes for a member from another class.

[0060] In making changes to the antigen-binding molecule, the costimulatory or activating domains of the engineered B cell, according to certain embodiments, the hydropathic index of amino acids can be considered. Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics. They are as follows: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (-0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (- 3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5). See, e.g., Kyte et al., 1982, J. Mol. Biol., 157, 105-131. It is known that certain amino acids can be substituted for other amino acids having a similar hydropathic index or score and still retain a similar biological activity. It is also understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity, particularly where the biologically functional protein or peptide thereby created is intended for use in immunological embodiments, as in the present case. Exemplary amino acid substitutions are set forth in Table 1.

Table 1

[0061] The term “derivative” refers to a molecule that includes a chemical modification other than an insertion, deletion, or substitution of amino acids (or nucleic acids). In certain embodiments, derivatives comprise covalent modifications, including, but not limited to, chemical bonding with polymers, lipids, or other organic or inorganic moieties. In certain embodiments, a chemically modified antigen-binding molecule can have a greater circulating half-life than an antigen-binding molecule that is not chemically modified. In some embodiments, a derivative antigen-binding molecule is covalently modified to include one or more water-soluble polymer attachments, including, but not limited to, polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.

[0062] Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compound are termed “peptide mimetics” or “peptidomimetics.” Fauchere, J. L., 1986, Adv. Drug Res., 1986, 15, 29; Veber, D. F. & Freidinger, R. M., 1985, Trends in Neuroscience, 8, 392-396; and Evans, B. E., et al., 1987, J. Med. Chem., 30, 1229-1239, which are incorporated herein by reference for any purpose.

[0063] The term “therapeutically effective amount” refers to a quantity or amount of an agent (e.g., therapeutic cell compositions, immune cells or other therapeutic agent) sufficient to achieve a desired therapeutic effect or response in a subject. Such therapeutically effective amounts are readily ascertained by one of ordinary skill in the art.

[0064] The terms “patient” and “subject” are used interchangeably and include human and non-human animal subjects as well as those with formally diagnosed disorders, those without formally recognized disorders, those receiving medical attention, those at risk of developing the disorders, etc. [0065] The term “treat” and “treatment” includes therapeutic treatments, prophylactic treatments, and applications in which one reduces the risk that a subject will develop a disorder or other risk factor. Treatment does not require the complete curing of a disorder and encompasses embodiments in which one reduces symptoms or underlying risk factors. The term “prevent” does not require the 100% elimination of the possibility of an event. Rather, it denotes that the likelihood of the occurrence of the event has been reduced in the presence of the compound or method.

[0066] Standard techniques can be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques can be performed according to manufacturer’s specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures can be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)), which is incorporated herein by reference for any purpose.

[0067] As used herein, the term “substantially” or “essentially” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that is about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% higher compared to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In one embodiment, the terms “essentially the same” or “substantially the same” refer to a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that is about the same as a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length.

[0068] As used herein, the terms “substantially free of’ and “essentially free of’ are used interchangeably, and when used to describe a composition, such as a cell population or culture media, refer to a composition that is free of a specified substance, such as, 95% free, 96% free, 97% free, 98% free, 99% free of the specified substance, or is undetectable as measured by conventional means. Similar meaning can be applied to the term “absence of,” where referring to the absence of a particular substance or component of a composition. [0069] As used herein, the term “appreciable” refers to a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length or an event that is readily detectable by one or more standard methods. The terms “not-appreciable” and “not appreciable” and equivalents refer to a range of quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length or an event that is not readily detectable or undetectable by standard methods. In one embodiment, an event is not appreciable if it occurs less than 5%, 4%, 3%, 2%, 1%, 0.1%, 0.001%, or less of the time.

[0070] Throughout this specification, unless the context requires otherwise, the words “comprise,” “comprises” and “comprising” will be understood to imply the inclusion of stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements. In particular embodiments, the terms “include,” “has,” “contains,” and “comprise” are used synonymously.

[0071] As used herein, “consisting of’ is meant including, and limited to, whatever follows the phrase “consisting of’. Thus, the phrase “consisting of’ indicates that the listed elements are required or mandatory, and that no other elements may be present.

[0072] By “consisting essentially of’ is meant including any elements listed after the phrase, and limited to other elements that do not interfere with or contribute to the activity or action specified in the disclosure for the listed elements. Thus, the phrase “consisting essentially of’ indicates that the listed elements are required or mandatory, but that no other elements are optional and may or may not be present depending upon whether or not they affect the activity or action of the listed elements.

[0073] Reference throughout this specification to “one embodiment,” “an embodiment,” “a particular embodiment,” “a related embodiment,” “a certain embodiment,” “an additional embodiment,” or “a further embodiment” or combinations thereof means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, the appearances of the foregoing phrases in various places throughout this specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments. [0074] As used herein, the term “about” or “approximately” refers to a quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length that varies by as much as 30, 25, 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1% to a reference quantity, level, value, number, frequency, percentage, dimension, size, amount, weight or length. In particular embodiments, the terms “about” or “approximately” when preceding a numerical value indicates the value plus or minus a range of 15%, 10%, 5% or 1%, or any intervening ranges thereof.

[0075] As used herein, the term “introducing” refers to a process that comprises contacting a cell with a polynucleotide, polypeptide, or small molecule. An introducing step may also comprise microinjection of polynucleotides or polypeptides into the cell, use of liposomes to deliver polynucleotides or polypeptides into the cell, or fusion of polynucleotides or polypeptides to cell permeable moi eties to introduce them into a cell.

IL Therapeutic Proteins for Treatment of Fabry Disease

[0076] In various embodiments, the engineered B cell comprises a therapeutic protein to be delivered to a patient in need thereof. As used herein, the term “therapeutic protein” means any protein that may contribute to the treatment, reduction of symptoms, prevention or cure of a disease or disorder in a patient. In certain embodiments, the therapeutic protein may be suitable for treatment of a rare disease or an orphan disease, where said therapy can be achieved by the replacement of a particular protein and/or enzyme. A therapeutic protein may include but is not limited to an enzyme, a ligand, a naturally occurring, engineered and/or chimeric receptor, a cytokine or a chemokine.

[0077] In various embodiments said therapeutic protein is a protein for the treatment of Fabry disease. In various embodiments, the therapeutic protein is a-galactosidase (a-GAL). In various embodiments, the therapeutic protein is human a-GAL. In various embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO. 1. In various embodiments, the therapeutic protein is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 1. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising SEQ ID NO. 5. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 5. [0078] In various embodiments the therapeutic protein comprises the human a-GAL protein, wherein the two leucine residues at the carboxy terminus have been deleted. In various embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO. 2. In various embodiments, the therapeutic protein is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 2. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising SEQ ID NO. 6. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 6.

[0079] In various embodiments, the therapeutic protein is a human a-GAL protein, wherein the two leucine residues at the carboxy terminus have been deleted, and the natural human GLA signal peptide has been replaced with an immunoglobulin (Ig) signal peptide. Modification to include an Ig signal peptide directs the a-GAL enzyme towards the secretory pathway, thereby promoting secretion of the expressed therapeutic protein.

[0080] In various embodiments the heavy chain Ig signal peptide is used. In various embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO. 3. In various embodiments, the therapeutic protein is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 3. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising SEQ ID NO. 7. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 7.

[0081] In various embodiments the kappa light chain Ig signal peptide is used. In various embodiments, the therapeutic protein comprises the amino acid sequence of SEQ ID NO. 4. In various embodiments, the therapeutic protein is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 4. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising SEQ ID NO. 8. In various embodiments, the therapeutic protein is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 8.

III. Cell Therapy for the Treatment of Fabry Disease [0082] In various embodiments, the therapeutic protein is expressed by engineering a population of B cells to express said therapeutic protein. As used herein, the term “B cell” refers to an immune cell (e.g., a white blood cell or leukocyte) that expresses a B cell receptor (BCR) or produces antibodies. As used herein, the term “B cell” includes any B cell lineage cell type that is derived from a B cell including memory B cells, plasma cells (PCs) and plasmablasts (PBs). A plasmablast is an intermediate, transitional stage cell type that arises during differentiation of activated B cells. It is the immediate precursor to a plasma cell. Both plasmablasts and plasma cells are antibody secreting cells, but mature plasma cells produce and secrete antibodies at a higher level. Plasma cells are the terminal, fully differentiated form resulting from B cell differentiation. The primary function of plasma cells is the robust synthesis and secretion of antibodies. Plasma cells have a highly developed secretory system to support a high level of protein synthesis and secretion. Although some plasma cells are short-lived, others can persist much longer. Antigen-induced B cell activation and differentiation can also result in memory B cells, which can persist for years. Upon a secondary encounter with the same antigen, memory B cells can also proliferate and differentiate into plasma cells. By delivering therapeutic proteins through engineered B cells, the embodiments disclosed herein provide long-term stable expression of the enzyme in vivo. The embodiments disclosed herein, leverage the B cell’s intrinsic protein secretion machinery and its long lifetime in vivo to express therapeutic proteins for treatment of multiple diseases including Fabry disease.

[0083] In various embodiments, the disclosure relates to a population of cells comprising engineered human B cells, wherein human B cells express a therapeutic protein, whose gene has been inserted into either the human AAVS1 or the human ROSA26 locus, wherein the therapeutic protein comprises the human GLA protein.

[0084] In various embodiments said population of cells are for treatment of a patient suffering from Fabry disease. In various embodiments, the population of cells express a therapeutic protein that is a-galactosidase (a-GAL). In various embodiments, the population of cells express a therapeutic protein that is wild type human a-GAL. In various embodiments, the population of cells express a therapeutic protein that comprises the amino acid sequence of SEQ ID NO. 1. In various embodiments, the population of cells express a therapeutic protein that is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 1. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising SEQ ID NO. 5. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 5.

[0085] In various embodiments, the population of cells express a therapeutic protein comprising the human a-GAL protein, wherein the two leucine residues at the carboxy terminus have been deleted. In various embodiments, the population of cells express a therapeutic protein that comprises the amino acid sequence of SEQ ID NO. 2. In various embodiments, the population of cells express a therapeutic protein that is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 2. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising SEQ ID NO. 6. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 6.

[0086] In various embodiments, the population of cells express a therapeutic protein comprising the human a-GAL protein, wherein the two leucine residues at the carboxy terminus have been deleted, and the natural human a-GAL signal peptide has been replaced with an immunoglobulin (Ig) signal peptide. Modification to include an Ig signal peptide directs the a-GAL enzyme towards the secretory pathway, thereby promoting secretion of the expressed therapeutic protein.

[0087] In various embodiments the heavy chain Ig signal peptide is used. In various embodiments, the population of cells express a therapeutic protein that comprises the amino acid sequence of SEQ ID NO. 3. In various embodiments, the population of cells express a therapeutic protein that is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 3. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising SEQ ID NO. 7. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 7. [0088] In various embodiments the kappa light chain Ig signal peptide is used. In various embodiments, the population of cells express a therapeutic protein that comprises the amino acid sequence of SEQ ID NO. 4. In various embodiments, the population of cells express a therapeutic protein that is at least 75%, 80%, 85%, 90% or 95% identical to the amino acid sequence of SEQ ID NO. 4. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising SEQ ID NO. 8. In various embodiments, the population of cells express a therapeutic protein that is encoded by a nucleic acid sequence comprising a sequence that is at least 75%, 80%, 85%, 90% or 95% identical to the nucleic acid sequence of SEQ ID NO. 8.

[0089] In various embodiments, depending upon the editing protocols used, a certain percentage of the population of cells will express said therapeutic protein. In various embodiments at least 20% of the population of cells express said therapeutic protein. In various embodiments at least 10%, 15%, 20%, 25%, 30%, 35% or 40% of the population of cells express said therapeutic protein.

IV. Methods of Engineering B Cells

[0090] Gene editing (including genomic editing) is a type of genetic engineering in which nucleotide(s)/nucleic acid(s) is/are inserted, deleted, and/or substituted in a DNA sequence, such as in the genome of a targeted cell. Targeted gene editing enables insertion, deletion and/or substitution at pre-selected sites in the genome of a targeted cell (e.g., in a targeted gene or targeted DNA sequence). When a sequence of an endogenous gene is edited, for example by deletion, insertion or substitution of nucleotide(s)/nucleic acid(s), the endogenous gene comprising the affected sequence may be knocked-out or knocked-down due to the sequence alteration. Therefore, targeted editing may be used to disrupt endogenous gene expression. “Targeted integration” refers to a process involving insertion of one or more exogenous sequences, with or without deletion of an endogenous sequence at the insertion site. Targeted integration can result from targeted gene editing when a donor template containing an exogenous sequence is present. As used herein, a “disrupted gene” refers to a gene comprising an insertion, deletion, or substitution relative to an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. As used herein, “disrupting a gene” refers to a method of inserting, deleting or substituting at least one nucleotide/nucleic acid in an endogenous gene such that expression of a functional protein from the endogenous gene is reduced or inhibited. Methods of disrupting a gene are known to those of skill in the art and described herein.

[0091] Targeted editing can be achieved either through a nuclease-independent approach, or through a nuclease - dependent approach. In the nuclease-independent targeted editing approach, homologous recombination is guided by homologous sequences flanking an exogenous polynucleotide to be introduced into an endogenous sequence through the enzymatic machinery of the host cell. The exogenous polynucleotide may introduce deletions, insertions or replacement of nucleotides in the endogenous sequence.

[0092] Alternatively, the nuclease - dependent approach can achieve targeted editing with higher frequency through the specific introduction of double strand breaks (DSBs) by specific rare - cutting nucleases (e.g., endonucleases). Such nuclease - dependent targeted editing also utilizes DNA repair mechanisms, for example, non - homologous end joining (NHEJ), which occurs in response to DSBs. DNA repair by NHEJ often leads to random insertions or deletions (indels) of a small number of endogenous nucleotides. In contrast to NHEJ mediated repair, repair can also occur by a homology directed repair (HDR). When a donor template containing exogenous genetic material flanked by a pair of homology arms is present, the exogenous genetic material can be introduced into the genome by HDR, which results in targeted integration of the exogenous genetic material.

[0093] Available endonucleases capable of introducing specific and targeted DSBs include, but are not limited to, zinc-finger nucleases (ZFN), meganucleases, transcription activator-like effector nucleases (TALEN), and RNA-guided CRISPR Cas9 nuclease (CRISPR/Cas9; Clustered Regular Interspaced Short Palindromic Repeats Associated 9). Additionally, DICE (dual integrase cassette exchange) system utilizing phiC31 and Bxbl integrases may also be used for targeted integration.

[0094] ZFNs are targeted nucleases comprising a nuclease fused to a zinc finger DNA binding domain (ZFBD), which is a polypeptide domain that binds DNA in a sequence specific manner. A zinc finger is a domain of about 30 amino acids within the zinc fingerbinding domain whose structure is stabilized through coordination of a zinc ion. Examples of zinc fingers include, but not limited to, C2H2 zinc fingers, C3H zinc fingers, and C4 zinc fingers. A designed zinc finger domain is a domain not occurring in nature whose design/composition results principally from rational criteria, e.g., application of substitution rules and computerized algorithms for processing information in a database storing information of existing ZFP designs and binding data. See, for example, U.S. Pat. Nos. 6,140,081; 6,453,242; and 6,534,261; see also WO98/53058; WO 98/53059; WO 98/53060; WO 02/016536 and WO 03/016496. A selected zinc finger domain is a domain not found in nature whose production results primarily from an empirical process such as phage display, interaction trap or hybrid selection. ZFNs are described in greater detail in U.S. Pat. Nos. 7,888,121 and 7,972,854. The most recognized example of a ZFN is a fusion of the Fokl nuclease with a zinc finger DNA binding domain.

[0095] A TALEN is a targeted nuclease comprising a nuclease fused to a TAL effector DNA binding domain. A “transcription activator-like effector DNA binding domain”, “TAL effector DNA binding domain", or “TALE DNA binding domain” is a polypeptide domain of TAL effector proteins that is responsible for binding of the TAL effector protein to DNA. TAL effector proteins are secreted by plant pathogens of the genus Xanthomonas during infection. These proteins enter the nucleus of the plant cell, bind effector-specific DNA sequences via their DNA binding domain, and activate gene transcription at these sequences via their transactivation domains. TAL effector DNA binding domain specificity depends on an effector - variable number of imperfect 34 amino acid repeats, which comprise polymorphisms at select repeat positions called repeat variable diresidues (RVD). TALENs are described in greater detail in US Patent Application No. 2011/0145940. The most recognized example of a TALEN in the art is a fusion polypeptide of the Fokl nuclease to a TAL effector DNA binding domain.

[0096] Additional examples of targeted nucleases suitable for use as provided herein include, but are not limited to, Bxbl, phiC31, R4, PhiBTl, and WB/SPBc/TP901-l, whether used individually or in combination.

[0097] Other non - limiting examples of targeted nucleases include naturally - occurring and recombinant nucleases, e.g., CRISPR/Cas9, restriction endonucleases, meganucleases homing endonucleases, and the like.

1. CRISPR-Cas9 Gene Editing

[0098] The CRISPR-Cas9 system is a naturally-occurring defense mechanism in prokaryotes that has been repurposed as an RNA-guided DNA - targeting platform used for gene editing. It relies on the DNA nuclease Cas9, and two noncoding RNAs, crisprRNA (CrRNA) and trans-activating RNA (tracrRNA), to target the cleavage of DNA. CRISPR is an abbreviation for Clustered Regularly Interspaced Short Palindromic Repeats, a family of DNA sequences found in the genomes of bacteria and archaea that contain fragments of DNA (spacer DNA) with similarity to foreign DNA previously exposed to the cell, for example, by viruses that have infected or attacked the prokaryote. These fragments of DNA are used by the prokaryote to detect and destroy similar foreign DNA upon reintroduction, for example, from similar viruses during subsequent attacks. Transcription of the CRISPR locus results in the formation of an RNA molecule comprising the spacer sequence, which associates with and targets Cas (CRISPR-associated) proteins able to recognize and cut the foreign, exogenous DNA. Numerous types and classes of CRISPR/Cas systems have been described (see, e.g., Koonin et al., (2017) Curr Opin Microbiol 37:67-78).

[0099] crRNA drives sequence recognition and specificity of the CRISPR - Cas9 complex through Watson - Crick base pairing typically with a 20 nucleotide (nt) sequence in the target DNA. Changing the sequence of the 5 ' 20nt in the crRNA allows targeting of the CRISPR - Cas9 complex to specific loci. The CRISPR - Cas9 complex only binds DNA sequences that contain a sequence match to the first 20 nt of the crRNA, single - guide RNA (sgRNA), if the target sequence is followed by a specific short DNA motif (with the sequence NGG) referred to as a protospacer adjacent motif (PAM).

[0100] TracrRNA hybridizes with the 3' end of crRNA to form an RNA-duplex structure that is bound by the Cas9 endonuclease to form the catalytically active CRISPR-Cas9 complex, which can then cleave the target DNA.

[0101] Once the CRISPR - Cas9 complex is bound to DNA at a target site, two independent nuclease domains within the Cas9 enzyme each cleave one of the DNA strands upstream of the PAM site, leaving a double-strand break (DSB) where both strands of the DNA terminate in a base pair (a blunt end).

[0102] After binding of CRISPR - Cas9 complex to DNA at a specific target site and formation of the site - specific DSB, the next key step is repair of the DSB. Cells use two main DNA repair pathways to repair the DSB: non - homologous end - joining (NHEJ) and homology - directed repair (HDR). [0103] NHEJ is a robust repair mechanism that appears highly active in the majority of cell types, including nondividing cells. NHEJ is error-prone and can often result in the removal or addition of between one and several hundred nucleotides at the site of the DSB, though such modifications are typically < 20 nt. The resulting insertions and deletions (indels) can disrupt coding or noncoding regions of genes. Alternatively, HDR uses a long stretch of homologous donor DNA, provided endogenously or exogenously, to repair the DSB with high fidelity. HDR is active only in dividing cells, and occurs at a relatively low frequency in most cell types. In many embodiments of the present disclosure, NHEJ is utilized as the repair operant.

[0104] In some embodiments, the Cas9 (CRISPR associated protein 9) endonuclease is from Streptococcus pyogenes, although other Cas9 homologs may be used. It should be understood, that wild - type Cas9 may be used or modified versions of Cas9 may be used (e.g., evolved versions of Cas9, or Cas9 orthologues or variants), as provided herein. In some embodiments, Cas9 may be substituted with another RNA- guided endonuclease, such as Cpfl (of a class II CRISPR/Cas system).

[0105] In some embodiments, the CRISPR/Cas system comprise components derived from a Type-1, Type-II, or Type-III system. Updated classification schemes for CRISPR/Cas loci define Class 1 and Class 2 CRISPR/Cas systems, having Types Ito V or VI (Makarova et al., (2015) Nat Rev Microbiol, 13(11):722-36; Shmakov etal., (2015)) Mol Cell, 60:385- 397). Class 2 CRISPR / Cas systems have single protein effectors. Cas proteins of Types II, V, and VI are single - protein, RNA - guided endonucleases, herein called “Class 2 Cas nucleases.” Class 2 Cas nucleases include, for example, Cas9, Cpfl, C2cl, C2c2, and C2c3 proteins. The Cpfl nuclease (Zetsche et al., (2015) Cell 163: 1-13) is homologous to Cas9, and contains a RuvC - like nuclease domain.

[0106] In some embodiments, the Cas nuclease is from a Type - II CRISPR/Cas system (e.g., a Cas9 protein from a CRISPR / Cas9 system). In some embodiments, the Cas nuclease is from a Class 2 CRISPR Cas system (a single protein Cas nuclease such as a Cas9 protein or a Cpfl protein). The Cas9 and Cpfl family of proteins are enzymes with DNA endonuclease activity, and they can be directed to cleave a desired nucleic acid target by designing an appropriate guide RNA, as described further herein. [0107] In some embodiments, a Cas nuclease may comprise more than one nuclease domain. For example, a Cas9 nuclease may comprise at least one RuvC-like nuclease domain (e.g., Cpfl) and at least one HNH-like nuclease domain (e.g., Cas9). In some embodiments, the Cas9 nuclease introduces a DSB in the target sequence. In some embodiments, the Cas9 nuclease is modified to contain only one functional nuclease domain. For example, the Cas9 nuclease is modified such that one of the nuclease domains is mutated or fully or partially deleted to reduce its nucleic acid cleavage activity. In some embodiments, the Cas9 nuclease is modified to contain no functional RuvC-like nuclease domain. In other embodiments, the Cas9 nuclease is modified to contain no functional HNH- like nuclease domain. In some embodiments in which only one of the nuclease domains is functional, the Cas9 nuclease is a nickase that is capable of introducing a single-stranded break (a “nick”) into the target sequence. In some embodiments, a conserved amino acid within a Cas9 nuclease domain is substituted to reduce or alter a nuclease activity. In some embodiments, the Cas nuclease nickase comprises an amino acid substitution in the RuvC- like nuclease domain. Exemplary amino acid substitutions in the RuvC-like nuclease domain include D10A (based on the S. pyogenes Cas9 nuclease). In some embodiments, the nickase comprises an amino acid substitution in the HNH-like nuclease domain. Exemplary amino acid substitutions in the HNH-like nuclease domain include E762A, H840A, N863 A, H983 A, and D986A (based on the S. pyogenes Cas9 nuclease).

[0108] In some embodiments, the Cas nuclease is from a Type-I CRISPR/Cas system. In some embodiments, the Cas nuclease is a component of the Cascade complex of a Type-I CRISPR/Cas system. For example, the Cas nuclease is a Cas3 nuclease. In some embodiments, the Cas nuclease is derived from a Type-III CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from Type-IV CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type-V CRISPR/Cas system. In some embodiments, the Cas nuclease is derived from a Type- VI CRISPR/Cas system.

2. Guide RNAs

[0109] The present disclosure provides a genome-targeting nucleic acid that can direct the activities of an associated polypeptide (e.g., a site-directed polypeptide) to a specific target sequence within a target nucleic acid. The genome-targeting nucleic acid can be an RNA. A genome-targeting RNA is referred to as a “guide RNA” or “gRNA” herein. A guide RNA comprises at least a spacer sequence that hybridizes to a target nucleic acid sequence of interest, and a CRISPR repeat sequence. In Type II systems, the gRNA also comprises a second RNA called the tracrRNA sequence. In the Type II gRNA, the CRISPR repeat sequence and tracrRNA sequence hybridize to each other to form a duplex. In the Type V gRNA, the crRNA forms a duplex. In both systems, the duplex binds a site-directed polypeptide, such that the guide RNA and site-direct polypeptide form a complex. In some embodiments, the genome-targeting nucleic acid provides target specificity to the complex by virtue of its association with the site-directed polypeptide. The genome-targeting nucleic acid thus directs the activity of the site-directed polypeptide.

[0110] As is understood by the person of ordinary skill in the art, each guide RNA is designed to include a spacer sequence complementary to its genomic target sequence. See Jinek et a/., Science, 337, 816-821 (2012) and Deltcheva et al., Nature, 471, 602-607 (2011).

[OHl] In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) is a double-molecule guide RNA. In some embodiments, the genome-targeting nucleic acid (e.g., gRNA) is a single-molecule guide RNA.

[0112] A double-molecule guide RNA comprises two strands of RNA. The first strand comprises in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence and a minimum CRISPR repeat sequence. The second strand comprises a minimum tracrRNA sequence (complementary to the minimum CRISPR repeat sequence), a 3' tracrRNA sequence and an optional tracrRNA extension sequence.

[0113] A single-molecule guide RNA (referred to as a “sgRNA”) in a Type II system comprises, in the 5' to 3' direction, an optional spacer extension sequence, a spacer sequence, a minimum CRISPR repeat sequence, a single-molecule guide linker, a minimum tracrRNA sequence, a 3' tracrRNA sequence and an optional tracrRNA extension sequence. The optional tracrRNA extension may comprise elements that contribute additional functionality (e.g., stability) to the guide RNA. The single-molecule guide linker links the minimum CRISPR repeat and the minimum tracrRNA sequence to form a hairpin structure. The optional tracrRNA extension comprises one or more hairpins.

[0114] A single-molecule guide RNA in a Type V system comprises, in the 5' to 3' direction, a minimum CRISPR repeat sequence and a spacer sequence. [0115] In some embodiments, the sgRNA comprises a 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a less than 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence. In some embodiments, the sgRNA comprises a more than 20 nucleotide spacer sequence at the 5' end of the sgRNA sequence.

[0116] In some embodiments, the sgRNA comprises comprise no uracil at the 3' end of the sgRNA sequence. In some embodiments, the sgRNA comprises comprise one or more uracil at the 3' end of the sgRNA sequence. For example, the sgRNA can comprise 1 uracil (U) at the 3' end of the sgRNA sequence. The sgRNA can comprise 2 uracil (UU) at the 3' end of the sgRNA sequence. The sgRNA can comprise 3 uracil (UUU) at the 3' end of the sgRNA sequence. The sgRNA can comprise 4 uracil (UUUU) at the 3' end of the sgRNA sequence. The sgRNA can comprise 5 uracil (UUUUU) at the 3' end of the sgRNA sequence. The sgRNA can comprise 6 uracil (UUUUUU) at the 3' end of the sgRNA sequence. The sgRNA can comprise 7 uracil (UUUUUUU) at the 3' end of the sgRNA sequence. The sgRNA can comprise 8 uracil (UUUUUUUU) at the 3' end of the sgRNA sequence.

[0117] The sgRNA can be unmodified or modified. For example, modified sgRNAs can comprise one or more 2'-O-methyl phosphorothioate nucleotides.

[0118] By way of illustration, guide RNAs used in the CRISPR/Cas/Cpfl system, or other smaller RNAs can be readily synthesized by chemical means, as illustrated below and described in the art. While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together. Much longer RNAs, such as those encoding a Cas9 or Cpfl endonuclease, are more readily generated enzymatically. Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art.

[0119] In some embodiments, indel frequency (editing frequency) may be determined using a TIDE analysis, which can be used to identify highly efficient gRNA molecules. In some embodiments, a highly efficient gRNA yields a gene editing frequency of higher than 80%. For example, a gRNA is considered to be highly efficient if it yields a gene editing frequency of at least 80%, at least 85%, at least 90%, at least 95%, or 100%.

[0120] In some embodiments, gene disruption may occur by deletion of a genomic sequence using two guide RNAs. Methods of using CRISPR-Cas gene editing technology to create a genomic deletion in a cell (e.g., to knock out a gene in a cell) are known (Bauer D E et al. Vis. Exp. 2015; 95;e52118).

3. Spacer Sequence

[0121] In some embodiments, a gRNA comprises a spacer sequence. A spacer sequence is a sequence (e.g., a 20 nucleotide sequence) that defines the target sequence (e.g., a DNA target sequences, such as a genomic target sequence) of a target nucleic acid of interest. In some embodiments, the spacer sequence is 15 to 30 nucleotides. In some embodiments, the spacer sequence is 15, 16, 17, 18, 19, 29, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides. In some embodiments, a spacer sequence is 20 nucleotides.

[0122] The “target sequence” is adjacent to a PAM sequence and is the sequence modified by an RNA-guided nuclease (e.g., Cas9). The “target nucleic acid” is a doublestranded molecule: one strand comprises the target sequence and is referred to as the “PAM strand,” and the other complementary strand is referred to as the “non-PAM strand.” One of skill in the art recognizes that the gRNA spacer sequence hybridizes to the reverse complement of the target sequence, which is located in the non-PAM strand of the target nucleic acid of interest. Thus, the gRNA spacer sequence is the RNA equivalent of the target sequence. For example, if the target sequence is 5'-AGAGCAACAGTGCTGTGGCC-3', then the gRNA spacer sequence is 5'-AGAGCAACAGUGCUGUGGCC-3'. The spacer of a gRNA interacts with a target nucleic acid of interest in a sequence-specific manner via hybridization (z.e., base pairing). The nucleotide sequence of the spacer thus varies depending on the target sequence of the target nucleic acid of interest.

[0123] In a CRISPR/Cas system herein, the spacer sequence is designed to hybridize to a region of the target nucleic acid that is located 5' of a PAM of the Cas9 enzyme used in the system. The spacer may perfectly match the target sequence or may have mismatches. Each Cas9 enzyme has a particular PAM sequence that it recognizes in a target DNA. For example, S. pyogenes recognizes in a target nucleic acid a PAM that comprises the sequence 5'-NRG-3', where R comprises either A or G, where N is any nucleotide and N is immediately 3' of the target nucleic acid sequence targeted by the spacer sequence.

[0124] In some embodiments, the target nucleic acid sequence comprises 20 nucleotides. In some embodiments, the target nucleic acid comprises less than 20 nucleotides. In some embodiments, the target nucleic acid comprises more than 20 nucleotides. In some embodiments, the target nucleic acid comprises at least: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid comprises at most: 5, 10, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30 or more nucleotides. In some embodiments, the target nucleic acid sequence comprises 20 bases immediately 5' of the first nucleotide of the PAM. For example, in a sequence comprising 5'- NNNNNNNNNNNNNNNNNNNNNRG-3', the target nucleic acid comprises the sequence that corresponds to the Ns, wherein N is any nucleotide, and the underlined NRG sequence is the S. pyogenes PAM.

4. Methods of Making gRNAs

[0125] The gRNAs of the present disclosure are produced by a suitable means available in the art, including but not limited to in vitro transcription (IVT), synthetic and/or chemical synthesis methods, or a combination thereof. Enzymatic (IVT), solid-phase, liquid-phase, combined synthetic methods, small region synthesis, and ligation methods are utilized. In one embodiment, the gRNAs are made using IVT enzymatic synthesis methods. Methods of making polynucleotides by IVT are known in the art and are described in International Application PCT/US2013/30062. Accordingly, the present disclosure also includes polynucleotides, e.g., DNA, constructs and vectors are used to in vitro transcribe a gRNA described herein.

[0126] In some embodiments, non-natural modified nucleobases are introduced into polynucleotides, e.g., gRNA, during synthesis or post-synthesis. In certain embodiments, modifications are on intemucleoside linkages, purine or pyrimidine bases, or sugar. In some embodiments, a modification is introduced at the terminal of a polynucleotide; with chemical synthesis or with a polymerase enzyme. Examples of modified nucleic acids and their synthesis are disclosed in PCT application No. PCT/US2012/058519. Synthesis of modified polynucleotides is also described in Verma and Eckstein, Annual Review of Biochemistry, vol. 76, 99-134 (1998). [0127] In some embodiments, enzymatic or chemical ligation methods are used to conjugate polynucleotides or their regions with different functional moieties, such as targeting or delivery agents, fluorescent labels, liquids, nanoparticles, etc. Conjugates of polynucleotides and modified polynucleotides are reviewed in Goodchild, Bioconjugate Chemistry, vol. 1(3), 165-187 (1990).

[0128] Certain embodiments of the invention also provide nucleic acids, e.g., vectors, encoding gRNAs described herein. In some embodiments, the nucleic acid is a DNA molecule. In other embodiments, the nucleic acid is an RNA molecule. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a crRNA. In some embodiments, the nucleotide sequence encoding the crRNA comprises a spacer flanked by all or a portion of a repeat sequence from a naturally-occurring CRISPR/Cas system. In some embodiments, the nucleic acid comprises a nucleotide sequence encoding a tracrRNA. In some embodiments, the crRNA and the tracrRNA is encoded by two separate nucleic acids. In other embodiments, the crRNA and the tracrRNA is encoded by a single nucleic acid. In some embodiments, the crRNA and the tracrRNA is encoded by opposite strands of a single nucleic acid. In other embodiments, the crRNA and the tracrRNA is encoded by the same strand of a single nucleic acid.

[0129] In some embodiments, the gRNAs provided by the disclosure are chemically synthesized by any means described in the art (see e.g., WO/2005/01248). While chemical synthetic procedures are continually expanding, purifications of such RNAs by procedures such as high performance liquid chromatography (HPLC, which avoids the use of gels such as PAGE) tends to become more challenging as polynucleotide lengths increase significantly beyond a hundred or so nucleotides. One approach used for generating RNAs of greater length is to produce two or more molecules that are ligated together.

[0130] In some embodiments, the gRNAs provided by the disclosure are synthesized by enzymatic methods (e.g., in vitro transcription, IVT).

[0131] Various types of RNA modifications can be introduced during or after chemical synthesis and/or enzymatic generation of RNAs, e.g., modifications that enhance stability, reduce the likelihood or degree of innate immune response, and/or enhance other attributes, as described in the art. [0132] In certain embodiments, more than one guide RNA can be used with a CRISPR/Cas nuclease system. Each guide RNA may contain a different targeting sequence, such that the CRISPR/Cas system cleaves more than one target nucleic acid. In some embodiments, one or more guide RNAs may have the same or differing properties such as activity or stability within the Cas9 RNP complex. Where more than one guide RNA is used, each guide RNA can be encoded on the same or on different vectors. The promoters used to drive expression of the more than one guide RNA is the same or different.

[0133] The guide RNA may target any sequence of interest via the targeting sequence (e.g., spacer sequence) of the crRNA. In some embodiments, the degree of complementarity between the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule is about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100%. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule is 100% complementary. In other embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule may contain at least one mismatch. For example, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule may contain 1-6 mismatches. In some embodiments, the targeting sequence of the guide RNA and the target sequence on the target nucleic acid molecule may contain 5 or 6 mismatches.

[0134] The length of the targeting sequence may depend on the CRISPR/Cas9 system and components used. For example, different Cas9 proteins from different bacterial species have varying optimal targeting sequence lengths. Accordingly, the targeting sequence may comprise 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, or more than 50 nucleotides in length. In some embodiments, the targeting sequence may comprise 18-24 nucleotides in length. In some embodiments, the targeting sequence may comprise 19-21 nucleotides in length. In some embodiments, the targeting sequence may comprise 20 nucleotides in length.

[0135] In some embodiments of the present disclosure, a CRISPR/Cas nuclease system includes at least one guide RNA. In some embodiments, the guide RNA and the Cas protein may form a ribonucleoprotein (RNP), e.g., a CRISPR/Cas complex. The guide RNA may guide the Cas protein to a target sequence on a target nucleic acid molecule (e.g., a genomic DNA molecule), where the Cas protein cleaves the target nucleic acid. In some embodiments, the CRISPR/Cas complex is a Cpfl /guide RNA complex. In some embodiments, the CRISPR complex is a Type-II CRISPR/Cas9 complex. In some embodiments, the Cas protein is a Cas9 protein. In some embodiments, the CRISPR/Cas9 complex is a Cas9/guide RNA complex.

5. Delivery of guide RNA and Nuclease

[0136] In some embodiments, a gRNA and an RNA-guided nuclease are delivered to a cell separately, either simultaneously or sequentially. In some embodiments, a gRNA and an RNA-guided nuclease are delivered to a cell together. In some embodiments, a gRNA and an RNA-guided nuclease are pre-complexed together to form a ribonucleoprotein (RNP).

[0137] RNPs are useful for gene editing, at least because they minimize the risk of promiscuous interactions in a nucleic acid-rich cellular environment and protect the RNA from degradation. Methods for forming RNPs are known in the art. In some embodiments, an RNP containing an RNA-guided nuclease e.g., a Cas nuclease, such as a Cas9 nuclease) and a gRNA targeting a gene of interest is delivered a cell (e.g.: a T cell). In some embodiments, an RNP is delivered to a T cell by electroporation.

[0138] As used herein, a “AAVS1 or ROSA26 targeting RNP” refers to a gRNA that targets the AAVS1 or ROSA26 genes pre-complexed with an RNA-guided nuclease. In some embodiments, a AAVS1 or ROSA26 targeting RNP is delivered to a cell. In some embodiments, more than one RNP is delivered to a cell. In some embodiments, more than one RNA is delivered to a cell separately. In some embodiments, more than one RNP is delivered to the cell simultaneously.

[0139] In some embodiments, an RNA-guided nuclease is delivered to a cell in a DNA vector that expresses the RNA-guided nuclease, an RNA that encodes the RNA-guided nuclease, or a protein. In some embodiments, a gRNA targeting a gene is delivered to a cell as an RNA, or a DNA vector that expresses the gRNA.

[0140] Delivery of an RNA-guided nuclease, gRNA, and/or an RNP may be through direct injection or cell transfection using known methods, for example, electroporation or chemical transfection. Other cell transfection methods may be used. 6. Multi-Modal or Differential Delivery of Components

[0141] Skilled artisans will appreciate that different components of genome editing systems can be delivered together or separately and simultaneously or nonsimultaneously. Separate and/or asynchronous delivery of genome editing system components may be particularly desirable to provide temporal or spatial control over the function of genome editing systems and to limit certain effects caused by their activity.

[0142] Different or differential modes as used herein refer to modes of delivery that confer different pharmacodynamic or pharmacokinetic properties on the subject component molecule, e.g, a RNA-guided nuclease molecule, gRNA, template nucleic acid, or payload. For example, the modes of delivery can result in different tissue distribution, different halflife, or different temporal distribution, e.g, in a selected compartment, tissue, or organ.

[0143] Some modes of delivery, e.g., delivery by a nucleic acid vector that persists in a cell, or in progeny of a cell, e.g., by autonomous replication or insertion into cellular nucleic acid, result in more persistent expression of and presence of a component. Examples include viral, e.g., AAV or lentivirus, delivery.

[0144] By way of example, the components of a genome editing system, e.g., a RNA- guided nuclease and a gRNA, can be delivered by modes that differ in terms of resulting halflife or persistent of the delivered component the body, or in a particular compartment, tissue or organ. In an embodiment, a gRNA can be delivered by such modes. The RNA-guided nuclease molecule component can be delivered by a mode which results in less persistence or less exposure to the body or a particular compartment or tissue or organ.

[0145] More generally, in an embodiment, a first mode of delivery is used to deliver a first component and a second mode of delivery is used to deliver a second component. The first mode of delivery confers a first pharmacodynamic or pharmacokinetic property. The first pharmacodynamic property can be, e.g., distribution, persistence, or exposure, of the component, or of a nucleic acid that encodes the component, in the body, a compartment, tissue or organ. The second mode of delivery confers a second pharmacodynamic or pharmacokinetic property. The second pharmacodynamic property can be, e.g., distribution, persistence, or exposure, of the component, or of a nucleic acid that encodes the component, in the body, a compartment, tissue or organ. [0146] In certain embodiments, the first pharmacodynamic or pharmacokinetic property, e.g., distribution, persistence or exposure, is more limited than the second pharmacodynamic or pharmacokinetic property.

[0147] In certain embodiments, the first mode of delivery is selected to optimize, e.g., minimize, a pharmacodynamic or pharmacokinetic property, e.g., distribution, persistence or exposure.

[0148] In certain embodiments, the second mode of delivery is selected to optimize, e.g., maximize, a pharmacodynamic or pharmacokinetic property, e.g., distribution, persistence or exposure.

[0149] In certain embodiments, the first mode of delivery comprises the use of a relatively persistent element, e.g., a nucleic acid, e.g., a plasmid or viral vector, e.g., an AAV, adenovirus or lentivirus. As such vectors are relatively persistent product transcribed from them would be relatively persistent.

[0150] In certain embodiments, the second mode of delivery comprises a relatively transient element, e.g., an RNA or protein.

[0151] In certain embodiments, the first component comprises gRNA, and the delivery mode is relatively persistent, e.g., the gRNA is transcribed from a plasmid or viral vector, e.g., an AAV, adenovirus or lentivirus. Transcription of these genes would be of little physiological consequence because the genes do not encode for a protein product, and the gRNAs are incapable of acting in isolation. The second component, a RNA-guided nuclease molecule, is delivered in a transient manner, for example as mRNA encoding the protein or as protein, ensuring that the full RNA-guided nuclease molecule/gRNA complex is only present and active for a short period of time.

[0152] Furthermore, the components can be delivered in different molecular form or with different delivery vectors that complement one another to enhance safety and tissue specificity.

[0153] Use of differential delivery modes can enhance performance, safety, and/or efficacy, e.g., the likelihood of an eventual off-target modification can be reduced. Delivery of immunogenic components, e.g., Cas9 molecules, by less persistent modes can reduce immunogenicity, as peptides from the bacterially-derived Cas enzyme are displayed on the surface of the cell by WIC molecules. A two-part delivery system can alleviate these drawbacks.

[0154] Differential delivery modes can be used to deliver components to different, but overlapping target regions. The formation active complex is minimized outside the overlap of the target regions. Thus, in an embodiment, a first component, e.g., a gRNA is delivered by a first delivery mode that results in a first spatial, e.g., tissue, distribution. A second component, e.g., a RNA-guided nuclease molecule is delivered by a second delivery mode that results in a second spatial, e.g., tissue, distribution. In an embodiment the first mode comprises a first element selected from a liposome, nanoparticle, e.g., polymeric nanoparticle, and a nucleic acid, e.g., viral vector. The second mode comprises a second element selected from the group. In an embodiment, the first mode of delivery comprises a first targeting element, e.g., a cell specific receptor or an antibody, and the second mode of delivery does not include that element. In certain embodiments, the second mode of delivery comprises a second targeting element, e.g., a second cell specific receptor or second antibody.

[0155] When the RNA-guided nuclease molecule is delivered in a virus delivery vector, a liposome, or polymeric nanoparticle, there is the potential for delivery to and therapeutic activity in multiple tissues, when it may be desirable to only target a single tissue. A two-part delivery system can resolve this challenge and enhance tissue specificity. If the gRNA and the RNA-guided nuclease molecule are packaged in separated delivery vehicles with distinct but overlapping tissue tropism, the fully functional complex is only be formed in the tissue that is targeted by both vectors.

V. Methods of Treatment

[0156] In various aspects of the invention, the engineered B cells will be delivered as a therapeutic to a patient in need thereof. In various embodiments, the engineered B cells will be capable of treating or preventing various diseases or disorders relating to Fabry disease.

[0157] In some respects, the invention comprises a pharmaceutical composition comprising a population of gene edited B cells comprising at least one therapeutic protein as described herein and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutical composition further comprises an additional active agent. [0158] In one aspect, pharmaceutical compositions according to the invention are administered to a subject in a dosage sufficient to achieve a therapeutic effect. As used herein “therapeutic” effect or action includes an effect or action of a pharmaceutical composition of the invention intended to cure, mitigate, treat, or prevent, or stabilize the progression of, a disease, disorder or condition, or affect the structure or any function of the body of a subject. It will be appreciated that appropriate doses and dosing schedules may be vary according to the subject and the intended therapeutic effect, and may dependent upon such factors as, for example, the disease, disorder or condition being treated, and the general health, age, body weight, sex, or relevant genetic makeup of the subject. Such appropriate dose levels and dosing schedules can be determined by the healthcare provider as needed. Additionally, multiple doses of engineered B cells can be provided in accordance with the invention.

[0159] In some embodiments, the expanded population of engineered B cells are autologous B cells. In some embodiments, the engineered B cells are allogeneic B cells. In some embodiments, the engineered B cells are heterologous B cells. In some embodiments, the engineered B cells of the present application are prepared by in vivo transfection or in vivo transduction. In other embodiments, the engineered cells are prepared ex vivo by transfection or transduction.

[0160] As used herein, the term “subject” or “patient” means an individual. In some aspect, a subject is a mammal such as a human. In some aspect, a subject can be a nonhuman primate. Non-human primates include marmosets, monkeys, chimpanzees, gorillas, orangutans, and gibbons, to name a few. The term “subject” also includes domesticated animals, such as cats, dogs, etc., livestock (e.g., llama, horses, cows), wild animals (e.g., deer, elk, moose, etc.,), laboratory animals (e.g., mouse, rabbit, rat, gerbil, guinea pig, etc.) and avian species (e.g, chickens, turkeys, ducks, etc.). Preferably, the subject is a human subject. More preferably, the subject is a human patient.

[0161] In additional embodiments, the composition comprising gene edited B cells can be administered with an anti-inflammatory agent. Anti-inflammatory agents or drugs include, but are not limited to, steroids and glucocorticoids (including betamethasone, budesonide, dexamethasone, hydrocortisone acetate, hydrocortisone, hydrocortisone, methylprednisolone, prednisolone, prednisone, triamcinolone), nonsteroidal anti-inflammatory drugs (NSAIDS) including aspirin, ibuprofen, naproxen, methotrexate, sulfasalazine, leflunomide, anti-TNF medications, cyclophosphamide and mycophenolate. Exemplary NSAIDs include ibuprofen, naproxen, naproxen sodium, Cox-2 inhibitors, and sialylates. Exemplary analgesics include acetaminophen, oxycodone, tramadol of proporxyphene hydrochloride. Exemplary glucocorticoids include cortisone, dexamethasone, hydrocortisone, methylprednisolone, prednisolone, or prednisone. Exemplary biological response modifiers include molecules directed against cell surface markers (e.g., CD4, CD5, etc.), cytokine inhibitors, such as the TNF antagonists, (e.g., etanercept (ENBREL®), adalimumab (HUMIRA®) and infliximab (REMICADE®)), chemokine inhibitors and adhesion molecule inhibitors. The biological response modifiers include monoclonal antibodies as well as recombinant forms of molecules. Exemplary DMARDs include azathioprine, cyclophosphamide, cyclosporine, methotrexate, penicillamine, leflunomide, sulfasalazine, hydroxychloroquine, Gold (oral (auranofin) and intramuscular) and minocycline.

[0162] In certain embodiments, the compositions described herein are administered in conjunction with a cytokine. “Cytokine” as used herein is meant to refer to proteins released by one cell population that act on another cell as intercellular mediators. Examples of cytokines are lymphokines, monokines, and traditional polypeptide hormones. Included among the cytokines are growth hormones such as human growth hormone, N-methionyl human growth hormone, and bovine growth hormone; parathyroid hormone; thyroxine; insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor (HGF); fibroblast growth factor (FGF); prolactin; placental lactogen; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor; integrin; thrombopoietin (TPO); nerve growth factors (NGFs) such as NGF-beta; platelet-growth factor; transforming growth factors (TGFs) such as TGF-alpha and TGF-beta; insulin-like growth factor-I and -II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon-alpha, beta, and -gamma; colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF); granulocyte-macrophage-CSF (GM-CSF); and granulocyte-CSF (G-CSF); interleukins (Ils) such as IL-1, IL-1 alpha, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12; IL-15, a tumor necrosis factor such as TNF-alpha or TNF -beta; and other polypeptide factors including LIF and kit ligand (KL). As used herein, the term cytokine includes proteins from natural sources or from recombinant cell culture, and biologically active equivalents of the native sequence cytokines. [0163] In some aspects, the method further comprises administering at least a second therapy to the subject. In various embodiments, the method further comprises a second therapy for the treatment of Fabry disease. In certain aspects, wherein the therapy is an oral chaperone therapy. In some embodiments, the second therapy is Galafold® (migalastat). In various embodiments the second therapy is enzyme replacement therapy. In various embodiments the enzyme replacement therapy is an infusion of recombinant a-GAL. In various embodiments, the second therapy is a substrate reduction therapy. In various embodiments, the second therapy is a therapy to reduce how much Gb3 is made by blocking other enzymes necessary for its production.

EXAMPLES

[0164] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or scope of the appended claims. The following examples are provided by way of illustration only and not by way of limitation. Those of skill in the art will readily recognize a variety of noncritical parameters that could be changed or modified to yield essentially similar results.

Example 1. Targeted Editing of B Cells

[0165] Human B cells were isolated from healthy donors using magnetic beads and activated using CD40 ligand and IL21. B cells were engineered using an rAAV6 encoding a- GAL protein and either an AAVS1 specific or ROSA26 specific RNP. See FIG. 1 A (AAVS1) and FIG. IB (ROSA26). B cells were edited to express the WT human a-GAL protein (1137, SEQ ID No. 9), the a-GAL protein with a carboxy -terminal LL truncation of the human a-GAL protein (1138, SEQ ID No. 10), or a a-GAL protein with both the carboxy-terminal LL truncation and the addition of a heavy chain (1139, SEQ ID No. 13) or light chain (1140, SEQ ID No. 11) signal peptide. As a control, B cells were only transduced with rAAV6 in absence of RNP electroporation to determine the level of a-GAL activity from AAV6 episomal expression in B cells (see, e.g., FIG. 2A-B “Episomal”).

[0166] Human B cell isolation, activation, and expansion. Buffy coats from healthy donors were obtained from Stanford Blood Center (Menlo Park, CA, USA). PBMCs were isolated from buffy coats using Ficoll-Paque (GE Healthcare, Chicago, IL). Primary human B cells were isolated using the EASYSEP™ Human B Cell Isolation Kit according to manufacturer’s instruction (STEMCELL Technologies Inc., Cambridge, MA, USA). B cells were isolated from peripheral blood of healthy donors and cultured for 3 days in activation cocktail (CD40L, CpG, IL2, IL 10, IL 15 and IL21) for 3 days. At day 3, gene-editing was performed using Cas9/sgRNA delivered via electroporation and AAV6 transduction. After gene editing, B cells were cultured in activation media for an additional 6 days.

[0167] AAVS1, ROSA26 sgRNAs and CRISPR engineering. A chemically modified sgRNA oligomer targeting AA VS1 or ROSA26 was manufactured by IDT (Integrated DNA Technologies, Coralville, Iowa, USA). Recombinant S. pyogenes Cas9 enzyme was purchased from IDT (Integrated DNA Technologies, Coralville, Iowa, USA). Cas9 was incubated with sgRNA at a molar ratio of 1 : 1.6 at room temperature for 10 minutes prior to mixing with B cells. Engineering of primary human B cells was carried out using an AMAXA™ 4D-NUCLEOF ACTOR™ in P3 nucleofection solution with program CM-137 (Lonza, Basel, Switzerland). 100 pmol RNP was used for electroporation with 1 million activated human B cells in 20 pl volume. Immediately after electroporation, B cells were transduced with rAAV6 donor at a multiplicity of infection (MOI) of 100,000 viral genomes (vg)/pl to maximize efficiency of transduction.

[0168] Measurement of a-GAL activity. Activity of secreted a-GAL forms from gene edited human B cells differentiated to PBs or PCs was then measured. Supernatants from edited human B cells were collected at 6, 9 and 12 days after gene editing. A-GAL specific activity was measured using the Alpha Galactosidase Activity Assay kit according to manufacturer’s instruction (Abeam, ab239716).

[0169] Results. As is shown in FIGs. 2A and 2B, when the human GLA gene was inserted into either the AAVS1 or ROSA26 loci, the resulting supernatant from these edited B cells showed increased a-GAL activity as compared to controls. This indicates that edited cells demonstrate increased expression and secretion of the human a-GAL protein. B cells edited with hGLA both the carboxy -terminal LL truncation and the addition of a heavy chain (SEQ ID No. 3) or light chain (SEQ ID No. 4) signal peptide showed the greatest increase in a-GAL activity.

Example 2. A-GAL Activity in Differentiated Plasma Blasts and Plasma Cells [0170] Next, human B cells isolated from peripheral blood were edited at the AAVS1 locus to again express the WT ha-GAL protein (SEQ ID No. 1), the a-GAL protein with a carboxy-terminal LL truncation of the ha-GAL protein (SEQ ID No. 2), or a a-GAL protein with both the carboxy-terminal LL truncation and the addition of a heavy chain (SEQ ID No. 3) or light chain (SEQ ID No. 4) signal peptide. As a control, B cells were only transduced with rAAV6 vectors, without RNP nucleofection (“episomal”). The B cells were next differentiated toward either PBs or PCs, and a-GAL activity was measured using the protocol described in Example 1.

[0171] Differentiation to PBs and PCs. Human B cells activated and expanded B cells were culture in a media containing IL2, IL6, IL10, IL15, IL21 for 3 days. This process leads to a mixture of plasmablasts and B cells. B cells were further differentiated into a mixture of B cells, plasmablasts, and plasma cells via 3 -day incubation in a media containing IL6, IL15, IL21, and INF-a.

[0172] Three days after media change, the supernatant from activated B cells and the differentiated PBs and PCs was measured for a-GAL activity. A-Gal activity was measured using the protocol described in Example 1.

[0173] Results. As is shown in FIG. 3, edited B cells, peripheral blood cells differentiated toward PBs and PCs showed greater a-GAL activity as compared to AAV- transduced controls, indicating that integration of the GLA transgene was leading to high express! on/secreti on of a-GAL enzyme. B cells engineered to express ha-GAL both the carboxy-terminal LL truncation and the addition of a heavy chain (SEQ ID No. 3) or light chain (SEQ ID No. 4) signal peptide showed the greatest increase in a-GAL activity.

Example 3. In Vitro Expression of a-GAL in Edited Human Plasmablasts

[0174] Next, human B cells isolated from peripheral blood of five different donors (Donors A-E), differentiated towards human plasmablasts and were edited at the AAVS1 locus to express the WT ha-GAL protein (“Edited Wildtype GLA Donor A,” 1137, SEQ ID NO. 9) or the truncated version of a-GAL (“Edited WFT 2AA-trunc-GLA Donor” A through E, 1140, SEQ ID NO. 11). As a control, B cells were only transduced with rAAV6 vectors (1137 or 1140), without RNP nucleofection (unedited cells Donor A). a-GAL activity was measured using the protocol described in Example 1. As shown in FIG. 4, edited B cells/plasmablasts showed significantly enhanced a-GAL activity compared to unedited cells. Example 4. Alpha-Galactosidase Activity in Supernatants from Plasmablasts and Plasma cells

[0175] Next, a-GAL expression was measured in edited cells under modified conditions. For this experiment, the IFNa2b concentration was increased from 1.5 ng/ml to 15 ng/ml. Cellular density was maintained at 0.6 M/mL and cells were expanded for nine days instead of seven. As shown in FIG. 5, under these conditions, edited peripheral blood cells differentiated toward PBs and PCs showed comparable secretion of active a-GAL when edited with a truncated version of a-GAL (“Edited GLA (1140)").

Example 5. Active a-GAL in Edited Human Plasmablasts.

[0176] Next, human B cells isolated from peripheral blood, differentiated towards human plasmablasts and were edited at the AAVS1 locus to again express various a-GAL forms (1140 = GLA with LL truncation and heavy chain signal peptide (SEQ ID No. 11); 1159 = GLA with LL truncation and light chain signal peptide (SEQ ID No. 12); 1501= GLA with 4 amino acids truncation at the C-terminal and heavy chain signal peptide; 1509 (SEQ ID No. 16 (GLA nt sequence), 18 (construct)), 1510 (SEQ ID No. 19), 1511 (SEQ ID No. 23) = 3 different codon optimization of GLA sequence with LL truncation and heavy chain signal peptide). As a control, B cells were only transduced with rAAV6 vectors, without RNP nucleofection (“AAV”). a-GAL activity was measured using the protocol described in Example 1. As shown in FIG. 6, edited B cells/plasmablast cells showed increased a-GAL activity when compared with AAV controls. Further, the codon optimized constructs encoding GLA with the LL truncation and either the heavy or light chain signal peptide (1509, 1510) showed improved a-GAL activity when compared with B cells/plasmablasts edited with the corresponding non-codon optimized sequences (1140, 1159). Further codon optimization studies are shown at FIG. 20 in two donors: donor 1 (FIG. 20 A) and donor 2 (FIG. 20B). When compared with episomal (AAV) expression, B cells edited to express human GLA (labeled in FIG.2 as “GLA-Edited”, and labeled in FIGs. 20A and 20B with “Edit” followed by the construct number) showed significantly enhanced a-GAL activity. Construct 1482 is the original cDNA sequence (SEQ ID NO. 4). Of the five codon optimized constructs (1588 (SEQ ID No. 26), 1598 (SEQ ID No. 27), 1599 (SEQ ID No. 28), 1600 (SEQ ID No. 29) and 1606 (SEQ ID No. 25)), construct 1606 and 1599 showed enhanced a- GAL activity in B cells/PB cells when compared to activated B cells and compared to construct 1482. Example 6. Restoration of Intracellular a-GAL levels in Fabry Patient Fibroblasts

[0177] Fabry’s disease is characterized by a deficiency in the body’s ability to produce a- GAL enzyme. In healthy cells, phosphorylated a-GAL binds to M6P receptors (M6P-R) and is internalized in the lysosome. See, e.g., FIG. 7A. In this experiment, fibroblasts from patients with Fabry Disease were isolated and grown as primary cell culture. Fibroblasts were then co-cultured with the supernatant from HEK 293 expressing/secreting either WT a- GAL or a-GAL with both the carboxy -terminal LL truncation and the addition of a heavy chain signal peptide (SEQ ID No. 3).

[0178] Results. As shown in FIG. 7B, WT fibroblasts express ha-GAL whereas fibroblasts from Fabry patients express no ha-GAL. When fibroblasts from Fabry patients were co-cultured with supernatant from HEK 293 cells expressing/secreting a-GAL, there was a significant increase (3-fold higher) in a-GAL activity. Both a-GAL forms tested are capable of being internalized and restored intracellular a-GAL activity in Fabry patient- derived fibroblasts.

Example 7. Expression of a-GAL Protein for Fabry from Edited B cells in vivo

[0179] a-GAL activity and expression of ha-GAL protein from edited B cells was examined in vivo. Mice were injected with 30 x 10 ⁶ of either un-edited or edited, activated B cells along with 3 x 10 ⁶ CD4 ⁺ T cells. Engraftment and survival of human B cells in NSG is poor given the lack of additional human immune components and cytokines. CD4 ⁺ T cells play an important role in survival and function of B cells. It has been demonstrated that the co-transfer of CD4 ⁺ T cells supports survival and function of human B cells in NSG mice. See, e.g., Ishikawa, Y., et al., 2014, Eur. J. Immunol., 44:3453-3463; Luo B. et al., 2020, Cell Death and Disease, 11 :973. a-GAL activity (FIG. 9A) was measured over 102 days and protein expression (FIG. 9B) was measured over the course of 22 days.

[0180] Adoptive Transfer of Edited B Cells. Human B cells gene edited and cultured as described in Example 1 were harvested at D6 after editing and washed in PBS. Subsequently, B cells were resuspended at 30 xlO ⁶ cells/300 ul and transferred into NSG mice via intravenous tail vein injection. Five days prior to B cells transfer, a total of 3 xlO ⁶ CD4 ⁺ T cells were transferred into the NSG mice using the same procedure. [0181] Isolation of Plasma from NSGMice. Mice were exposed to a heat lamp to induce vasodilation. Once the lateral tail veins were visibly dilated, the mouse were restrained and a snip at the tip of the tail was performed. 80 - 90 pL of blood were collected into an EDTA spiked plasma tube. Collected blood samples were kept on ice until processing. Subsequently, blood samples were spun at 8,000 RPM for 5 minutes and ~45- 50 pl of plasma were collected and kept frozen at -20°C until analyzed for a-GAL activity levels. a-GAL activity was measured from isolated plasma as described in Example 1 above.

[0182] Measuring a-Gal Protein. a-GAL specific activity in plasma of NSG mice was measured using the Alpha Galactosidase Activity Assay kit according to manufacturer’s instruction (Abeam, ab239716). a-GAL protein concentration was assessed using Human GLA/ Alpha Galactosidase (Sandwich ELISA) (LS Bio, LS-F 10765).

Example 8. Assessment of sgRNA efficiency and specificity and effect of codon optimization on a-GAL expression.

[0183] Described herein is a highly efficient, specific and safe gene editing strategy targeting an AAV1 locus. Healthy donor B cells are isolated from peripheral blood and engineered to expresses a-GAL, using CRISPR/Cas-based genome editing using the methods described above. Engineered B cells were expanded and cultured using the experimental methods described above and as set forth in FIG. 13A and FIG. 13B. Genomic DNA was extracted to measure efficiency of site-specific mutations (FIG. 9A) and targeted integration frequency, using digital PCR assays (n= 3 healthy donors) (FIG. 9B).

[0184] Human B cells were edited using the techniques described in example 1 and using various GLA-cDNA sequences (FIG. 10A (SEQ ID NO. 14) and FIG. 10B (SEQ ID NO. 24) were cultured for 12 days. At day 9 and 12, cell culture supernatants were collected, cell counts and viability were assessed. Functional, secreted a-GAL was quantified in supernatants using an activity assay and results were normalized to cell counts.

[0185] RNPs targeting an AAV1 locus were delivered into B cells via nucleofection and genomic DNA was extracted to measure efficiency of site-specific mutations using digital PCR assays sequences (FIG. 11 A (SEQ ID NO. 11) and FIG. 1 IB (SEQ ID NO. 25)) n=3 healthy donors). [0186] Guide-SEQ analysis of genomic DNA isolated from human B cells treated with AAV1 specific RNPs. On-target/Off-target sites were identified by incorporation of doublestranded oligodeoxynucleotides (dsODNs) (FIG. 12).

Example 9. Assessment of B Cell Lineages After In Vitro Conditioning.

[0187] B Cell phenotype was assessed in engineered B cells after in vitro conditioning.

[0188] Flow Cytometry. Phenotypic analysis of B cells was performed by flow cytometry. Cells were stained in Cell Staining Buffer (Biolegend) and Human TruStain FcX™ (Fc Receptor Blocking Solution; Biolegend) was used to avoid FcRs-mediated nonspecific antibody binding. Cells were stained with the following antibody- fluorochrome combination: IgD- AF488 (Biolegend), CD20- BV711 (Biolegend), CD38-PE (Biolegend), CD27-BV605 (Biolegend), CD138-BV421 (Biolegend).

[0189] It was found that ex-vivo conditioning promotes B cell differentiation toward a plasma cell-like phenotype, expressing high levels of engineered a-GAL. B cells lineages after in vitro conditioning. Memory B cells (CD27+IgD-), Plasmablasts (PBs) (CD27+CD38+ CD20-), Plasma cells (PCs) (CD27+CD38+ CD20- CD 138+ populations were monitored using Flow cytometry (FIG. 14A). PrimeFlow analysis of GLA transcripts in B cells showed that the CD27+CD38+ CD20- cell population express higher levels of GLA transcripts than the CD27- cell population (FIG. 14B).

Example 10. In Vivo Adoptive Transfer of Genetically Engineered B Cells.

[0190] a-GAL activity protein from edited B cells was examined in vivo. Mice were injected with 30 x 10 ⁶ of either un-edited or edited, activated B cells along with 3 x 10 ⁶ CD4 ⁺ T cells as described in Example 7 above. Human B cells gene edited and cultured as described in Example 1 were harvested at D6 after editing and washed in PBS. Subsequently, B cells were resuspended at 30 xlO ⁶ cells/300 ul and transferred into NSG mice via intravenous tail vein injection. Five days prior B cells transfer total 3 xlO ⁶ CD4 ⁺ T cells were transferred into the NSG mice using the same procedure. Plasma was isolated from NGS mice as described in Example 7 above and a-GAL activity was measured from isolated plasma as described in Example 1 above.

[0191] Circulating a-GAL levels were monitored every 7-10 days via an enzymatic activity assay on plasma samples (n= 2 healthy donors). Engineered B Cells engrafted in NSG mice produced sustained, supraphysiologic a-GAL plasma levels (FIG. 15). Luciferase imaging showed early engraftment of engineered cells in bone marrow (FIG. 16A).

Engrafted B cells were isolated from multiple murine tissues and the cell phenotype was assessed using Flow cytometry (n=4 mice) using the methods described in Example 8 (FIG. 16B).

Example 11. Reduction in GvHD symptoms by infusion of memory CD4+ cells.

[0192] B cell engraftment in NSG mice is extremely poor in the absence of support from additional human immune components or cytokines (Luo 2020; Cheng 2022). NSG mice humanized via adoptive transfer of autologous total human CD4+ T cells prior or together with human B cells dramatically increased the ability of B cells to engraft and survive in vivo (Levy 2016).

[0193] One of the challenges in developing humanized mouse models using T cells to

“humanize” the host is development of graft versus host disease (GvHD), which limits the study period as mice must be sacrificed for ethical reasons. It has been shown that adoptive transfer of memory CD4+ T cells (CD4+CD45RO+) in NSG mice dramatically reduced GvHD onset and severity (Anderson 2003) while supporting human B cells engraftment and function (Ishikawa 2014).

[0194] In another, in vivo adoptive transfer study, memory CD4+ T cells (CD4+CD45RO+) were to reduce the incidence and delay the onset of GvHD. a-GAL activity and expression of ha-GAL protein from edited B cells was examined in vivo. Mice were injected with 25 x 10 ⁶ of either un-edited or edited, activated B cells along with 3 x 10 ⁶ CD4 ⁺ T cells as described in Example 7 above. Human B cells gene edited and cultured as described in Example 1 were harvested at D6 after editing and washed in PBS. Subsequently, B cells were resuspended at 25 xlO ⁶ cells/300 pl and transferred into NSG mice via intravenous tail vein injection. Five days prior B cells transfer total 3 xlO ⁶ CD4 ⁺ T cells were transferred into the NSG mice using the same procedure. Plasma was isolated from NGS mice as described in Example 7 above and a-GAL activity was measured from isolated plasma as described in Example 1 above.

[0195] Circulating a-GAL levels were monitored every 7-10 days via an enzymatic activity assay on plasma samples. Engineered B Cells engrafted in NSG mice produced sustained, supraphysiologic a-GAL plasma levels (FIG. 18). NSG mice were humanized as described in FIG 18 were assessed for bodyweight and GVHD symptoms (e.g., hair loss, redness ears/extremities, hunched posture). Compared with saline treated mice (FIG. 19A), mice infused with Memory CD4+ T cells together with edited B cells (1140, SEQ ID NO. 11) (FIG. 19B) showed no difference in body weight or GVHD symptoms as compared to saline controls. In contrast, mice infused with Total CD4+ T cells together with edited B cells (1140, SEQ ID NO. 11) showed reduction in body weight and/or exhibited GVHD symptoms. (FIG. 19C).

Example 12. Gene editing of a functional GLA cDNA in Fabry patient B cells

[0196] Next, human B cells isolated from peripheral blood of a Fabry patient activated and were edited at the AAVS1 locus to again express construct 1606 (SEQ ID NO. 25). B cells were isolated from Fabry patient’s PBMCs via CD19+ positive selection, and activated for 3 days in media containing CD40L, CpG, IL-2, IL- 10, IL- 15 and IL-21. Gene editing was performed on day 3 after isolation using Cas9/sgRNA delivered via electroporation followed by transduction via AAV6 GLA vector (1606, SEQ ID No. 25). Engineered B cells were expanded in the same media describe above for additional 7 days.

[0197] Edited Fabry B cells we able to expand in vitro over time (FIG. 17A). Edited Fabry B cells demonstrated on-target integration of approximately 60 copies per 100 cells, as measured by digital PCR (FIG. 17B). Finally, edited Fabry B cells secreted active a-GAL enzyme, where unedited cells did not (FIG. 17C).